Note: Descriptions are shown in the official language in which they were submitted.
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
HUMAN COMPLEMENT C3-DEGRADING POLYPEPTIDE
FROM STREPTOCOCCUS PNEUMONIAE
Meld of the Invention
This invention relates to Streptococcus pneumoniae and in particular this
invention relates to the identification of an S. pneumoniae polypeptide that
is
capable of degrading human complement protein C3.
~jtground of the Invention
Respiratory infection with the bacterium Streptococcus pneumoniae (S
pneumoniae) leads to an estimated 500,000 cases of pneumonia and 47,000
deaths annually. Those persons at highest risk of bacteremic pneumococcal
infection are infants under two years of age, individuals with a compromised
immune system and the elderly. In these populations, S. pneumoniae is the
leading cause of bacterial pneumonia and meningitis. Moreover, S. pneumoniae
is the major bacterial cause of ear infections in children of all ages. Both
children and the elderly share defects in the synthesis of protective
antibodies to
pneumococcal capsular polysaccharide after either bacterial colonization,
local
or systemic infection, or vaccination with purified polysaccharides. S
pneumoniae is the leading cause of invasive bacterial respiratory disease in
both
adults and children with HIV infection and produces hematogenous infection in
these patients (Connor et al. Current Topics in AIDS 1987;1:185-209 and Janoff
et al. Ann. Intern. Med. 1992;117(4):314-324).
Individuals who demonstrate the greatest risk for severe infection are not
able to make antibodies to the current capsular polysaccharide vaccines. As a
result, there are now four conjugate vaccines in clinical trial. Conjugate
vaccines consist of pneumococcal capsular polysaccharides coupled to protein
carriers or adjuvants in an attempt to boost the antibody response. However,
t'iere are other potential problems with conjugate vaccines currently in
clinical
trials. For example, pneumococcal serotypes that are most prevalent it a'r~e
United States are differP~.: fiom the serotypes thw a,e most cc~° _.mon
in places
... . .,b. ...,
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
2
such as Israel, Western Europe, South Africa, or Scandinavia. Therefore,
vaccines that may be useful in one geographic locale may not be useful in
another. The potential need to modify currently available capsular
polysaccharide vaccines or to develop protein conjugates for capsular vaccines
to suit geographic serotype variability entails prohibitive financial and
technical
complications. Thus, the search for immunogenic, surface-exposed proteins that
are conserved worldwide among a variety of virulent serotypes is of prime
importance to the prevention of pneumococcal infection and to the formulation
of broadly protective pneumococcal vaccines. Moreover, the emergence of
penicillin and cephalosporin-resistant pneumococci on a worldwide basis makes
the need for effective vaccines even more exigent (Baquero et al. J.
Antimicrob.
Chemother. 1991;28S;31-8).
Several pneumococcal proteins have been proposed for conjugation to
pneumococcal capsular polysaccharide or as single immunogens to stimulate
1 S immunity against S. pneumoniae. Surface proteins that are reported to be
involved in adhesion of S pneumoniae to epithelial cells of the respiratory
tract
include PsaA, PspC/CBP112, and IgAI proteinase (Sampson et al. Infect.
Immun. 1994;62:319-324, Sheffield et al. Microb. Pathogen. 1992; 13: 261-9,
and Wani, et al. Infect. Immun. 1996; 64:3967-3974). Antibodies to these
adhesins could inhibit binding of pneumococci to respiratory epithelial cells
and
thereby reduce colonization. Other cytosolic pneumococcal proteins such as
pneumolysin, autolysin, neuraminidase, or hyaluronidase are proposed as
vaccine antigens because antibodies could potentially block the toxic effects
of
these proteins in patients infected with S. pneumoniae. However, these
proteins
are typically not located on the surface of S. pneumoniae, rather they are
secreted
or released from the bacterium as the cells lyse and die (Lee et al. Vaccine
1994;
12:875-8 and Berry et al. Infect. Immun. 1994; 62:1101-1108). While use of
these cytosolic proteins as immunogens might ameliorate late consequences of
S. pneumoniae infection, antibodies to these proteins would neither promote
pneumococcal death nor prevent initial or subsequent pneumococcal
colonization.
A prototypic surface protein that is being te~~~-:3 as a pneh:-.yococcal
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
3
vaccine is the pneumococcal surface protein A (PspA). PspA is a heterogeneous
protein of about 70-140 kDa. The PspA structure includes an alpha helix at the
amino terminus, followed by a proline-rich sequence, and terminates in a
series
of 11 choline-binding repeats at the carboxy-terminus. Although much
information regarding its structure is available, PspA is not structurally
conserved among a variety of pneumococcal serotypes, and its function is
entirely unknown (Mother et al. J. Bacteriol. 1992;174:601-9 and Mother J.
Bacteriol. 1994;176:2976-2985). Studies have confirmed the immunogenicity of
PspA in animals (McDaniel et al. Microb. Pathogen. 1994; 17;323-337).
Despite the immunogenicity of PspA, the heterogeneity of PspA, its existence
in
four structural groups (or Glades), and its uncharacterized function
complicate its
ability to be used as a vaccine antigen.
In patients who cannot make protective antibodies to the type-specific
polysaccharide capsule, the third component of complement, C3, and the
I S associated proteins of the alternative complement pathway constitute the
first
line of host defense against S. pneumoniae infection. Because complement
proteins cannot penetrate the rigid cell wall of S. pneumoniae, deposition of
opsonic C3b on the pneumococcal surface is the principal mediator of
pneumococcal clearance. Interactions of pneumococci with plasma C3 are
known to occur during pneumococcal bacteremia, when the covalent binding of
C3b, the opsonically active fragment of C3, initiates phagocytic recognition
and
ingestion (Johnston et al. J. Exp. Med 1969;129:1275-1290, Hasin HE, J.
Immunol. 1972; 109:26-31 and Hostetter et al. J. Infect. Dis. 1984; 150:653-61
).
C3b deposits on the pneumococcal capsule, as well as on the cell wall. This
method for controlling S. pneumoniae infection is fairly inefficient. Methods
for
augmenting S. pneumoniae opsonization could improve the disease course
induced by this organism. There currently exists a strong need for methods and
therapies to limit f rneumoniae infection.
ummarv of the Invention
This invention relates to the identification ~ _~ use ofa f:~.:r~ily of human
CA 02343931 2001-03-23
PCT/US99122362
WO 00/17370
4
complement C3-degrading polypeptides (e.g., proteins) expressed by S.
pneumoniae. The polypeptides preferably have a molecular weight of about I S
kDa to about 25 kDa, or about 75 kDa to about 95 kDa, as determined, for
example, on a 10% SDS polyacrylamide gel. The invention includes a number
of polypeptides isolatable from different C3-degrading strains of S.
pneumoniae.
In one aspect, the invention relates to an isolated polypeptide having at
least 80% sequence identity with SEQ ID N0:2 or SEQ ID NO:S. In a preferred
embodiment, the polypeptide is isolated from S. pneumoniae or alternatively
the
polypeptide is a recombinant polypeptide. Preferably, the isolated polypeptide
degrades human complement protein C3. A preferred polypeptide of this
invention is an isolated polypeptide having an amino acid sequence that
includes
SEQ ID N0:2 or SEQ ID NO:S, and more preferably, is SEQ ID N0:2 or SEQ
ID NO:S. The term "isolated" as used herein refers to a naturally occurring
species that has been removed from its natural environment, as well as to
synthetic species. The term "polypeptide" as used herein includes peptides,
polypeptides, and proteins, regardless of length. Preferably, the polypeptides
of
the invention include one or more functional units, which encompasses
polypeptides that degrade human complement protein C3.
Thus, the invention also relates to polypeptide fragments isolated from a
C3-degrading protein of this invention. Such fragments are encompassed by the
term "polypeptide" as used herein. Preferably, the invention provides
polypeptides of at least 1 S sequential amino acids derived from a protein
that has
at least 80% sequence identity with SEQ ID N0:2 or SEQ ID NO:S, and more
preferably, polypeptides of at least 15 sequential amino acids of SEQ ID N0:2
or SEQ ID NO:S. In another aspect of this invention, preferred polypeptides
are
capable of degrading human complement protein C3.
In another aspect, the invention relates to an isolated polypeptide that
preferably degrades human complement protein C3, wherein nucleic acid
encoding the isolated polypeptide hybridizes to at least a portion of SEQ ID
NO:1 or SEQ ID N0:4 or their complementary strands under highly stringent
hybridization conditions. Preferably, the polypeptide includes at least 15
CA 02343931 2001-03-23
WO 00/17370
PCT/US99/22362
sequential amino acids, which are, more preferably, of SEQ ID N0:2 or SEQ ID
NO:S.
In an additional aspect, this invention relates to polypeptides that have
reduced human C3 degradation activity or which do not degrade human C3;
5 however, the nucleic acids encoding this group of polypeptides each include
a
nucleotide sequence that hybridizes to either the nucleic acids that encode
human
C3 degrading polypeptides, or the complementary strands for each nucleic acid.
This latter group of polypeptides having reduced or no human C3 degrading
activity are referred to herein as "non-degrading" polypeptides. The non-
10 degrading polypeptides may differ from C3 degrading polypeptides by one or
more amino acids. This amino acid change may be a substitution, alteration, or
deletion of one or more amino acids. V arious types of amino acid changes are
discussed herein. Nucleic acids encoding the non-degrading polypeptides are
alternatively preferred embodiments of this invention.
15 The invention also relates to an immune system stimulating composition
(preferably, a vaccine) comprising an effective amount of an immune system
stimulating polypeptide of the present invention, which is preferably isolated
from S. pneumoniae, and a therapeutically acceptable carrier. In one
embodiment, the immune system stimulating composition or vaccine further
20 comprises at least one other immune system stimulating polypeptide isolated
from S. pneumoniae.
The invention further relates to an antibody capable of binding (typically,
specifically binding) to a polypeptide (at least a portion thereof) of the
present
invention. In one embodiment, the antibody is a monoclonal antibody and in
25 another embodiment, the antibody is a polyclonal antibody. In another
embodiment the antibody is an antibody fragment. The antibody or antibody
fragments can be obtained from a mouse, a rat, a goat, a chicken, a human, or
a
rabbit.
The invention also relates to an isolated nucleic acid molecule (i.e., a
30 polynucleotide, which can be single stranded or double stranded, and which
can
be a part, .or fragment, of a larger molecule such as a vector) capah!~ ~~~
hybridizing to at least a portion of SEQ ID''' ~~: i or SE(O r~ N0:4 or their
CA 02343931 2001-03-23
WO 00/17370
6
PCT/US99I22362
complimentary strands under highly stringent hybridization conditions. As used
herein, highly stringent hybridization conditions include, for example, 6XSSC,
SX Denhardt, 0.5% SDS, and 100 ltg/ml fragmented and denatured salmon
sperm DNA hybridized overnight at 65°C and washed in 2X SSC, 0.1% SDS
one time at room temperature for about 10 minutes followed by one time at
65°C
for about 15 minutes followed by at least one wash in 0.2XSSC, 0.1% SDS at
room temperature for at least 3-5 minutes. In one embodiment, the nucleic acid
molecule is isolated from S. pneumoniae and in another embodiment, the nucleic
acid molecule encodes a polypeptide. In one embodiment, the polypeptide
degrades human complement protein C3. In another embodiment, the nucleic
acid molecule encodes a polypeptide that does not degrade human complement
C3.
