Note: Descriptions are shown in the official language in which they were submitted.
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
TITLE OF THE INVENTION
PNEUMOCOCCAL SURFACE PROTEIN C (PspC), EPITOPIC REGIONS
AND STRAIN SELECTION THEREOF, AND USES THEREFOR
STATEMENT OF GOVERNMENT SUPPORT
This work was supported in part by National Institute of Health Grants
AI21548 and HL58418.
RELATED APPLICATIONS/PATENTS
This application is based upon and claims priority from U.S. Provisional
application Serial No. 60/082,728, filed April 23, 1998.
Reference also is made to: Briles et al., "Strain Selection of Pneumococcal
Surface Proteins," U.S. application Serial No. 08/710,749, filed September 20,
1996
(allowed); Briles et al., "Pneumoccocal Genes, Portions Thereof, Expression
Products
Therefrom, And Uses of Such Genes, Portions and Products," U.S. applications
Serial
Nos. 08/714,741, filed September 16, 1996, and 08/529,055, filed September 15,
1995, and PCT applications PCT/US96/14819, filed September 16, 1996 and WO
97/09994, published March 20, 1997; Briles et al. "Oral Administration ...,"
U.S.
application Serial Nos. 08/482,981, filed June 7, 1995 (allowed); U.S.
application
Serial No. 08/458,399, filed June 2, 1995, and U.S. application Serial No.
08/657,751,
filed May 30, 1996 {allowed}; "Mucosal Administration ...," Briles et al.,
U.S.
application Serial No. 08/446,201, filed May 19, 1995 (allowed; filed as a CIP
of
USSN 08/246,636, filed May 20, 1994 (also allowed)), and Briles et al., U.S.
application Serial No. 08/312,949, filed September 30, 1994 (allowed); Briles
et al.,
U.S. application Serial No. 08/319,795, filed May, 20, 1994 (allowed); Briles
et al.,
"Epitopic Regions of Pneumococcal Surface Protein A," U.S. application Serial
No.
08/456,746, filed June 6, 1995 (now U.S. Patent No. 5,679,768; filed as a
cont. USSN
08/048,896, filed April 20, 1993, now abandoned, which was as a CIP of USSN
07/835,698, filed February 12, 1992, now abandoned, which was as a CIP of USSN
07/656,773, now abandoned); Briles et al.,"Structural Gene of Pneumococcal
Protein," U.S. application Serial No. 08/467,852, filed June 6, 1995 (now U.S.
Patent
No. 5,856,170; filed as a cont. of U.S. application Serial No. 08/247,491,
filed May
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
2
23, 1994), U.S. application Serial No. 8/072,070, filed June 3, 1993 (now U.S.
Patent
No. 5,476,929) and U.S. Patent Nos. 5,753,463 and 5,728,387 (from U.S.
applications
Serial Nos. 08/469,434, filed June 6, 1995 and U.S. application Serial No.
214,164,
filed March 14, 1994, respectively); Briles et al., "Truncated PspA ...," U.S.
S application Serial No. 08/214,222, filed March 17, 1994 (now U.S. Patent No.
5,804,193); Briles et al. U.S. application Serial No. 08/468,985 (allowed);
Briles et
al., "Immunoassay Comprising a Truncated Pneumococcal Surface Protein A
(PspA)," U.S. Patent No. 5,871,943; U.S. applications Serial Nos. 08/226,844,
filed
May 29, 1992, 08/093,907, filed July 5, 1994.and 07/889,918, filed July 5,
1994;
PCT/LJS93/05191; and Briles et al., WO 92/1448.
Each of these applications and patents, as well as each document or reference
cited in each of these applications and patents (including during the
prosecution of
each issued patent) and PCT and foreign applications or patents corresponding
to
and/or claiming priority from any of the foregoing applications and patents,
is hereby
expressly incorporated herein by reference. Documents or references are also
cited in
the following text, either in a Reference List before the claims, or in the
text itself;
and, each of these documents or references ("herein-cited documents or
references"),
as well as each document or reference cited in each of the herein-cited
documents or
references, is hereby expressly incorporated herein by reference.
FIELD OF THE INVENTION
The present invention relates to epitopic regions of Pneumococcal Surface
Protein C or "PspC", different Glades of PspC, isolated and/or purified
nucleic acid
molecules such as DNA encoding a fragment or portion of PspC such as an
epitopic
region of PspC or at least one epitope of PspC, uses for such nucleic acid
molecules,
e.g., to detect the presence of PspC or of S. pneumoniae by detecting a
nucleic acid
molecule therefor in a sample such as by amplification and/or a polymerase
chain
reaction, vectors or plasmids which contain and/or express such nucleic acid
molecles, e.g., in vitro or in vivo, immunological, immunogenic or vaccine
compositions comprising at least one PspC and/or a portion thereof (such as at
least
one epitopic region of at least one PspC and/or at least one polypeptide
encoding at
least one epitope of at least one PspC), either alone or in further
combination with at
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
3
least one second pneumococcal antigen, such as at least one different PspC
and/or a
fragment thereof and/or at least one PspA and/or at least one epitopic region
of at
least one PspA and/or at least one polypeptide comprising at least one epitope
of
PspA.
PspC or a fragment thereof, and thus a composition comprising PspC or a
fragment thereof, can be administered by the same routes, and in approximately
the
same amounts, as PspA. Thus, the invention further provides methods for
administering PspC or a fragment thereof, as well as uses of PspC or a
fragment
thereof to formulate such compositions.
Other aspects of the invention are described in or are obvious from (and
within
the ambit of the invention) the following disclosure.
BACKGROUND OF THE INVENTION
Streptococcus pneumoniae is an important cause of otitis media, meningitis,
bacteremia and pneumonia, and a leading cause of fatal infections in the
elderly and
persons with underlying medical conditions, such as pulmonary disease, liver
disease,
alcoholism, sickle cell, cerebrospinal fluid leaks, acquired immune deficiency
syndrome (AIDS), and patients undergoing immunosuppressive therapy. It is also
a
leading cause of morbidity in young children. Pneumococcal infections cause
approximately 40,000 deaths in the U.S. yearly. The most severe pneumococcal
infections involve invasive meningitis and bacteremia infections, of which
there are
3,000 and 50,000 cases annually, respectively.
Despite the use of antibiotics and vaccines, the prevalence of pneumococcal
infections has declined little over the last twenty-five years; the case-
fatality rate for
bacteremia is reported to be 15-20% in the general population, 30-40% in the
elderly,
and 36% in inner-city African Americans. Less severe forms of pneumococcal
disease are pneumonia, of which there are 500,000 cases annually in the U.S.,
and
otitis media in children, of which there are an estimated 7,000,000 cases
annually in
the U.S. caused by pneumococcus. Strains of drug-resistant S. pneumoniae are
becoming ever more common in the U.S. and worldwide. In some areas, as many as
30% of pneumococcal isolates are resistant to penicillin. The increase in
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
4
antimicrobial resistant pneumococcus further emphasizes the need for
preventing
pneumococcal infections.
Pneumococcus asymptomatically colonizes the upper respiratory tract of
normal individuals; disease often results from the spread of organisms from
the
nasopharynx to other tissues during opportunistic events. The incidence of
carnage in
humans varies with age and circumstances. Carrier rates in children are
typically
higher than those of adults. Studies have demonstrated that 38 to 60% of
preschool
children, 29 to 35% of grammar school children and 9 to 25% of junior high
school
children are Garners of pneumococcus. Among adults, the rate of carnage drops
to
6% for those without children at home, and to 18 to 29% for those with
children at
home. It is not surprising that the higher rate of carriage in children than
in adults
parallels the incidence of pneumococcal disease in these populations.
An attractive goal for streptococcal vaccination is to reduce carnage in the
vaccinated populations and subsequently reduce the incidence of pneumococcal
disease. There is speculation that a reduction in pneumococcal carriage rates
by
vaccination could reduce the incidence of the disease in non-vaccinated
individuals as
well as vaccinated individuals. This "herd immunity" induced by vaccination
against
upper respiratory bacterial pathogens has been observed using the Haemophilus
in, fluenzae type b conjugate vaccines (Takala, A.K., et al., J. Infect. Dis.
1991; 164:
982-986; Takala, A.K., et al., Pediatr. Infect. Dis. J., 1993; 12: 593-599;
Ward, J., et
al., Vaccines, S.A. Plotkin and E. A. Mortimer, eds., 1994, pp. 337-386;
Murphy,
T.V., et al., J. Pediatr., 1993; 122; 517-523; and Mohle-Boetani, J.C., et
al., Pediatr.
Infect. Dis. J., 1993; 12: 589-593).
It is generally accepted that immunity to Streptococcus pneumoniae can be
mediated by specific antibodies against the polysaccharide capsule of the
pneumococcus. However, neonates and young children fail to make adequate
immune response against most capsular polysaccharide antigens and can have
repeated infections involving the same capsular serotype. One approach to
immunizing infants against a number of encapsulated bacteria is to conjugate
the
capsular polysaccharide antigens to protein to make them immunogenic. This
approach has been successful, for example, with Haemophilus influenzae b (see
U.S.
Patent No. 4,496,538 to Gordon and U.S. Patent No. 4,673,574 to Anderson).
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
However, there are over ninety known capsular serotypes of S. pneumoniae, of
which twenty-three account for about 95% of the disease. For a pneumococcal
polysaccharide-protein conjugate to be successful, the capsular types
responsible for
most pneumococcal infections would have to be made adequately immunogenic.
This
approach may be difficult, because the twenty-three polysaccharides included
in the
presently-available vaccine are not all adequately immunogenic, even in
adults.
Protection mediated by anti-capsular polysaccharide antibody responses are
restricted to the polysaccharide type. Different polysaccharide types
differentially
facilitate virulence in humans and other species. Pneumococcal vaccines have
been
developed by combining 23 different capsular polysaccharides that are the
prevalent
types of human pneumococcal disease. These 23 polysaccharide types have been
used in a licensed pneumococcal vaccine since 1983 (D.S. Fedson and D. M.
Musher,
Vaccines, S.A. Plotkin and J.E.A. Montimer, eds., 1994, pp. 517-564). The
licensed
23-valent polysaccharide vaccine has a reported efficacy of approximately 60%
in
preventing bacteremia caused vaccine type pneumococci in healthy adults.
However, the efficacy of the vaccine has been controversial, and at times, the
justification for the recommended use of the vaccine questioned. It has been
speculated that the efficacy of this vaccine is negatively affected by having
to
combine 23 different antigens. Having a large number of antigens combined in a
single formulation may negatively affect the antibody responses to individual
types
within this mixture because of antigenic competition. The efficacy is also
affected by
the fact that the 23 serotypes encompass all serological types associated with
human
infections and carriage.
An alternative approach to protecting against pneumococcal infection,
especially for protecting children, and also the elderly, from pneumococcal
infection,
would be to identify protein antigens that could elicit protective immune
responses.
Such proteins may serve as a vaccine by themselves, may be used in conjunction
with
successful polysaccharide-protein conjugates, or as Garners for
polysaccharides.
Pneumococcal Surface Protein A or PspA, has been identified as an antigen;
and, its DNA and amino acid sequences have been investigated. PspA is useful
in
eliciting protective immune responses. PspA or fragments thereof can be used
in
immunological, immunogenic or vaccine compositions; and, such compositions can
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
6
contain different types of PspAs or fragments from different types of PspAs.
Further,
such compositions can be administered by injection, or mucosally or orally, or
by
means of a vector expressing the PspA or fragment thereof.
Studies on PspA led to the discovery of a PspA-like protein and a pspA-like
gene, now termed PspC and pspC. Indeed, early patent literature termed PspC as
"PspA-like".
It is believed that heretofore that epitopic regions of PspC have not been
disclosed or suggested. It is likewise believed that heretofore different
Glades of PspC
have not been taught or suggested. Further, it is believed that heretofore DNA
encoding epitopic regions of PspC have not been disclosed or suggested.
Further still,
it is believed that heretofore immunological, immunogenic or vaccine
compositions
comprising at least one PspC and/or portions thereof (such as at least one
epitopic
region of at least one PspC and/or at least one polypeptide encoding at least
one
epitope of at least one PspC), either alone or in further combination with at
least one
second pneumococcal antigen, such as at least one different PspC and/or a
fragment
thereof and/or at least one PspA and/or at least one epitopic region of at
least one
PspA and/or at least one polypeptide comprising at least one epitope of PspA,
have
not been taught or suggested.
Alternative vaccination strategies are desirable as such provide alternative
immunological, immunogenic or vaccine compositions, as well as alternative
routes to
administration or alternative routes to responses. It would be advantageous to
provide
an immunological composition or vaccination regimen which elicits protection
against various diversified pneumococcal strains, without having to combine a
large
number of possibly competitive antigens within the same formulation. And, it
is
advantageous to provide additional antigens and epitopes for use in
immunological,
immunogenic and/or vaccine compositions, e.g., to provide alternative
compositions
containing or comprising such antigens or epitopes either alone or in
combination
with different antigens.
Furthermore it is advantageous to provide a better understanding of the
pathogenic mechanisms of pneumococci, as this can lead to the development of
improved vaccines, diagnosis and treatments.
