Note: Descriptions are shown in the official language in which they were submitted.
20 6534 6
1
TITLE
Tumor Necrosis Factor-a and -/3 Receptors
BACKGROUND OF THE INVENTION
The present invention relates generally to cytokine
receptors and more specifically to tumor necrosis factor
receptors.
Tumor necrosis factor-a (TNFa, also known as
cachectin) and tumor necrosi:~ factor-p (TNFp, also known as
lymphotoxin) are homologous mammalian endogenous secretory
proteins capable of inducing a wide variety of effects on a
large number of cell types. The great similarities in the
structural and functional characteristics of these two
cytokines have resulted in their collective description as
"TNF". Complementary cDNA clones encoding TNFa (Pennica et
al., Nature 312:724, 1984) arid TNF/3 (Gray et al., Nature
312:721, 1984) have been isolated, permitting further
structural and biological characterization of TNF.
TNF proteins initiate their biological effect on
cells by binding to specific TNF receptor (TNF-R) proteins
expressed on the plasma membrane of a TNF-responsive cell.
TNFa and TNF(3 were first shown to bind to a common receptor on
the human cervical carcinoma cell line ME-180 (Aggarwal et
al., Nature 318:665, 1985). Estimates of the size of the TNF-
R determined by affinity labeling studies ranged from 54 to
175 kDa (Creasey et al, Proc, Natl. Acad. Sci. USA 84:3293,
1987; Stauber et al., J. Bio7.. Chem. 263:19098, 1988; Hohmann
et al., j. Biol. Chem. 264:14927, 1989). Although the
72249-30
20 s53,~ s
2
relationship between these ThfF-Rs of different molecular mass
is unclear, Hohmann et al. {J. Biol. Chem. 264:14927, 1989)
reported that at least two different cell surface receptors
for TNF exist on different cell types. These receptors have
an apparent molecular mass of: about 80 kDa and about 55-60
kDa, respectively. None of t;he above publications, however,
reported the purification to homogeneity of cell surface TNF
receptors.
In addition to cell. surface receptors for TNF,
soluble proteins from human urine capable of binding TNF have
also been identified (Peetre et al., Eur. J. Haematol. 41:414,
1988; Seckinger et al., J. E~;p. Med. 167:1511, 1988; Seckinger
et al., J. Biol. Chem. 264-17.966, 1989; UK Patent Application,
Publ. No. 2 218 101 A to Seckinger et al.; Engelmann et al.,
J. Biol. Chem. 264:11974, 19ft9). The soluble urinary TNF
binding protein disclosed by UK 2 218 101 A has a partial N-
Terminal amino acid sequence of Asp-Ser-Val-Cys-Pro-, which
corresponds to the partial sequence disclosed later by
Engelmann et al. (1989). They relationship of the above
soluble urinary binding proteins was further elucidated when
Engelmann et al. reported the' identification and purification
of a second distinct soluble urinary TNF binding protein
having an N-terminal amino acid sequence of Val-Ala-Phe-Thr-
Pro (J. Biol. Chem. 265:1531,. 1990). The two urinary proteins
disclosed by the UK 2 218 10.1 A and the Engelmann et al.
publications were shown to be' immunochemically related to two
apparently distinct cell suri:ace proteins by the ability of
72249-30
~~R
'~1,~~
2o x534 6
3
antiserum against the bindings proteins to inhibit TNF binding
to certain cells.
More recently, two separate groups reported the
molecular cloning and expression of a human 55 kDa TNF-R
(Loetscher et al., Cell 61:3G~1, 1990; Schall et al., Cell
61:361, 1990). The TNF-R of both groups has an N-terminal
amino acid sequence which corresponds to the partial amino
acid sequence of the urinary binding protein disclosed by UK 2
218 101 A, Engelmann et al. (1989) and Engelmann et al.
(1990).
In order to elucidate the relationship of the
multiple forms of TNF-R and soluble urinary TNF binding
proteins, or to study the structural and biological
characteristics of TNF-Rs ancL the role played by TNF-Rs in the
response of various cell populations to TNF or other cytokine
stimulation, or to use TNF-R:. effectively in therapy,
diagnosis, or assay, purified compositions of TNF-R are
needed. Such compositions, however, are obtainable in
practical yields only by cloning and expressing genes encoding
the receptors using recombinant DNA technology. Effort to
purify the TNF-R molecule fox' use in biochemical analysis or
to clone and express mammalian genes encoding TNF-R, however,
have been impeded by lack of a suitable source of receptor
protein or mRNA. Prior to tree present invention, no cell
lines were known to express high levels of TNF-R
constitutively and continuou:cly, which precluded purification
72249-30
a
' x
o.
._ 20 6534 g
3a
of receptor for sequencing or construction of genetic
libraries for cDNA cloning.
SUHHARY Ol? THE INVENTION
The present invention provides isolated TNF receptors and
DNA sequences encoding mammalian tumor necrosis factor
receptors (TNF-R), in particular, human TNF-Rs whose native
forms have molecular weights of about 80 kilodaltons. Such
DNA sequences include (a) cDrfA clones having a nucleotide
sequence derived from the coding region of a native TNF-R
gene; (b) DNA sequences which are capable of hybridization to
the cDNA clones of (a) under moderately stringent conditions
(50oC, 2 x SSC) and which encode biologically active TNF-R
molecules; or (c) DNA sequences which are degenerate as a
result of the genetic code to the DNA sequences defined in (a)
and (b) and which encode biologically active TNF-R molecules.
In particular, the present invention provides DNA sequences
which encode soluble TNF receptors. In a preferred embodiment
amino acid residue 46 is selected from the group consisting of
Ile and Thr and amino acid residue 118 is selected from the
group consisting of Val and 7:1e.
The present invention also provides recombinant
expression vectors comprising the DNA sequences defined above,
recombinant TNF-R molecules ~>roduced using the recombinant
expression vectors, and processes for producing the
recombinant TNF-R molecules using the expression vectors.
72249-30
w ,
.,
~; r
20 6534 6
3b
The present invention also provides isolated or
purified protein compositions comprising TNF-R, and, in
part icular, soluble forms of '.CNF-R. The invent ion also
provides an isolated DNA sequE~nce as defined above which
encodes a soluble human TNF-R protein which has an amino acid
sequence comprising an amino <~cid sequence 1 to x, wherein
x is selected from the group consisting of amino acids 163-235
of Figure 2.
The present invention also provides compositions for
use in therapy, diagnosis, assay of TNF-R, or in raising
antibodies to TNF-R, comprising effective quantities of
soluble native or recombinant receptor proteins prepared
according to the foregoing processes. The invention therefore
also provides a pharmaceutical composition comprising a
purified biologically active mammalian TNF receptor (TNF-R?
protein comprising an amino acid sequence 1 to x, wherein x is
selected from the group consi:~ting of 165-235 of Figure 2
together with a pharmaceutically acceptable carrier or
diluent.
Because of the ability of TNF to specifically bind
TNF receptors (TNF-Rs), purified TNF-R compositions will be
useful in diagnostic assays for TNF, as well as in raising
antibodies to TNF receptor fo:r use in diagnosis and therapy.
In addition, purified TNF receptor compositions may be used
directly in therapy to bind or scavenge TNF, thereby providing
a means for regulating the immune activities of this cytokine.
72249-30
20 6534 6
3C
The invention provides the use of mammalian TNF-R
protein comprising an amino acid sequence 1 to x, wherein x is
selected from the group consisting of 163-235 of Figure 2 in
preparing a pharmaceutical composition suitable for parenteral
adminstration to a human patiE~nt for regulating immune
responses.
The invention also Z~rovides an assay method for
detection of a tumor necrosis factor (TNF) or a tumor necrosis
factor receptor (TNF-R) molecule comprising an amino acid
sequence 1 to x, wherein x is selected from the group
consisting of 163-235 of Figure 2 which assay method comprises
reacting a sample suspected o:E containing TNF or TNF-R with
labelled TNF-R or labelled TNIi and detecting binding of TNF to
labelled TNF-R or binding of 'TNF-R to labelled TNF.
These and other aspects of the present invention
will become evident upon reference to the following detailed
description.
BRIEF DPSCRIPT:CON OF THE DRAWINGS
Figure 1 is a schem~~tic representation of the coding
region of various cDNAs encoding human and murine TNF-Rs. The
leader sequence is hatched and the transmembrane region is
solid.
Figures 2-3 depict the partial cDNA sequence and
derived amino acid sequence of the human TNF-R clone 1.
Nucleotides are numbered from the beginning of the 5'
untranslated region. Amino acids are numbered from the
beginning of the signal peptide sequence. The putative signal
72249-30
.~_
3d
peptide sequence is represented by the amino acids -2 to -1.
The N-terminal leucine of the mature TNF-R protein is
underlined at position 1. The predicted transmembrane region
from amino acids 236 to 265 i;s also underlined. The C-termini
of various soluble TNF-~Rs are marked with an arrow (t).
Figures 4-6 depict 'the cDNA sequence and derived
amino acid sequence of murine TNF-R clone 11. The putative
signal peptide sequence is re~~resented by amino acids -22 to
-1. The N-terminal valine of ithe mature TNF-R protein is
underlined at position 1. The predicted transmembrane region
from amino acids 234 to 265 i;~ also underlined.
72249-30
WO 91 /03553 2 ~ 6 5 3 4 ~ PCT/US90/04001
4
DETAILED DESCRIPTION OF THE INVENTION
Definitions
As used herein, the terms "TNF receptor" and "TNF-R" refer to proteins having
amino acid sequences which are substantially similar to the native mammalian
TNF receptor
amino acid sequences, and which are biologically active, as defined below, in
that they are
capable of binding TNF molecules or ti-ansducing a biological signal initiated
by a TNF
molecule binding to a cell, or cross-reacting with anti-TNF-R antibodies
raised against TNF-
R from natural (i.e., nonrecombinant) sources. The mature full-length human
TNF-R is a
glycoprotein having a molecular weight of about 80 kilodaltons (kDa). As used
throughout
the specification, the term "mature" means a protein expressed in a form
lacking a leader
sequence as may be present in full-length transcripts of a native gene.
Experiments using
COS cells transfected with a cDNA encoding full-length human TNF-R showed that
TNF-R
bound 125I_TNFa with an apparent Ka of about 5 x 109 M-1, and that TNF-R bound
1251_
TNF~i with an apparent Ka of about 2 x 109 M-1. The terms "TNF receptor" or
"TNF-R"
include, but are not limited to, analogs or subunits of native proteins having
at least 20 amino
acids and which exhibit at least some biological activity in common with TNF-
R, for
example, soluble TNF-R constructs which are devoid of a transmembrane region
(and are
secreted from the cell) but retain the ability to bind TNF. Various
bioequivalent protein and
amino acid analogs are described in detail below.