In another embodiment, the nucleic acid molecule is in a vector (i.e., it is
a fragment of a nucleic acid vector). The vector can be an expression vector
1 S capable of producing a polypeptide. Cells containing the nucleic acid
molecule
are also contemplated in this invention. In one embodiment, the cell is a
bacterium or a eukaryotic cell.
The invention further relates to an isolated nucleic acid molecule
comprising the nucleic acid sequence of SEQ ID NO:1 or SEQ ID N0:4, or their
complementary strands. The invention further relates to an RNA molecule
transcribed by a double-stranded DNA sequence comprising SEQ ID NO:1 or
SEQ ID N0:4.
In another aspect of this invention, the invention relates to a method for
producing an immune response to S. pneumoniae in a mammal (particularly a
human). The method includes: administering to a mammal a composition
comprising a therapeutically effective amount of a polypeptide of the present
invention, and a pharmaceutically acceptable carrier, to produce an immune
response to the polypeptide. The immune response can be a B cell response, a T
cell response, an epithelial response, or an endothelial response. In a
preferred
embodiment, the composition is a vaccine composition. Preferably the
polypeptide is at least 15 amino acids in length and also prefers=~iy Brie
composition further comprises at least r~ :, uther im~w .:~e system
stimulating
-a ,.
CA 02343931 2001-03-23
' PCT/US99/22362
WO 00/17370
7
polypeptide from S. pneumoniae. In one embodiment, the polypeptide
comprises at least 15 amino acids of SEQ ID N0:2 or SEQ ID NO: S.
The invention further relates to an isolated polypeptide of about 15 kDa
to about 25 kDa, or about 75 kDa to about 95 kDa, from Streptococcus
pneumoniae that is capable of degrading human complement C3 and to a method
for inhibiting Streptococcus pneumoniae-mediated C3 degradation. The method
includes contacting a Streptococcus pneumoniae bacterium with antibody
capable of binding to a polypeptide (at least a portion thereof) of the
present
invention.
The invention also relates to a method for inhibiting C3-mediated
inflammation and rejection in xenotransplantation. The method includes
expressing on the surface of an organ of an animal used in xenotransplantation
a
polypeptide of the present invention. This method is particularly advantageous
for causing, for example, the kidneys of pigs to express the polypeptide
described herein and thereby to inhibit C3 mediated inflammation after
xenotransplantation.
The invention also relates to an isolated nucleic acid molecule that
contains a region of at least 1 S nucleotides which hybridize under highly
stringent hybridization conditions to at least a portion of a nucleic acid
sequence
of SEQ ID NO:1 or SEQ ID N0:4 or their complementary strands.
The invention also relates to isolated DNA molecules or primers having
the nucleic acid sequences as shown in SEQ ID N0:6, SEQ ID N0:7, SEQ ID
N0:8 AND SEQ ID N0:9.
Brief Descri~~t~~n ~f tl~e Figures
Figure 1 provides the nucleic acid sequence of the translated portion of a
C3-degrading polypeptide (approximately 20 kDa) gene of this invention (SEQ
ID NO:1).
Figure 2 provides the amino acid sequence of a C3-degrading
polypeptide (approximately 20 kDa) of this invention (SEQ ID N0:2).
Figure 3 diagrams the amino acid sequence of a C3-~';.~:ading
polypeptide (approximately 20 kDa~ ~ ~:iioned wi~'._ the nucleic acid sequence
CA 02343931 2001-03-23
WO 00/17370
8
PCT/US99/22362
(double stranded) encoding a C3-degrading polypeptide according to this
invention (SEQ ID NOS:1-3 wherein SEQ ID N0:3 is the complement of SEQ
ID NO:1).
Figure 4 provides the nucleic acid sequence for a predicted 92 kDa amino
S acid sequence (SEQ ID N0:4).
Figure 5 provides the predicted 92 kDa amino acid sequence (SEQ ID
NO:S).
Figure 6 shows sequence alignments of SEQ ID NO:1 and a portion of
SEQ ID N0:4.
Figure 7 shows sequence alignment of SEQ ID N0:2 with a portion of
SEQ ID NO:S.
Figure 8. Western blot analysis of several pneumococcal whole cell
lysate with polyclonal anti--rr20 kDa sera. Molecular weight markers were run
in
lane 1; recombinant 20 kDa polypeptide from pDF122 was run in lane 2;
15 recombinant 92 kDa polypeptide from Type 7 was run in lane 3; lane 4 was a
blank; CP1200 whole cell lysate was run in lane 5; Type 3 whole cell lysate
was
run in lane 6; and Type 7 whole cell lysate was run in lane 7. The antisera
recognizes the recombinant polypeptides of approximately 20 kDa and
approximately 92 kDa, but only recognized the larger polypeptide in whole cell
lysates.
Figure 9. Autoradiogram showing degradation of biotinylated C3 by 20
kDa and 92 kDa polypeptides of the present invention.
Figure 10. Coomassie Blue-Stained 7.5% SDS-PAGE analysis of C3
degradation by the 20 kDa (Lane A8) and the 92 kDa (Lane C8) polypeptides of
the present invention.
Figure 11 is a chart which shows the survival of CBA/CAHN xid/J mice
immunized SC (subcutaneous) with r79 kDa protein adjuvanted with MPL and
challenged IN (intranasal) with S. pneumoniae Type 3.
Figure 12 is a SDS-PAGE gel described in Example 8.
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
9
detailed Description of the Preferred Embodiments
' ' The present invention relates to the identification and isolation of a
human complement C3 degrading polypeptide fragment of a larger polypeptide
of about 75 kD to about 95 kD. This fragment has a molecular weight of about
20 kDa (~ 5 kDa) on a 10% SDS-PAGE gel. It also relates to nucleic acids
encoding C3 degrading polypeptides.
It has been observed that exponentially growing cultures of pneumococci
from several serotypes were able to first degrade the [3-chain then degrade
the a
chain of C3 without producing defined C3 cleavage fragments (Angel, et al. J.
Infect. Dis. 170:600-608, 1994). This pattern of degradation without cleavage
differs substantially from that of other microbial products such as the
elastase
enzyme of Pseudomonas aeruginosa and the cysteine proteinase of Entamoeba
hisrolytica.
The term "degrade" is used herein to refer to the removal of amino acids
from proteinaceous molecules, generating peptides or polypeptides. The
polypeptide of this invention degrade C3 without generating the cleavage
fragments known as C3b, iC3b, or C3d. There is at least some preference of the
C3-degrading polypeptides of this invention for C3 in that, for example, the
C3-
degrading polypeptide does not appear to degrade other proteins, such as
albumin.
A C3-degrading polypeptide of about 20 kDa was isolated from a library
of insertionally interrupted pneumococcal genes by identifying those clones
that
had decreased C3 degrading activity as compared to wild type S. pneumoniae.An
exemplary assay for assessing C3-degrading activity of clones is provided in
Example 1. Clones with decreased C3-degrading activity were identified and a
546 by SmaI insert was selected, based on the sequence of the clones that had
demonstrated decreased C3-degrading activity. This Smal fragment was used to
probe an S. pneumoniae library made from strain CP1200. Positive clones from
the S. pneumoniae library that hybridized to the Smal fragment were isolated
and
the open reading frame of the gene associated with C3-degrading activity was
identified. The following oligonucleotide (SEQ ID NO:10}, which 1-~as sequence
identify with a portion of PspA, was used tc ,:ciW rm, by d~:ferential
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
hybridization, that the gene encoding the C3-degrading protinease was distinct
from the gene encoding PspA.
SEQ ID NO:10
5 GAAAACAATAATGTAGAAGACTACTTTAAAGAAGGTTAGA
An open reading frame of a 20 kDa polypeptide spans an area of
approximately 500 base pairs (SEQ ID NO:1 ) predicting a polypeptide of
molecular weight of about 20 kDa (+/- 5 kDa) or about 168 amino acids (SEQ
10 ID N0:2). An exemplary gene sequence encoding a C3-degrading polypeptide
is provided in Figure 1 as SEQ ID NO:1 and an amino acid sequence of the
polypeptide is provided in Figure 2 as SEQ ID N0:2. Figure 3 combines a
preferred gene sequence with a corresponding preferred translated polypeptide
as
SEQ ID NOS:I-3.
Using SEQ ID N0:2, the amino acid sequence of the approximately 20
kDa polypeptide, was determined to be unrelated to other polypeptides in the
GenBank or Swiss Prot databases. The predicted polypeptide encompasses a
proline-rich sequence characteristic of membrane domains in prokaryotes,
particularly between amino acids 80-108 suggesting that the polypeptide is
expressed at the surface. The amino acid sequence exhibits no apparent choline-
binding repeats. Electrophoresis of pneumococcal lysates and supernatants from
cultures of CP 1200 on SDS-PAGE gels impregnated with C3 identified a lytic
band at about 20 kDa (t S kDa) in both supernatants and lysates, confirming
that
a polypeptide of a size predicted by SEQ ID N0:2 had C3-degrading activity
(see Example 2). As provided in Example 3, the gene encoding the 20 kDa C3-
degrading polypeptide is conserved in at least two dozen pneumococcal isolates
representing five serotypes (serotypes 1, 3, 4, 14, and 19F)
The nucleotide sequence encoding the C3-degrading polypeptide of this
invention was inserted into a gene expression vector for expression in E.
coli.
Recombinant C3-degrading polypeptide was isolated as described in the
examples. Those of ordinary skill in the art recogni~c t:~at, given a
particular
gene sequence such as that r- ~ ~ ~ded in ~~' ~ iD NO:1, there are a variety
of
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
11
expression vectors that could be used to express the gene. Further, there are
a
variety of methods known in the art that could be used to produce and isolate
the
recombinant polypeptide of this invention and those of ordinary skill in the
art
also recognize that the C3 degrading assay of this invention will determine
whether or not a particular expression system, in addition to those expression
systems provided in the examples, is functioning, without requiring undue
experimentation. A variety of molecular and immunological techniques can be
found in basic technical texts such as those of Sambrook et al. (Molecular
Cloning, A Laboratory Manual, 1989 Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, NY) and Harlow et al. (Antibodies; A Laboratory Manual.
Cold Spring Harbor, NY; Cold Spring Harbor Laboratory Press, 1988).
The polynucleotide encoding the C3 degrading polypeptide of this
invention was identified using a plasmid library made with pneumococcal
genomic DNA fragments from strain CP 1200. Although there are a variety of
methods known for obtaining a plasmid library, in a preferred strategy, a
plasmid
library was constructed with Sau 3A digested pneumococcal genomic DNA
fragments (0.5 -4.0 kb) from pneumococcal strain CP 1200 (obtained from D.A.