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
7
OBJECTS .AND SUMMARY OF THE INVENTION
An object of the invention can include providing one or more of epitopic
regions of PspC, different Glades of PspC, isolated and/or purified nucleic
acid
molecules such as DNA encoding a fragment or portion of PspC such as an
epitopic
region of PspC or at least one epitope of PspC, uses for such nucleic acid
molecules,
vectors or plasmids which contain and/or express such nucleic acid molecles,
e.g., in
vitro or in vivo, immunological, immunogenic or vaccine compositions
comprising
such a vector or plasmid and/or at least one PspC and/or a portion thereof
(such as at
least one epitopic region of at least one PspC and/or at least one polypeptide
encoding
at least one epitope of at least one PspC), either alone or in further
combination with
at least one second pneumococcal antigen, such as at least one different PspC
and/or a
fragment thereof and/or at least one PspA and/or at least one epitopic region
of at
least one PspA and/or at least one polypeptide comprising at least one epitope
of
PspA and/or at least one vector or plasmid expressing said second pneumococcal
antigen (which vector or plasmid could be the same as the aforementioned
vector or
plasmid comrprising a nucleic molecule encoding PspC or a portion or fragment
thereof); and, methods for administering PspC or a fragment thereof, as well
as uses
of PspC or a fragment thereof to formulate such compositions, inter alia.
Accordingly, the invention can provide one or more of epitopic regions of
PspC, different Glades of PspC, isolated and/or purified nucleic acid
molecules such as
DNA encoding a fragment or portion of PspC such as an epitopic region of PspC
or at
least one epitope of PspC, uses for such nucleic acid molecules, vectors or
plasmids
which contain and/or express such nucleic acid molecles, e.g., in vitro or in
vivo,
immunological, immunogenic or vaccine compositions comprising such a vector or
plasmid and/or at least one PspC and/or a portion thereof (such as at least
one epitopic
region of at least one PspC and/or at least one polypeptide encoding at least
one
epitope of at least one PspC), either alone or in further combination with at
least one
second pneumococcal antigen, such as at least one different PspC and/or a
fragment
thereof and/or at least one PspA and/or at least one epitopic region of at
least one
PspA and/or at least one polypeptide comprising at least one epitope of PspA
and/or
at least one vector or plasmid expressing said second pneumococcal antigen
(which
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
8
vector or plasmid could be the same as the aforementioned vector or plasmid
comprising a nucleic molecule encoding PspC or a portion or fragment thereof);
and,
methods for administering PspC or a fragment thereof, as well as uses of PspC
or a
fragment thereof to formulate such compositions, inter alia.
PspC or a fragment thereof, and thus a composition comprising PspC or a
fragment thereof, can be administered by the same routes, and in approximately
the
same amounts, as PspA. Thus, the invention further provides methods for
administering PspC or a fragment thereof, as well as uses of PspC or a
fragment
thereof to formulate such compositions.
Still further, the invention provides PspC epitopic regions, e.g., the alpha
helical region, or the proline region or the combination of the alpha helical
and
proline regions, or the entire PspC molecule, or as 1-590 of PspC Glade A, or
amino
acids) ("aa") 1-204 or as 46-204 or as 1-295 or as 46-295 or as 1-454 or as 46-
454 or
as 204-454 or as 295-454 or as 1-590 or as 46-590 or as 204-590 or as 295-590
or as
454-590 or as 1-652 or as 46-652 or as 204-652 or as 295-652 or as 454-652 or
as
590-652 or as 1-892 or as 46-892 or as 204-892 or as 295-892 or as 454-892 or
590-892 of PspC Glade A. A prototypic Glade A PspC is PspC.EF6796. In other
Glade
A PspCs, the epitopic regions may have slightly different amino acid numbers.
Thus,
the invention comprehends regions of other Glade A PspCs which are
substantially
homologous, or significantly homologous, or highly homologous, or very highly
homologous, or identical, or highly conserved, with respect to the foregoing
particularly recited epitopic regions. Also, where possible, these regions can
extend
in either the N-terminal or COON-terminal direction; e.g., by about another 1-
25 or 1-
50 amino acids in either or both directions. The invention further provides a
polypeptide comprising at least one epitopic region or at least one epitope in
any one
of these various regions.
Similarly, the invention provides Glade B epitopic regions, e.g., the alpha
helical region, the proline region, the combination of the alpha helical and
proline
regions, and the entire molecule, as well as by as such as as 1-664, or as 1-
375, or as
1-445 or as 1-101, or as 1-193, or as 1-262, or as 1-355, or as 101-193, or as
101-262, or as 101-355, or as 101-375, or as 101-455 or as 193-262, or as 193-
355,
or as 193-375, or as 193-445 or as 262-355, or as 262-375, or as 262-445 or as
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
9
355-375, or as 355-445 or as 375-445 or as 101-664, or as 193-664, or as 262-
664, or
as 355-664 or as 375-664 or as 1-end of proline subregion A, or as 1-beginning
of
proline subregion B, or as 101-end of proline subregion A, or as 101-beginning
of
proline subregion B, or as 193-end of proline subregion A, or as 193-beginning
of
proline subregion B, or as 262-end of proline subregion A, or as 262-beginning
of
proline subregion B, or as 355-end of proline subregion A, or as 355-beginning
of
proline subregion B, or as 375-end of proline subregion A, or proline
subregion A, or
as 375-beginning of proline subregion B, or proline subregion B, or beginning
of
proline subregion B-as 664. A prototypic Glade B PspC is PspC.D39. In other
Glade B
PspCs, the epitopic regions may have slightly different amino acid numbers.
Thus,
the invention comprehends regions of other Glade B PspCs which are
substantially
homologous, or significantly homologous, or highly homologous, or very highly
homologous, or identical, or highly conserved, with respect to the foregoing
particularly recited epitopic regions. Also, where possible, these regions can
extend
in either the N-terminal or COOH-terminal direction; e.g., by about another 1-
25 or 1-
50 amino acids in either or both directions. For instance, interesting
epitopic regions
include: as 263-482, 1-445 and 255-445. And, the invention further provides a
polypeptide comprising at least one epitopic region or at least one epitope in
any one
of these regions.
A polypeptide comprising at least one epitope of PspC or PspA can be shorter
than natural or full length PspC or PspA, e.g., a truncated PspC or PspA, such
as
comprising up to about 90% of natural or full length PspC or PspA.
The invention further provides an isolated nucleic acid molecule, e.g., DNA
comprising a sequence encoding any one of these epitopic regions or a
polypeptide
comprising at least one of these epitopic regions, or an epitope of PspC; such
a
nucleic acid molecule is advantageously at least about 12 nucleotides in
length, for
instance, at least about 15, about 18, about 21, about 24 or about 27
nucleotides in
length, such as at least about 30, about 33, about 36, about 39 or about 42
nucleotides
in length, for example, a nucleic acid molecule of at least about 12
nucleotides in
length such as about 12 to about 30, about 12 to about 50 or about 12 to about
60, or
about 12 to about 75 or about 12 to about 100 or more nucleotides in length. A
nucleic
acid molecule comprising a sequence encoding at least one epitope of PspC or
PspA
CA 02328399 2000-10-20
WO 99/53940 PCT1US99/08895
can be shorter than natural or full length pspC or pspA, e.g., a truncated
pspC or pspA,
such as comprising up to about 90% of natural or full length pspC or pspA or
encoding up to about 90% of natural or full length PspA or PspC.
Moreover, in this disclosure, Applicants demonstrate cross-reactivity between
5 PspC and PspA, as well as regions of PspC and PspA and/or of pspC and pspA
which
are highly conserved, substantially homologous, highly homologous, and
identical.
This information allows the skilled artisan to identify nucleic acid molecules
which
can hybridize, e.g., specifically ("specific hybridization") to pspC or pspA
or both
pspC and pspA, e.g., under stringent conditions. The term "specific
hybridization"
10 will be understood to mean that the nucleic acid probes of the invention
are capable of
stable, double-stranded hybridization to bacterially-derived DNA or RNA under
conditions of high stringency, as the term "high stringency" would be
understood by
those with skill in the art (see, for example, Sambrook et al., 1989,
Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y. and Hames and Higgins, eds., 1985, Nucleic Acid Hybridization,
IRL
Press, Oxford, U.K.). Hybridization will be understood to be accomplished
using
well-established techniques, including but not limited to Southern blot
hybridization,
Northern blot hybridization, in situ hybridization and, most preferably;
Southern
hybridization to PCR-amplified DNA fragments. In a preferred alternative, the
nucleic acid hybridization probe of the invention may be obtained by use of
the
polymerase chain reaction (PCR) procedure, using appropriate pairs of PCR
oligonucleotide primers as provided herein or from the teachings herein. See
U.S. Pat.
Nos. 4,683,195 to Mullis et al. and 4,683,202 to Mullis. A probe or primer can
be any
stretch of at least 8, preferably at least 10, more preferably at least 12,
13, 14, or 15,
such as at least 20, e.g., at least 23 or 25, for instance at least 27 or 30
nucleotides in
pspC which are unique to pspC, e.g., not also in pspA (when amplification of
just
pspC is desired) or unique to both pspC and pspA or in both pspC and pspA
(when
amplification of both is acceptable or desired) or which are in pspC and are
least
conserved among the pspClpspA genes. As to PCR or hybridization primers or
probes
and optimal lengths therefor, reference is also made to Kajimura et al., GATA
7(4):71-79 (1990). The invention will thus be understood to provide
oligonucleotides,
such as , pairs of oligonucleotides, for use as primers for the in vitro
amplification of
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
11
bacterial DNA samples and fragments thereof, or for use in expressing a
portion of
bacterial DNA, either in vitro or in vivo. The oligonucleotides preferably
specifically
hybridize to sequences flanking a nucleic acid to be amplified, wherein the
oligonucleotides hybridize to different and opposite strands of the double-
stranded
DNA target. The oligonucleotides of the invention are preferably derived from
the
nucleic acid molecules and teachings herein. As used in the practice of this
invention,
the term "derived from" is intended to encompass the development of such
oligonucleotides from the nucleic acid molecules and teachings disclosed
herein, from
which a multiplicity of alternative and variant oligonucleotides can be
prepared.
And, the invention further comprehends vectors or plasmids containing and/or
expressing such a nucleic acid molecule, as well as uses of such nucleic acid
molecules, e.g., for expression of PspC or an epitopic region thereof or at
least an
epitope thereof or a polypeptide comprising at least one epitope thereof
either in vitro
or in vivo, or for amplifying or detecting PspC or S. pneumoniae in a sample,
for
instance by a polymerase chain reaction.
With respect to the herein mentioned nucleic acid molecules and polypeptides,
e.g., the aforementioned nucleic acid molecules and polypeptides, the
invention
further comprehends isolated and/or purified nucleic acid molecules and
isolated
and/or purified polypeptides having at least about 70%, preferably at least
about 75%
or about 77% identity or homology ("substantially homologous or identical"),
advantageously at least about 80% or about 83%, such as at least about 85% or
about
87% homolgy or identity ("significantly homologous or identical"), for
instance at
least about 90% or about 93% identity or homology ("highly homologous or
identical"), more advantageously at least about 95%, e.g., at least about 97%,
about
98%, about 99% or even about 100% identity or homology ("very highly
homologous
or identical" to "identical"; or from about 84-100% identity considered
"highly
conserved"). The invention also comprehends that these nucleic acid molecules
and
polypeptides can be used in the same fashion as the herein or aforementioned
nucleic
acid molecules and polypeptides.
Nucleotide sequence homology can be determined using the "Align" program
of Myers and Miller, ("Optimal Alignments in Linear Space", CABIOS 4, 11-17,
1988, incorporated herein by reference) and available at NCBI. Alternatively
or
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
12
additionally, the term "homology" or "identity", for instance, with respect to
a
nucleotide or amino acid sequence, can indicate a quantitative measure of
homology
between two sequences. The percent sequence homology can be calculated as
(N~ej -
Ndf)* 100lN,.ef, wherein Ndf is the total number of non-identical residues in
the two
sequences when aligned and wherein Nref is the number of residues in one of
the
sequences. Hence, the DNA sequence AGTCAGTC will have a sequence similarity
of 75% with the sequence AATCAATC (N,ef = 8; N~;~2).
Alternatively or additionally, "homology" or "identity" with respect to
sequences can refer to the number of positions with identical nucleotides or
amino
acids divided by the number of nucleotides or amino acids in the shorter of
the two
sequences wherein alignment of the two sequences can be determined in
accordance
with the Wilbur and Lipman algorithm (Wilbur and Lipman, 1983 PNAS USA
80:726, incorporated herein by reference), for instance, using a window size
of 20
nucleotides, a word length of 4 nucleotides, and a gap penalty of 4, and
computer-
assisted analysis and interpretation of the sequence data including alignment
can be
conveniently performed using commercially available programs (e.g.,
Intelligenetics
TM Suite, Intelligenetics Inc. CA).. When RNA sequences are said to be
similar, or
have a degree of sequence identity or homology with DNA sequences, thymidine
(T)
in the DNA sequence is considered equal to uracil (U) in the RNA sequence.
RNA sequences within the scope of the invention can be derived from DNA
sequences, by thyrnidine (T) in the DNA sequence being considered equal to
uracil
(U) in RNA sequences.
Additionally or alternatively, amino acid sequence similarity or identity or
homology can be determined using the BlastP program (Altschul et al., Nucl.
Acids
Res. 25, 3389-3402, incorporated herein by reference) and available at NCBI.