The nomenclature for TNF-R analogs as used herein follows the convention of
naming the protein (e.g., TNF-R) preceded by either hu (for human) or mu (for
murine) and
followed by a D (to designate a deletion) and the number of the C-terminal
amino acid. For
example, huTNF-80235 refers to human TNF-R having Asp235 as the C-terminal
amino acid
(i.e., a polypeptide having the sequence of amino acids 1-235 of Figure 2). In
the absence of
any human or murine species designation, TNF-R refers generically to mammalian
TNF-R.
Similarly, in the absence of any specific designation for deletion mutants,
the term TNF-R
means all forms of TNF-R, including mutants and analogs which possess TNF-R
biological
activity.
"Soluble TNF-R" or "sTNF-R" as used in the context of the present invention
refer to
proteins, or substantially equivalent analogs, having an amino acid sequence
corresponding to
all or part of the extracellular region of a native TNF-R, for example, huTNF-
R~235,
huTNF-80185 and huTNF-80163, or amino acid sequences substantially similar to
the
sequences of amino acids 1-163, amino acids 1-185, or amino acids 1-235 of
Figure 2, and
which are biologically active in that they bind to TNF ligand. Equivalent
soluble TNF-Rs
include polypeptides which vary from these sequences by one or more
substitutions,
deletions, or additions, and which retain the ability to bind TNF or inhibit
TNF signal
transduction activity via cell surface bound TNF receptor proteins, for
example huTNF-ROx,
su~~ ~w sH~~
WO 91 /03553 PC'f/US90/04001
20 6534 6
wherein x is selected from the group consisting of any one of ammo acids 163-
235 of Figure
2. Analogous deletions may be made to~ muTNF-R. Inhibition ~ TNF signal
transduction
activity can be determined by transfecting cells with recombinant TNF-R DNAs
to obtain
recombinant receptor expression. The cells are then contacted with TNF and the
resulting
metabolic effects examined. If an effeca results which is attributable to the
action of the
ligand, then the recombinant receptor has signal transduction activity.
Exemplary procedures
for determining whether a polypeptide has signal transduction activity are
disclosed by
Idzerda et al., J. Exp. Med. 171:861 (1990); Curtis et al., Proc. Natl. Acad.
Sci. USA
86:3045 ( 1989); Prywes et al., EMBD J. 5:2179 ( 1986) and Chou et al., J.
Biol. Chem.
262:1842 (1987). Alternatively, primary cells or cell lines which express an
endogenous
TNF receptor and have a detectable biological response to TNF could also be
utilized.
The term "isolated" or "purified", as used in the context of this
specification to define
the purity of TNF-R protein or protein compositions, means that the protein or
protein
composition is substantially free of other proteins of natural or endogenous
origin and
contains less than about 1 % by mass of protein contaminants residual of
production
processes. Such compositions, however, can contain other proteins added as
stabilizers,
carriers, excipients or co-therapeutics. Tl'vTF-R is isolated if it is
detectable as a single protein
band in a polyacrylamide gel by silver staining.
The term "substantially similar," vvhen used to define either amino acid or
nucleic acid
sequences, means that a particular subjeca sequence, for example, a mutant
sequence, varies
from a reference sequence by one or more substitutions, deletions, or
additions, the net effect
of which is to retain biological activity of the TNF-R protein as may be
determined, for
example, in one of the TNF-R binding assays set forth in Example 1 below. ~
~natively,
nucleic acid subunits and analogs are "substantially similar" to the specific
DNfi sequences
disclosed herein if: (a) the DNA sequence is derived from the coding region of
a native
mammalian TNF-R gene; (b) the DN~~ sequence is capable of hybridization to DNA
sequences of (a) under moderately stringent conditions (50'C, 2x SSC) and
which encode
biologically active TNF-R molecules; or DNA sequences which are degenerate as
a result of
the genetic code to the DNA sequences defined in (a) or (b) and which encode
biologically
active TNF-R molecules.
"Recombinant," as used herein, means that a protein is derived from
recombinant
(e.g., microbial or mammalian) expression systems. "Microbial" refers to
recombinant
proteins made in bacterial or fungal I;e.g., yeast) expression systems. As a
product,
"recombinant microbial" defines a protein produced in a microbial expression
system which is
essentially free of native endogenous substances. Protein expressed in most
bacterial
cultures, e.g., E. coli, will be free of glycan. Protein expressed in yeast
may have a
glycosylation pattern different from that expressed in mammalian cells.
Sins?rr~ sH~E1-
W091/03553 ~ ~ ~ ~ ~ ~ ~ PC1'/US90/04001
6
"Biologically active," as used throughout the specification as a
characteristic of TNF
receptors, means that a particular molecule shares sufficient amino acid
sequence similarity
with the embodiments of the present invention disclosed herein to be capable
of binding
detectable quantities of TNF, transmitting a TNF stimulus to a cell, for
example, as a
component of a hybrid receptor construct, or cross-reacting with anti-TNF-R
antibodies
raised against TNF-R from natural (i.e., nonrecombinant) sources. Preferably,
biologically
active TNF receptors within the scope of the present invention are capable of
binding greater
than 0.1 nmoles TNF per nmole receptor, and most preferably, greater than 0.5
nmole TNF
per nmole receptor in standard binding assays (see below).
"Isolated DNA sequence" refers to a DNA polymer, in the form of a separate
fragment
or as a component of a larger DNA construct, which has been derived from DNA
isolated at
least once in substantially pure form, i.e., free of contaminating endogenous
materials and in
a quantity or concentration enabling identification, manipulation, and
recovery of the
sequence and its component nucleotide sequences by standard biochemical
methods, for
example, using a cloning vector. Such sequences are preferably provided in the
form of an
open reading frame uninterrupted by internal nontranslated sequences, or
introns, which are
typically present in eukaryotic genes. Genomic DNA containing the relevant
sequences could
also be used as a source of coding sequences. Sequences of non-translated DNA
may be
present 5' or 3' from the open reading frame, where the same do not interfere
with
manipulation or expression of the coding regions.
"Nucleotide sequence" refers to a heteropolymer of deoxyribonucleotides. DNA
sequences encoding the proteins provided by this invention can be assembled
from cDNA
fragments and short oligonucleotide linkers, or from a series of
oligonucleotides, to provide a
synthetic gene which is capable of being expressed in a recombinant
transcriptional unit.
Isolation of cDNAs Encoding TNF-R
The coding sequence of TNF-R is obtained by isolating a complementary DNA
(cDNA) sequence encoding TNF-R from a recombinant cDNA or genomic DNA library.
A
cDNA library is preferably constructed by obtaining polyadenylated mRNA from a
particular
cell line which expresses a mammalian TNF-R, for example, the human fibroblast
cell line
WI-26 VA4 (ATCC CCL 95.1) and using the mRNA as a template for synthesizing
double
stranded cDNA. The double stranded cDNA is then packaged into a recombinant
vector,
which is introduced into an appropriate E. coli strain and propagated. Murine
or other
mammalian cell lines which express TNF-R may also be used. TNF-R sequences
contained
in the cDNA library can be readily identified by screening the library with an
appropriate
nucleic acid probe which is capable of hybridizing with TNF-R cDNA.
Alternatively, DNAs
encoding TNF-R proteins can be assembled by ligation of synthetic
oligonucleotide subunits
su~as~~ s~~~'
~_.. 2o s534 s
7
corresponding to all or part of the sequence of Figures 2-3 or
Figures 4-6 to provide a com~~lete coding sequence.
The human TNF receptor cDNAs of the present
invention were isolated by the method of direct expression
cloning. A cDNA library was constructed by first isolating
cytoplasmic mRNA from the hu~r~an fibroblast cell line WI26
VA4. Polyadenylated RNA was isolated and used to prepare
double-stranded cDNA. Purified cDNA fragments were then
ligated into pCAV/NOT vector DNA which uses regulatory
sequences derived from pDC201 (a derivative of pMLSV,
previously described by Cosm~in et al., Nature 312:768, 1984),
SV40 and cytomegalovirus DNA, described in detail below in
Example 2. pCAU/NOT has been deposited with the American
Type Culture Collection under Accession No. ATCC 68014 on
June 19th, 1989. The pCAV/NOT vectors containing the WI26-VA4
cDNA fragments were transformed into E. colj strain DHSa.
Transformants were plated to provide approximately 800
colonies per plate. The resulting colonies were harvested and
each pool used to prepare plasmid DNA for transfection into
COS-7 cells essentially as described by Cosman et al. (Nature
312:768, 1984) and Luthman et: al. (Nucl. Acjd Res. 11:1295,
1983). Transformants expres:~ing biologically active cell
surface TNF receptors were identified by screening for their
ability to bind 1251-TNF. In this screening approach,
transfected COS-7 cells were incubated with medium containing
1251-TNF, the cells washed to remove unbound labelled TNF, and
the cell monolayers contacted with X-ray film to detect
72249-30
20 6534 6
7a
concentrations of TNF binding, as disclosed by Sims et al,
Scjence 241:585 (1988). Transfectants detected in this manner
appear as dark foci against << relatively light background.
Using this approach, approximately 240,000 cDNAs
were screened in pools of ap~~roximately 800 cDNAs until assay
of one transfectant pool indicated positive foci for TNF
binding. A frozen stock of bacteria from this positive pool
was grown in culture and plated to provide individual
colonies, which were screened until a single clone (clone 11)
was identified which was capable of directing synthesis of a
surface protein with detectable TNF binding activity. The
seguence of cDNA clone 11 isolated by the above method is
depicted in Figures 4-6.
Additionally cDNA clones can be isolated from cDNA
libraries of other mammalian species by cross-species
hybridization. For use in h~rbridization, DNA encoding TNF-R
may be covalently labeled wit:h a detectable substance such as
a fluorescent group, a radioF~ctive atom or a chemiluminescent
group by methods well known t:o those skilled in the art. Such
probes could also be used for jn vjtra diagnosis of particular
conditions.
Like most mammalian genes, mammalian TNF receptors
are presumably encoded by mu:Lti-exon genes. Alternative mRNA
constructs which can be attr:Lbuted to different mRNA splicing
events following transcription, and which share large regions
of identity or similarity
72249-30
WO 91/03553 2 0 6 5 3 4 6 PCT/US90/04001
8
with the cDNAs claimed herein, are considered to be within the scope of the
present
invention.
Other mammalian TNF-R cDNAs are isolated by using an appropriate human TNF-R
DNA sequence as a probe for screening; a particular mammalian cDNA library by
cross-
species hybridization.
Proteins and Analogs
The present invention provides isolated recombinant mammalian TNF-R
polypeptides. Isolated TNF-R polypepti~des of this invention are substantially
free of other
contaminating materials of natural or endogenous origin and contain less than
about 1 °!o by
mass of protein contaminants residual oi" production processes. The native
human TNF-R
molecules are recovered from cell lysates as glycoproteins having an apparent
molecular
weight by SDS-PAGE of about 80 kilodaltons (kDa). The TNF-R polypeptides of
this
invention are optionally without associated native-pattern glycosylation.