Morrison, University of Illinois, Champagne-Urbana, Illinois and described in
Havarstein LF, et al. Proc. Natl. Acad. Sci. (USA) 1995;92:11140-11144) and
inserted into the Bam HI site of the integrative shuttle vector pVA 891 (erm',
cm'; has origin of replication for E. coli). This library was transformed into
an E.
coli DHSa MCR strain by electroporation. Plasmid extractions of some
randomly selected E. coli transformants revealed that all of them contained
recombinant plasmids.
Plasmid library DNA can be extracted from the E. coli transformants and
used to transform the CP 1200 parent pneumococcal strain using insertional
mutagenesis by homologous recombination.
The pneumococcal strain CP 1200 cells can be made competent using a
pH shift with HCl procedure in CTM medium. The competent cells are frozen at
-70°C in small aliquots until needed.
The isolated polypeptide of this inventiecr c~ri be incubated with human
complement C3 for 4 h~-'-'~ or longer .. .i 7°C in the presence of PBS
to detect
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
12
C3 degradation. Control samples without the isolated pneumococcal
polypeptide are used as controls for comparative purposes.
The polypeptides of this invention have an apparent molecular weight on
a 10% SDS-polyacrylamide gel of either about 1 S kDa to about 25 kDa; and
5 preferably about 20 kDa; or about 75 kDa to about 95 kDa; and preferably
about
92 kDa. Exemplary polypeptides sequences are provided by SEQ ID NO: 2 and
SEQ ID NO:S. Those of ordinary skill in the art will recognize that some
variability in amino acid sequence is expected and that this variability
should not
detract from the scope of this invention. For example, conserved mutations do
10 not detract from this invention nor do variations in amino acid sequence
identity
of less than about 80% amino acid sequence identity and preferably less than
about 90% amino acid sequence identity where the polypeptide is capable of
degrading human complement protein C3, and particularly where the
polypeptide is isolated or originally obtained from an S pneumoniae bacterium.
15 Proteins and fragments thereof (all referred to as polypeptides) are also
within
the scope of the present invention, particularly if they are capable of
degrading
human complement protein C3.
Some nucleic acid sequence variability is expected among pneumococcal
strains and serotypes as is some amino acid variability. Conserved amino acid
20 substitutions are known in the art and include, for example, amino acid
substitutions using other members from the same class to which the amino acid
belongs. For example, the nonpolar amino acids include alanine, leucine,
isoleucine, valine, proline, phenylalanine, and tryptophan. The polar neutral
amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine
and
25 glutamine. The positively charged (basic) amino acids include arginine,
lysine
and histidine. The negatively charged (acidic) amino acids include aspartic
acid
and glutamic acid. Such alterations are not expected to affect apparent
molecular weight as determined by polyacrylamide gel electrophoresis or
isoelectric point. Particularly preferred conservative substitutions include,
but
30 are not limited to, Lys for Arg and vice verse to maintain a positive
charge; Glu
f;.r Asp and vice versa to maintain a negative charge; Ser for Thr so that a
free
-OH is maintained; and Gln for Asn to maintain a free NH2.
""
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
13
_ _ Preferred polypeptides of this invention includes polypeptides with the
amino acid sequence of SEQ ID N0:2 or SEQ ID NO:S. Other polypeptides
include those degrading human complement polypeptide C3 and having nucleic
acid encoding the polypeptide that hybridizes to SEQ ID NO:l or SEQ ID N0:4
S under highly stringent hybridization conditions such as 6XSSC, SX Denhardt,
0.5% SDS (sodium dodecyl sulfate), and 100 lxg/ml fragmented and denatured
salmon sperm DNA hybridized overnight at 65°C and washed in 2X SSC,
0.1%
SDS one time at room temperature for about 10 minutes followed by one time at,
65°C for about 15 minutes followed by at least one wash in 0.2XSSC,
0.1% SDS
10 at room temperature for at least 3-5 minutes are also contemplated in this
invention. Typically, an SSC solution contains sodium chloride, sodium
citrate,
and water to prepare a stock solution.
The polypeptides of this invention can be isolated or prepared as
recombinant polypeptides. That is, nucleic acid encoding a protein, or a
portion
15 thereof, can be incorporated into an expression vector or incorporated into
a
chromosome of a cell to express the polypeptide in the cell. The polypeptide
can
be purified from a bacterium or another cell, preferably a eukaryotic cell and
more preferably an animal cell. Alternatively, the polypeptide can be isolated
from a cell expressing the polypeptide, such as a S. pneumoniae cell. Thus,
20 proteins, peptides, or polypeptides are all considered within the scope of
this
invention when the term "polypeptide" is used. The polypeptides are preferably
at least 15 amino acids in length and preferred polypeptides have at least 15
sequential amino acids from SEQ ID N0:2 or SEQ ID NO:S.
Nucleic acid encoding the about 15 kDa to about 20 kDa polypeptide and
25 the about 75 kD to about 95 kD polypeptide are also part of this invention.
SEQ
ID NOS:1 and 4 are preferred nucleic acid molecules encoding a C3-degrading
polypeptide. Those of ordinary skill in the art will recognize that some
substitution will not alter the C3-degrading polypeptide sequence to an extent
that the character or nature of the C3-degrading polypeptide is substantially
30 altered. For example, nucleic acid with an identity of at least 80% to SEQ
ID
N<): l is contemplated in this invention. ~'. ~::eihod for determining whether
a
particular nucleic _° .a sequemP ':~~is within the scope of this
invention is to
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
14
consider whether or not a particular nucleic acid sequence encodes a C3-
degrading polypeptide and has a nucleic acid identity of at least 80% as
compared with SEQ ID NO:1 or SEQ ID N0:4. Other nucleic acid sequences
encoding the C3 polypeptide include nucleic acid encoding the C3 polypeptide
where the C3 polypeptide has the same sequence or at least a 90% sequence
identity with SEQ ID N0:2 or SEQ ID NO:S but which includes degeneracy
with respect to the nucleic acid sequence. A degenerate codon means that a
different three letter codon is used to specify the same amino acid. For
example,
it is well known in the art that the following RNA codons (and therefore, the
corresponding DNA codons, with a T substituted for a U) can be used
interchangeably to code for each specific amino acid:
Phenylalanine (Phe or F) UUU, UUC, UUA or UUG
Leucine (Leu or L) CUU, CUC, CUA or CUG
Isoleucine (Ile or I) AUU, AUC or AUA
Methionine (Met or M) AUG
Valine (Val or V) GUU, GUC, GUA, GUG
Serine (Ser or S) AGU or AGC
Proline (Pro or P) CCU, CCC, CCA, CCG
Threonine (Thr or T) ACU, ACC, ACA, ACG
Alanine (Ala or A) GCU, GCG, GCA, GCC
1'ryptophan (Trp) UGG
Tyrosine (Tyr or Y) UAU or UAC
1-Iistidine (His or H) CAU or CAC
Glutamine (Gln or Q) CAA or CAG
Asparagine (Asn or N) AAU or AAC
Lysine (Lys or K) AAA or AAG
Aspartic Acid (Asp or D) GAU or GAC
Glutamic Acid (Glu or E) GAA or GAG
Cysteine (Cys or C) UGU or UGC
Arginine (Arg or R) AGA or AGG
Glycine (Gly or G} GGU or GGC or GGA or
GG(
~;;rminati~r :odon UAA, UAG or UGA
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
Further, a particular DNA sequence can be modified to employ the
codons preferred for a particular cell type. For example, the preferred codon
usage for E. coli is known, as are preferred codons for animals including
humans. These changes are known to those of ordinary skill in the art and
5 therefore these gene sequences are considered part of this invention. Other
nucleic acid sequences include at least 15, and preferably, at least 30
nucleic
acids in length from SEQ ID NO:1 or SEQ ID N0:4 or other nucleic acid
fragments of at least 15, and preferably at least 30 nucleic acids in length
where
these fragments hybridize to SEQ ID NO:1 or SEQ ID N0:4 under highly
10 stringent hybridization conditions such as 6XSSC, SX Denhardt, 0.5% SDS,
and
100 pg/ml fragmented and denatured salmon sperm DNA hybridized overnight
at 65°C and washed in 2X SSC, 0.1% SDS one time at room temperature for
about 10 minutes followed by one time at, 65°C for about 15 minutes
followed
by at least one wash in 0.2XSSC, 0.1 % SDS at room temperature for at least 3-
5
I S minutes.
The nucleic acid molecules of this invention can encode all, none (i.e.,
fragments that cannot be transcribed, fragments that include regulatory
portions
of the gene, or the like), or a portion of SEQ ID N0:2 or SEQ ID NO:S and
preferably containing a contiguous nucleic acid fragment that encodes at least
20 nine amino acids from SEQ ID N0:2 or SEQ ID NO:S. Because nucleic acid
molecues encoding a portion of a C3 degrading polypeptide are contemplated in
this invention, it will be understood that not all of the nucleic acid
molecules will
encode a protein or peptide or polypeptide with C3 degrading activity.
Further,
the nucleic acid of this invention can be mutated to remove or otherwise
25 inactivate the C3 degrading activity of this polypeptide. Therefore,
nucleic acid
molecules that encode polypeptides without C3 degrading activity that meet the
hybridization requirements described above are also contemplated. Methods for
mutating or otherwise altering nucleic acid sequences are well described in
the
art and the production of an immunogenic, but enzymatically inactive
30 polypeptide can be tested for therapeutic utility.
The nucleic acid molecu!.:~~ ~i this invention can be incorporated into
nucleic ~~'r vectors or r :~aoly incorporated into host genomes to produce
r ~~ , w.. ,x:.~
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
16
recombinant polypeptides including recombinant chimeric polypeptides. In one
embodiment, the C3-degrading polypeptide is encoded by a gene in a vector and
the vector is in a cell. Preferably, the cell is a prokaryotic cell such as a
bacterium. The genes and gene fragments can exist as the fusion of all or a
portion of the gene with another gene and the C3-degrading polypeptide can
exist as a fusion protein of one or more proteins where the fusion protein is
expressed as a single protein. A variety of nucleic acid vectors of this
invention
are known in the art and include a number of commercially available expression
plasmids or viral vectors. The use of these vectors is well within the scope
of
what is ordinary skill in the art. Exemplary vectors are employed in the
examples, but should not be construed as limiting on the scope of this
invention.
This invention also relates to antibodies capable of binding (typically
specifically binding) to polypeptides of about 15 kDa to about 25 kDa; and
preferably about 20 kDa; and about 75 kDa to about 95 kDa; and preferably
15 about 92 kDa, from S. pneumoniae and preferably where the polypeptides are
capable of degrading human complement C3. Polyclonal or monoclonal
antibodies can be prepared to all or part of the polypeptides of the invention
Methods for preparing antibodies to polypeptides are well known and well
described, for example, by Harlow et al., (Antibodies; A Laboratory Manual.
20 Cold Spring Harbor, NY; Cold Spring Harbor Laboratory Press, 1988). In a
preferred example, the antibodies can be human derived, rat derived, mouse
derived, goat derived, chicken derived, or rabbit derived. Polypeptide-binding
antibody fragments and chimeric fragments are also known and are within the
scope of this invention.