The
following references (each incorporated herein by reference) provide
algorithms for
comparing the relative identity or homology of amino acid residues of two
proteins,
and additionally or alternatively with respect to the foregoing, the teachings
in these
references can be used for determining percent homology or identity: Needleman
SB
and Wunsch CD, "A general method applicable to the search for similarities in
the
amino acid sequences of two proteins," J. Mol. Biol. 48:444-453 (1970); Smith
TF
and Waterman MS, "Comparison of Bio-sequences," Advances in Applied
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
13
Mathematics 2:482-489 (1981); Smith TF, Waterman MS and Sadler JR,
"Statistical
characterization of nucleic acid sequence functional domains," Nucleic Acids
Res.,
11:2205-2220 (1983); Feng DF and Dolittle RF, "Progressive sequence alignment
as a
prerequisite to correct phylogenetic trees," J. of Molec. Evol., 25:351-360
(1987);
Higgins DG and Sharp PM, "Fast and sensitive multiple sequence alignment on a
microcomputer," ABIO , 5: 151-153 (1989); Thompson JD, Higgins DG and
Gibson TJ, "ClusterW: improving the sensitivity of progressive multiple
sequence
alignment through sequence weighing, positions-specific gap penalties and
weight
matrix choice, Nucleic Acid Res., 22:4673-480 (1994); and, Devereux J,
Haeberlie P
and Smithies O, "A comprehensive set of sequence analysis program for the
VAX,"
Nucl. Acids Res., 12: 387-395 (1984).'
A polypeptide comprising at least a fragment or epitope of PspC, e.g., an
epitopic region of PspC or PspC, can be a fusion protein; for instance, fused
to a
protein which enhances immunogenicity, such as a Cholera Toxin, e.g., Cholera
Toxin B (CTB).
Similarly, a polypeptide comprising at least a fragment or epitope of PspC,
e.g., an epitopic region of PspC or PspC, can be administered with an adjuvant
or a
vehicle which enhances immunogenicity, such as CTB.
Thus, the invention provides an immunological, immunogenic or vaccine
composition comprising at least one PspC and/or a portion thereof (such as at
least
one epitopic region of at least one PspC and/or at least one polypeptide
encoding at
least one epitope of at least one PspC), either alone or in further
combination with at
least one second pneumococcal antigen, such as at least one different PspC
and/or a
fragment thereof and/or at least one PspA and/or at least one epitopic region
of at
least one PspA and/or at least one polypeptide comprising at least one epitope
of
PspA. The epitopic region of PspA can be as in applications cited under
"Related
Applications", supra, e.g., as 1 to 115, 1 to 314, 1 to 260, 192 to 260, 192
to 588, 192
to 299, 1-301, 1-314 or 1-370 of PspA. From the teachings herein and in the
applications cited under "Related Applications", the skilled artisan can
select an
epitope of interest, e.g, of PspC and/or PspA.
This invention also provides strain selection of PspCs from strains for
vaccine
compositions, based upon sequence homology and cross-reactivity, akin to that
which
CA 02328399 2000-10-20
WO 99/53940 PCT/US99108895
14
Applicants have done with PspA. PspC strains can be classified according to
sequence homology in the alpha helical and/or proline rich regions, and
assigned to a
Glade, and subsequently, each Glade is assigned to a family. Applicants have
thus
determined that so far there is at least one PspC family with at least two
major Glades.
Inventive compositions, such as immunogenic, immunological or vaccine
compositions can comprise at least one PspC (or immungenic fragment thereof or
polypeptide comprising at least one PspC epitope or epitopic region or at
least one
vector or plasmid expressing such PspC or fragment thereof, or at least one
PspC
epitope or epitopic region), preferably at least two {2), for instance up to
ten (10),
from strains from each Glade (and/or family), alone, or in further combination
with at
least one PspA (or immungenic fragment thereof or polypeptide comprising at
least
one PspA or at least one epitope or epitopic region of PspA or at least one
vector or
plasmid expressing such PspA or fragment thereof, or at least one PspA epitope
or
epitopic region, which vector or plasmid can be the same as the aforementioned
vector or plasmid) or preferably at least two (2), for instance up to ten (
10), from
strains from each PspA Glade (and/or family), for a broadly efficacious
pneumococcal
vaccine with a limited number of strains.
Immunogenic, immunological or vaccine compositions of the invention can be
administered in the same ways as PspA immunogenic, immunological or vaccine
compositions, e.g., by injection, mucosally, orally, nasally, and the like,
and/or by
way of in vivo expression thereof by a plasmid or vector, as well as in same
or similar
regimens (e.g., such as by prime boost) (see applications cited under Related
Applications, as well as documents cited herein). (Thus, there can be PspA, an
epitopic region of PspA, a polypeptide comprising an epitope within an
epitopic
region of PspA, an immunogenic, immunological or vaccine composition
comprising
at least one PspA and/or at least one fragment or portion thereof, e.g., an
epitopic
region thereof or a polypeptide comprising at least one epitope from PspA
and/or a
vector or plasmid expressing a nucleic acid molecule encoding PspA or a
fragment or
portion thereof, administration of PspA or such a polypeptide or such a
composition
by injection, mucosally, nasally, orally, and the like and/or as part of a
prime-boost
regimen with another antigen which can also be PspA.) The amount of PspC in
such
compositions can be analogous to the amount of PspA in PspA immunogenic,
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
immunological or vaccine compositions (see applications cited under Related
Applications). (Accordingly, there can be PspC, an epitopic region of PspC, a
polypeptide comprising an epitope within an epitopic region of PspC, an
immunogenic, immunological or vaccine composition comprising at least one PspC
and/or at least one fragment or portion thereof, e.g., an epitopic region
thereof or a
polypeptide comprising at least one epitope from PspC and/or a vector or
plasmid
expressing a nucleic acid molecule encoding PspC or a fragment or portion
thereof,
administration of PspC or such a polypeptide or such a composition by
injection,
mucosally, nasally, orally, and the like and/or as part of a prime-boost
regimen with
10 another antigen which can also be PspC.)
Such compositions are useful in eliciting an immune response in an animal or
a host, such as a protective immune response; or, for generating antibodies,
which can
be subsequently used in kits, tests or assays for detecting the presence of
PspC and/or
PspA and PspC and/or S. pneumoniae.
15 These and other embodiments are disclosed or are obvious from and
encompassed by, the following Detailed Description.
BRIEF DESCRIPTION OF FIGURES
The following Detailed Description, given by way of example, and not
intended to limit the invention to specific embodiments described, may be
understood
in conjunction with the accompanying Figures, incorporated herein by
reference, in
which:
Fig. 1 shows a schmatic representation of the PspC Glade A and Glade B and
PspA polypeptides, in comparison with each other (long arrows represent direct
repeats found within alpha helix; hypervariable region is indicated by zig-zag
lines;
and the region of homology of pspC with pspA found within the alpha helix is
indicated by horizontal lines);
Fig. 2 shows the alignment of PspCs (SEQ ID NOS: ) (the amino
acid sequences which included the a helical region and the proline-rich
region of PspC were aligned using MacVector 6.0; the direct repeats within
the a helix, the non-coiled-coil block, and the proline-rich region are
indicated with arrows; conserved regions are shaded, and gaps are shown
CA 02328399 2000-10-20
WO 99/53940 PCTNS99/08895
16
with a dash (-); taxons are named for the strain from which the gene was
cloned with the exception of Genbank entrees: SpsAl (Y10818) from strain
ATCC33400 {serotype 1 }, SpsA2 (AJ002054) from strain ATCC 11733
(serotype 2), ), SpsA47 (A3002055) from strain NCTC10319 (serotype 47), ),
CbpA (AF019904) from strain LM91 (serotype 2), C3bp (AF067128), and
tigr from a serotype 4 clinical isolate (http//:www.tigr.org); the capsular
serotypes of the other strains are as follows: EF6796 (6A), BG8090 (19),
L81905 (4), DBL6A (6A), BG9163 (6B), D39 (2) and E134 (23)):
Fig. 3 shows the coiled-coil motif of the alpha-helix of PspC (amino
acids that are not in the coiled-coil motif are in the right column; this is
the
output from the Matcher program);
Fig. 4 shows a tree of the PspC proteins from this disclosure and
related proteins SpsA and CbpA from Genbank (PspC proteins were
truncated after the proline-rich region (Fig. 1 ) before being aligned using
the
ClustalW algorithm and the Blosum30 amino acid scoring matrix in
MacVector; the tree is an uprooted phylogram generated by the neighbor-
joining method using mean character distances in the program PAUP4.Ob
(Swofford); non-italic numbers on the tree indicate distances along the branch
lengths as calculated by PAUP; italic bolded numbers indicate the percentage
of time each branch was joined together under bootstrap analysis (i000
replicates performed); Clade A and Clade B are each monophyletic groups
separated by greater than 0.1 distance which clustered together 100% of the
time; Clade A PspC proteins share a 120 amino acid domain with many PspA
proteins (Fig. 2); Clade B proteins lack the 120 AA domain, but all
PspC/SpsA/CbpA proteins share the proline-rich domain with PspA proteins;
the boxed D39-lineage indicates different sequences for this locus originating
from strains that are laboratory descendents of the strain D39; the taxons
used
were the same as those described for Fig 2);
Fig. 5 shows PspC and PspA consensus of the choline binding region;
Fig. 6 shows the reactivity of the PspC antiserum with selected
pneumococcal lysates run in a Western immunoblot ;
CA 02328399 2000-10-20
WO 99/53940 PCTNS99/08895
17
Fig. 7 shows the level of antibody reactivity to PspC and PspA
fragments present in the sera of mice immunized with PspC (each bar
represents the mean of the log reciprocal titer and upperbound of the standard
error of sera from five mice; the limit of detection of the log reciprocal
antibody titer is 1.8);
Fig. 8 shows amino acid and DNA sequences for SpsA and spsA from
Genbank (SEQ ID NOS: ) (accession CAA05158; AJ002054.1; AJ002054;
Hammerschmidt et al. 1997);
Fig. 9 shows an additional amino acid and DNA sequences for SpsA
and spsA from Genbank (SEQ ID NOS: ) (accession CAA05159; AJ002055;
AJ002055.1; Hammerschmidt et al. 1997);
Fig. 10 shows amino acid and DNA sequences for CbpA and cbpA
from Genbank (SEQ ID NOS: ) (accession AAB70838; AF019904;
AF019904.1; Rosenow et al. 1997);
Fig. 11 shows amino acid and DNA sequences for PspC and pspC
from Genbank (SEQ ID NOS: ) (from EF6796; accession AAD00184;
U72655.1; U72655; Brooks-Walter et al.);
Fig. 12 shows a tree of PspC proteins from this disclosure from the
University of Alabama, analogous to the tree shown in Fig. 4 (PspC proteins
sequenced at the University of Alabama; PspC proteins were truncated after
the proline-rich region - see Fig. 1 - before aligned using the ClustalW
algorithm and the Blosum30 amino acid scoring matrix in MacVector; the
tree is an unrooted phylogram generated by the neighbor joining method
using mean character distances in the program PAUP4.Ob (Swofford); non-
italic numbers on the tree indicate distances along the branch lengths as
calculated by PAUP; italic bolded numbers indicate the percentage of time
each branch was joined together under bootstrap analysis (1000 replicates
performed); Clade A and Clade B are monophyletic groups separated by
greater than 0.1 distance which clustered together 100% of the time; Clade A
PspC proteins share a 120 amino acid domain with many PspA protein - see
Fig. 2; taxons are named for the strain from which the gene was cloned, with
CA 02328399 2000-10-20
WO 99!53940 PCT/US99/08895
18
the capsular serotypes as follows - EF6796 (6A), BG8090 (19), L81905 (4),
DBL6A (6a), BG9163 (6B), D39 (2) and E134 (23));
Fig. 13 shows the alignment of PspCs (SEQ ID NOS: ) from this
disclosure from the University of Alabama, analogous to the alignment
shown in Fig. 2;
Fig. 14 shows a dendrogram showing the distance of a divergent PspC
(from other PspCs), indicating that it likely belongs to a second family
(Dendrogram of the PspC/SpsA/Cbpa from Genbank and nearest relative
genes from other species; PspC proteins were truncated after the proline-rich
region - see Fig. 1 - before being aligned using the ClustalW algorithm and
the Blusom30 amino acid scoring matrix in MacVector; the dendrogram is
the guide tree used in alignment by MacVector; small numbers on the tree
indicate distances along the branch lengths as calculated during the ClustalW
alignment; sequences of two proteins from Streptococcus agalactiae bac and
rib, and one from Enterococcus facaelis are included for comparison; the
PspC.V26 is a highly divergent PspC protein from S. pneumoniae strain
V26);
Fig. 15 shows the amino acid and DNA sequences (SEQ ID NOS: )
of the divergent PspC (PspC from S. pneumoniae strain V26);
Figs. 16-21 show the DNA sequences (SEQ ID NOS: ) of PspCs
from strains E134, D39, BG9163, BG8090, L81905, and DBL6a,
respectively.
DETAILED DESCRIPTION
PspC (see Figs. 1, 2, 3, 4, 5, 11, 12, 13, 14, 15) is one of three
designations for
a pneumococcal surface protein which is PspA-like, and whose gene is present
in
approximately 75% of all Streptococcus pneumoniae. Applicants have cloned and
sequenced the pspC gene and have expressed the PspC protein (See, e.g., Figs.