Mammalian TNF-R of the present invention includes, by way of example, primate,
human, murine, canine, feline, bovine, ovine, equine and porcine TNF-R.
Mammalian TNF-
Rs can be obtained by cross species hybridization, using a single stranded
cDNA derived
from the human TNF-R DNA sequence as a hybridization probe to isolate TNF-R
cDNAs
from mammalian cDNA libraries.
Derivatives of TNF-R within the ;.cope of the invention also include various
structural
forms of the primary protein which retain biological activity. Due to the
presence of ionizable
amino and carboxyl groups, for example;, a TNF-R protein may be in the form of
acidic or
basic salts, or may be in neutral form. Individual amino acid residues may
also be modified
by oxidation or reduction.
The primary amino acid structure may be modified by forming covalent or
aggregative
conjugates with other chemical moieties, such as glycosyl groups, lipids,
phosphate, acetyl
groups and the like, or by creating amino acid sequence mutants. Covalent
derivatives are
prepared by linking particular functional groups to TNF-R amino acid side
chains or at the N-
or C-termini. Other derivatives of TNF-R within the scope of this invention
include covalent
or aggregative conjugates of TNF-R or its fragments with other proteins or
polypeptides,
such as by synthesis in recombinant culture as N-terminal or C-terminal
fusions. For
example, the conjugated peptide may be .a a signal (or leader) polypeptide
sequence at the N-
terminal region of the protein which co-translationally or post-
translationally directs transfer
of the protein from its site of synthesis to its site of function inside or
outside of the cell
membrane or wall (e.g., the yeast a-factor leader). TNF-R protein fusions can
comprise
peptides added to facilitate purification or identification of TNF-R (e.g.,
poly-His). The
amino acid sequence of TNF receptor c.an also be linked to the peptide Asp-Tyr-
Lys-Asp-
suB~ sHE~
WO 91/03553 2 ~ 6 5 ~ 4 6 PCT/US90/04001
9
Asp-Asp-Asp-Lys (DYKDDDDK) (Hopp et al., BioITechnology 6:1204,1988.) The
latter
sequence is highly antigenic and provides an epitope reversibly bound by a
specific
monoclonal antibody, enabling rapid assay and facile purification of expressed
recombinant
protein. This sequence is also specifically cleaved by bovine mucosal
enterokinase at the
residue immediately following the Asp-L,ys pairing. Fusion proteins capped
with this peptide
may also be resistant to intracellular degradation in E. coli.
TNF-R derivatives may also be used as immunogens, reagents in receptor-based
immunoassays, or as binding agents for affinity purification procedures of TNF
or other
binding ligands. TNF-R derivatives m~ty also be obtained by cross-linking
agents, such as
M-maleimidobenzoyl succinimide ester and N-hydroxysuccinimide, at cysteine and
lysine
residues. TNF-R proteins may also be covalently bound through reactive side
groups to
various insoluble substrates, such as c:yanogen bromide-activated, bisoxirane-
activated,
carbonyldiimidazole-activated or tosyl.-activated agarose structures, or by
adsorbing to
polyolefin surfaces (with or without glutaraldehyde cross-linking). Once bound
to a
substrate, TNF-R may be used to selecti~rely bind (for purposes of assay or
purification) anti-
TNF-R antibodies or TNF.
The present invention also includes TNF-R with or without associated native-
pattern
glycosylation. TNF-R expressed in yeast or mammalian expression systems, e.g.,
COS-7
cells, may be similar or slightly different in molecular weight and
glycosylation pattern than
the native molecules, depending upon the expression system. Expression of TNF-
R DNAs
in bacteria such as E. coli provides non-glycosylated molecules. Functional
mutant analogs
of mammalian TNF-R having inactivated N-glycosylation sites can be produced by
oligonucleotide synthesis and ligation or by site-specific mutagenesis
techniques. These
analog proteins can be produced in a homogeneous, reduced-carbohydrate form in
good yield
using yeast expression systems. N-glycosylation sites in eukaryotic proteins
are
characterized by the amino acid triplet Asn-A1-Z, where A1 is any amino acid
except Pro, and
Z is Ser or Thr. In this sequence, asparagine provides a side chain amino
group for covalent
attachment of carbohydrate. Such a site can be eliminated by substituting
another amino acid
for Asn or for residue Z, deleting Asn o:r Z, or inserting a non-Z amino acid
between A1 and
Z, or an amino acid other than Asn between Asn and A1.
TNF-R derivatives may also be obtained by mutations of TNF-R or its subunits.
A
TNF-R mutant, as referred to herein, is a polypeptide homologous to TNF-R but
which has
an amino acid sequence different from native TNF-R because of a deletion,
insertion or
substitution.
Bioequivalent analogs of TNF'-R proteins may be constructed by, for example,
making various substitutions of residues or sequences or deleting terminal or
internal residues
or sequences not needed for biological activity. For example, cysteine
residues can be deleted
suBS~n~E~r
WO 91/03553 -- PCT/US90/04001
206~~46
i0
(e.g., Cysl~g) or replaced with other amino acids to prevent formation of
unnecessary or
incorrect intramolecular disulfide bridges upon renaturation. Other approaches
to
mutagenesis involve modification of adjacent dibasic amino acid residues to
enhance
expression in yeast systems in which KEX2 protease activity is present.
Generally,
S substitutions should be made conservatively; i.e., the most preferred
substitute amino acids
are those having physiochemical characteristics resembling those of the
residue to be
replaced. Similarly, when a deletion or insertion strategy is adopted, the
potential effect of
the deletion or insertion on biological activity should be considered.
Substantially similar
polypeptide sequences, as defined above, generally comprise a like number of
amino acids
sequences, although C-terminal truncations for the purpose of constructing
soluble TNF-Rs
will contain fewer arriino acid sequences. In order to preserve the biological
activity of TNF-
Rs, deletions and substitutions will preferably result in homologous or
conservatively
substituted sequences, meaning that a given residue is replaced by a
biologically similar
residue. Examples of conservative substitutions include substitution of one
aliphatic residue
for another, such as Ile, Val, Leu, or Ala for one another, or substitutions
of one polar
residue for another, such as between Lys and Arg; Glu and Asp; or Gln and Asn.
Other such
conservative substitutions, for example, substitutions of entire regions
having similar
hydrophobicity characteristics, are well known. Moreover, particular amino
acid differences
between human, murine and other mammalian TNF-Rs is suggestive of additional
conservative substitutions that may be made without altering the essential
biological
characteristics of TNF-R.
Subunits of TNF-R may be constructed by deleting terminal or internal residues
or
sequences. Particularly preferred sequences include those in which the
transmembrane region
and intracellular domain of TNF-R are deleted or substituted with hydrophilic
residues to
facilitate secretion of the receptor into the cell culture medium. The
resulting protein is
referred to as a soluble TNF-R molecule which retains its ability to bind TNF.
A particularly
preferred soluble TNF-R construct is TNF-R~235 (the sequence of amino acids 1-
235 of
Figure 2), which comprises the entire extracellular region of TNF-R,
terminating with Asp235
immediately adjacent the transmembrane region. Additional amino acids may be
deleted from
the transmembrane region while retaining TNF binding activity. For example,
huTNF-
R0183 which comprises the sequence of amino acids 1-183 of Figure 2, and TNF-
80163
which comprises the sequence of amino acids 1-163 of Figure 2, retain the
ability to bind
TNF ligand as determined using the binding assays described below in Example
1. TNF-
R0142, however, does not retain the ability to bind TNF ligand. This suggests
that one or
both of Cysls~ and Cys163 is required for formation of an intramolecular
disulfide bridge for
the proper folding of TNF-R. Cysl~g, which was deleted without any apparent
adverse
effect on the ability of the soluble TNF-R to bind TNF, does not appear to be
essential for
st~s~~ sH~t
206534fi
11
proper folding of TNF-R. Thus, any deletion C-terminal to
Cys163 would be expected to result in a biologically active
soluble TNF-R. The present invention contemplates such
soluble TNF-R constructs corresponding to all or part of the
extracelluar region of TNF-R terminating with any amino acid
after Cys163. ether C-terminal deletions, such as TNF-Fe157,
may be made as a matter of convenience by cutting TNF-R cDNA
with appropriate restriction enzymes and, if necessary,
reconstructing specific sequences with synthetic
oligonucleotide linkers. They resulting soluble TNF-R
constructs are then inserted and expressed in appropriate
expression vectors and assayed for the ability to bind TNF, as
described in Example 1. Biologically active soluble TNF-Rs
resulting from such constructions are also contemplated to be
within the scope of the present invention.
Mutations in nucleotide sequences constructed for
expression of analog TNF-R must, of course, preserve the
reading frame phase of the coding sequences and preferably
will not create complementary regions that could hybridize to
produce secondary mRNA structures such as loops or hairpins
which would adversely affect translation of the receptor mRNA.
Although a mutation site may be predetermined, it is not
necessary that the nature of the mutation per se be
predetermined. For example, in order to select for optimum
characteristics of mutants at: a given site, random mutagensis
may be conducted at the targE~t codon and the expressed TNF-R
mutants screened for the des~~red activity.
72249-30
2p 6534 6
11a
Not all mutations i.n the nucleotide sequence which
encodes TNF-R will be expres:ced in the final product, for
example, nucleotide substitutions may be made to enhance
expression, primarily to avoid secondary structure loops in
the transcribed mRNA (see EPP~ 75,444A) or to provide codons
that are more readily translated by the selected host, e.g.,
the well-known E. coli preference codons for E. coli
expression.
Mutations can be introduced at particular loci by
synthesizing oligonucleotide:c containing a mutant sequence,
flanked by restriction sites enabling ligation to fragments of
the native sequence. Following ligation, the resulting
reconstructed sequence encodes an analog having the desired
amino acid insertion, substitution, or deletion.
Alternatively, olic~onucleotide-directed site-
specific mutagensis procedures can be employed to provide an
altered gene having particular codons altered according to the
substitution, deletion, or insertion required. Exemplary
methods of making the alterations set forth above are
disclosed by Walder et al. I;Gene 42:133, 1986); Bauer et al.
(Gene 37:73, 1985); Craik (B~LoTechniques, January 1985, 12-
19); Smith et al. (Genetic H ngineering: Principles and
Methods, Plenum Press, 1981);; and U.S. Patent Nos. 4,518,584
and 4,737,462 disclose suitable techniques.
Both monovalent forms and polyvalent forms of TNF-R
are useful in the compositions and methods of this invention.
Polyvalent forms possess mull:iple TNF-R
72249-30
I
t
WO 91/03553 .,- . 2 0 6 5 3 4 6 P~/US90/04001
12
binding sites for TNF ligand. For example, a bivalent soluble TNF-R may
consist of two
tandem repeats of amino acids 1-235 of Figure 2, separated by a linker region.