25 The invention also relates to the use of immune stimulating
compositions. The term "immune stimulating" or "immune system stimulating"
composition refers to protein, peptide, or polypeptide compositions according
to
the invention that activate at least one cell type of the immune system in a
subject, such as a mammal. Preferably, the immune stimulating composition
30 provides an immunizing response or prophylactic benefit in a normal, i.e.,
uninfected subject, typically a vaccine. However, any measurable immune
response is benef cial to the suh,;.ct in a therapy application or protocol.
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
17
Preferred activated cells of the immune system include phagocytic cells such
as
neutrophils or macrophages, T cells, B cells, epithelial cells and endothelial
cells. Immune stimulating compositions comprising the peptides, polypeptides
or proteins of the invention can be used to produce antibody in an animal such
as
a rat, mouse, goat, chicken, rabbit, or a human or an animal model for
studying
S. pneumoniae infection. Preferred immune stimulating compositions include an
immune stimulating amount, e.g, a therapeutically effective amount, of at
least
one peptide or polypeptide including at least 15 amino acids from the C3
degrading polypeptide.
The term "vaccine" refers to a composition for immunization. This
process can include the administration of a protein, peptide, polypeptide,
antigen, nucleic acid sequence or complementary sequence, e.g., anti-sense, or
antibody, or suspensions thereof, wherein upon administration, the molecule
will
produce active immunity and provide protection against an S. pneumoniae
infection or colonization. Typically, such vaccines are prepared as
injectables,
either as liquid solutions or suspensions. Solid forms suitable for solution
in, or
suspension in, liquid prior to injection may also be prepared. The vaccine
preparation may optionally be emulsified, or encapsulated in liposomes.
The immune stimulating composition (such as a vaccine) can further
include other polypeptides in a pharmaceutically acceptable buffer or carrier,
such as PBS (phosphate buffer saline) or another buffer recognized in the art
as
suitable and safe for introduction of polypeptides into a host to stimulate
the
immune system. The immune stimulating compositions can also include other
immune system stimulating polypeptides such as adjuvants or immune
stimulating proteins, peptides, or polypeptides from S. pneumoniae or other
organisms. For example, a cocktail of peptides or polypeptides may be most
useful for controlling S. pneumoniae infection. Preferably one or more of the
polypeptides, or fragments thereof, of this invention are used in a vaccine
preparation to protect against or limit S. pneumoniae colonization or the
pathogenic consequences of S. pneumoniae colonization.
A "therapeutically eff Naive amount," as used herein, refers to that
amen- > ai~at is effP:-:.:ve for production of a desired result. This amount
varies
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
18
depending upon the health and physical condition of a subject's immune system,
i.e., to 'synthesize antibodies, the degree of protection desired, the
formulation
prepared and other relevant factors. It is expected that the amount will fall
in a
relatively broad range that can be determined through routine trials.
The active immune stimulating ingredients are often mixed with
excipients or diluents that are pharmaceutically acceptable as carriers and
compatible with the active ingredient. The term "pharmaceutically acceptable
carrier" refers to a carriers) that is "acceptable" in the sense of being
compatible
with the other ingredients of a composition and not deleterious to the
recipient
thereof. Suitable excipients are, for example, water, saline, dextrose,
glycerol,
ethanol, or the like and combinations thereof. In addition, if desired, the
immune
stimulating composition (including vaccine) may contain minor amounts of
auxiliary substances such as wetting or emulsifying agents, pH buffering
agents,
andlor adjuvants which enhance the effectiveness of the immune stimulating
1 S compostion.
Examples of adjuvants or earners that may be effective include but are
not limited to: aluminum hydroxide, N-acetyl-muramyl-L-threonyl-D-
isoglutamine (thr-MDP); N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP
11637, referred to as nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-
alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine
(CGP 19835A, referred to as MTP-PE), and RIBI, which contains three
components extracted from bacteria, monophosphoryl lipid A, trehalose
dimycolate and cell wall skeleton (MPL + TDM + CWS) in a 2%
squalene/Tween 80 emulsion.
This invention also relates to a method for inhibiting Streptococcus
pneumoniae-mediated C3 degradation comprising contacting a Streptococcus
pneumonie bacterium with a polypeptide, such as an antibody or another
polypeptide that is capable of binding to an isolated polypeptide (typically,
at
least a portion thereof) of about 15 kDa to about 25 kDa, or about 75 kDa to
about 95 kDa, from Streptococcus pneumoniae. The protein capable of binding
to an isolated polypeptide . -f about 15 kDa to about 25 kDa, or about 75 kDa
to
al~.~ ~~ 95 kDa r :, be an antibody or a fragment thereof, or the protein can
be a
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
19
chimeric protein that includes the antibody binding domain, such as a variable
domain, from antibody that is capable of specifically recognizing an isolated
polypeptide of about 15 kDa to about 25 kDa, or about 75 kDa to about 95 kDa,
from Streptococcus pneumoniae having C3 degrading activity.
5 The isolated S. pneumoniae polypeptide of this invention can be isolated,
and optionally purified, and the isolated polypeptide or immunogenic fragments
thereof can be used to produce an immunologic response, including, in one
example, an antibody response in a human or an experimental animal.
Polypeptides without C3 degrading ability can be tested for their ability to
limit
10 the effects of S. pneumoniae infection. Similarly, the polypeptides of this
invention can be modified, such as through mutation to interrupt or inactivate
the
C3 degrading activity of the polypeptides. Antibody capable of inhibiting the
C3-degrading activity of the polypeptides of this invention may be used as a
strategy for preventing C3 degradation and for promoting clearance of S.
15 pneumoniae through the opsonic pathway. Isolated polypeptides can be used
in
assays to detect antibody to S. pneumoniae or as part of a vaccine or a multi-
valent or multiple protein, peptide, or polypeptide-containing vaccine for S.
pneumoniae therapy.
Thus, the term "treatment," as used herein, refers to prophylaxis and/or
20 therapy of either normal mammalian subjects or mammalian subjects colonized
with, diagnosed with, or exhibiting characteristics or symptoms of various S
pneumoniae infections. The term "therapy" refers to providing a therapeutic
effect to a mammalian subject such that the subject exhibits few or no
symptoms
of a pneumococcal infection or other related disease. Such treatment can be
25 accomplished by administration of nucleic acid molecules (sense or
antisense),
proteins, peptides or polypeptides or antibodies of the instant invention.
It is further contemplated that the polypeptides of this invention can be
surface expressed on vertebrate cells and used to degrade C3, for example,
where complement deposition (or activation) becomes a problem, such as in
30 xenotransplantation or in complement-mediated glomerulonephritis. For
example, the entire pne~.ml;,coccal polypeptide, a recombinant polypeptide, or
a
~.°aion of ei~'~ .:, can be incorporated into xenotransplant cells and
expressed as
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
a surface polypeptide or as a secreted polypeptide to prevent or minimize
complement deposition (and/or complement-mediated inflammation).
Another specific aspect of the present invention relates to using a vaccine
vector expressing an isolated protein, and peptides or polypeptides therefrom.
5 Accordingly, in a further aspect this invention provides a method of
inducing an
immune response in a mammal, which comprises providing to a mammal a
vaccine vector expressing at least one, or a mixture of an isolated protein
and/or
peptide or polypeptide of the invention. The protein and peptides or
polypeptides of the present invention can be delivered to the mammal using a
10 live vaccine vector, in particular using live recombinant bacteria, viruses
or other
live agents, containing the genetic material necessary for the expression of
the
protein and/or peptides or polypeptides as a foreign polypeptide.
Particularly,
bacteria that colonizes the gastrointestinal tract, such as Salmonella,
Shigella,
Yersinia, Vibrio, Escherichia and BCG have been developed as vaccine vectors,
15 and these and other examples are discuessed by J. Holmgren et al.,
Zmmunobiol.,
~, 157-179 (1992) and J. McGhee et al., i e, ,~0_, 75-88 (1992).
An additional embodiment of the present invention relates to a method of
inducing an immune response in a subject, e.g,. mammal, comprising
administering to the subject an amount of a DNA molecule encoding an isolated
20 protein and/or peptide or polypeptide therefrom of this invention,
optionally with
a transfection-facilitating agent, where the protein and/or peptides or
polypeptides retain immunogenicity and, when incorporated into an immune
stimulating composition, e.g, vaccine, and administered to a human, provides
protection without inducing enhanced disease upon subsequent infection of the
human with S. pneumoniae pathogen. Transfection-facilitating agents are known
in the art.
It is further contemplated that the antisense sequence of the gene
encoding the about I 5 kDa to about 25 kDa polypeptide, and the about 75 kDa
to
about 95 kDa polypeptide may be used as a vaccine or as a therapeutic
treatment
for pneumococcal infection. Antisense DNA is defined as a non-coding
sequence that is corr,.~inentary, i.e., a complementary strand, to all or a
portion
of SEQ T'-' :~U:1 or SEQ ID N0:4. For example, the antisense sequence for 5~-
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
21
ATGTCAAGC-3' is 3'-TACAGTTCG-5'. Delivery of antisense sequence or
oligonuclotides into an animal may result in the production of antibody by the
animal or in the incorporation of the sequence into living bacteria or other
cells
whereby transcription and/or translation of all or a portion of the 92 kDa
gene
S product is inhibited.
Introduction of an antisense nucleic acid sequence can be accomplished,
for example, by loading the antisense nucleic acid into a suitable carrier,
such as
a liposome, for introduction into pneumococci or infected cells. Typically, an
antisense nucleic acid sequence having eight or more nucleotides is capable of
binding to the bacterial nucleic acid or bacterial messenger RNA. The
antisense
nucleic acid sequence, typically contains at least about 15 nucleotides,
preferably
at least about 30 nucleotides or more nucleotides to provide necessary
stability
of a hybridization product of bacterial nucleic acid or bacterial messenger
RNA.
Introduction of the sequences preferably inhibit the transcription or
translation of
at least one endongenous S pneumoniae nucleic acid sequence. Methods for
loading antisense nucleic acid is known in the art as exemplified by U.S.
Patent
4,242,046.
The present invention also provides nucleic acid having an open reading
frame of 2478 bases (SEQ ID N0:4) that encompasses the open reading frame of
a nucleic acid sequence (SEQ ID NO:1 ) that encodes a polypeptide that has a
molecular weight of about 20 kDa (SEQ ID N0:2). The 20 kDa polypeptide,
described herein, is further characterized as a C3-degrading polypeptide. The
larger open reading frame, e.g., 2163 by (SEQ ID N0:4), encodes for a putative
polypeptide of about 92 kDa (SEQ ID NO:S).
All references and publications cited herein are expressly incorporated by
reference into this disclosure. There are a variety of alternative techniques
and
procedures available to those of skill in the art which would similarly permit
one
to successfully perform the intended invention in view of the present
disclosure.
It will be appreciated by those skilled in the art that while the invention
has been
described above in connection with particular embodiments and examples, the
invention is not .r.A~::;ssarily so limited and that numerous other
embodiments,
examnl.~-_, uses, modifications and departures from the embodiments; example
CA 02343931 2001-03-23
WO 00117370 PCT/US99/22362
22
and uses may be made without departing from the inventive scope of this
application.