1, 2, 4,
5, 11, 12, 13, and patent applications cited under the heading Related
Applications,
supra, as well as to articles or literature cited herein; see also Figs. 14, 1
S). Under the
designation SpsA (see Figs. 8, 9), PspC has been shown to bind secretory IgA
(Hammerschmidt et al. 1997). Under the designation CbpA (see Fig. 10), PspC
has
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
19
been shown to interact with human epithelial and endothelial cells (Rosenow et
al.
1997).
The pspC gene is paralogous to the pspA gene in S. pneumoniae and was thus
called pspC (Brooks-Walter et al. 1997; see also applications cited in Related
Applications, supra).
The present invention provides epitopic regions of PspC, different Glades of
PspC, DNA encoding epitopic regions of PspC, vectors which express such
epitopic
regions, immunological, immunogenic or vaccine compositions comprising at
least
one PspC and/or a portion thereof (such as at least one epitopic region of at
least one
PspC and/or at least one polypeptide encoding at least one epitope of at least
one
PspC), either alone or in further combination with at least one second
pneumococcal
antigen, such as at least one different PspC and/or a fragment thereof and/or
at least
one PspA and/or at least one epitopic region of at least one PspA and/or at
least one
polypeptide comprising at least one epitope of PspA.
PspC or a fragment thereof, and thus a composition comprising PspC or a
fragment thereof, can be administered by the same routes, and in approximately
the
same amounts, as PspA. Thus, the invention further provides methods for
administering PspC or a fragment thereof or a polypeptide comprising at least
one
epitope of PspC, as well as uses of PspC or a fragment thereof to formulate
such
compositions.
Furthermore, in this disclosure, pspC genes from seven different clinical S.
pneumoniae strains were cloned and sequenced. Examination of the sequences of
twelve alleles reveals that this gene exists in diverse forms among
pneumococci and
has a mosaic structure in which sequence modules encoding protein domains have
contributed to the pattern of variation during gene evolution.
Two major Glades exist: Glade A alleles are larger and contain an extra module
that is shared by many pspA genes; Glade B alleles are smaller and lack this
pspA-like
domain. All genes in both Glade A and Glade B maintain a proline-rich domain
and a
choline-binding repeat domain that are indistinguishable from similar domains
in the
pspA gene at the nucleotide and protein level.
Thus, this invention also relates to strain selection of PspCs from strains
for
vaccine compositions, based upon sequence homology and cross-reactivity, akin
to
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
that which Applicants have done with PspA. PspC strains can be classified
according
to sequence homology in the alpha helical and/or proline rich regions, and
assigned to
a Glade, and subsequently, each Glade is assigned to a family. Applicants have
thus
determined that so far there is one PspC family with at least two major
Glades.
5 There is, however, a single PspC (PspC.V26, from S. pneumoniae strain V26,
a capsular-type 14 S. pneumoniae strain) that appears to be a member of a
second
family because it seems only distantly related to members of the first major
PspC
family Figure 14 provides a dendrogram showing the distance of this divergent
PspC
from the other PspCs. Fig. 15 provides the amino acid and DNA sequences of the
10 divergent PspC.
Inventive compositions, such as immunogenic, immunological or vaccine
compositions can comprise at least one PspC (or immungenic fragment thereof or
polypeptide comprising at least one PspC epitope or epitopic region or at
least one
vector or plasmid expressing such PspC or fragment thereof, or at least one
PspC
15 epitope or epitopic region), preferably at least two {2), for instance up
to ten (10),
from strains from each Glade, alone, or in further combination with at least
one PspA
(or immungenic fragment thereof or polypeptide comprising at least one PspA or
at
least one epitope or epitopic region of PspA or at least one vector or plasmid
expressing such PspA or fragment thereof, or at least one PspA epitope or
epitopic
20 region, which vector or plasmid can be the same as the aforementioned
vector or
plasmid) or preferably at least two {2), for instance up to ten ( 10), from
strains from
each PspA Glade, for a broadly efficacious pneumococcal vaccine with a limited
number of strains.
Accordingly, in an aspect, the invention provides an immunogenic,
immunological or vaccine composition containing an epitope of interest from at
least
one PspC and/or PspA, and a pharmaceutically acceptable carrier or diluent. An
immunological composition elicits an immunological response - local or
systemic.
The response can, but need not be, protective. An immunogenic composition
likewise
elicits a local or systemic immunological response which can, but need not be,
protective. A vaccine composition elicits a local or systemic protective
response.
Accordingly, the terms "immunological composition" and "immunogenic
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
21
composition" include a "vaccine composition" (as the two former terms can be
protective compositions).
The invention therefore also provides a method of inducing an immunological
response in a host mammal comprising administering to the host an immunogenic,
immunological or vaccine composition. From the disclosure herein and the
documents cited herein, including the applications cited under "Related
Applications", the skilled artisan can obtain an epitope of interest of PspC
and/or
PspA, without undue experimentation.
Further, the invention demonstrates that more than one serologically
complementary PspC molecule can be in an antigenic, immunological or vaccine
composition, so as to elicit better response, e.g., protection, for instance,
against a
variety of strains of pneumococci; and, the invention provides a system of
selecting
PspCs for a multivalent composition which includes cross-protection evaluation
so as
to provide a maximally efficacious composition.
The determination of the amount of antigen, e.g., PspC or truncated portion
thereof or a polypeptide comprising an epitope or epitopic region of PspC, and
optional adjuvant in the inventive compositions and the preparation of those
compositions can be in accordance with standard techniques well known to those
skilled in the pharmaceutical or veterinary arts.
In particular, the amount of antigen and adjuvant in the inventive
compositions
and the dosages administered are determined by techniques well known to those
skilled in the medical or veterinary arts taking into consideration such
factors as the
particular antigen, the adjuvant (if present), the age, sex, weight, species
and
condition of the particular patient, and the route of administration.
For instance, dosages of particular PspC antigens for suitable hosts in which
an immunological response is desired, can be readily ascertained by those
skilled in
the art from this disclosure, as is the amount of any adjuvant typically
administered
therewith. Thus, the skilled artisan can readily determine the amount of
antigen and
optional adjuvant in compositions and to be administered in methods of the
invention.
Typically, an adjuvant is commonly used as 0.001 to 50 wt% solution in
phosphate
buffered saline, and the antigen is present on the order of micrograms to
milligrams,
such as about 0.0001 to about 5 wt%, preferably about 0.0001 to about 1 wt%,
most
CA 02328399 2000-10-20
WO 99/53940 PGT/US99/08895
22
preferably about 0.0001 to about 0.05 wt% (see, e.g., Examples below or in
applications cited herein).
Typically, however, the antigen is present in an amount on the order of
micrograms to milligrams, or, about 0.001 to about 20 wt%, preferably about
0.01 to
about 10 wt%, and most preferably about 0.05 to about 5 wt%.
Of course, for any composition to be administered to an animal or human,
including the components thereof, and for any particular method of
administration, it
is preferred to determine therefor: toxicity, such as by determining the
lethal dose
(LD) and LDSO in a suitable animal model e.g., rodent such as mouse; and, the
dosage
of the composition(s), concentration of components therein and timing of
administering the composition(s), which elicit a suitable immunological
response,
such as by titrations of sera and analysis thereof for antibodies or antigens,
e.g., by
ELISA and./or REFIT analysis. Such determinations do not require undue
experimentation from the knowledge of the skilled artisan, this disclosure and
the
documents cited herein. And, the time for sequential administrations can be
ascertained without undue experimentation.
Examples of compositions of the invention include liquid preparations for
orifice, e.g., oral, nasal, anal, vaginal, peroral, intragastric, mucosal
(e.g., perlingual,
alveolar, gingival, olfactory or respiratory mucosa) etc., administration such
as
suspensions, syrups or elixirs; and, preparations for parenteral,
subcutaneous,
intradermal, intramuscular or intravenous administration (e.g., injectable
administration), such as sterile suspensions or emulsions. Such compositions
may be
in admixture with a suitable carrier, diluent, or excipient such as sterile
water,
physiological saline, glucose or the like. The compositions can also be
lyophilized.
The compositions can contain auxiliary substances such as wetting or
emulsifying
agents, pH buffering agents, gelling or viscosity enhancing additives,
preservatives,
flavoring agents, colors, and the like, depending upon the route of
administration and
the preparation desired. Standard texts, such as "REMINGTON'S
PHARMACEUTICAL SCIENCE", 17th edition, 1985, incorporated herein by
reference, may be consulted to prepare suitable preparations, without undue
experimentation.
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
23
Compositions of the invention, are conveniently provided as liquid
preparations, e.g., isotonic aqueous solutions, suspensions, emulsions or
viscous
compositions which may be buffered to a selected pH. If digestive tract
absorption is
preferred, compositions of the invention can be in the "solid" form of pills,
tablets,
capsules, caplets and the like, including "solid" preparations which are time-
released
or which have a liquid filling, e.g., gelatin covered liquid, whereby the
gelatin is
dissolved in the stomach for delivery to the gut. If nasal or respiratory
(mucosal)
administration is desired, compositions may be in a form and dispensed by a
squeeze
spray dispenser, pump dispenser or aerosol dispenser. Aerosols are usually
under
pressure by means of a hydrocarbon. Pump dispensers can preferably dispense a
metered dose or, a dose having a particular particle size.
Compositions of the invention can contain pharmaceutically acceptable flavors
and/or colors for rendering them more appealing, especially if they are
administered
orally. The viscous compositions may be in the form of gels, lotions,
ointments,
creams and the like and will typically contain a sufficient amount of a
thickening
agent so that the viscosity is from about 2500 to 6500 cps, although more
viscous
compositions, even up to 10,000 cps may be employed. Viscous compositions have
a
viscosity preferably of 2500 to 5000 cps, since above that range they become
more
difficult to administer. However, above that range, the compositions can
approach
solid or gelatin forms which are then easily administered as a swallowed pill
for oral
ingestion.
Liquid preparations are normally easier to prepare than gels, other viscous
compositions, and solid compositions. Additionally, liquid compositions are
somewhat more convenient to administer, especially by injection or orally, to
animals,
children, particularly small children, and others who may have difficulty
swallowing a
pill, tablet, capsule or the like, or in mufti-dose situations. Viscous
compositions, on
the other hand, can be formulated within the appropriate viscosity range to
provide
longer contact periods with mucosa, such as the lining of the stomach or nasal
mucosa.
Obviously, the choice of suitable carriers and other additives will depend on
the exact route of administration and the nature of the particular dosage
form, e.g.,
liquid dosage form (e.g., whether the composition is to be formulated into a
solution,
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
24
a suspension, gel or another liquid form), or solid dosage form (e.g., whether
the
composition is to be formulated into a pill, tablet, capsule, caplet, time
release form or
liquid-filled form).
Solutions, suspensions and gels, normally contain a major amount of water
(preferably purified water) in addition to the antigen, lipoprotein and
optional
adjuvant. Minor amounts of other ingredients such as pH adjusters (e.g., a
base such
as NaOH), emulsifiers or dispersing agents, buffering agents, preservatives,
wetting
agents, jelling agents, (e.g., methylcellulose), colors and/or flavors may
also be
present. The compositions can be isotonic, i.e., it can have the same osmotic
pressure
as blood and lacrimal fluid.
The desired isotonicity of the compositions of this invention may be
accomplished using sodium chloride, or other pharmaceutically acceptable
agents
such as dextrose, boric acid, sodium tartrate, propylene glycol or other
inorganic or
organic solutes. Sodium chloride is preferred particularly for buffers
containing
sodium ions.
Viscosity of the compositions may be maintained at the selected level using a
pharmaceutically acceptable thickening agent. Methylcellulose is preferred
because it
is readily and economically available and is easy to work with. Other suitable
thickening agents include, for example, xanthan gum, carboxymethyl cellulose,
hydroxypropyl cellulose, carbomer, and the like. The preferred concentration
of the
thickener will depend upon the agent selected. The important point is to use
an
amount which will achieve the selected viscosity. Viscous compositions are
normally
prepared from solutions by the addition of such thickening agents.
A pharmaceutically acceptable preservative can be employed to increase the
shelf life of the compositions. Benzyl alcohol may be suitable, although a
variety of
preservatives including, for example, parabens, thimerosal, chlorobutanol, or
benzalkonium chloride may also be employed. A suitable concentration of the
preservative will be from 0.02% to 2% based on the total weight although there
may
be appreciable variation depending upon the agent selected.
Those skilled in the art will recognize that the components of the
compositions
must be selected to be chemically inert with respect to the PspC antigen and
optional
adjuvant. This will present no problem to those skilled in chemical and
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
pharmaceutical principles, or problems can be readily avoided by reference to
standard texts or by simple experiments (not involving undue experimentation),
from
this disclosure and the documents cited herein.
The immunologically effective compositions of this invention are prepared by
S mixing the ingredients following generally accepted procedures. For example
the
selected components may be simply mixed in a blender, or other standard device
to
produce a concentrated mixture which may then be adjusted to the final
concentration
and viscosity by the addition of water or thickening agent and possibly a
buffer to
control pH or an additional solute to control tonicity. Generally the pH may
be from
10 about 3 to 7.5. Compositions can be administered in dosages and by
techniques well
known to those skilled in the medical and veterinary arts taking into
consideration
such factors as the age, sex, weight, and condition of the particular patient
or animal,
and the composition form used for administration (e.g., solid vs. liquid).