Alternate
polyvalent forms may also be constructed, for example, by chemically coupling
TNF-R to
any clinically acceptable carrier molecule, a polymer selected from the group
consisting of
Ficoll, polyethylene glycol or dextran using conventional coupling techniques.
Alternatively,
TNF-R may be chemically coupled to biotin, and the biotin-TNF-R conjugate then
allowed to
bind to avidin, resulting in tetravalent avidin/biotin/TNF-R molecules. TNF-R
may also be
covalently coupled to dinitrophenol (I~NP) or trinitrophenol (TNP) and the
resulting
conjugate precipitated with anti-DNP or anti-TNP-IgM, to form decameric
conjugates with a
vaaency of 10 for TNF-R binding sites.
A recombinant chimeric antibody molecule may also be produced having TNF-R
sequences substituted for the variable domains of either or both of the
immunoglubulin
molecule heavy and light chains and having unmodified constant region domains.
For
example, chimeric TNF-RlIgGI may be produced from two chimeric genes -- a TNF-
Rlhuman x light chain chimera (TNF-RICK) and a TNF-RJhuman Yl heavy chain
chimera
(TNF-R/C71). Following transcription and translation of the two chimeric
genes, the gene
products assemble into a single chime;ric antibody molecule having TNF-R
displayed
bivalently. Such polyvalent forms of TIvTF-R may have enhanced binding
affinity for TNF
ligand. Additional details relating to the construction of such chimeric
antibody molecules are
disclosed in WO 89/09622 and EP 3150152.
Expression of Recombinant TNF-R
The present invention provides recombinant expression vectors to amplify or
express
DNA encoding TNF-R. Recombinant expression vectors are replicable DNA
constructs
which have synthetic or cDNA-derived DNA fragments encoding mammalian TNF-R or
bioequivalent analogs operably linked to suitable transcriptional or
translational regulatory
elements derived from mammalian, microbial, viral or insect genes. A
transcriptional unit
generally comprises an assembly of (1) a genetic element or elements having a
regulatory role
in gene expression, for example, transciiptional promoters or enhancers, (2) a
structural or
coding sequence which is transcribed into mRNA and translated into protein,
and (3)
appropriate transcription and translation initiation and termination
sequences, as described in
detail below. Such regulatory elements may include an operator sequence to
control
transcription, a sequence encoding suitable mRNA ribosomal binding sites. The
ability to
replicate in a host, usually conferred by an origin of replication, and a
selection gene to
facilitate recognition of transformants may additionally be incorporated. DNA
regions are
operably linked when they are functionstlly related to each other. For
example, DNA for a
signal peptide (secretory leader) is operably linked to DNA for a polypeptide
if it is expressed
WO 91/03553 ~ ~ ~ ~ ~ ~ 6 PCT/US90/04001
13
as a precursor which participates in the secretion of the polypeptide; a
promoter is o~ferably
linked to a coding sequence if it controls the transcription of the sequence;
or a ribosome
binding site is operably linked to a coding sequence if it is positioned so as
to permit
translation. Generally, operably linked means contiguous and, in the case of
secretory
leaders, contiguous and in reading frame. Structural elements intended for use
in yeast
expression systems preferably include a leader sequence enabling extracellular
secretion of
translated protein by a host cell. Alternatively, where recombinant protein is
expressed
without a leader or transport sequence, it may include an N-terminal
methionine re~.due. This
residue may optionally b~ ubsequently cleaved from the expressed recombinant
protein to
provide a final product.
DNA sequences encoding mammalian TNF receptors which are to be expressed in a
microorganism will preferably contain no introns that could prematurely
terminate
transcription of DNA into mRNA; however, premature termination of
transcription may be
desirable, for example, where it would result in mutants having advantageous C-
terminal
truncations, for example, deletion of a transmembrane region to yield a
soluble receptor not
bound to the cell membrane. Due to code degeneracy, there can be considerable
variation in
nucleotide sequences encoding the same amino acid sequence. Other embodiments
include
sequences capable of hybridizing to the sequences of the provided cDNA under
moderately
stringent conditions (50°C, 2x SSC) and other sequences hybridizing or
degenerate to those
which encode biologically active TNF receptor polypeptides.
Recombinant TNF-R DNA is e;rpressed or amplified in a recombinant expression
system comprising a substantially homogeneous monoculture of suitable host
microorganisms, for example, bacteria such as E. coli or yeast such as S.
cerevisiae, which
have stably integrated (by transformation or transfection) a recombinant
transcriptional unit
into chromosomal DNA or carry the recombinant transcriptional unit as a corn
lent of a
resident plasmid. Generally, cells constituting the system are the progeny ~~
a single
ancestral transformant. Recombinant expression systems as defined herein will
express
heterologous protein upon induction of ~:he regulatory elements linked to the
P' ' A sequence
or synthetic gene to be expressed.
Transformed host cells are cells which have been transformed or transfected
with
TNF-R vectors constructed using recombinant DNA techniques. Transformed host
cells
ordinarily express TNF-R, but host cells transtc ~~ed for purposes of cloning
or amplifying
TNF-R DNA do not need to express TNF-R. Expressed TNF-R will be deposited in
the cell
membrane or secreted into the culture supernatant, depending on the TNF-R DNA
selected.
Suitable host cells for expression of mammalian TNF-R include prokaryotes,
yeast or higher
eukaryotic cells under the control of appropriate promoters. Prokaryotes
include gram
negative or gram positive organisms, for example E. coli or bacilli. Higher
eukaryotic cells
S~J~3~~"n'f~~T"~ Sff~l~'~"
2o s5~4 s
14
include established cell lines of mammalian origin as describ-
ed below. Cell-free translation systems could also be
employed to produce mammalian TNF-R using RNAs derived from
the DNA constructs of the present invention. Appropriate
cloning and expression vectors for use with bacterial, fungal,
yeast, arid mammalian cellular hosts are described by Pouwels
et al. (Cloning Vectors: A Laboratory Manual, Elsevier, New
York, 1985).
Prokaryotic express>ion hosts may be used for expres-
sion of TNF-R that do not require extensive proteolytic and
disulfide processing. Prokaryotic expression vectors gene-
rally comprise one or more phenotypic selectable markers, for
example a gene encoding protESins conferring antibiotic resist-
ance or supplying an autotrophic requirement, and an origin of
replication recognized by the host to ensure amplification
within the host. Suitable prokaryotic hosts for trans-
formation include E. coli, Bacillus subtilis, Salmonella
typhimurium, and various spe~:ies within the genera
Pseudomonas, Streptomyces, and Staphyolococcus, although
others may also be employed .as a matter of choice. .
Useful expression vectors for bacterial use can
comprise a selectable marker and bacterial origin of
replication derived from commercially available plasmids
comprising genetic elements of the well known cloning vector
pBR322 (ATCC 37017). Such commercial vectors include, for
example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden)
and pGEM1 (Promega Biotec, Madison, WI, USA). These pBR322
72249-30
B
20 fi534 6
14a
"backbone" sections are combined with an appropriate promoter
and the structural sequence to be expressed. E. coli is
typically transformed using derivatives of pBR322, a plasmid
derived from an E. coli species (Bolivar et al., Gene 2:95,
1977). pBR322 contains genes for ampicillin and tetracycline
resistance and thus provides simple means for identifying
transformed cells.
Promoters commonly used in recombinant microbial
expression vectors include the (3-lactamase (penicillinase) and
lactose promoter system (Chang et al., Nature 275:615, 1978;
and Goeddel et al., Nature 2F31:544, 1979), the tryptophan
(trp) promoter system (Goeddel et al., Nucl. Acids Res.
8:4057, 1980; and EPA 36,776) and tac promoter (Maniatis,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory, p. 412, 1982). .A particularly useful bacterial
expression system employs the phage ~. PL promoter and cI857ts
thermolabile repressor. Plasmid vectors available from the
American Type Culture Collection which incorporate derivatives
of the ~, PL promoter include plasmid pHUB2, resident in E.
coli strain JMB9 (ATCC 37092) and pPLc28, resident in E. coli
RR1 (ATCC 53082).
Recombinant TNF-R proteins may also be expressed in
yeast hosts, preferably from the Saccharomyces species, such
as S. cerevisiae. Yeast of other genera, such as Pichia or
Kluyveromyces may also be employed. Yeast vectors will
generally contain an origin of replication from the 2u yeast
plasmid or an autonomously replicating sequence (ARS),
72249-30
WO 91/03553 PCT/US90/04001
-. 20 653 6
promoter, DNA encoding TNF-R, sequences for polyadenylation and transcription
termination and a selection gene. Preferably, yeast vectors will include an
origin of
replication and selectable marker permitting transformation of both yeast and
E. coli, e.g., the
ampicillin resistance gene of E. coli and S. cerevisiae T'RP1 or URA3 gene,
which provides a
selection marker for a mutant strain of yc;ast lacking the ability to grow in
tryptophan, and a
promoter derived from a highly expressed yeast gene to induce transcription of
a structural
sequence downstream. The presence of the TRP1 or URA3 lesion in the yeast host
cell
genome then provides an effective environment for detecting transformation by
growth in the
absence of tryptophan or uracil.
Suitable promoter sequences in yeast vectors include the promoters for
metallothionein, 3-phosphoglycerate ki.nase (Hitzeman et al., J. Biol. Cycem.
255:2073,
1980) or other glycolytic enzymes (He;ss et al., J. Adv. Enryme Reg. 7:149,
1968; and
Holland et al., Biochem. 17:4900, 197~B), such as enolase, glyceraldehyde-3-
phosphate
dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase,
glucose-6-
phosphate isomerase, 3-phosphoglycc:rate mutase, pyruvate kinase,
triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase. Suitable vectors and
promoters for
use in yeast expression are further described in R. Hitzeman et al., EPA
73,657.
Preferred yeast vectors can be assembled using DNA sequences from pUCl8 for
selection and replication in E. coli (Arripr gene and origin of replication)
and yeast DNA
sequences including a glucose-repressible: ADH:2 promoter and a-factor
secretion leader. The
ADH2 promoter has been described by Russell et al. (J. Biol. Chem. 258:2674,
1982) and
Beier et al. (Nature 300:724, 1982). The yeast a-factor leader, which directs
secretion of
heterologous proteins, can be inserted between the promoter and the structural
gene to be
expressed. See, e.g., Kurjan et al., Cell 30:933, 1982; and Bitter et al.,
Proc. Natl. Acad.
Sci. USA 81:5330, 1984. The leader sequence may be modified to contain, near
its 3' end,
one or more useful restriction sites to facilitate fusion of the leader
sequence to foreign genes.
Suitable yeast transformation protocols are known to those of skill in the
art; an
exemplary technique is described by Hinnen et al., Proc. Natl. Acad. Sci. USA
75:1929,
1978, selecting for Trp+ transformants in a selective medium consisting of
0.67% yeast
nitrogen base, 0.5% casamino acids, 2%~ glucose, 10 ~g/ml adenine and 20 ug/ml
uracil or
URA+ tranformants in medium consisting of 0.67% YNB, with amino acids and
bases as
described by Sherman et al., Laboratory Course Manual for Methods in Yeasr
Generics, Cold
Spring Harbor Laboratory, Cold Spring Harbor, New York, 1986.