Example 1
Identification of Insertional Mutants with Reduced
C3-Degrading Activity
Insertional mutants were received from Dr. Elaine Tuomanen,
(Rockefeller Inst., New York, New York). The clones with insertions were
tested in an assay to detect reduced C3-degrading activity. 137 clones were
tested by growing the cells in Todd Hewitt broth overnight at room temperature
in microtitre plates. The cells were diluted 1:10 in synthetic medium for
pneumococci (see Sicard A. M., Genetics 50:31-44, 1984) and the remainder of
the cells were frozen in the microtiter plate. Either 63 ng or 83 ng of C3
IS (purified from human plasma according to the method of Tack et al., Meth.
Enzymol. 80:64-101, 1984) per 100 pl of medium containing 1 mg/ml of 0.1%
BSA in phosphate buffered saline (PBS) was added to about 200 p.l of diluted
cells. The cells were incubated at 37°C for 4 hrs. One hundred pl of
the mixture
was added to ELISA plates and incubated overnight at 4°C. The plates
were
washed three times with wash buffer and the wells were filled with 0.05%
Tween 20 in PBS with five minute incubations between the washes. One
hundred pl of antibody to C3 (polyclonal horse-radish peroxidase-conjugated
goat antibody specific to human C3-IgG fraction, ICN Cappel, Costa Mesa, CA)
was diluted 1:1200 with 3% BSA in PBS. The ELISA plate was incubated at
37°C for about 30 minutes to 1 hr in the dark and washed with wash
buffer as
above. The assay was developed using 12 mg of OPD in 30 ml of 0.1 M sodium
citrate buffer with 12 pl of 30% hydrogen peroxide. Assay results were
determined by optical density readings at 490 nm on an ELISA plate reader.
Each clone was tested four times. Nineteen clones were selected that had
less than 40% C3 degradation as compared to nonmutated controls. These 19
clones were scr~,:rcd 6 times by the assay described above and from these
resu~~ .~ clones were selected with less than 30% C3-degrading activity as
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
23
compared to controls. These 6 clones were screened eleven times each and the
two clones with the lowest C3-degrading activity were selected for further
study.
A partial sequence of one of the clones was received and a Smal
fragment of 546 by was labeled with 32P by random primer labeling (kit
available from Stratagene, La Jolla, CA). The 546bp SmaI fragment from SEQ
ID NO:1 was hybridized to EcoRl and KpnI digests of numerous pneumococcal
strains on Southern blots. This same fragment was also used to screen a
library
of Sau3A fragments of genomic DNA from S. pneumoniae strain CP1200.
A 3.5 kb insert was identified from the CP1200 library. The insert was
sequenced and an open reading frame of 492 base pairs, including the stop
codon, was identified. The open reading frame coded for a polypeptide of 168
amino acids and a predicted molecular weight of about I 8,500 daltons.
PCR primers were constructed to amplify the open reading frame; the S'
PCR primer incorporated a BamHl site; the 3' primer incorporated a Pstl site.
The amplified insert was ligated in frame to a His-Tagged E. coli expression
vector pQE30 (Qiagen, San Diego, CA). The resulting plasmid was used to
transform E. coli strain BL21 (Novagen, Madison, W1) containing the lac
repressor plasmid pREP4 (Qiagen). E. coli cultures were induced to express the
His-Tagged polypeptide and the polypeptide was column purified with Ni-NTA
resin (Qiagen). The purified polypeptide was confirmed by SDS-PAGE gel.
Example 2
Identification of a 201iDa C3-Degrading Polypeptide
To determine the C3-degrading capability of the 20 kDa polypeptide, 0.5
mg/ml of C3 (prepared according to Tack et al., Meth. Enrymol. 80:64-101,
1984) was copolymerized in a sodium dodecyl sulfate (SDS) gel-containing I S%
acrylamide (15% SDS-PAGE gel). Pneumococcal supernatants were obtained
from cultures of S. pneumoniae strain CP1200 grown to exponential phase in
Todd Hewitt broth; pneumococcal lysates were obtained by incubating 5 x 10g
cells with 5% SDS for 30 minutes at room temperature. The lysate was
concentrated 10 fold using a Centricon filtration device with a 10,000 mw
cutoff
(~';_.icon, Beverly, MA). The samples were not heated before electrophnr..sis.
m ~. ..
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
24
Samples of supernatants and lysates were added to the 15% C3-containing SDS-
PAGE gels and electrophoresis was carried out at 4°C at 150 V until
the dye
front ran out. The gel was washed successively with 50 ml of 2.5% Triton X-
100 in water (2 times, 10 minutes), 2.5 % Triton X-100 in 50 mM Tris-HCI, pH
7.4 (2 times, 10 minutes), and SO mm Tris-HCI, pH 7.4 (2 times, 10 minutes) to
remove SDS. After washes, 50 ml of SO mM Tris-HCI, pH 7.4, was poured into
dishes containing the gels, and the dishes were covered and incubated at
37°C
for 1.5 hour and overnight (about 16 hours). The gels were stained with
Coomassie blue for 10 minutes and destained totally.
Two lytic bands were visualized, one of which was about 20 kDa in size,
against the dark blue background in both lysates and supernatant. C3 degrading
activities in the pneumococcal lysates were observed after a 1.5 hour
incubation
at 37°C, while C3 degrading activities in the Pn supernatant were
observed after
an overnight incubation. Therefore, C3 degrading activities appeared to be
mainly cell associated.
Example 3
The gene encoding the 20 liD polypeptide is conserved in a number of S.
pneumoniae strains.
20 DNA was obtained from a variety of S pneumoniae strains (Clinical
isolates of Type 1, Type 3, L002 and L003 (type 3), Type 4, Type 14 and
Laboratory isolates CP1200, WU2, R6X, 6303,109,110, JY1I19, JY182, and
JY53) and SEQ ID N0:3 was used as a probe to detect the presence of nucleic
acid encoding the 20 kD polypeptide in DNA from these strains. Isolated
chromosomal DNA was digested with EcoRl and separated by electrophoresis.
The DNA was transferred to a solid support and hybridized to end-labeled SEQ
ID NO:3 under the hybridization and washing conditions of 6X SSC, SX
Denhart's, 0.5% SDS, 100 p.g/ml denatured fragmented salmon sperm DNA
hybridized at 65 °C overnight and washed in 2X SSC, 1 time at room
30 temperature for 10 minutes and in 2X SSC, 0.1% SDS 1 time at 65°C
for 15
minutes f~~lowed by two washes in 0.2X SSC, 0.1% SDS for 3 minutes each at
~um temperature.
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
Results indicated that SEQ ID N0:3 hybridized identically in each of the
DNA samples tested indicating that the polypeptide appears to be conserved
among strains. In some strains, the DNA encoding the 20 kDa C3-degrading
polypeptide appears to be part of a larger open reading frame of 2478 by that
5 putatively encodes a 92 kDa polypeptide.
Southern blot of S. pneumoniae DNA probe
Five ug samples of genomic DNA were obtained from 11 strains of S.
10 pneumoniae. Each sample was digested with the restriction enzyme Kpn 1. The
samples were subsequently loaded onto an agarose gel and resolved by
electrophoresis. The samples contained in the gel were subsequently
transferred
to a Hybond-N+ membrane available from Amersham (Upsalla, Sweden) by
capillary transfer. A 540 by SmaI fragment from the open reading frame was
15 random primer labeled with P32 using a T~QuickPrime kit (Pharmacia,
Piscathaway, NJ) and purified from non-incorporated nucleotides using NucTrap
column (Stragene, La Jolla, CA) and hybridized.
The hybridization conditions were 6XSSC, SX Denhardt, 0.5% SDS, and
100 pg/ml fragmented and denatured salmon sperm DNA hybridized overnight
20 at 65°C and washed in 2X SSC, 0.1 % SDS once at room temperature for
about
10 minutes followed by 1 time at, 65°C for about 15 minutes followed by
at least
one wash in 0.2XSSC, 0.1 % SDS at room temperature for at least 3-5 minutes.
The blot demonstrated that the 20 kDa gene was present in all tested strains
of S.
pneumoniae.
Example 5
Two DNA primers were prepared from SEQ ID NO:1 and utilized to
amplify the nucleotide sequence encoding the 20 kDa polypeptide from S.
pneumoniae (serotype 3 ) genomic DNA. The first primer, a 5'-primer, SEQ ID
N0:6, includes an ~.T( i start codon of the S' end of the nucleotide sequence,
inser~=:: ;. i~icol site, and had an Ala residue inserted after the ATG start
codon to
maintain a correct reading frame. The second primer, a 3'-primer '" ~ ,il ID
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
26
N0:7, includes a termination codon at the 3' end of the nucleotide sequence
and
inserts a BamH 1 site.
5'-GGGGG CCA TGG CC TCA AGC CTT TTA CGT GAA TTG-3';
(SEQ ID N0:6)
5'-GGGGG ~A TCC CTA GCT ATA TGA GAT AAA CTT TCC
TGC T-3'; (SEQ ID N0:7)
The two primers were synthesized on an Applied Biosystems 380A DNA
synthesizer (Foster City, CA) using reagents purchased from Glen Research
(Sterling, VA). Amplifications were performed utilizing a Perkin Elmer
Thermocycler (ABI) according to the manufacturer's directions. The identified
PCR product was ligated into the TA tailed PCR cloning vector PCR2.1,
available from Invitrogen, Carlsbad, CA, and used to transform OneShot
ToplOF' competent cells (Invitrogen). Kanamycin resistant transformants were
screened by restriction enzyme analysis of plasmid DNA prepared by alkaline
lysis. An approximately 500 by insert fragment was identified and subsequently
excised with restriction enzymes Nco 1 and BamH 1. The 500 by fragment was
purified from a low melting agarose gel, and subsequently ligated into the
Ncol-
BamHl sites of the T7 promoted expression vector pET 28a, available from
Novagen ( Madison, WI).
The ligation mixture was subsequently transformed into ToplOF'cells
(Invitrogen}, and the kanamycin resistant transformants were screened by
restriction enzyme analysis of plasmid DNA prepared by alkaline lysis. A
recombinant plasmid (pLP505) was subsequently tranformed into BL21
(Novagen) cells and grown in SOB media supplemented with 30 ~g/ml
kanamycin. Cells were grown to an O.D.6~ of 0.6, and were subsequently
induced with 0.4mM IPTG (Boehringer Mannheim, Indianapolis, Indiana) for 2-
4 hours. Whole cell lysates were prepared and electrophoresed on a 14% SDS-
PAGE gel. The gel was stained with Coomassie and the expression product was
detecte~'. i he coomassie stained gel revealed a band between the 28 kDa and
the
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
27
18 kDa molecular weight markers, and was determined to be approximately 20
kDa.
The DNA sequence of the insert in the recombinant pLP505 plasmid was
obtained using the ABI 370A DNA sequencer. The DNA sequence was aligned
5 with the DNA sequence of SEQ ID NO:1, using the Pustell DNA matrix plot
feature of MacVector (Oxford Molecular Group, Campbell, CA). Alignment of
the DNA sequence obtained from the pLP505 plasmid, SEQ ID NO:1, and the S
pneumoniae (serotype 4) genome, revealed that the open reading frame (ORF)
that codes for the 20 kDa polypeptide may be part of a larger ORF, i.e., a
2478
10 by in the serotype 4 genome, that codes for a polypeptide with a predicted
MW
of approximately 92 kDa (SEQ ID NO: 4). DNA SEQ ID N0:4 encodes for a
predicted amino acid sequence as shown in SEQ ID NO:S.