Dosages for
humans or other mammals can be determined without undue experimentation by the
15 skilled artisan, from this disclosure, the documents cited herein, the
Examples below
(e.g., from the Examples involving mice and from the applications cited
herein, e.g.,
under "Related Applications", especially since PspC can be administered in a
manner
and dose analogous to PspA).
Suitable regimes for initial administration and booster doses or for
sequential
20 administrations also are variable, may include an initial administration
followed by
subsequent administrations; but nonetheless, may be ascertained by the skilled
artisan,
from this disclosure, the documents cited herein, including applications cited
herein,
and the Examples below. The compositions can be administered alone, or can be
co-
administered or sequentially administered with other compositions of the
invention or
25 with other prophylactic or therapeutic compositions. Given that PspC is
PspA-like,
the skilled artisan can readily adjust concentrations of PspA in compositions
comprising PspA or a portion thereof to take into account the presence of PspC
or a
portion thereof in accordance with the herein teachings of compositions
comprising at
least one PspC or portion thereof and optionally at least one PspA or a
portion thereof.
The PspC antigen (PspC or a portion thereof), as well as a PspA antigen (PspA
or a portion thereof] can be expressed recombinantly, e.g., in E. coli or in
another
vector or plasmid for either in vivo expression or in vitro expression. The
methods for
CA 02328399 2000-10-20
WO 99/53940 PCTNS99/08895
26
making and/or administering a vector or recombinant or plasmid for expression
of
PspC or a portion thereof either in vivo or in vitro can be any desired
method, e.g., a
method which is by or analogous to the methods disclosed in: U.S. Patent Nos.
4,603,112, 4,769,330, 5,174,993, 5,505,941, 5,338,683, 5,494,807, 4,722,848,
WO
94/16716, WO 96/39491, Paoletti, "Applications of pox virus vectors to
vaccination:
An update," PNAS USA 93:11349-11353, October 1996, Moss, "Genetically
engineered poxviruses for recombinant gene expression, vaccination, and
safety,"
PNAS USA 93:11341-11348, October 1996, Smith et al., U.S. Patent No. 4,745,051
(recombinant baculovirus), Richardson, C.D. (Editor), Methods in Molecular
Biolo~y
39, "Baculovirus Expression Protocols" (1995 Humana Press Inc.), Smith et al.,
"Production of Huma Beta Interferon in Insect Cells Infected with a
Baculovirus
Expression Vector," Molecular and Cellular Biology, Dec., 1983, Vol. 3, No.
12, p.
2156-2165; Pennock et al., "Strong and Regulated Expression of Escherichia
coli B-
Galactosidase in Infect Cells with a Baculovirus vector," Molecular and
Cellular
Biology Mar. 1984, Vol. 4, No. 3, p. 399-406; EPA 0 370 573, U.S. application
Serial
No. 920,197, filed October 16, 1986, EP Patent publication No. 265785, U.S.
Patent
No. 4,769,331 (recombinant herpesvirus), Roizman, "The function of herpes
simplex
virus genes: A primer for genetic engineering of novel vectors," PNAS USA
93:11307-11312, October 1996, Andreansky et al., "The application of
genetically
engineered herpes simplex viruses to the treatment of experimental brain
tumors,"
PNAS USA 93:11313-11318, October 1996, Robertson et al. "Epstein-Barr virus
vectors for gene delivery to B lymphocytes," PNAS USA 93:11334-11340, October
1996, Frolov et al., "Alphavirus-based expression vectors: Strategies and
applications," PNAS USA 93:11371-11377, October 1996, Kitson et al., J. Virol.
65,
3068-3075, 1991; U.S. Patent Nos. 5,591,439, 5,552,143 (recombinant
adenovirus),
Grunhaus et al., 1992, "Adenovirus as cloning vectors," Seminars in Virology
(Vol. 3)
p. 237-52, 1993, Ballay et al. EMBO Journal, vol. 4, p. 3861-65, Graham,
Tibtech 8,
85-87, April, 1990, Prevec et al., J. Gen Virol. 70, 429-434, PCT W091/11525,
Felgner et al. (1994), J. Biol. Chem. 269, 2550-2561, Science, 259:1745-49,
1993 and
McClements et al., "Immunization with DNA vaccines encoding glycoprotein D or
glycoprotein B, alone or in combination, induces protective immunity in animal
models of herpes simplex virus-2 disease," PNAS USA 93:11414-11420, October
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
27
1996, and U.S. Patents Nos 5,591,639, 5,589,466, and 5,580,859 relating to DNA
expression vectors, inter alia. See also WO 98/33510; Ju et al., Diabetologia,
41:736-
739, 1998 (lentiviral expression system); Sanford et al., U.S. Patent No.
4,945,050
(method for transporting substances into living cells and tissues and
apparatus
therefor); Fischbach et al. (Intracel), WO 90/01543 (method for the genetic
expression
of heterologous proteins by cells transfected); Robinson et al., seminars in
IMMUNOLOGY, vol. 9, pp.271-283 (1997) (DNA vaccines); Szoka et al., U.S.
Patent No. 4,394,448 (method of inserting DNA into living cells); and
McCormick et
al., U.S. Patent No. 5,677,178 (use of cytopathic viruses for therapy and
prophylaxis
of neoplasia).
The expression product generated by vectors or recombinants in this invention
optionally can also be isolated and/or purified from infected or transfected
cells; for
instance, to prepare compositions for administration to patients. However, in
certain
instances, it may be advantageous to not isolate and/or purify an expression
product
from a cell; for instance, when the cell or portions thereof enhance the
effect of the
polypeptide.
An inventive vector or recombinant expressing PspC or a portion thereof
and/or PspA or a portion thereof can be administered in any suitable amount to
achieve expression at a suitable dosage level, e.g., a dosage level analogous
to the
aforementioned dosage levels (wherein the antigen or epitope of interest is
directly
present). The inventive vector or recombinant can be administered to a patient
or
infected or transfected into cells in an amount of about at least I03 pfu;
more
preferably about 104 pfu to about 103° pfu, e.g., about 105 pfu to
about 109 pfu, for
instance about i06 pfu to about 108 pfu. In plasmid compositions, the dosage
should
be a sufficient amount of plasmid to elicit a response analogous to
compositions
wherein PspC or a portion thereof and/or PspA or a portion thereof are
directly
present; or to have expression analogous to dosages in such compositions; or
to have
expression analogous to expression obtained in vivo by recombinant
compositions.
For instance, suitable quantities of plasmid DNA in plasmid compositions can
be 1 ug
to 100 mg, preferably 0.1 to 10 mg, e.g., 500 micrograms, but lower levels
such as 0.1
to 2 mg or preferably 1-10 ug rnay be employed. Documents cited herein
regarding
DNA plasmid vectors may be consulted for the skilled artisan to ascertain
other
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
28
suitable dosages for DNA plasmid vector compositions of the invention, without
undue experimentation.
Returning to our discussion of the examples and results presented herein, a
rabbit polyclonal serum to PspC was made by immunization with a recombinant
truncated Glade B allele. The serum reacted with both PspC and PspA from
fifteen
(15) pneumococcal isolates indicating that PspC and PspA share extensive cross-
reactive epitopes. The cross-reactive antibodies appeared to cause cross-
protection in
a mouse model system. Mice immunized with recombinant Glade B PspC were
protected against challenge with a strain that expressed PspA but not PspC. In
this
experiment, the PspA-PspC cross-reactive antibodies were directed to the
proline-rich
domain present in both molecules.
More in particular, S. pneumoniae possess a family of proteins that bind
phosphocholine (Brooks-Walter et al. 1997; Garcia et al. 1986; McDaniel et al.
1992)
present in the teichoic acid and the lipoteichoic acid of the cell membrane
and the cell
1 S wall (Tomasz 1967). The choline-binding proteins of pneumococci and other
gram-
positive organisms all contain structurally similar choline-binding domains,
which are
composed of multiple tandem amino acid repeats (Breise et al. 1985).
Autolysin,
PspA (pneumococcal surface protein A), and PcpA (pneumococcal choline-binding
protein A) of S. pneumoniae, toxins A and B of Clostridium difficile,
glucosyltransferases from Streptococcus downei and Streptococcus mutans, CspA
of
Clostridium acetobiltylicum, and PspA of Clostridium perfringens all contain
similar
regions (Sanchez-Beato et al. 1995; Banas et al. 1990; Barroso et al. 1990;
Dove et al.
1990; Garcia et al. 1986; Sanchez-Beato et al. 1998).
In PspA from S. pneumoniae, these choline-binding repeats are responsible for
the attachment of PspA to the surface of the pneumococcus (Yother et al.
1994).
PspA molecules interfere with complement activation (Briles et al. 1997), slow
clearance of pneumococci from the blood of infected mice (McDaniel et al.
1987),
and elicit protection against pneumococcal sepsis and nasal carriage (McDaniel
et al.
1991; Wu et al. 1997). A single non pspA locus has been identified which has
greater
similarity to the choline-binding and proline rich regions of pspA than any of
the other
choline-binding genes (McDaniel et al. 1992). Applicants have designated the
molecule PspC because of its strong molecular and serologic similarities to
PspA
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
29
(Brooks-Walter et al. 1997; see also applications cited under Related
Applications,
supra, note that in those applications initially PspC was called "PspA-like",
and pspC
was considered pspA-like).
Other PspA-like proteins and pspA-like loci, which could be the same as PspC
and pspC, have also been characterized and sequenced (SpsA, which reportedly
binds
secretory IgA, Hammerschmidt et al. 1997; choline-binding protein (for binding
a
moiety on eukaryotic surfaces), CbpA, Rosenow et. al. 1997; see, e.g., Figs.
8, 9, 10)..
Immunization with a crude extract of pooled non-PspA choline-binding proteins
containing CbpA elicited protection to a lethal challenge of pneumococci
introduced
intraperitoneally into mice (Rosenow et al. 1997).
In the present studies, Applicants have demonstrated that immunization with
purified PspC is able to elicit protection against sepsis, and this protection
is
apparently mediated by antibodies cross-reactive with PspA. Applicants have
also
examined the genetic diversity present within this genetic locus, herein
called pspC,
by the examination of 12 sequenced alleles. These include the previously
sequenced
alleles of cbpA and spsA, an allele from the genomic sequencing project, and
seven
newly sequenced pspC genes presented here for the first time.
The sequences of cbpA and spsA both included sequences of D39 or its
derivatives. Rosenow et al. sequenced cbpA from LM91 a pspA- mutant of D39
(Rosenow et al. 1997); and Hammerschmidt et al. sequenced spsA from an
encapsulated derivative of R36A (ATCC11733) (Hammerschmidt et al. 1997; see
also Figs. 8, 9, 10). From a comparison or these two sequences, it was
apparent that
spsA sequence contained a 480 by deletion within the gene. Because of this
discrepancy, Applicants also reported a sequence of pspC from a cloned HindIII-
EcoRI chromosomal fragment of D39 that was determined prior to the cbpA and
spsA
sequence (Brooks-Walter et al. 1997; see also applications cited under Related
Applications, supra). This sequence matched exactly that of cbpA. Other
sequences
that were used for sequence alignment comparisons included two spsA sequences
from capsular serotype 1 and 47 strains (Hammerschmidt et al. 1997), and the
pspClcbpAlspsA sequence from the capsular serotype 4 strain sequenced in the
TIGR
genome project (accessed by the Internet at http:// www.tigr.org).
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
The invention shall be further described by way of the following Examples
And Results, provided for illustration and not to be considered a limitation
of the
invention.
EXAMPLES AND RESULTS
5 Materials and methods
Bacterial strains, plasmids, and recombinant DNA techniques
Chromosomal DNA from S. pneumoniae EF6796, a serotype 6A clinical
isolate (Salser et al. 1993) and D39, a serotype 2 isolate, was isolated using
a cesium
chloride gradient procedure. The I~indIII-EcoRI fragment of EF6796 and D39 was
10 cloned in a modified pZero vector (Invitrogen, San Diego, CA) in which the
Zeocin-
resistance cassette was replaced by a kanamycin cassette, kindly provided by
Randall
Harris. Recombinant plasmids were electroporated into Escherichia coli TOPlOF'
cells [F' {lacIqTetR} mcrA (mrr-hsdRMS-mcrBC) fi301acZ M15 lac.Y74 deoR
recAl araDl39 _ (ara-leu)7697 galU galK rpsL endAl nupG] {Invitrogen). DNA
15 was purified from agarose using Gene Clean (Bio101, Inc., Vista, CA).
Chromosomal DNA used for PCR was isolated using a chloroform-isoamyl
alcohol procedure. Oligonucleotide primers, ABW13 (5'
CGACGAATAGCTGAAGAGG 3') (SEQ ID NO: ) and SKH2
(5'CATACCGTTTTCTTGTTTCCAGCC 3') (SEQ ID NO: ), were used to amplify
20 the DNA encoding the alpha helical region and the proline rich region of
pspC in 100
additional S. pneumoniae strains. These primers correspond to nucleotides 215-
235
and nucleotides 1810-1834, respectively, of the pspClEF6796 gene. PCR products
from L81905 (serotype 4), BG9163 (serotype 6B), DBL6A (serotype 6A), BG8090
(serotype 19) and E134 (serotype 23) were cloned into pGem (Promega) or Topo
TA
25 vector (Invitrogen) which utilize the A over hangs generated by Taq
polyrnerase.