Host strains transformed by vectors comprising the ADH2 promoter may be grown
for expression in a rich medium consisting of 1% yeast extract, 2% peptone,
and 1% or 4%
glucose supplemented with 80 ug/ml adenine and 80 pg/ml uracil. Derepression
of the ADH2
'SU~'.~T1~°iL9T'E S~"ff~'
WO 91/03553 -- PCT/US90/04001
2o s~~4 ~
16
promoter occurs upon exhaustion of medium glucose. Crude yeast supernatants
are
harvested by filtration and held at 4°C prior to further purification.
Various mammalian or insect cell culture systems are also advantageously
employed
to express recombinant protein. Expression of recombinant proteins in
mammalian cells is
particularly preferred because such proteins are generally correctly folded,
appropriately
modified and completely functional. Examples of suitable mammalian host cell
lines include
the COS-7 lines of monkey kidney cells, described by Gluzman (Cell 23:175,
1981 ), and
other cell lines capable of expressing an appropriate vector including, for
example, L cells,
C127, 3T3, Chinese hamster ovary (CHO), HeLa and BHK cell lines. Mammalian
expression vectors may comprise nontranscribed elements such as an origin of
replication, a
suitable promoter and enhancer linked to the gene to be expressed, and other
5' or 3' flanking
nontranscribed sequences, and 5' or 3' nontranslated sequences, such as
necessary ribosome
binding sites, a polyadenylation site, splice donor and acceptor sites, and
transcriptional
termination sequences. Baculovirus systems for production of heterologous
proteins in insect
cells are reviewed by Luckow and Summers, BioITechnology 6:47 (1988).
The transcriptional and translational control sequences in expression vectors
to be
used in transforming vertebrate cells may be provided by viral sources. For
example,
commonly used promoters and enhancers are derived from Polyoma, Adenovirus 2,
Simian
Virus 40 (SV40), and human cytomegalovirus. DNA sequences derived from the
SV40 viral
genome, for example, SV40 origin, early and late promoter, enhancer, splice,
and
polyadenylation sites may be used to provide the other genetic elements
required for
expression of a heterologous DNA sequence. The early and late promoters are
particularly
useful because both are obtained easily from the virus as a fragment which
also contains the
SV40 viral origin of replication (Fiers et al., Nature 273:113, 1978). Smaller
or larger SV40
fragments may also be used, provided the approximately 250 by sequence
extending from the
Hind 3 site toward the Bgll site located in the viral origin of replication is
included. Further,
mammalian genomic TNF-R promoter, control and/or signal sequences may be
utilized,
provided such control sequences are compatible with the host cell chosen.
Additional details
regarding the use of a mammalian high expression vector to produce a
recombinant
mammalian TNF receptor are provided in Examples 2 and 7 below. Exemplary
vectors can
be constructed as disclosed by Okayama and Berg (Mol. Cell. Biol. 3:280,
1983).
A useful system for stable high level expression of mammalian receptor cDNAs
in
C127 murine mammary epithelial cells can be constructed substantially as
described by
Cosman et al. (Mol. Immunol. 23:935, 1986).
In preferred aspects of the present invention, recombinant expression vectors
comprising TNF-R cDNAs are stably integrated into a host cell's DNA. Elevated
levels of
expression product is achieved by selecting for cell lines having amplified
numbers of vector
SU~~~'!~'t~Tg S~~~"~'
WO 91/03553 PCT/US90/04001
20 fi534 fi
17
DNA. Cell lines having amplified nurr~bers of vector DNA are selected, for
example, by
transforming a host cell with a vector comprising a DNA sequence which encodes
an enzyme
which is inhibited by a known drug. The vector may also comprise a DNA
sequence which
encodes a desired protein. Alternatively, the host cell may be co-transformed
with a second
vector which comprises the DNA sequence which encodes the desired protein. The
transformed or co-transformed host cells are then cultured in increasing
concentrations of the
known drug, thereby selecting for drug-resistant cells. Such drug-resistant
cells survive in
increased concentrations of the toxic iirug by over-production of the enzyme
which is
inhibited by the drug, frequently as a result of amplification of the gene
encoding the enzyme.
Where drug resistance is caused by an increase in the copy number of the
vector DNA
encoding the inhibitable enzyme, there is a concomitant co-amplification of
the vector DNA
encoding the desired protein (TNF-R) in the host cell's DNA.
A preferred system for such co-arnplification uses the gene for dihydrofolate
reductase
(DHFR), which can be inhibited by the drug methotrexate (MTX). To achieve co-
amplification, a host cell which lacks an active gene encoding DHFR is either
transformed
with a vector which comprises DNA sequence encoding DHFR and a desired
protein, or is
co-transformed with a vector comprising a DNA sequence encoding DHFR and a
vector
comprising a DNA sequence encoding the desired protein. The transformed or co-
transformed host cells are cultured in media containing increasing levels of
MTX, and those
cells lines which survive are selected.
A particularly preferred co-amplification system uses the gene for glutamine
synthetase (GS), which is responsible for the synthesis of glutamate and
ammonia using the
hydrolysis of ATP to ADP and phosphate to drive the reaction. GS is subject to
inhibition by
a variety of inhibitors, for example methionine sulphoximine (MSX). Thus, TNF-
R can be
expressed in high concentrations by co-amplifying cells transformed with a
vector comprising
the DNA sequence for GS and a desired protein, or co-transformed with a vector
comprising
a DNA sequence encoding GS and a vecoor comprising a DNA sequence encoding the
desired
protein, culturing the host cells in media containing increasing levels of MSX
and selecting
for surviving cells. The GS co-amplification system, appropriate recombinant
expression
3(? vectors and cells lines, are described in the following PCT applications:
WO 87/04462, WO
89/01036, WO 89/10404 and WO 86/05807.
Recombinant proteins are preferably expressed by co-amplification of DHFR or
GS in
a mammalian host cell, such as Chinese Hamster Ovary (CHO) cells, or
alternatively in a
murine myeloma cell line, such as SP2,/p-Ag 14 or NSO or a rat myeloma cell
line, such as
YB2/3.0-Ag20, disclosed in PCT applications WO/89/10404 and WO 86/05807.
A preferred eukaryotic vector for expression of TNF-R DNA is disclosed below
in
Example 2. This vector, referred to as hCAV/NOT, was derived from the
mammalian high
SIJBSTIT~"'T'~ SIfE~'~'
'O 91 /03553 PCh/ USA 4001
21~ fi534 fi
18,
expression vector pDC201 and contains regulatory sequences from SV40,
adenovirus-2, and
human cytomegalovirus.
Purification of Recombinant TNF-R
Purified mammalian TNF receptors ~or analogs are prepared by culturing
suitable
host/vector systems to express the recombinant translation products of the
DNAs of the
present invention, which are then purified from culture media or cell
extracts.
For example, supernatants from systems which secrete recombinant protein into
culture media can be first concentrated using a commercially available protein
concentration
filter, for example, an Amicon*or Millipore Pellicon*ultrafiltration unit.
Following the
concentration step, the concentrate can be applied to a suitable purification
matrix. For
example, a suitable affinity matrix can comprise a TNF or lectin or antibody
molecule bound
to a suitable suppot~t. Alternatively, an anion exchange resin can be
employed, for example, a
matrix or substrate having pendant diethylarr,~inoethyl (DEAE) groups. The
matrices can be
acrylamide, agarose, dextran, cellulose or other types commonly employed in
protein
purification. Alternatively, a cation exchange step can be employed. Suitable
cation
exchangers include various insoluble matrices comprising sulfopropyl or
carboxymethyl
groups. Sulfopropyl groups are preferred.
Finally, one or more reversed-phase high performance liquid chromatography (RP-
HPLC) steps employing hydrophobic RP-IEiPLC media, e.g., silica gel having
pendant
methyl or other aliphatic groups, can be employed tv further purify a TNF-R
composition.
Some or all of the foregoing purification steps, in various combinations, can
also be
employed to provide a homogeneous recombinant protein.
Recombinant protein produced in bacterial culture is usually isolated by
initial
extraction from cell pellets, followed by one or more concentration, salting-
out, aqueous ion
exchange or size exclusion chromatography steps. Finally, high performance
liquid
chromatography (HPLC) can be employed for final purification steps. Microbial
cells
employed in expression of recombinant mammalian TNF-R can be disrupted by any
convenient method, including freeze-thaw cycling, sonication, mechanical
disruption, or use
of cell lysing agents.
Fermentation of yeast which express mammalian TNF-R as a secreted protein
greatly
simplifies purification. Secreted recombinant protein resulting from a large-
scale fermentation
can be purified by methods analogous to those disclosed by Urdal et al. (J.
Chromatog.
296:171, 1984). This reference describes two sequential, reversed-phase HPLC
steps for
purification of recombinant human GM-CSF on a preparative HPLC column.
Human TNF-R synthesized in recomhinant culture is characterized by the
presence of
non-human cell components, including proteins, in amounts and of a character
which depend
*Trade-mark 72249-30
WO 91103553 PCT/US90/04001
20 6534- 19
upon the purification steps taken to recover human TNF-R from the culture.
These
components ordinarily will be of yeast, :prokaryotic or non-human highew
eukaryotic origin
and preferably are presen~ in innocuous contaminant quantities, on the order
of less than
about 1 percent by weight. Further, recombinant cell culture enables the
production of TNF-
R free of proteins which may be normally associated with TNF-R as it is found
in nature in
its species of origin, e.g. in cells, cell exudates or body fluids.
Therataeutic Administration of Recombinant Soluble TNF-R
The present invention provides methods of using therapeutic compositions
comprising
an effective amount of soluble TNF-R proteins and a suitable diluent and
carrier, and methods
for suppressing TNF-dependent inflammatory responses in humans comprising
administering
an effective amount of soluble TNF-R prntein.
For therapeutic use, purified soluble TNF-R protein is administered to a
patient,
preferably a human, for treatment in a manner appropriate to the indication.
Thus, for
example, soluble TNF-R protein compositions can be administered by bolus
injection,
continuous infusion, sustained release from implants, or other suitable
technique. Typically,
a soluble TNF-R therapeutic agent will be administered in the form of a
composition
comprising purified protein in conjunction with physiologically acceptable
carriers, excipients
or diluents. Such carriers will be nontoxic to recipients at the dosages and
concentrations
employed. Ordinarithe preparation of such compositions entails combining the
TNF-R
with buffers, antioxidants such as ascorbic acid, low molecular weight (less
than about 10
residues) polypeptides, proteins, amino acids, carbohydrates including
glucose, sucrose or
dextrins, chelating agents such as EDT,A, glutathione and other stabilizers
and excipients.