The S. pneumoniae (serotype 4) genome sequence was obtained from
The Institute for Genomic Research at www.tigr.org and/or through NCBI at
15 www.ncbi.nlm.nih.gov, using the ClustalW feature of MacVector, (Oxford
Molecular Group, Campbell CA). A sequence comparison was made between
the 20 kDa amino acid sequence (SEQ ID N0:2) and the predicted 92 kDa
amino acid sequence (SEQ ID NO:S).
Based upon the available genomic DNA (serotype 4) sequence, two
20 primers flanking the 2478 by ORF were designed and subsequently synthesized
using the ABI 380A DNA synthesizer (SEQ ID NOS:8 and 9). SEQ ID N0:8
was an S. pneumoniae 5'-primer having an inserted Ncol site and a "Glu"
residue added after the ATG start codon to maintain a correct reading frame.
SEQ ID N0:9, was an S. pneumoniae 3'-primer having an inserted HindIII site.
5'- CCC GGG CCA TGG CTA AAA TTA ATA AAA AAT ATC TAG
-3'; (SEQ ID N0:8)
5'-CCG GGC AAG CTT TTA CTT ACT CTC CT-3'-; (SEQ ID N0:9)
An approximately 2400 by DNA fragment was then amplified from the 4
different S. pneumoniae serotypes (serotype 3, 5; 6B and 7) rP~:;,;;;ng in 4
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
28
fragments. Each of the 4 fragments were subsequently ligated into the PCR
cloning vector PCR2.1 (Invitrogen), and used to transform OneShot Top l OF'
cells (Invitrogen). Kanamycin resistant transformants were screened by
restriction analysis of the plasmid DNA prepared by alkaline lysis. A
recombinant plasmid containing the serotype 7 PCR product was identified,
e.g.,
pLP512. The DNA sequence was obtained from the serotype 7 clone using the
ABI model 370A DNA sequencer. The DNA sequence was essentially identical
to SEQ ID N0:4 and encoded a predicted amino acid sequence essentially
identical to SEQ ID NO:S.
Example_6
Western blot detection of 92 lcDa Polypeptide in Whole Pneumococci
Recombinant approximately 20 kDa C3 degrading polypeptide was
purified from Escherichia coli strain BLR containing plasmid pDF122. Plasmid
pDF122 contains the polynucleotide shown in SEQ ID NO:1 expressed under
control of the T7 phage promoter system. The bacterial cells were grown to mid-
log phase in Hy-Soy/yeast Extract medium containing ampicillin to select for
the
plasmid. Expression of the recombinant polypeptide was induced by adding
IPTG to a concentration of 1 mM and continuing incubation for an additional 3
hours. The bacterial cells were harvested by centrifugation and resuspended in
Tris buffered saline, pH 7.2. Cells were mechanically lysed in a French
Pressure
cell and the insoluble material including inclusion bodies were pelleted in a
centrifuge. The pellet was solubilized in 3 M Urea buffered with 100mM NaP04,
pH 8.0 containing 0.1% Triton X-100. After pelleting and discarding insoluble
material (centrifuged at 100,000 x g), the soluble r 20kDa polypeptide was
exchanged into 0.1% Zwittergent 3-12 (Calbiochem-Behrng) replacing the Urea
and then into 100 mM NaP04 pH 8.0 replacing the detergent. SDS-PAGE
analysis confirmed that the ~20 kDa material remained soluble. The His-tagged
recombinant polypeptide was dialyzed into 50 mM NaP04 buffer, pH 8.0 and
absorbed onto a Ni column equilibrated with the same buffer. The column was
sequentially washed with 50 mM NaP04 at pH 7.0, 6.6, and 5.5 until baseline
absorbances (OD2go) were reached with each buffer. The bound ~r20 kDa
~"... .._
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
29
polypeptide was eluted with 50 mM NaP04, pH 4.5. The eluted polypeptide was
approximately 90% homogeneous in SDS-PAGE analysis.
This polypeptide was used to immunize Swiss-Webster mice. Five pg
doses of the polypeptide were mixed with 50 ~g of Monophosphoryl Iipid A
(Ribi Immunochemicals) and injected intramuscularly into mice. Animals were
immunized at weeks 0, 4, and 6 and exsangruinated at week 8. The sera were
pooled together and found to contain high titered antisera against the
immunogen.
Pneumococcal strains CP 1200, T3, and T7 were grown in Todd-Hewitt
broth containing yeast Extract and the cells pelleted by centrifugation.
Pneumococcal cells were lysed in SDS-PAGE cracking buffer under reducing
conditions by boiling for Sminutes. The lysates were loaded onto a 10% SDS-
PAGE gel and electrophoresed. Separated polypeptides were electroblotted onto
Nitrocellulose and the filter blocked with 5% BLOTTO in phosphate buffered
1 S saline, pH 7.4. The polyclonal antisera was diluted 1:2000 in BLOTTO and
used
to probe the separated polypeptides. Bound antibodies were detected with
Alkaline phosphatase conjugated goat anti-mouse IgG. The Western Blot is
shown in Figure 8 and described further in the brief description of the
figures.
Ex~mplle 7
Evidence of that the 20 kDa and 92 kDa Polypeptides Degrade C3
The gel shown in Figure 9 is a Western blot. This data were obtained by
incubating a 20 kDa polypeptide and a 92 kDa polypeptide with biotinylated and
methylamine-treated C3 as shown in the table below. These polypeptides were
expressed from a T7 vector.
METHYLAMINE-TREATED C3: 500 pl of purified human C3 at
concentration of 4.46 mg/ml (prepared according to the method of Tack et al.,
Meth. Enzymol. 80:64-101, 1984) was incubated with 55 pl of 1 M methylamine
(('1-13NH2) in 0.1 M TRIS/0.01 M EDTA, pH 8.0 for 80 minutes at 37°C,
then
:?~uiyzed overnight in 0.1 M TRIS/0.01 M EDTA, pH 8.0, at 4°C . The
following
day, the C3 was incubated again with 60 ~l of 1 M methylan;i~.ie in 0.1 ~".
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
TRIS/0.01 M EDTA for 80 minutes at 37°C, then dialyzed overnight
in 50 mM
NaHC03 at 4°C .
BIOTINYLATION of METHYLAMINE-TREATED C3: 2 mg
of methylamine-treated C3, prepared above, was incubated with 75 pl of NSC-
5 biotin (Pierce) made as 1 mg NSC biotin in 1 ml H20 for 30 minutes at room
temperature. The biotinylated C3 was dialyzed overnight in 50 mM NaHC03,
pH 8.0 at 4 °C.
Reagents Tube A - 20 kDa Tube C - 92 kDa
Polypeptide 34 p,l 20 kDa polypeptideI 00 ~l 92 kDa polypeptide
5.6 x 10'9 moles 5.6 x 10-9 moles
Biotinylated 3 p,l C3 3 p.l C3
C3 71 x 10-12 moles 71 x 10-2 moles
Buffer 63 ~l 0.01% BSA/PBS63 ~tl 0.01% BSA/PBS
Samples from Tubes A and C were removed after 66 hours of incubation,
reduced by boiling for 2 minutes in reducing buffer with (i mercaptoethanol,
electrophoresed on 7.5% SDS-PAGE, and transferred to nitrocellulose paper for
Western blotting. Western blotting was carried out for one hour according to
standard procedures (Tobin et al. PNAS USA 76:4350-4354, 1979). Membranes
were incubated with horseradish-peroxidase-avidin ( 1:10,000 dilution) and
developed with the Supersignal CL-HRP Substrate System (Amersham) to
detect biotinylated C3 fragments.
In Figure 9 lane 1 is C3 alone (control), lanes 2 and 3 are the 20 and 92
kDa polypeptides, and lanes 4 and S are again C3 alone (controls). Along the
right margin the position of the a-chain of C3, the ~3-chain of C3, and the C3
fragment present in the control samples are shown. The position of a C3
fragment in the 20 kDa digest and several fragments in the 92 kDa digest are
identified.
The second experiment used the reagents of the first (expressed
polypeptides, biotinylated C3, and buffer) in the ~w _.: proporti~::., as
shown in
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
31
the table above. C3 control samples were removed at time 0, 2 hours, 8 hours,
and 24 hours. However, instead of doing a Western blot, the samples were
reduced on 7.5% SDS-PAGE, reasoning that some additional degradation
fragments might not be biotinylated and would therefore show up on a
Coomassie stained SDS-PAGE gel. Indeed, that is what was observed. Only the
20 (lane A8) and 92 (lane C8) kDa polypeptides were analyzed on this gel. The
gel of Figure 10 shows along the right margin the position of the a-chain of
C3
and the (3-chain of C3, and the 92 kDa polypeptide in lane C8. In lane C8 are
at
least two fragments ranging in size from ~90 kDa to 75 kDa. There are also
several fragments beneath the a-chain at 75 kDa. In lane A8 is a major
degradation fragment just below the ~-chain of C3. Thus, both the 92 kDa
polypeptide in lane C8 and the 20 kDa polypeptide in lane A8 degrade C3.
Example 8
Preparation of recombinant 92 lcDa protein and generation of poyclonal
anitsera
The insert in plasmid pLP512 (see Example 5) was excised with Ncol
and HindIII. A fragment of the expected size was purified from low melting
point agarose, and subsequently ligated into the Nco 1- HindIII sites of the
T7
promoted expression vector pET28a (Novagen, Madison, WI).
The ligation mixture was subsequently transformed into TopIOF' cells
(Invitrogen) and the kanamycin resistant transformants were screened as
described previously in Example 5. A recombinant plasmid (pLP515) was
subsequently transformed into BL21 cells (Novagen) and grown in SOB media
supplemented with 30 ~g/ml kanamycin. Cells were grown to an O.D. boo of 0.6,
and were subsequently induced with 0.4 mM IPTG (Boehringer Mannheim,
Indianapolis, IN) for 2-4 hours. Whole cell lysates were prepared and
electrophoresed on a 10% SDS-PAGE gel. Coomassie staining of the gel
revealed a new band of approximately 80 kDa as compared to a pre-induction
sample.
CA 02343931 2001-03-23
WO 00!17370 PCT/US99/22362
32
Recombinant protein coded by the ~92 kDa ORF was purified from E. coli strain
BL21 (Novagen) containing the plasmid pLP515. Bacterial cells were grown to
mid log phase in SOB medium containing SO p,g/ml kanamycin to select for the
plasmid. Expresssion of the recombinant polypeptide was induced by addition
IPTG to 0.4 mM and continuing incubation for 3 hours. The bacterial cells were
harvested by centrifugation and resuspended in Tris-Buffered Saline, pH7.2.