Sequencing and DNA analysis
Sequencing of pspC was completed using automated DNA sequencing (ABI
377, Applied Biosystems, Inc., Foster City, CA). Sequence analyses were
performed
using the University of Wisconsin Genetics Computer Group (GCG) programs
30 (Devereux et al. 1984), MacVector 6.5 (Oxford Molecular), Sequencer 3.0
(GeneCodes, Inc.), and DNA Strider programs (Salser et al. 1993). Sequence
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
31
similarities of pspC were determined using the NCBI BLAST -coil structure
predicted
by pspC sequence was analyzed using Matcher (Fischetti et al. 1993). The
accession
number by Genbank/EMBL for the nucleotide sequence of PspC are as follows:
EF6796 -U72655, DBL6A- AF068645, D39-AF068646, E134 -AF068647, BG8090-
AF068648, L81905 - AF068649, BG9163 -AF068650, DBL6A - AF068645, D39 -
AF068646, E134 - AF068647, BG8090 - AF068648, L8I905 - AF068649, and
BG9163 - AF068650; and each of these sequences and GenBank results from the
accession numbers are hereby expressly incorporated herein by refrence (See
also
Figs. 11 and 1 S-21 ) . Preliminary sequence data was obtained from The
Institute for
Genomic Research website at http:// www.tigr.or~.
Example/Result 1: Sequence analysis of pspC gene -
aspects relating to domain structure and function:
The protein sequences of pspC, spsA, and cbpA were aligned using MacVector
6.5 (Figures 1, 2, and 13). The predicted amino acid sequences encode proteins
ranging in size from 59 to 105 kDa protein. The signal sequences of 37 amino
acids
are highly conserved (84-100% Identity). The major part of each protein is
composed
of a large alpha-helical domain (Figures 1, 2, and 13). The N-terminal 100 -
150
amino acids of this alpha-helical domain are hypervariable in both size and
sequence
and are unique for each strain sequenced of unrelated parentage (Figure 2,
D39,
SpsA2, CbpA, and Cb3P are all from a related lineage; see also Fig. 13). In
the
hypervariable regions of capsular serotype l and 4 strains, there is a unique
23 amino
acid serine-rich sequence (amino acid positions 112 to 135).
Downstream of the hypervariable region and central to the alpha-helical
domain is the first of two direct repeats. The amino acid repeats (Figures 2,
13) vary
in size in individual PspCs from 101 to 205 amino acids and are approximately
79-
89% identical at the amino acid level. Smaller-sized amino acid repeats in
some
strains differ from the larger repeats of other strains only by lack of
sequence at the
NHZ-terminal end, which accounts for their smaller size. The first repeat in
each
strain is more like the corresponding first repeat of other strains than it is
like the
second repeat of the same strain. This pattern suggests that duplication
forming this
repeat happened in an ancestral gene, prior to the diversification of pspC
into the
numerous divergent alleles seen today. These repeats are highly charged with
approximately 45% of their sequence being either lysine or glutamic acid
residues.
CA 02328399 2000-10-20
WO 99/53940 PCTNS99/08895
32
These alpha-helical repeats were present in all alleles that were examined
except for
the spsA//serotype 1 and spsA//serotype 2 (Hammerschmidt et al. 1997) (Figures
2,
13).
Between the amino acid repeats of the alpha-helical domain is a highly
conserved 40 amino acid sequence break in the coiled-coil motif which was
identified
using the Matcher program (Fischetti et al. 1993) (Figures 2, 13 and 3).
Matcher
examines the characteristic seven residue periodicity of coiled-coil proteins
arising
largely from the predominance of hydrophobic residues in the first and fourth
positions (a and d) and non-hydrophobic residues in the remaining positions
(Fischetti
et al. 1993). The coiled-coil region of the alpha-helix of PspC/EF6796 has
three
breaks in the heptad repeat motif (Figure 3). These interruptions of the
heptad motif
in the 7-residue periodicity were respectively 6, 44 and S amino acids in
length.
Similar breaks at corresponding sequence positions were found in all PspC
alleles.
In some molecules of PspC, the proline-rich region followed the second amino
acid repeat (Figures 1, 2, and I3). However, in the three larger PspC
molecules, a
region very similar to a corresponding region of the pspA genetic locus is
present.
Based on whether this pspA-like region was present or absent and on a distance-
based
cluster analysis, PspC molecules were classified into two Glades (Figure 4,
12). Clade
A molecules contained the pspA-like element and were larger in size. PspC
Glade B
molecules were smaller and lacked this pspA-like region. This pspA-like region
(alpha-helical-2) was present in PspCBG9163, EF6796 and BG7322 (Figures 1, 2,
and 13 Table 1 ) as well as in many pspA genes.
Although there is some variation within the proline-rich region of the
sequenced PspCs (Figures 1, 2, 13), the region is not distinguishable from the
proline-
rich region of PspA molecules. Within PspA molecules, two types of proline-
rich
regions have been identified. One type, which corresponds to about 60% of
PspAs,
contains a central region of 27 non-proline amino acids, which is highly
conserved.
The other type of proline-rich region in PspA lacks this conserved non-proline
region.
In the case of PspC, Glade A strains lacked the 27 amino acid non-proline-rich
block,
whereas the four Glade B PspC molecules had this conserved block. When
present,
the sequence of the 27 amino acid non-proline-rich region is highly conserved
between PspC and PspA molecules. No correlation was observed between the
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
33
expression of this conserved region within PspA and PspC molecules produced by
the
same strain. The proline-region of SpsA/serotype 1 was different from that of
all other
PspC molecules. This proline-rich region of this SpsA molecule has a truncated
proline-rich region, which contains the 27 amino acid non-proline break but
lacks the
NHZ end of the proline-rich region.
The choline-binding repeat domains of PspC, CbpA and SpsA proteins each
contain between 4 and 11 repeats of about 20 amino acids (Figure S). The
repeats
found in the center of the choline-binding domain were closest to the
consensus
sequence, while repeats on the NH2-terminal and COOH-terminal ends of the
block
were more distant from the consensus sequence. The arrangement of repeats over
the entire choline-binding region in PspC was examined relative to the
arrangement
of similar repeats in the choline-binding region of five PspC and three PspA
genes
for which the entire choline-binding domain was sequenced.
The following findings all suggested a very close relationship between PspA
and
PspC in the choline-binding region of the molecule: 1) the NHz-terminal
divergent
repeat is identical between the paralogous proteins (PspA and PspC); 2)
similarly, the
COOH-terminal divergent repeats are very similar between PspC and PspA (see
repeats 10 and 11 of PspC consensus and repeats 9 and 10 of PspA consensus -
Figure 5), yet these repeats are highly diverged from the rest of the repeat
block; 3)
the conserved central repeats of the choline-binding domain in each case have
a single
amino acid at position 6 which is frequently asparagine in PspC, but usually
tyrosine
in PspA proteins. Other than position 6, the consensus repeat for both genes
is
identical; 4) Divergence of individual amino acids within the 20 amino acid
repeat
from the repeat consensus sequence was identical between PspA and PspC
(position
number 4,6,9,12,13,15,16, and 18); and 5) The repeat blocks are followed by a
17
amino acid partially hydrophobic "tail" that is nearly identical for PspC or
PspA
except for an additional asparagine present at the end of the PspC proteins
that is
missing from PspA proteins. Overall, the choline-binding domains of PspA and
PspC
are so similar that it would not be possible to determine with certainty
whether any
particular choline-binding domain from these two proteins belongs to PspA or
PspC
without knowledge of its flanking DNA.
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
34
Example/Result 2: Ph~genetic Anal sis:
The pspA and pspC genes are paralogs of each other because they are both
present in the genome of most pneumococci, and because they share high
identity in
the sequence encoding their COOH-terminal halves (Table 1 ). An alignment of
the
12 PspC/CbpA/SpsA sequences was constructed using the Clustal W algorithm
(Figures 2, 13). An uprooted phylogram was produced with PAUP 4.OB with the
neighbor joining method from the mean amino acid distances as calculated over
this
alignment (Figures 4, 12). The figure as shown incorporates both distance
measurements along the branch lengths and bootstrap analysis of 1000
repetitions.
Branch length between molecules is proportional to the similarity of the
sequences.
The tree represents the evolutionary hypothesis that PspC molecules arose in
two
main clusters representing Glades A and B. One Glade, A, consisted of the
larger PspC
molecules, and contained strong identity in alpha-helical region-2 with some
pspA
alleles. The second Glade, B, did not contain this region of identity with
pspA alpha-
helical region pspAs.
Example/Result 3: Analysis of pspC using PCR:
PCR was used to amplify pspC from different strains of S. pneumoniae to
permit studies of the variability of PspC. Two oligonucleotides which
recognized the
common sequence regions of pspC, but which did not amplify the pspA genes,
were
designed in an effort to permit specific amplification of pspC alleles from
all
pneumococcal strains. Oligonucleotide ABW13 is specific to DNA upstream of the
promoter sequence of the pspC gene locus. Oligonucleotide SKH2 is specific to
the
DNA encoding the C-terminal end of the proline-rich region of both the pspA
and
pspC gene loci. These oligonucleotides were used to amplify fragments of pspC
from
100 S. pneumoniae strains. Seventy-eight of the 100 strains produced PCR-
generated
fragments, which varied from 1.5 kb to 2.2 kb in size. The remaining 22
strains failed
to produce a PCR product. Based on the strains of known sequence it was
observed
that the size of the amplified products correlated with whether they were
Glade A or
Glade B. Because of the absence of thispspA-conserved region, the Glade B pspC
sequences were smaller than the Glade A pspC. The amplified product using
oligonucleotide ABW13 and SKH2 of Glade A molecules was 2.0 kb or greater. The
amplified fragment of Glade B molecules was approximately 1.6 kb.
Approximately
CA 02328399 2000-10-20
WO 99/53940 PCTNS99/08895
4% of the 75 strains from which a pspC gene was amplified were found to be
Glade A
by this criterion and 96% were Glade B.
Example/Result 4: Cloning and expression of a recombinant truncated PspC
molecules:
5 Oligonucleotides were used to amplify a 1.2 kb fragment of L81905, which
encodes amino acids 263-482 of the alpha-helix and proline-rich region of
PspC. The
amplified PCR fragment was cloned into pQE40 (Qiagen, Chatsworth, CA ) which
allows expression of a fusion product with a polyhistidine tag at the amino-
terminal
end, followed by dihyrofolate reductase (DHFR), and then by the fragment of
10 PspC/L81905 (263-482). Expression of the fusion protein in Escherichia coli
strain
BL21(DE3) was induced during growth at room temperature by the addition of 1
mM
isopropyl-b-d-thiogalactopyranoside (IPTG). The overexpressed fusion protein
was
purified by aff nity chromatography under non-denaturing conditions over a
nickel
resin according to the manufacturer's protocols. Purified fusion protein was
then
15 analyzed by SDS-PAGE and quantitated using a BiolRad Protein Assay
(Hercules,
CA). Two fragments of PspC/D39 (AA 1-445 and AA 255-445), and three fragment
of PspA/Rxl {AA 1-301, AA 1-314 and AA 1-370) were expressed as fusion
proteins
with 6X His tag in the pET20b expression system {Novagen, Madison, WI). In
this
case, the overexpressed fusion proteins contain a PeIB leader peptide,
followed by the
20 PspC or PspA fragments and the His tag at the carboxy-terminus. Expression
was
induced for pET20b-based constructs with 0.4mM IPTG in the expression strain
BL21(DE3), and purified according the manufacturer's protocol.
Example/Result 5: Production of a nolyclonal antiserum SDS-PAGE, and
immunoblots:
25 The truncated product (AA 263 to 482) of PspC/L81905 was purified by metal
affinity chromatography and used to immunize a rabbit. Approximately 4 ~,g of
purified PspC from L81905 was injected two times subcutaneously into a rabbit
twice
on consecutive weeks and blood was collected 10 days after the last inj
ection. The
primary immunization was with Freund's complete adjuvant and the booster
30 immunization was given in saline. Polyclonal rabbit antiserum was diluted
1:50 and
used to analyze pneumococcal lysates on a 7.5% SDS-PAGE gel (BioRad, Hercules,
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
36
CA). Pneumococcal lysates and immunoblots were performed as described by
Yother
et al. 1994.
Example/Result 6: Cross-reactivity of antisera made to
PspC/L81905 with PspA and other PspC molecules:
A truncated product (AA 263-482) of the PspC/L81905 Glade B pspC protein
was expressed in E. coli using the Qiagen Expression system. It should be
noted that
PspC/L81905 is Glade B and lacks the pspA-like region region in its alpha-
helix. The
truncated (AA263-482) Glade B PspC protein was purified by metal affinity
chromatography and used to immunize a rabbit to generate a polyclonal
antiserum to
PspC. Pneumococcal lysates were separated on SDS-polyacrylamide gels and
blotted
to nitrocellulose. The blots were developed either with Xi126, a monoclonal
antibody
to PspA, or with the anti-PspC rabbit polyclonal antiserum. The reactivity of
the PspC
antiserum with selected pneumococcal lysates run in a Western immunoblot is
shown
in Figure 6.