Neutral buffered saline or saline mixed with conspecific serum albumin are
exemplary
appropriate diluents. Preferably, product is formulated as a lyophilizate
using appropriate
excipient solutions (e.g., sucrose) as diluents. Appropriate dosages can be
determined in
trials. The amount and frequency of administration will depend, of course, on
such factors as
the r~ ire and severity of the indication being treated, the desired response,
the condition of
the I,..~ient, and so forth.
Soluble TNF-R proteins are administered for the purpose of inhibiting TNF-
dependent responses. A variety of diseases or conditions are believed to be
caused by TNF,
such as cachexia and septic shock. I~- ,ddition, other key cytokines (IL-1, IL-
2 and other
colony stimulating factors) can also i: :e significant host production of TNF.
Soluble
TNF-R compositions may therefore be used, for example, to treat cachexia or
septic shock or
to treat side effects associated with cytokine therapy. Because of the primary
roles 1L-1 and
IL-2 play in the production of TNF, cornbination therapy using both IL-1
receptors or IL-2
receptors may be preferred in the treatment of T'NF-associated clinical
indications.
WO 91103553 ~ PC1'/U~ 040x1
2065346
The following examples are offered by way of illustration, and not by way of
limitation.
5
Example 1
in in Assays
A. Radiolabeling of TNFa and TNF~B. Recombinant human TNFa, in the form of a
fusion protein containing a hydrophilic octapeptide at the N-terminus, was
expressed in yeast
as a secreted protein and purified by affinity chromatography (Hopp et al.,
BioITechnology
6:1204, 1988). Purified recombinant human TNF~i was purchased from R&D Systems
(Minneapolis, MN). Both proteins were radiolabeled using the commercially
available solid
phase agent, IODO-GEN*(Pierce). In this procedure, 5 ug of IODO-GEN were
plated at the
bottom of a 10 x 75 mm glass tube and incubated for 20 minutes at 4'C with 75
~1 of 0.1 M
sodium phosphate, pH 7.4 and 20 ~l (2 mCi) Na 125I. This solution was then
transferred to
a second glass tube containing 5 pg TNFa (or TNFp) in 45 ~1 PBS for 20 minutes
at 4'C.
The reaction mixture was fractionated by gel filtration on a 2 ml bed volume
of Sephadex 6-
(Sigma) equilibrated in Roswell Park Memorial Institute (RPMI) 1640 medium
containing
2.5% (w/v) bovine serum albumin (BSA), O.:Z% (w/v) sodium azide and 20 mM
Hepes pH
7.4 (binding medium). The final pool of ~251i-TNF was diluted to a working
stock solution
of 1 x 10-7 M in binding medium and stored for up to one month at 4'C without
detectable
25 loss of receptor binding activity. The specific activity is routinely 1 x
106 cpm/mmoIe TNF.
B. Binding to Intact Cells. Binding assays with intact cells were performed by
two
methods. In the first method, cells were first grown either in suspension
(e.g., U 937) or by
adherence on tissue culture plates (e.g., WI26-VA4, COS cells expressing the
recombinant
TNF receptor). Adherent cells were subsequently removed by treatment with 5mM
ED'~'A
treatment for ten minutes at 37 degrees centigrade. Binding assays were then
performed by a
pthalate oil separation method (Dower et al., J. lmmunol. 132:751, 1984)
essentially as
described by Park et al. (J. Biol. Chem. 26i!:4177, 1986). Non-specific
binding of ~25I-
TNF was measured in the presence of a 200-fold or greater molar excess of
unlabeled TNF.
Sodium azide (0.2%) was included in a binding assay to inhibit internalization
of 1251-TNF
by cells. In the second method, COS cells transfected with the TNF-R-
containing plasmid,
and expressing TNF receptors on the surface,. were tested for the ability to
bind 1251_TNF by
the plate binding assay described by Sims et ttl. (Science 241:585, 1988).
C. Solid Phase Binding Assays. The ability of TNF-R to be stably adsorbed to
nitrocellulose from detergent extracts of humt~n cells yet retain TNF-binding
activity provided
72249-30
*Trade-mark
W(7 9t ~ .3553 2 0 6 5 3 4 s ~/US90/04001
2'l
a means of detecting TNF-R. Cell extracts were prepared by mixing a cell
pellet with a 2 x
volume of PBS containing 1% Triton X-101*and a cocktail of protease inhibitors
(2 mM
phenylmethyl sulfonyl fluoride, 10 ~.iM pepstatin, 10 ~Nl leupeptin, 2 mM o-
phenanthroline
and 2 mM EGTA) by vigorous vortexing. The mixture was incubated on ice for 30
minutes
after which it was centrifuged at 12,OOOx g fcrr 15 minutes at 8'C to remove
nuclei and other
debris. Two microliter aliquots of cell extracts were placed on dry BA85/21
nitrocellulose
membranes (Schleicher and Schuell, Keene, NH) and allowed to dry. The
membranes were
incubated in tissue culture dishes for 30 minutes in Tris (0.05 M) buffered
saline (0.15 M)
pH 7.5 containing 3% w/v BSA to block nonspecific binding sites. The membrane
was then
covered with 5 x 10-1 i M 125I_TNF in PBS + 3% BSA and incubated for 2 hr at
4'C with
shaking. At the end of this time, the membranes were washed 3 times in PBS,
dried and
placed on Kodak X-Omat AR film for 18 hr a.t -70'C.
Example 2
i5 Isolation of Human TNF-R cDNA by Direca Expression of Active Protein in COS-
7 Cells
Various human cell lines were screened for expression of TNF-R based on their
ability to bind 1251-labeled TNF. The humor fibroblast cell line WI-26 VA4 was
found to
express a reasonable number of receptors per cell. Equilibrium binding studies
showed that
the cell line exhibited biphasic binding of 1~-51-TNF with approximately 4,000
high affinity
sites (Ka = 1 x 101 M-1) and 15,00 low affinity sites (Ka = 1 x 10g M-1) per
cell.
An unsized cDNA library was constructed by reverse transcription of
polyadenylated
mRNA isolated from total RNA extracted from human fibroblast WI-26 VA4 cells
grown in
the presence of pokeweed mitogen using standard techniques (Gubler, et al.,
Gene 25:263,
1983; Ausubel et al., eds., Current Protocol: in Molecular Biology, Vol. 1,
1987). The cells
were harvested by lysing the cells in a guanidine hydrochloride solution and
total RNA
isolated as previously described (Ma.rch et al., Nature 315:641, 1985).
Poly A+ RNA was isolated by oligo dT cellulose chromatography and double
stranded cDNA was prepared by a methodl similar to that of Gubler and Hoffman
(Gene
25:263, 1983). Briefly, the poly A+ RN~~ was convened to an RNA-cDNA hybrid by
reverse transcriptase using oligo dT as a prinner. The RNA-cDNA hybrid was
then converted
into double-stranded cDNA using RNAase H in combination with DNA polymerase I.
The
resulting double stranded cDNA was blunt-ended with T4 DNA polymerase. To the
blunt-
ended cDNA is added EcoRI linker-adapters (having internal Notl sites) which
were
phosphorylated on only one end (Invitrogen). The linker-adaptered cDNA was
treated with
T4 polynucleotide kinase to phosphorylate the 5' overhanging region of the
linker-adapter and
unligated linkers were removed by running the cDNA over a Sepharose CLAB
column. The
linker-adaptered cDNA was ligated to an equimolar concentration of EcoR 1 cut
and
*Trade-mark 72249-30
WO 91/03553 2 0 6 5 3 4 ~ P~T/US90/04001
22
dephosphorylated arms of bacteriophag;e 7~gt10 (Huynh et al, DNA Cloning: A
Practical
Approach, Glover, ed.; IRL Press, pp. 49-78). The ligated DNA was packaged
into phage
particles using a commercially available lkit to generate a library of
recombinants (Stratagene
Cloning Systems, San Diego, CA, USA). Recombinants were further amplified by
plating
phage on a bacterial lawn of E. coli strain c600(hfl-).
Phage DNA was purified from the: resulting 7~gt10 cDNA library and the cDNA
inserts
excised by digestion with the restriction enzyme Notl. Following
electrophoresis of the
digest through an agarose gel, cDNAs grf:ater than 2,000 by were isolated.
The resulting cDNAs were ligated into the eukaryotic expression vector
pCAV/NOT,
which was designed to express cDNA sequences inserted at its multiple cloning
site when
transfected into mammalian cells. pCAV/NOT was assembled from pDC201 (a
derivative of
pMLSV, previously described by Cos:man et al., Nature 312: 768, 1984), SV40
and
cytomegalovirus DNA and comprises, in sequence with the direction of
transcription from the
origin of replication: (1) SV40 sequence; from coordinates 5171-270 including
the origin of
replication, enhancer sequences and early and late promoters; (2)
cytomegalovirus sequences
including the promoter and enhancer regions (nucleotides 671 to +63 from the
sequence
published by Boechart et al. (Cell 41:52:1, 1985); (3) adenovirus-2 sequences
containing the
first exon and part of the intron between ~:he first and second exons of the
tripartite leader, the
second exon and pan of the third exon of the tripartite leader and a multiple
cloning site
(MCS) containing sites for Xhol, Kpnl, Smal, Notl and Bgll; (4) SV40 sequences
from
coordinates 4127-4100 and 2770-2533 that include the polyadenylation and
termination
signals for early transcription; (5) sequences derived from pBR322 and virus-
associated
sequences VAI and VAII of pDC201, with adenovirus sequences 10532-11156
containing
the VAI and VAII genes, followed by ~pBR322 sequences from 4363-2486 and 1094-
375
containing the ampicillin resistance gene ~~nd origin of replication.
The resulting WI-26 VA4 cDNA library in pCAV/NOT was used to transform E. coli
strain DHSa, and recombinants were plated to provide approximately 800
colonies per plate
and sufficient plates to provide approximately 50,000 total colonies per
screen. Colonies
were scraped from each plate, pooled, and plasmid DNA prepared from each pool.
The
pooled DNA was then used to transfect a sub-confluent layer of monkey COS-7
cells using
DEAE-dextran followed by chloroquine treatment, as described by Luthman et al.
(Nucl.
Acids Res. 11:1295, 1983) and McCutchan et al. (J. Natl. Cancer Inst. 41:351,
1986). The
cells were then grown in culture for three days to permit transient expression
of the inserted
sequences. After three days, cell culture supernatants were discarded and the
cell monolayers
in each plate assayed for TNF binding as follows. Three ml of binding medium
containing
1.2 x 10-11 M 125I_labeled FLAG~-TNF~ was added to each plate and the plates
incubated at
4°C for 120 minutes. This medium wa.s then discarded, and each plate
was washed once
St~~3STl T ;ATE SNEE'~
20 6534 G
23
with cold binding medium (containing no labeled TNF) and twice
with cold PBS. The edges of each plate were then broken off,
leaving a flat disk which was contacted with X-ray film for 72
hours at -70oC using an intensifying screen. TNF binding
activity was visualized on th,e exposed films as a dark focus
against a relatively uniform background.