Cells were mechanically lysed in a French Pressure Cell and the insoluble
material including inclusion bodies were pelleted in a centrifuge at 7700 x g
at 4
degrees for 10 minutes. The pellet containing the inclusion bodies was
resolubilized and the soluble protein was purified by ion exchange
chromatography. Recombinant protein was used to generate polyclonal
antibodies in mice. Briefly, S pg of protein was adjuvanted for each dose with
20
p.g QS21 and injected subcutaneously into the necks of a 6-8 weeks Swiss
Webster mice. The mice were bled and vaccinated at week 0, vaccinated at week
4, then bled and exsanguinated at week 6. 10 mice were vaccinated with the
recombinant 92 kDa protein adjuvanted with QS21. Pooled sera were used at a
1:1000 dilution to examine whole cell lysates and concentrated culture
supernatants from several serotypes of S. pneumoniae on a Western Blot. The
sera reacted specifically to a protein in whole cell lysates and concentrated
culture supernatants whose molecular weight was approximately 90 kDa.
Exam
The chart of Figure 11 summarizes the results from an intranasal (IN)
challenge of CBA/CAHN xidlJ mice vaccinated with r92 kDa protein, prepared
as described in Example 8 (SEQ ID NO:S) adjuvanted with monophosphoryl
lipid A (MPL).
10 mice per group were vaccinated subcutaneously in the neck region at
weeks 0, 3,and S, with either 5 pg each of 92 kDa adjuvanted with 50 pg MPL,
1 p.g each of Type 3 capsule conjugated to the protein carrier CRM197
adjuvanted with 100 pg aluminum phosphate, or phosphate buffered saline
(PBS) alone, in a sample volume of 10 ~1. CRM 197 is a genetically detoxified
version Jf diptheria toxin. Each c:-~ouse was cha~:cnged in at week 7 with 1 x
106
" r..,.r " ,~..
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
33
cfu's of Type 3 S. pneumoniae in a 10 p,l sample volume. Nasal tissue was
isolated 3 days after challenge and the number of type 3 S. pneumoniae colony-
forming units per gram of nasal tissue determined by plating on selective
media.
Type 3 is capsule isolated from S. pneumoniae serotype 3, and then conjugated
to protein carrier CRM 197, through reductive animation (see U.S. Patent No.
5,
360,897 for preparation of the Type 3 control; see U.S. Patent No. 5,614,382
for
genetically detoxified version of ditheria toxin; see U.S.Patent 4,902,506
with
regard to using CRM 197 as a carrier).
The chart in Figure 11 shows that in this model, both the negative
controls, mice adjuvanted with MPL and naive mice at 6 weeks of age, had a
survival rate of approximately 30% when challenged intranasally, while the
positive control, the Type 3 conjugate adjuvanted with aluminum phosphate,
offered 100% protection against death to the end of the study, approximately
14
days. When mice immunized with r92 kDa were challenged, 100% survived to
the end of the study, indicating that r92 kDa protein does offer protection
against
death from intranasal challenge by Type 3 S. pneumoniae.
xam l,~e 10
METHODS
Recombinant 92 kDa (r92 kDa) polypeptide (SEQ ID NO:S) were
incubated with purified human C3 for 2 hours, 6 hours, and 26 hours at
37°C in
the following ratios:
Tube A lControl~: C3 - 3p1 [7.2x10-12 moles] PBS/0.01% bovine serum
albumin (BSA) - 100 p.l; Tube B: r92 kDa - 50 pl [5.6x10-10 moles] C3 - 3 pl
[7.2x10-12 moles] PBS/0.01% BSA - SO pl.
At each time point (2, 6, and 26 hours), 20 pl samples were removed
from Tubes A and B reducing buffer was added, and the samples were boiled at
100°C for 2 minutes.
After boiling, samples were electrophoresed on 7.5% SDS-PAGE under
reducing conditions. The SDS-PAGE gel was stained with Coomassie blue. The
resultant gel is shown in Figure I2.
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
34
Lane I - molecular weight standards (reading from top of gel: 200 kDa, 116
kDa, 97 kDa, 66 kDa, 45 kDa); Lanes 2 and 4 - 2 hour incubation; Lane 2 - C3
control (Tube A); Lane 4 - r92 kDa sample (Tube B); Lanes 5 and 7 - 6 hour
incubation; Lane 5 - C3 control (Tube A); Lane 7 - r92 kDa sample (Tube B);
Lanes 8 and 10 - 26 hour incubation; Lane 8 - C3 control (Tube A); Lane 10 -
r92 kDa sample (Tube B).
INTERPRETATION of GEL
The a-chain of C3 runs at about 11 S kDa. The [3-chain of C3 runs at
about 75 kDa. These are marked on the gel. The band at about 66 kDa is
albumin. Lanes 2 and 4 are the 2-hour incubation. Compared to Lane 2 (C3
control), Lane 4 shows cleavage of the C3 a-chain - new fragment at ~97 kDa.
Lanes 5 and 7 are the 6-hour incubation. There is the same new 97 kDa cleavage
fragment in Lane 7. Lanes 8 and 10 are the 26-hour incubation. Compared to
Lane 8 (C3 control), Lane 10 shows continued cleavage of the a-chain.
It will be appreciated by those skilled in the art that while the invention
has been described above in connection with particular embodiments and
examples, the invention is not necessarily so limited and that numerous other
embodiments, examples, uses, modifications and departures from the
embodiments, examples and uses may be made without departing from the
inventive scope of this application.
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
1
SEQUENCE LISTING
<110> HOSTETTER, Margaret K.
FINKEL, David J.
CHENG, Qi
MASI, Amy W.
REGENTS OF THE UNIVERSITY OF MINNESOTA
AMERICAN CYNAMID COMPANY
<120> HUMAN COMPLEMENT C3-DEGRADING PROTEINASE FROM
STREPTOCOCCUS PNEUMONIAE
<130> 11000570230
<140> Not Assigned
<191> 1999-09-24
<150> 60/101,736
<151> 1998-09-24
<150> 09/283,094
<151> 1999-03-31
<160> 10
<170> PatentIn Ver. 2.0
<210> 1
<211> 504
<212> DNA
<213> Streptococcus pneumoniae
<400> 1
atgtcaagcc ttttacgtga attgtatgct aaacccttat cagaacgcca tgtagaatct 60
gatggcctta ttttcgaccc agcgcaaatc acaagtcgaa ccgccaatgg tgttgctgta 120
ccgcacggag accattatca ctttattcct tattcacaac tgtcaccttt ggaagaaaaa 180
ttggctcgta ttattcccct tcgttatcgt tcaaaccatt gggtaccaga ttcaagacca 240
gaacaaccaa gtccacaatc gactccggaa cctagtccaa gtccgcaacc tgcaccaaat 300
cctcaaccag ctccaagcaa tccaattgat gagaaattgg tcaaagaagc tgttcgaaaa 360
gtaggcgatg gttatgtctt tgaggagaat ggagttcctc gttatatccc agccaaggat 420
ctttcagcag aaacagcagc aggcattgat agcaaactgg ccaagcagga aagtttatct 480
cataagctgc agttagatcc atta 504
<210> 2
<211> 168
<212> PRT
<213> Streptococcus pneumoniae
<400> 2
Met Ser Ser Leu Leu Arg Glu Leu Tyr Ala Lys Pro Leu Ser Glu Arg
1 5 10 15
His Val Glu Ser Asp Gly Leu Ile Phe Asp Pro Ala Gln Ile Thr Ser
20 25 30
Arg Thr Ala Asn Gly Val Ala Val Pro His Gly Asp His Tyr His Phe
35 40 95
Ile Pro Tyr Ser Gln Leu Ser Pro Leu Glu Glu Lys Leu Ala Arr Ile
50 55 60
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
2
Ile Pro Leu Arg Tyr Arg Ser Asn His Trp Val Pro Asp Ser Arg Pro
65 70 75 80
Glu Gln Pro Ser Pro Gln Ser Thr Pro Glu Pro Ser Pro Ser Pro Gln
85 90 95
Pro Ala Pro Asn Pro Gln Pro Ala Pro Ser Asn Pro Ile Asp Glu Lys
100 105 110
Leu Val Lys Glu Ala Val Arg Lys Val Gly Asp Gly Tyr Val Phe Glu
115 120 125
Glu Asn Gly Val Pro Arg Tyr Ile Pro Ala Lys Asp Leu Ser Ala Glu
130 135 140
Thr Ala Ala Gly Ile Asp Ser Lys Leu Ala Lys Gln Glu Ser Leu Ser
145 150 155 160
His Lys Leu Gln Leu Asp Pro Leu
165
<210> 3
<211> 504
<212> DNA
<213> Streptococcus pneumoniae
<400> 3
taatggatct aactgcagct tatgagataa actttcctgc ttggccagtt tgctatcaat 60
gcctgctgct gtttctgctg aaagatcctt ggctgggata taacgaggaa ctccattctc 120
ctcaaagaca taaccatcgc ctacttttcg aacagcttct ttgaccaatt tctcatcaat 180
tggattgctt ggagctggtt gaggatttgg tgcaggttgc ggacttggac taggttccgg 290
agtcgattgt ggacttggtt gttctggtct tgaatctggt acccaatggt ttgaacgata 300
acgaagggga ataatacgag ccaatttttc ttccaaaggt gacagttgtg aataaggaat 360
aaagtgataa tggtctccgt gcggtacagc aacaccattg gcggttcgac ttgtgatttg 420
cgctgggtcg aaaataaggc catcagattc tacatggcgt tctgataagg gtttagcata 480
caattcacgt aaaaggcttg acat 504
<210> 4
<211> 2478
<212> DNA
<213> Streptococcus pneumoniae
<900> 4
atgaaaatta ataaaaaata tctagcaggt tcagtggcag tccttgccct aagtgtttgt 60
tcctatgaac ttggtcgtca ccaagctggt caggttaaga aagagtctaa tcgagtttct 120