The reactivity pattern of the antiserum to PspC was deciphered in part using
lysates from S. pneumoniae strains JY1119 and JY53. These strains are
derivatives of
the pneumococcal strains WU2 and D39, respectively, in which the pspA genes
have
been insertionally inactivated (Yother et al 1992). From the Western blot, it
is
apparent that the polyclonal serum reacts with a 90 kDa band in JY53 even
though the
pspA gene has been inactivated in this strain. This band is assumed to
represent PspC.
Both JY1119 and its parent, WU2, lack the pspC gene altogether (McDaniel et
al.
1992). An 85 kDa molecule from WU2 reacts with the anti-PspC antiserum and
with
the anti-PspA MAb. This band is not present in JY1119, which contains an
insertionally inactivated PspA.
The rabbit antiserum was reactive with proteins in the lysates from all
pneumococcal strains tested. The relative molecular weights of the proteins
detected
also made it apparent that the antiserum was reacting with both PspA and PspC
molecules. To distinguish cross-reactivity with the PspA molecule from direct
reactivity with the PspC molecule in untested strain lysates a second
identical Western
blot was developed with a monoclonal antibody specific to PspA molecules
(Figure 6,
part B). PspC bands could be identified through the comparison of banding
patterns
in parts A and B of Figure 6. The bands reactive the anti-PspC rabbit
antiserum but
not with the anti-PspA MAb were identified as PspC. Bands stained by the
rabbit
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
37
antiserum that co-migrate with those also stained by the MAb were PspA
molecules
that cross-reacted with the antiserum to PspC. Besides failing to react with
the Mab,
it was also noted that PspC bands were of higher molecular weight than the
PspA
bands. By these criteria the anti-PspC serum cross-reacted with PspA in all
strains
tested except A66. For A66, a single band was detected. Further testing
determined
this band to be PspA-derived, rather than PspC-derived. In this case, A66
lacked a
pspC gene and the PspA of A66 was not reactive with the MAb used, Xi126, even
though anti-PspA immune sera does detect PspA in this strain. From the above
patterns of reactivity, it was concluded that the PspC polyclonal antiserum is
cross-
reacting specifically with the PspA molecule.
Example/Result 7: Immunization and challenge studies:
CBA/N mice were immunized with purified recombinant PspC proteins
originating from strain L81905 (AA 263-482), the full alpha-helical region of
PspC in
strain D39 (AA 1-445), or a truncated portion of the PspC protein in strain
D39 (AA
255-445). Each mouse received only one of the above recombinant proteins and
groups of 5-6 mice were immunized in each experiment. The mice were immunized
subcutaneously with approximately 1 ~g of purified protein emulsified in 0.2
ml of
complete Freund's adjuvant. Three weeks later they were boosted with 1 ltg of
purified protein in saline. Three weeks after the boost, the mice were
challenged with
approximately 700 colony-forming units (CFU) of pneumococcal strain WU2.
Control mice were immunized with buffer and complete Freund's adjuvant without
PspC.
Analysis of Immune Sera: Mice were bled retroorbitally 24 hours before
challenge. The blood was collected into .5 ml 1 % BSA/phosphate buffered
saline.
Samples were centrifuged for 1 min (2000 rpm) and the supernatant was
collected and
stored at -20°C until used in direct ELISAs (enzyme-linked
immunosorbent assays).
Microtiter 96 well plates (Nunc, Weisbaden, Germany) were coated overnight a
4°C
with .5 p.g of expressed protein which included PspC (AA 1-445) and PspA
(UAB55-
AA 1-301, UAB15- AA 1-314 and UAB103- AA 1-370). Plates were blocked with
1% bovine serum albumin/phosphate buffered saline (PBS) followed by incubation
with immune sera for 3 hour at 37°C. Plates were washed with PBS/DAKO
with
.15% tween and incubated with goat anti-mouse immunoglobulin biotin-conjugated
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
38
antiserum and streptavidin alkaline phosphatase (Southern Biotechnology
Assoc.,
Birmingham AL). They were developed with p-nitrophenyl phosphate (Sigma, St.
Louis, MO). The log reciprocal titer giving 33% maximum binding to the mouse
immune sera was determined to evaluate the reactivity.
Ability of PspC to elicit protective immunity in mice: Mice were immunized
with one of three purified fragments of Glade B PspC: L81905 (AA 263-482), D39
(AA 1-445) and D39 (AA 255-445). None of these immunogens contained the pspA-
like alpha-helical region 2 noted earlier, but all of the immunogens contained
the
proline-rich region. Mice immunized with PspC and control mice then immunized
with adjuvant only were challenged with WU2 or BG7322. WU2 is a capsular
serotype 3 strain that produces no detectable PspC and does not contain the
structural
gene for pspC (Figure 6). BG7322 is a capsular serotype 6B strain and contains
a
Glade A PspC molecule. Significant protection against death was seen with both
challenge strains in mice immunized with the three different PspC Glade B
molecules
(Table 2). Protective immunity in mice challenged with WU2 must derive from
the
ability of the PspC immunogen to elicit immunity (presumably mediated by
antibodies) in the mice that cross-reacts with the PspA molecule present on
surface of
strain WU2 because this strain lacks PspC. The ability of PspC to elicit
immunity that
is directed against PspA was expected from the data herein since PspC had been
shown to elicit antibodies cross-reactive with PspA (Figure 6). Protection of
the mice
challenged with BG7322 was statistically significant even though only 62% of
the
mice were protected as opposed to 96% when challenged with WU2.
Example/Result 8: Antibody Elicited to Recombinant PspC:
For this study sera was used from mice immunized with LXS240, which
encoded amino acids 255-445 of Glade B PspC/D39. This sequence contains the
entire proline-rich region of PspC/D39. Direct binding ELISAs were conducted
to
localize the epitope yielding the cross-reactivity with PspA. Microtiter 96
well plates
were coated with fragments of PspC/D39 and PspAlRxl. Each of the cloned
PspAlRx 1 molecules used in these assays expressed the PspA alpha-helical
region
and differed only in the number of the amino acids it contained in the proline-
rich
region. UAB55 contained 15 amino acids in the proline-rich region, UAB15
contained 26 amino acids in the proline-rich region, and UAB 103 contained the
entire
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
39
proline-rich region. The results from the ELISA are depicted in Figure 7.
Mouse
antisera only reacted with the PspAlRxl molecules containing the entire
proline-rich
region. The antisera did not react with the PspA molecules UAB55 and UAB 15
that
contained truncated proline regions. These results strongly suggest that the
antibodies
elicited by PspC that cross-protect against PspA are probably directed at the
proline-
rich regions of these molecules. Accordingly, the invention comprehends a
method
for eliciting anti-PspA antibodies comprising administering PspC or an
epitopic
region thereof or a polypeptide comprising an epitope of PspC.
Example/Result 9: Modular evolution and chimeric structure of pspC:
PspC is a chimeric protein, which has acquired domains from both interspecies
and intraspecies genetic exchanges. The protein contains a signal sequence has
75%
nucleotide identity to the bac gene from group B streptococci (accession
numbers
X59771 and X58470) (Hammerschmidt et al. 1997). The bac gene encodes the b
antigen of Group B streptococci, a cell surface receptor that binds the
constant region
of human IgA. This similar sequence in the signal peptide region suggests that
potential interspecies genetic exchange between group B streptococci and S.
pneumoniae may have formed a chimeric locus including the bac regulatory
region
and a partial pspA or a pspA-like locus to create an ancestral gene for pspC.
The
origin of the central region specific to the current pspC genes is unknown.
The direct
amino acid repeats of the alpha-helix suggest that this region of PspC has
evolved by
a domain duplication event. This internal duplication of a portion of the
alpha-helix
led to gene elongation. The region of the alpha-helix is presumably the
functional
region of the molecule and reportedly binds SIgA (Hammerschmidt et al. 1997).
Further intraspecies variation events are hinted at in the finding that 4% of
PspC
proteins are of Glade A. This Glade appears to have derived from a
recombination
event with PspA (or visa versa) providing further evidence of chimeric
structure of
PspC and possibly PspA molecules.
Several functions have been attributed to the PspC molecule. In addition to
binding secretory IgA and a moiety on the surface of epithelial cells,
Hoistetter et al.
have reported that PspC binds the complement component C3 (Hostetter et al.
1997).
Recent studies have shown that PspA inhibits complement activation by
inhibiting the
formation of the C3 convertase. With the similar structural domains of PspA
and
37
antiserum that co-migrate with
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
PspC, it is conceivable that the virulence properties of the two proteins may
complement each other in the host. WU2 is a strain of S. pneumoniae that does
not
contain a structural gene for PspC. When mutants of PspA are produced in WU2
that
lacks PspC there is a 10,000-fold decrease in virulence (Briles et al. 1997).
When
5 PspA is mutated in D39, a strain that contains both PspA and PspC, there is
only a 10-
fold decrease in virulence (Briles et al. 1997). From the data herein, PspA
and PspC
may complement each other in their abilities to block the clearance of
pneumococci
by interfering with the complement pathway (see also the preliminary data of
Hostetter et al. 1997 and the data of Briles et al. 1997).
10 Rosenow et al. demonstrated that CbpA is expressed more strongly by
pneumococci in the nasopharynx than by pneumococci in the blood (Rosenow et
al.
1997). Thus, it is feasible that the two molecules may serve the same general
function, possibly in different host tissues and in different stages of
infection.
Furthermore, either molecule may be more critical to virulence in the absence
of the
I S other. This hypothesis is further strengthened by data from ongoing
studies that show
that mutants lacking in both PspC and PspA are significantly decreased in
virulence.
In PspC immunization studies, Applicants challenged mice with a strain
expressing both PspC and PspA and a strain expressing PspA but not PspC. By
including strains lacking the pspC gene Applicants could determine if
protection
20 elicited by PspC required the expression of PspC or might act, at least in
part, through
cross-reactions with PspA. For the study presented, mice were immunized with
Glade
B PspC. This molecule lacks the PspA-PspC homology region near the C-terminal
end of the alpha-helical region of PspC. Thus, this immunogen was expected to
be
one that would give less cross-reaction With PspA than would a Glade A PspC.
Even
25 so, immunization with PspC/D39 resulted in protection when mice were
challenged
with either strain BG7322 that expresses both PspA and PspC, or with strain
WLT2,
which expresses PspA but lacks PspC.
The protection-eliciting PspC immunogen contained the entire proline-rich
region. The alpha-helical regions of PspA/WU2 and PspC/D39 have essentially no
30 homology. However, the proline-rich region of PspC is repetitive and
homologous
with PspA. It was possible that antibody to this region was responsible for
the cross-
protection we have observed. This hypothesis was supported by the observation
that
CA 02328399 2000-10-20
WO 99/53940 PCTNS99/08895
41
antibody elicited to PspC reacted with PspA fragments that contained the
proline-rich
region but not with those that lacked the proline-rich region in direct
ELISAs.
Antibodies elicited by PspC also cross-reacted with PspA on Western blots. The
likelihood that the protective cross-reaction of PspC immune sera is mediated
through
PspA was further strengthened by the sequence data released by TIGR (accessed
by
the Internet at http:// www.tigr or~~. Extensive searches of the largely
completed
genome failed to find other pneumococcal gene sequences with as high a
similarity
with the PspC sequence domains as the proline-rich region of PspA.
Electron microscopy surface labeling studies, and epitope mapping studies
have localized PspA on the surface of pneumococci with the largely exposed
alpha-
helical region (Gray, Pneumococcal infection, in Bacterial Infection, P.E.
Brachman,
Ed. 1997, Plenum Pub. Corp. NY; McDaniel et al. 1994; McDaniel et al,
Monoclonal
antibodies against surface components of Streptococcus pneumoniae, in
Monoclonal
antibodies against bacteria, A.J.L. Macario and E.C. de Macario, Eds. 1986,
1 S Academic Press, Inc. Orlando). Studies by Yother and White have shown that
PspA
is attached by the C-terminal end to lipoteichoic acids (Yother et al. 1994).
No
information has been available however, about whether or not the proline-rich
domain
is surface exposed. Results from these experiments indicating that antibodies
to the
proline-rich domain are protective suggest that this domain of PspA is
probably
accessible on the surface of the pneumococci. This study also provides the
first
published evidence that antibodies reactive with the proline-rich region of
PspA can
be protective against pneumococcal infection.
PspA, PspC/CbpA/SpsA, LytA and PcpA are proteins of S. pneumoniae
that contain choline-binding domains. The choline-binding domains of
PspC/CbpA/SpsA contain between 4 and 11 repeats of about 20 amino acids. The
consensus sequences of these repeats are from 90 to 95% identical. The middle
region of the choline-binding domain of PspA and PspC is conserved. The first
and last two repeats of PspA and PspC differ substantially (by 40 to 65%) from
the
consensus sequence. Even so, PspA and PspC sequences in these areas generally
have the same deviations from the consensus sequence and in most cases are
within
95% identical. The choline-binding domains of LytA and PcpA are quite
different
from that of PspA or PspC (42-62% identity) (Garcia et al. 1986; Sanchez-Beato
et
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
42
al. 1998). Whereas PspA and PspC have most likely evolved by gene duplication,
PcpA has probably arisen from horizontal gene transfer. The choline-binding
regions of these proteins all support a modular form of evolution of this
group of
proteins.