After approximately 240,000 recombinants from the
library had been screened in this manner, one transfectant
pool was observed to provide TNF binding foci which were
clearly apparent against the background exposure.
A f rozen st ock of bact a r is f rom t he pos it ive poo 1
was then used to obtain plates of approximately 150 colonies.
Replicas of these plates were made on nitrocellulose filters,
and the plates were then scraped and plasmid DNA prepared and
transfected as described above to identify a positive plate.
Bacteria from individual colonies from the nitrocellulose
replica of this plate were grown in 0.2 ml cultures, which
were used to obtain plasmid DNA, which was transfected into
COS-7 cells as described above. In this manner, a single
clone, clone 1, was isolated which was capable of inducing
expression of human TNF-R in COS cells. The expression vector
pCAV/NOT containing the TNF-~~ cDNA clone 1 has been deposited
with the American Type Culture Collection, 12301 Parklawn
Drive, Rockville, MD 20852, tJSA (Accession No. 68088) under
the name pCAV/NOT-TNF-R on SE~ptember 6th, 1989.
72249-30
_. _.- ..~. ~ __._
2o s5.34 s
23a
Bxample 3
Construction of cDNAs Encoding Soluble huTNF-R~235
A cDNA encoding a soluble huTNF-R~235 (having the
sequence of amino acids 1-235 of Figure 2) was constructed by
excising an 840 by fragment from pCAV/NOT-TNF-R with the
restriction enzymes Notl and Pvu2. Notl cuts at the multiple
cloning site of pCAV/NOT-TNF-R and Pvu2 cuts within the TNF-R
coding region 20 nucleotides 5' of the transmembrane region.
In order to reconstruct the ~I' end of the TNF-R sequences, two
oligonucleotides were synthe:;ized and annealed to create the
following oligonucleotide linker:
Pvu2 BamHI Bgl2
CTGAAGGGAGCAC7.'GGCGACTAAGGATCCA
GACTTCCCTCGTGFICCGCTGATTCCTAGGTCTAG
AlaGluGlySerThrGlyAspEnd
This oligonucleotide linker has terminal Pvu2 and Bgl2
restrictions sites, regenerates 20 nucleotides of the TNF-R,
followed by a termination codon (underlined) and a BamHI
restriction site (for convenjLence in isolating the entire
soluble TNF-R by Notl/BamHI digestion). This oligonucleotide
was then ligated with the 840 by Notl/Pvu2 TNF-R insert into
8g12/Notl cut pCAV/NOT to yield psolhuTNF-R~235/CAVNOT, which
was
/72249-30
WO 91/03553 PCT/US90/04001
2o s5~~
24
transfected into COS-7 cells as described above. This expression vector
induced expression
of soluble human TNF-R which was capable of binding TNF.
Example 4
Construction of cDNA~~ Encoding Soluble huTNF-80185
A cDNA encoding a soluble hu'I'NF-80185 (having the sequence of amino acids 1-
185 of Figure 2) was constructed by excising a 640 by fragment from pCAV/NOT-
TNF-R
with the restriction enzymes Notl and Bgl2. Notl cuts at the multiple cloning
site of
pCAV/NO-TNF-R and Bgl2 cuts within the TNF-R coding region at nucleotide 637,
which is
237 nucleotides 5' of the transmembrane region. The following oligonucleotide
linkers were
synthesized:
Bgl2
1S 5'-GATCTGTAACGTGGTGGCCATCCCTGGGAATGCAAGCATGGATGC-3'
ACATTGCACCACCGGTAGGGACCCTTACGTTCG
IleCysAsnValValAlaIleProGlyAsnAlaSerMetAspAla
Note
5'- AGTCTGCACGTCCACGTCCCCCACCCGGTGAGC -3'
TACCTACGTCAGACGTGCAGGTGCAGGGGGTGGGCCACTCGCCGG
ValCysThrSerThrSerProThrArgEnd
The above oligonucleotide linkers reconstruct the 3' end of the receptor
molecule up to
nucleotide 708, followed by a termination codon (underlined). These
oligonucleotides were
then ligated with the 640 by Notl TrfF-R insert into Notl cut pCAV/NOT to
yield the
expression vector psoITNFR~185/CA'VNOT, which was transfected into COS-7 cells
as
described above. This expression vector induced expression of soluble human
TNF-R which
was capable of binding TNF.
Example 5
construction of cDNA,s Encoding Soluble huTNF-80163
A cDNA encoding a soluble huTNF-80163 (having the sequence of amino acids 1-
163 of Figure 2) was constructed by excising a 640 by fragment from from
pCAV/NOT-
TNF-R with the restriction enzymes Notl and Bgl2 as described in Example 4.
The
following oligonucleotide linkers were ~,ynthesized:
Bgl2 Notl
5' -GATCTGTTGAC;C -3'
ACAACTCGCCGG
IleCysEnd
~uss~rer;~ ~H~E,~.
.___
WO 91/03553 PCT/US90/04001
20 6534 6
This above oligonucleotide linker reconstructs the 3' end of the receptor
molecule up to
nucleotide 642 (amino acid 163), followed by a termination codon (underlined).
This
oligonucleotide was then ligated with the 640 by Notl TNF-R insert into Notl
cut
5 pCAV/NOT to yield the expression vector psoITNFR0163/CAVNOT, which was
transfected
into COS-7 cells as described above. This expression vector induced expression
of soluble
human TNF-R which was capable of binding TNF in the binding assay described in
Example
1.
F;xample 6
Construction of cDNAs Encoding Soluble huTNF-R~142
A cDNA encoding a soluble huTNF-R~142 (having the sequence of amino acids 1-
142 of Figure 2) was constructed by excising a 550 by fragment from from
pCAV/NOT-
TNF-R with the restriction enzymes Notl and AlwNl. AlwNl cuts within the TNF-R
coding region at nucleotide 549. The following oligonucleotide linker was
synthesized:
Bgl2 Notl
2O 5'-CTGAAACATCAGACGTGGTGTGCAAGCCCTGT~A-3'
CTTGACTTTGTAGTCTGCACf~ACACGTTCGGGACAATTTCTAGA
End
This above oligonucleotide linker reconstructs the 3' end of the receptor
molecule up to
nucleotide 579 (amino acid 142), followed by a termination codon (underlined).
This
oligonucleotide was then ligated with the 550 by Notl/AlwNl TNF-R insert into
Not1Bg12
cut pCAV/NOT to yield the expression vector psoITNFR~142/CAVNOT, which was
transfected into COS-7 cells as described above. This expression vector did
not induced
expression of soluble human TNF-R which was capable of binding TNF. It is
believed that
this particular construct failed to expreas biologically active TNF-R because
one or more
essential cysteine resi3ue (e.g., Cysls~ or Cys163) required for
intramolecular bonding (for
formation of the proper tertiary structure of the TNF-R molecule) was
eliminated.
Example 7
3$ ~x~ession of SolulZle TNF Receptors in CHO Cells
Soluble TNF receptor was expressed in Chinese Hamster Ovary (CHO) cells using
the glutamine-synthetase (GS) gene amplification system, substantially as
described in PCT
patent application Nos. W087/04462 and W089/01036. Briefly, CHO cells are
transfected
with an expression vector containing gE;nes for both TNF-R and GS. CHO cells
are selected
!~UIBSTIT~TE SH~L~
WO 91 /03553
2 0 6 5 3 4 6 P~/US90/04001
26
for GS gene expression based on the ability of the transfected DNA to confer
resistance to
low levels of methionine sulphoximine (MSX). GS sequence amplification events
in such
cells are selected using elevated MSX concentrations. In this way, contiguous
TNF-R
sequences are also amplified and enhanced TNF-R expression is achieved.
The vector used in the GS expression system was psoITNFR/P6/PSVLGS, which
was constructed as follows. First, the vector pSVLGS.l (described in PCT
Application
Nos. W087/04462 and W089/01036, and available from Celltech, Ltd., Berkshire,
UK)
was cut with the BamHl restriction enzyme and dephosphorylated with calf
intestinal alkaline
phosphatase (CIAP) to prevent the vector from religating to itself. The BamHl
cut
pSVLGS.l fragment was then ligated to a 2.4 kb BamHl to Bgl2 fragment of
pEE6hCMV
(described in PCT Application No. W089/01036, also available from Celltech)
which was
cut with Bgl2, BamHl and Fspl to avoid two fragments of similar size, to yield
an 11.2 kb
vector designated p6/PSVLGS.l. pSVLGS.I contains the glutamine synthetase
selectable
marker gene under control of the SV40 later promoter. The BamHl to Bgl2
fragment of
pEE6hCMV contains the human cytomegalovirus major immediate early promoter
(hCMV), a
polylinker, and the SV40 early polyadenylation signal. The coding sequences
for soluble
TNF-R were added to p6/PSVLGS.1 by excising a Notl to BamHl fragment from the
expression vector psoITNFR/CAVNOT (made according to Example 3 above), blunt
ending
with Klenow and ligating with SmaI cut dephosphorylated p6/PSVLGS.1, thereby
placing
the soITNF-R coding sequences under the control of the hCMV promoter. This
resulted in a
single plasmid vector in which the SV40/GS and hCMB/soITNF-R transcription
units are
transcribed in opposite directions. This vector was designated
psoITNFR/P6/PSVLGS.
psoITNFR/P6/PSVLGS was used to transfect CHO-K1 cells (available from ATCC,
Rochville, MD, under accession number CCL 61) as follows. A monolayer of CHO-K
1 cells
were grown to subconfluency in Minimum Essential Medium (MEM) lOX (Gibco: 330
1581AJ) without glutamine and supplemented with 10% dialysed fetal bovine
serum (Gibco:
220-6300AJ), 1 mM sodium pyruvate (Sigma), MEM non-essential amino acids
(Gibco: 320-
1140AG), 500 ~M asparagine and glutamate (Sigma) and nucleosides (30 ~.M
adenosine,
guanosine, cytidine and uridine and 10 N.M thymidine)(Sigma).
Approximately 1 x 106 cells per 10 cm petri dish were transfected with 10 ug
of
psoITNFR/P6/PSVLGS by standard calcium phosphate precipitation, substantially
as
described by Graham & van der Eb, Virology 52:456 (1983). Cells were subjected
to
glycerol shock (15% glycerol in serum-free culture medium for approximately
1.5 minutes)
approximately 4 hours after transfection, substantially as described by Frost
& Williams,
Virology 91:39 (1978), and then washed with serum-free medium. One day later,
transfected
cells were fed with fresh selective medium containing MSX at a final
concentration of 25 uM.
Colonies of MSX-resistant surviving cells were visible within 3-4 weeks.