tatatagatg gtgatcaggc tggtcaaaag gcagaaaact tgacaccaga tgaagtcagt 180
aagagggagg ggatcaacgc cgaacaaatc gtcatcaaga ttacggatca aggttatgtg 290
acctctcatg gagaccatta tcattactat aatggcaagg tcccttatga tgccatcatc 300
agtgaagagc tcctcatgaa agatccgaat tatcagttga aggattcaga cattgtcaat 360
gaaatcaagg gtggttatgt tatcaaggta gatggaaaat actatgttta ccttaaggat 420
gcagctcatg cggataatat tcggacaaaa gaagagatta aacgtcagaa gcaggaacac 480
agtcataatc acgggggtgg ttctaacgat caagcagtag ttgcagccag agcccaagga 540
cgctatacaa cggatgatgg ttatatcttc aatgcatctg atatcattga ggacacgggt 600
gatgcttata tcgttcctca cggcgaccat taccattaca ttcctaagaa tgagttatca 660
gctagcgagt tagctgctgc agaagcctat tggaatggga agcagggatc tcgtccttct 720
tcaagttcta gttataatgc aaatccagct caaccaagat' tgtcagagaa ccacaatctg 780
actgtcactc c:aacttatca tcaaaatcaa ggggaaaaca tttcaagcct tttacgtgaa 840
ttgtatgcta aacccttatc agaacgccat gtggaatctg atggccttat tttcgaccca 900
gcgcaaatca caagtcgaac cgccagaggt gtagctgtcc ctcatggtaa ccattaccac 960
tttatccctt ar_gaacaaat gtctgaattg gaaaaacgaa ttgctc~4tat tattcccctt 1020
cgttatcgtt caaaccattg ggtaccagat tcaagaccag ~=~aaccaag tccacaatcg 1080
actccggaac otagtccaag tccgcaacr' gcaccaaa~~; ctcaaccagc tccaagcaat 1140
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
3
ccaattgatg agaaattggt caaagaagct gttcgaaaag taggcgatgg ttatgtcttt 1200
gaggagaatg gagtttctcg ttatatccca gccaaggatc tttcagcaga aacagcagca 1260
ggcattgata gcaaactggc caagcaggaa agtttatctc ataagctagg agctaagaaa 1320
actgacctcc catctagtga tcgagaattt tacaataagg cttatgactt actagcaaga 1380
attcaccaag atttacttga taataaaggt cgacaagttg attttgaggc tttggataac 1440
ctgttggaac gactcaagga tgtcccaagt gataaagtca agttagtgga tgatattctt 1500
gccttcttag ctccgattcg tcatccagaa cgtttaggaa aaccaaatgc gcaaattacc 1560
tacactgatg atgagattca agtagccaag ttggcaggca agtacacaac agaagacggt 1620
tatatctttg atcctcgtga tataaccagt gatgaggggg atgcctatgt aactccacat 1680
atgacccata gccactggat taaaaaagat agtttgtctg aagctgagag agcggcagcc 1740
caggcttatg ctaaagagaa aggtttgacc cctccttcga cagaccatca ggattcagga 1800
aatactgagg caaaaggagc agaagctatc tacaaccgcg tgaaagcagc taagaaggtg 1860
ccacttgatc gtatgcctta caatcttcaa tatactgtag aagtcaaaaa cggtagttta 1920
atcatacctc attatgacca ttaccataac atcaaatttg agtggtttga cgaaggcctt 1980
tatgaggcac ctaaggggta tactcttgag gatcttttgg cgactgtcaa gtactatgtc 2040
gaacatccaa acgaacgtcc gcattcagat aatggttttg gtaacgctag cgaccatgtt 2100
caaagaaaca aaaatggtca agctgatacc aatcaaacgg aaaaaccaag cgaggagaaa 2160
cctcagacag aaaaacctga ggaagaaacc cctcgagaag agaaaccgca aagcgagaaa 2220
ccagagtctc caaaaccaac agaggaacca gaagaatcac cagaggaatc agaagaacct 2280
caggtcgaga ctgaaaaggt tgaagaaaaa ctgagagagg ctgaagattt acttggaaaa 2340
atccaggatc caattatcaa gtccaatgcc aaagagactc tcacaggatt aaaaaataat 2400
ttactatttg gcacccagga caacaatact attatggcag aagctgaaaa actattggct 2460
ttattaaagg agagtaag 2478
<210> 5
<211> 826
<212> PRT
<213> Streptococcus pneumoniae
<400> 5
Met Lys Ile Asn Lys Lys Tyr Leu Ala Gly Ser Val Ala Val Leu Ala
1 5 10 15
Leu Ser Val Cys Ser Tyr Glu Leu Gly Arg His Gln Ala Gly Gln Val
20 25 30
Lys Lys Glu Ser Asn Arg Val Ser Tyr Ile Asp Gly Asp Gln Ala Gly
35 40 95
Gln Lys Ala Glu Asn Leu Thr Pro Asp Glu Val Ser Lys Arg Glu Gly
50 55 60
Ile Asn Ala Glu Gln Ile Val Ile Lys Ile Thr Asp Gln Gly Tyr Val
65 70 75 80
Thr Ser His Gly Asp His Tyr His Tyr Tyr Asn Gly Lys Val Pro Tyr
85 90 95
Asp Ala Ile Ile Ser Glu Glu Leu Leu Met Lys Asp Pro Asn Tyr Gln
100 105 110
Leu Lys Asp Ser Asp Ile Val Asn Glu Ile Lys Gly Gly Tyr Val Ile
115 120 125
Lys Val Asp G'ly Lys Tyr Tyr Val Tyr Leu Lys Asp Ala Ala His Ala
130 135 140
Asp Asn Ile Ard ':'hr Lys Glu Glu Ile Lys Arg Gln Lys Gln Glu Hia
145 150 155 l~C
Ser His Asn His Gly Gly Gly Ser Asn Asp :;in Ala Val Val Ala Ala
165 170 175
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
9
Arg Ala Gln Gly Arg Tyr Thr Thr Asp Asp Gly Tyr Ile Phe Asn Ala
180 185 190
Ser Asp Ile Ile Glu Asp Thr Gly Asp Ala Tyr Ile Val Pro His Gly
195 200 205
Asp His Tyr His Tyr Ile Pro Lys Asn Glu Leu Ser Ala Ser Glu Leu
210 215 220
Ala Ala Ala Glu Ala Tyr Trp Asn Gly Lys Gln Gly Ser Arg Pro Ser
225 230 235 240
Ser Ser Ser Ser Tyr Asn Ala Asn Pro Ala Gln Pro Arg Leu Ser Glu
245 250 255
Asn His Asn Leu Thr Val Thr Pro Thr Tyr His Gln Asn Gln Gly Glu
260 265 27p
Asn Ile Ser Ser Leu Leu Arg Glu Leu Tyr Ala Lys Pro Leu Ser Glu
275 280 285
Arg His Val Glu Ser Asp Gly Leu Ile Phe Asp Pro Ala Gln Ile Thr
290 295 300
Ser Arg Thr Ala Arg Gly Val Ala Val Pro His Gly Asn His Tyr His
305 310 315 320
Phe Ile Pro Tyr Glu Gln Met Ser Glu Leu Glu Lys Arg Ile Ala Arg
325 330 335
Ile Ile Pro Leu Arg Tyr Arg Ser Asn His Trp Val Pro Asp Ser Arg
340 345 350
Pro Glu Gln Pro Ser Pro Gln Ser Thr Pro Glu Pro Ser Pro Ser Pro
355 360 365
Gln Pro Ala Pro Asn Pro Gln Pro Ala Pro Ser Asn Pro Ile Asp Glu
370 375 380
Lys Leu Val Lys Glu Ala Val Arg Lys Val Gly Asp Gly Tyr Val Phe
385 390 395 900
Glu Glu Asn Gly Val Ser Arg Tyr Ile Pro Ala Lys Asp Leu Ser Ala
405 410 915
Glu Thr Ala Ala Gly Ile Asp Ser Lys Leu Ala Lys Gln Glu Ser Leu
420 425 430
Ser His Lys Leu Gly Ala Lys Lys Thr Asp Leu Pro Ser Ser Asp Arg
435 490 4q5
Glu Phe Tyr Asn Lys Ala Tyr Asp Leu Leu Ala Arg Ile His Gln Asp
450 455 460
Leu Leu Asp Asn Lys Gly Arg Gln Val Asp Phe Glu Ala Leu Asp Asn
465 470 475 480
Leu Leu Glu Arg Leu Lys Asp Val Pro Ser Asp Lys Val Lys Leu Val
985 490 995
Asp Asp Ile Leu Ala Phe Leu Ala Pro Ire Arg His Pro Glu Arg Leu
500 ''J~ 51-0
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
Gly Lys Pro Asn Ala Gln Ile Thr Tyr Thr Asp Asp Glu Ile Gln Val
515 520 525
Ala Lys Leu Ala Gly Lys Tyr Thr Thr Glu Asp Gly Tyr Ile Phe Asp
530 535 590
Pro Arg Asp Ile Thr Ser Asp Glu Gly Asp Ala Tyr Val Thr Pro His
545 550 555 560
Met Thr His Ser His Trp Ile Lys Lys Asp Ser Leu Ser Glu Ala Glu
565 570 575
Arg Ala Ala Ala Gln Ala Tyr Ala Lys Glu Lys Gly Leu Thr Pro Pro
580 585 590
Ser Thr Asp His Gln Asp Ser Gly Asn Thr Glu Ala Lys Gly Ala Glu
595 600 605
Ala Ile Tyr Asn Arg Val Lys Ala Ala Lys Lys Val Pro Leu Asp Arg
610 615 620
Met Pro Tyr Asn Leu Gln Tyr Thr Val Glu Val Lys Asn Gly Ser Leu
625 630 635 640
Ile Ile Pro His Tyr Asp His Tyr His Asn Ile Lys Phe Glu Trp Phe
645 650 655
Asp Glu Gly Leu Tyr Glu Ala Pro Lys Gly Tyr Thr Leu Glu Asp Leu
660 665 670
Leu Ala Thr Val Lys Tyr Tyr Val Glu His Pro Asn Glu Arg Pro His
675 680 685
Ser Asp Asn Gly Phe Gly Asn Ala Ser Asp His Val Gln Arg Asn Lys
690 695 700
Asn Gly Gln Ala Asp Thr Asn Gln Thr Glu Lys Pro Ser Glu Glu Lys
705 710 715 720
Pro Gln Thr Glu Lys Pro Glu Glu Glu Thr Pro Arg Glu Glu Lys Pro
725 730 735
Gln Ser Glu Lys Pro Glu Ser Pro Lys Pro Thr Glu Glu Pro Glu Glu
790 795 750
Ser Pro Glu Glu Ser Glu Glu Pro Gln Val Glu Thr Glu Lys Val Glu
755 760 765
Glu Lys Leu Arg Glu Ala Glu Asp Leu Leu Gly Lys Ile Gln Asp Pro
770 775 780
Ile Ile Lys Ser Asn Ala Lys Glu Thr Leu Thr Gly Leu Lys Asn Asn
785 790 795 800
Leu Leu Phe Gly Thr Gln Asp Asn Asn Th- Ile Met Ala Glu Ala Glu
805 81;~~ 815
Lys Leu Leu Ala Leu Leu Lys Glu Ser Lye
820 825
<210> 6
<211> 39
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
6
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence:Primer
<220>
<223>Incorporates a Ncol site and codon for ala.
a DNA
<400>6
gggggccatg 34
gcctcaagcc
ttttacgtga
attg
<210>7
<211>39
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence:Primer
<220>
<223>Incorporates a BamHl site.
<400>7
gggggggatc t 39
cctagctata
tgagataaac
tttcctgc
<210>8
<211>36
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence:Primer
<220>
<223>Incorporates a Ncol site and codon for Glu.
a DNA
<400>8
cccgggccat 36
ggctaaaatt
aataaaaaat
atctag
<210>9
<211>26
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence:Primer
<220>
<223>Incoporates a HindD III site.
<400>9
ccgggcaagc 26
ttttacttac
tctcct
<210>10
<211>40
<212>DNA
<213>Artificial Sequence
<220>
<223>Description of Artificial Sequence:Probe
<220>
CA 02343931 2001-03-23
WO 00/17370 PCT/US99/22362
<223> Oligonucleotide
<900> 1D_
gaaaacaata atgtagaaga ctactttaaa gaaggttaga 40