This disclosure provides a comprehensive study of the sequence of pspC and
shows that PspCs can be divided into two Glades based on the sequences in
their
alpha-helical and proline-rich domains. The disclosure also demonstrates that
immunity to the proline-rich domain of PspC can be protective through its
recognition
of the proline-rich domain of the PspA molecule. The fact that the N-terminal
alpha-
helical domain of PspC is different from the alpha-helical domain of PspA
suggests
that PspC and PspA may serve somewhat distinct roles in virulence. However,
the
fact that the two molecules have a very similar domain structure and have
similarity in
much of their sequences raises the possibility that these two molecules may
have
similar functions. Although there are sequences of a few pspC alleles, this is
the first
report that the PspC family contains two Glades and that the PspC molecules
that
contain homology to PspA within the cross-protective region of the alpha-
helix. The
identification of two Glades of PspC is pertinent to PspC-containing vaccine,
immunological or immunogenic compositions, as well as to methods for
identifying
PspA, pspA, PspC, pspC, and/or S. pneumoniae. Moreover, the observation that
antibodies to the proline-rich regions of PspA and PspC can be cross-
protective
facilitates the design of more efficacious vaccines, as well as of alternate
vaccines,
immunogenic or immunological compositions, e.g., by providing epitopic regions
of
PspC, epitopes of PspC and nucleic acid molecules encoding the same, and
methods
for identifying PspA, pspA, PspC, pspC, and/or S. pneumoniae.
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
43
Table 1. Conservation of PspC domains shown as percent amino acid identities.
Clade A Clade B
PspC Domain PspC vs. PspC PspC vs. PspA PspC vs. PspA PspA vs. PspA
OrthologousParalogous paralogous orthologous
Upstream >97% No alignmentno alignment>95%
through signal possible possible
peptide
Whole gene 67.6-99% 14-29% 14-21 % 22-79%
Alpha-helical 66.9-99.6% 11.8-22.0% 14.8-23.1 not present
1 %
Alpha-helical 100% 13.1-88.7% not present14-99%
2
Proline-rich* High** high high high
Choline- 87% 77% 79.1-99% 77-98%
binding
17 AA tail 100% 88.9% 88.9-94.4% 98-100%
3' downstream 99% No alignmentno alignmentN.D.
possible possible
Percentages calculated using a distance matrix from Paup 3Ø
* All PspA and PspC molecules have a repetitive segment of protein in this
region
with the motif PEPK or PAPAP. Clade B PspC molecules have a conserved non-
repetitive break in the proline-rich region. Distance ranges are uninformative
because
it is not possible to align these sequences in a meaningful way.
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
44
Table 2. Cross-Protection of CBA/N Mice immunized with Recombinant PspC
Immunogen immunized2non- p value 1
immunized2
PspC Capsular Challenge # of mice # of mice
strain
fragmentSqrotype and Capsular alive/dead3alive/dead3
of PspC Serotype
donor
L81905 4 WU2 (3) 13/0 1/12 <.0001
(AA 263-
248)
D39 (AA 2 WU2 (3) S/0 0/5 .008
1-445)
D39 (Aa 2 WU2 (3) 4/1 0/5 .048
255-445)
D39 (AA 2 BG7322 {6B) 13/8 1/19 .0002
255-445)
1 The statistical difference between immunized and non-immunized was
calculated using the Fisher exact test.
2 Mice were either immunized with PspC with complete Freund's adjuvant or
with adjuvant and buffer but no antigen.
3 Mice were challenged 21 days post immunization with 700 CFU of WU2 or
2000 CFU of BG7322 injected i.v. in 0.2 Ringer's injection solution.
***
Having thus described in detail preferred embodiments of the present
invention, it is to be understood that the invention defined by the appended
claims is
not to be limited to particular details set forth in the above description as
many
CA 02328399 2000-10-20
WO 99/53940 PCTNS99/08895
apparent variations thereof are possible without departing from the spirit or
scope of
the present invention.
CA 02328399 2000-10-20
WO 99/53940 PCTNS99/08895
46
References
1. Hammerschmidt, S., et al., SpsA, a novel pneumococcal surface protein with
specific binding to secretory immunoglobulin A and secretory component. Mol.
Microbiol., 1997. 25: p. 1113-1124.
2. Rosenow, C., et al., Contribution of novel choline-binding proteins to
adherance, colonization and immunogenicity of Streptococcus pneumoniae. Mol.
Microbiol., 1997. 25: p. 819-829.
3. Brooks-Walter, A., et al., The pspCgene encodes a second pneumococcal
surface protein homologous to the gene encoding the protection-elicting PspA
protein
of Streptococcus pneumoniae. ASM Anunal Meeting (Abstract), 1997.
4. Tomasz, A., Choline in the cell wall of a bacterium: novel type ofpolymer-
linked choline in pneumococcus. Science, 1967. 57: p. 694-697.
5. Breise, T. and R. Hackenbeck, Interactions of pneumococcal amidase with
lipoteichoic acid and choline. Eur. J. Biochem., 1985. 146: p. 417-427.
6. Sanchez-Beato, A. and J. Garcia, Molecular characterization of a family of
choline-binding proteins of Costridium acetobutylicum NCIB8052 Accession
number
250008. 1995.
7. Banas, J.A., R.R.B. Russell, and J.J. Ferretti, Sequence analysis of the
gene for
the glucan-binding protein of Streptococcus mutans Ingbritt. 1990.
8. Barroso, L.A., et al., Nucleotide sequence of Clostridium difficile toxin B
gene.
Nuc. Acids Res., 1990. 18: p. 4004.
9. Dove, C.H., et al., Molecular characterization of the Clostridium di~cile
toxin A gene. Infect. Immun., 1990. 58: p. 480-488.
10. Garcia, P., et al., Nucleotide sequence and expression of the pneumococcal
autolysin gene from its own promoter in Escherichia coli. Gene, 1986. 43: p.
265-272.
11. Sanchez-Beato, A.R., R. Lopez, and J.L. Garcia, Molecular characterization
of PcpA: a novel choline-binding protein of Streptococcus pneumoniae. FEMS
Microbiol. Lett., 1998. 164(1): p. 207-214.
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
47
12. Yother, J. and J.M. White, Novel surface attachment mechanism for the
Streptococcus pneumoniae protein PspA. J. Bact., 1994. 176: p. 2976-2985.
13. Briles, D.E., et al., PspA and PspC: their potential for use as
pneumococcal
vaccines. Microb. Drug Resist., 1997. 3: p. 401-408.
14. McDaniel, L.S., et al., Use of insertional inactivation to facilitate
studies of
biological properties of pneumococcal surface protein A (PspA). J. Exp. Med.,
1987.
165: p. 381-394.
15. McDaniel, L.S., et al., PspA, a surface protein of Streptococcus
pneumoniae,
is capable of eliciting protection against pneumococci of more than one
capsular
type. Infect. Immun., 1991. 59: p. 222-228.
16. Wu, H.-Y., et al., Intranasal immunization of mice with PspA (pneumococcal
surface protein A) can prevent intranasal carriage and infection with
Streptococcus
pneumoniae. J. Infect. Dis., 1997. 175: p. 893-846.
17. McDaniel, L.S., et al., Molecular localization of variable and conserved
regions of pspA,and identification of additional pspA homologous sequences in
Streptococcus pneumoniae. Microb. Pathog., 1992. 13: p. 261-269.
18. Fischetti, V.A., et al., Identifying periodic occurances of a template
with
applications to protein structure. Inform. Proc. Letters, 1993: p. 11-18.
19. Yother, J., G.L. Handsome, and D.E. Briles, Truncated forms ofPspA that
are
secreted from Streptococcus pneumoniae and their use in functional studies and
cloning of the pspA gene. J. Bact., 1992. 174: p. 610-618.
20. Hostetter, M.K., Q. Cheng, and D.A. Finkel, C3-binding protein (pbcA) in
Steptococcus pneumoniae: Accession number AF067128. ASM Meeting Miami
Beach, Florida 1997, 1997.
21. Gray, B.M., Pneumoccal infection, in Bacterial Infection, P.E. Brachman,
Editor. 1997, Plenum Publishing Corporation: New York.
22. McDaniel, L.S., et al., Localization ofprotection-eliciting epitopes on
PspA of
Streptococcus pneumoniae between amino acid residues 192 and 260. Microb.
Pathog., 1994. 17: p. 323-337.
CA 02328399 2000-10-20
WO 99153940 PCTJUS99/08895
48
23. McDaniel, L.S. and D.E. Briles, Monoclonal antibodies against surface
components of Streptococcus pneumoniae, in Monclonal antibodies against
bacteria,
A.J.L. Macario and E.C. de Macario, Editors. 1986, Academic Press, Inc.:
Orlando. p.
143.
24. Devereux, J., P. Haeberli, and O. Smithies, A comprehensive set of
sequence
analysis programs for the VAX. Nuc. Acids Res., 1984. 12: p. 387-395.
25. Salser, W., et al., DNA sequence assembly and editing products which
permits
direct visualization of raw data traces from automated (fluorescent)
sequencing data.
J. NIH Res., 1993(5): p. 81-82.
26. Tart, RC, LS McDaniel, BA Ralph, DE Briles. Truncated Streptococcus
pneumoniae PspA molecules elicit cross-protective immunity against
pneumococcal
challenge in mice. J. Infect. Dis. 173: 380-393, 1996.
27. Briles DE, JD King, MA Gray, LS McDaniel, E Swiatlo, KA Benton. PspA, a
protection-eliciting pneumococcal protein: Immunogenicity of isolated native
PspA in
mice. Vaccine. 14: 858-67. 1996.
28. Crain MJ, JS Scott, DA Robinson, TJ Coffey, A Brooks-Walter, LS
McDaniel, DE Briles. Evidence for the simultaneous expression of two PspAs by
a
clone of capsular serotype 6B Streptococcus nneumoniae. Microbiol. Patho. 21:
265-
275. 1996.
29. Yamamoto M, LS McDaniel, K Kawabata, DE Briles, RJ Jackson, JR
McGhee, H Kiyono. Oral immunization with PspA elicits protective humoral
immunity against Streptococcus pneumoniae infection. Infect. Immun. 56:640-
644,1997.
30. Hong-Yin Wu, Moon Nahm, Y. Guo, Michael W. Russell, and David E. Briles
Intranasal immunization of mice with PspA (Pneumococcal surface protein A) can
prevent carnage, and infection with Streptococcus pneumoniae. J. Infect. Dis.
In
Press, 1997.
31. Swiatlo E, A Brooks-Walter, DE Briles, LS McDaniel. Oligonucleotides
identify conserved and variable regions of pspA and pspA-like sequences of
Streptococcus pneumoniae. Gene 188(2), 279-284, 1997.
32. McDaniel LS, F Loechel, C Benedict, T Greenway DE Briles, RM Conry, DT
Curiel. Immunization with a plasmid expressing Pneumococcal Surface Protein A
CA 02328399 2000-10-20
WO 99/53940 PCTNS99/08895
49
(PspA) can elicit protection against fatal infection with Streptococcus
pneumoniae.
Gene Therapy 4(4):375-377, 1997.
33. Wortham C, L Grinberg, DC Kaslow, DE Briles, LS McDaniel, A Lees, M
Flora, CM Snapper, JJ Mond. Enhanced protective antibody responses to PspA
after
intranasal or subcutaneous injection of PspA genetically fused to granulocyte-
macrophage colony-stimulating factor or interlukin-2. Infect. Immun. 66:1513-
1520.
1998.
34. Nayak AR, SA Tinge, RC Tart, LS McDaniel, DE Briles, R Curtiss III. A live
recombinant avirulent oral Salmonella vaccine expressing pneumococcal surface
protein A (PspA) induced protective responses against Streptococcus
pneumoniae.
Infect. Immun. 66:3744-3751. 1998.
35. McDaniel LS, DO McDaniel, SK Hollingshead, DE Briles. Comparison of the
PspA sequence from Streptococcus pneumoniae EF5668 to the previously
identified
PspA sequence from strain Rx 1 and the ability of PspA from EF5668 to elicit
protection against pneumococci of different capsular types. Infect. Immun.
66:4748-
4754, 1998.
36. Yamamoto M, DE Briles, S Yamamoto, M Ohmura, H Kiyono, JR McGhee.
A non-toxic adjuvant of mucosal immunity to pneumococcal surface protein A. J.
Immunol. 161: 4115-4121. 1998.
37. Abstracts of 89th Annual Meeting of the American Society for Microbiology,
p. 125, item D-257, May 1989.
38. Abstracts of 90th Annual Meeting of the American Society for Microbiology,
p. 98, item D-106, May 1990.
39. Abstracts of 3rd International ASM Conference on Streptococcal Genetics,
p.
11, item 12, June 1990.
40. Talkington et al, Infect. Immun. 59:1285-1289,
1991.
41. Yother et al., J. Bacteriol. 174:601-609,
1992.
42. McDaniel et al., J. Exp. Med. 160:386-397,
1984.
43. McDaniel et al., Microbial Pathogenesis
1:519-531, 1986.
44. McDaniel et al., J. Exp. Med. 165:381-394,
1987.
45. Crain et al, Infect.Immun., 56:3293-3299,
1990.
46. Ralph, B.A., et al., Ann. N.Y. Acad. Sci.
1994; 730: 361-363.
CA 02328399 2000-10-20
WO 99/53940 PCT/US99/08895
47. Alonso DeVelasco, E., et al., Microbiological Rev. 1995; 59: 591-603.