Surviving colonies
RUBS SHEET
20 6534 6
27
were transferred to 24-well elates and allowed to grow to
confluency in selective medium. Conditioned medium from
confluent wells were then as=rayed for soluble TNF-R activity
using the binding assay described in Example 1 above. These
assays indicated that the colonies expressed biologically
active soluble TNF-R.
In order to select for GS gene amplification,
several MSX-resistant cell lines are transfected with
psoITNFR/P6/PSVLGS and grown in various concentrations of MSX.
For each cell line, approximE~tely 1x106 cells are plated in
gradually increasing concentrations of 100 uM, 250 uM, 500 uM
and 1 mM MSX and incubated far 10-14 days. After 12 days,
colonies resistant to the hic3her levels of MSX appear. The
surviving colonies are assayed for TNF-R activity using the
binding assay described above' in Example 1. Each of these
highly resistant cell lines contains cells which arise from
mult iple independent amplif ic:at ion events . From these cell
lines, one or more of the mo:~t highly resistant cell lines are
isolated. The amplified cel7.s with high production rates are
then cloned by limiting dilution cloning. Mass cell cultures
of the transfectants secrete active soluble TNF-R.
E~:amp 1 a 8
Expression of Soluble Human TNF-R in Yeast
Soluble human TNF-R was expressed in yeast with the
expression vector pIXY432, which was derived from the yeast
expression vector pIXY120 and plasmid pYEP352. pIXY120 is
identical to pYaHuGM (ATCC 5.3157, deposited June 19th, 1985),
72249-30
27a
except that it contains no cDNA insert and includes a
polylinker/multiple cloning rite with a NcoI restriction site.
A DNA fragment encoding TNF receptor and suitable
for cloning into the yeast e~:pression vector pIXY120 was first
generated by polymerase chain reaction (PCR) amplification of
the extracellular portion of the full length receptor from
pCAV/NOT-TNF-R (ATCC 68088). The following primers were used
in this PCR amplification=
5' End Primer
5'-TTCCGGTACCTTTGGATAAAAGAGACTACAAGGAC
Asp718->ProLeuAspLysF,rgAspTyrLysAsp
GACGATGACAAGTTGCC'.CGCCCAGGTGGCATTTACA-3'
AspAspAspLys<----~---TNF-R---------->
3' End Primer (antisensEl
5'-CCCGGGATCCTTAGTCGCCAC~TGCTCCCTTCAGCTGGG-3'
BamHI>End<-------------TNF-R------->
72249-30
W091/03553 2 0 6 5 3 4 6 P~/US90/04001
_. 2g
The S' end oligonucleotide primer used in the amplification included an Asp718
restriction
site at its 5' end, followed by nucleotides encoding the 3' end of the yeast a-
factor leader
sequence (Pro-Leu-Asp-Lys-Arg) and those encoding the 8 amino acids of the
FLAG~
peptide (AspTyrLysAspAspAspAspLys) fused to sequence encoding the 5' end of
the mature
receptor. The FLAG~ peptide (Hopp et al., BioITechnology 6:1204, 1988) is a
highly
antigenic sequence which reversibly binds the monoclonal antibody M1 (ATCC HB
9259).
The oligonucleotide used to generate the 3' end of the PCR-derived fragment is
the antisense
strand of DNA encoding sequences which terminate the open reading frame of the
receptor
after nucleotide 704 of the mature coding region (following the Asp residue
preceding the
transmembrane domain) by introducing a. TAA stop codon (underlined). The stop
codon is
then followed by a BamHl restriction site. The DNA sequences encoding TNF-R
are then
amplified by PCR, substantially as described by Innis et al., eds., PCR
Protocols: A Guide ro
Methods and Applications (Academic Press, 1990).
The PCR-derived DNA fragment encoding soluble human TNF-R was subcloned into
the yeast expression vector pIXY120 bar digesting the PCR-derived DNA fragment
with
BamH 1 and Asp718 restriction enzymes, digesting pIXY 120 with BamH 1 and
Asp718, and
ligating the PCR fragment into the cut vector in vitro with T4 DNA ligase. The
resulting
construction (pIXY424) fused the open reading frame of the FLAG~-soluble TNF
receptor
in-frame to the complete a-factor leader sequence and placed expression in
yeast under the
aegis of the regulated yeast alcohol dehydrogenase (ADH2) promoter. Identity
of the
nucleotide sequence of the soluble TNF receptor carried in pIXY424 with those
in cDNA
clone 1 were verified by DNA sequencing using the dideoxynucleotide chain
termination
method. pIXY424 was then transformed into E. coli strain RR1.
Soluble human TNF receptor was also expressed and secreted in yeast in a
second
vector. This second vector was generated by recovering the pIXY424 plasmid
from E. coli
and digesting with EcoRl and BamHl restriction enzymes to isolate the fragment
spanning
the region encoding the ADH2 promoter, the a-factor leader, the FLAG~-soluble
TNF
receptor and the stop codon. This fragmf;nt was ligated in vitro into EcoR 1
and BamH 1 cut
plasmid pYEP352 (Hill et al., Yeast :?:163 ( 1986)), to yield the expression
plasmid
pIXY432, which was transformed into E.~coli strain RR1.
To assess secretion of the soluble human TNF receptor from yeast, pIXY424 was
purified and introduced into a diploid yeast strain of S. cerevisiae (XV2181 )
by
electroporation and selection for acquisition of the plasmid-borne yeast TRP1+
gene on media
lacking tryptophan. To assess secretion of the receptor directed by pIXY432,
the plasmid
was introduced into the yeast strain PB1~49-6b by electroporation followed by
selection for
the plasmid-borne URA3+ gene with growth on media lacking uracil. Overnight
cultures
were grown at 30°C in the appropriate selective media. The PB 149-
6b/pIXY434
SUaSTI i s.!'~''~ SH~Z'1' '
V4'O 9' 3553 , 2 ~ ~) 5 3 4 ~ P~/US90/040C
2!~
transformants were diluted into YEP-1% glut:ose media and grown at 30'C for 38-
40 hours.
Supernatants were prepared by removal of cells by centrifugation, and
filtration of
supernatants through 0.45p filters.
The level of secreted receptor in the supernatants was determined by immuno-
dotblot.
Briefly, 1 ul of supernatants, and dilutions of the supernatants, were spotted
onto
nitrocellulose filters and allowed to dry. After blocking non-specific protein
binding with a
3% BSA solution, the filters were incubated with diluted M1 anti-FLAG~
antibody, excess
antibody was removed by washing and then dilutions of horseradish peroxidase
conjugated
anti-mouse IgG antibodies were incubated with the filters. After removal of
excess secondary
antibodies, peroxidase substrates were added and color development was allowed
to proceed
for approximately 10 minutes prior to removal of the substrate solution.
The anti-FLAG~ reactive material found in the supernatants demonstrated that
significant levels of receptor were secreted by both expression systems.
Comparisons
demonstrated that the pIXY432 system secreted approximately 8-16 times more
soluble
1 S human TNF receptor than the pIXY424 system. The supernatants were assayed
for soluble
TNF-R activity, as described in Example 1, by their ability to bind 1251-TNFa
and block
TNFa binding. The pIXY432 supernatants were found to contain significant
levels of active
soluble TNF-R.
Example 9
Isolation of Murin~F-R cDNAs
Murine TNF-R cDNAs were isolated from a cDNA library made from murine 7B9
cells, an antigen-dependent helper T cell linE; derived from C57BL/6 mice, by
cross-species
hybridization v~~ith a human TNF-R probe. The cDNA library was constructed in
,ZAP
(Stratagene, San Diego), substantially as described above in Example 2, by
isolating
polyadenylated RNA from the 7B9 cells.
A double-stranded human TNF-R cDNA probe was produced by excising an
approximately 3.5 kb Notl fragment of tht: human TNF-R clone 1 and 32P-
labeling the
cDNA using random primers (Boehringer-Mannheim).
The murine cDNA library was amplified once and a total of 900,000 plaques were
screened, substantially as described in Example 2, with the human TNF-R cDNA
probe.
Approximate v 21 positive plaques were purified, and the Bluescript plasmids
containing
EcoRl-linke:;:d inserts were excised (Stratal;ene, San Diego). Nucleic acid
sequencing of a
portion of murine TNF-R clone 11 indicated that the coding sequence of the
murine TNF-R
was approximately 88% homologous to the: corresponding nucleotide sequence of
human
*Trade-mark 72249-30
WO 91/03553 ~ PCT/US90/04001
'2~ 6534 f
TNF-R. A partial nucleotide sequence of murine TNF-R cDNA clone 11 is set
forth in
Figures 4-S.
Example 10
5 Preparation of Mon~xlonal Antibodies to TNF-R
Preparations of purified recombinant TNF-R, for example, human TNF-R, or
transfected COS cells expressing high levels of TNF-R are employed to generate
monoclonal
antibodies against TNF-R using conventional techniques, for example, those
disclosed in
10 U.S. Patent 4,411,993. Such antibodies are likely to be useful in
interfering with TNF
binding to TNF receptors, for example, iin ameliorating toxic or other
undesired effects of
TNF, or as components of diagnostic or research assays for TNF or soluble TNF
receptor.
To immunize mice, TNF-R immunogen is emulsified in complete Freund's adjuvant
and injected in amounts ranging from 1Ci-100 ~.g subcutaneously into Balb/c
mice. Ten to
15 twelve days later, the immunized animals are boosted with additional
immunogen emulsified
in incomplete Freund's adjuvant and periodically boosted thereafter on a
weekly to biweekly
immunization schedule. Serum samples are periodically taken by retro-orbital
bleeding or
tail-tip excision for testing by dot-blot assay (antibody sandwich) or ELISA
(enzyme-linked
immunosorbent assay). Other assay procedures are also suitable. Following
detection of an
20 appropriate antibody titer, positive animals are given an intravenous
injection of antigen in
saline. Three to four days later, the animals are sacrificed, splenocytes
harvested, and fused
to the murine myeloma cell line NS 1. H~~bridoma cell lines generated by this
procedure are
plated in multiple rnicrotiter plates in a HAT selective medium (hypoxanthine,
aminopterin,
and thymidine) to inhibit proliferation of non-fused cells, myeloma hybrids,
and spleen cell
25 hybrids.
Hybridoma clones thus generated can be screened by ELISA for reactivity with
TNF-
R, for example, by adaptations of the techniques disclosed by Engvall et al.,
Immunochem.
8:871 (1971) and in U.S. Patent 4,703,004. Positive clones are then injected
into the
peritoneal cavities of syngeneic Balb/c mi~;,e to produce ascites containing
high concentrations
30 (>1 mg/ml) of anti-TNF-R monoclonal antibody. The resulting monoclonal
antibody can be
purified by ammonium sulfate precipitation followed by gel exclusion
chromatography,
and/or affinity chromatography based on binding of antibody to Protein A of
Staphylococcus
aureus.
~ven~ sH~r
y.....~~._ ._.._ _ ~ ~.. ~a~ __ __ .
