Note: Descriptions are shown in the official language in which they were submitted.
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
A novel splice variant of MyD88 and uses thereof
Field of the invention
The present invention relates to the field of infection and inflammation and
more
specifically to the field of pathogen-induced nuclear factor kappa B
activation. More
specifically, a novel splice variant of MyD88, (MyD88s), has been identified
encoding a
protein that inhibits TLR-induced NF-kappaB activation. MyD88s is a target to
inhibit
the phenomenon of endotoxin-tolerance that occurs in sepsis.
Background of the invention
The MyD88 gene was originally described as one of several myeloid
differentiation
primary response genes that are induced in murine M1 myeloblastic leukemia
cells
upon stimulation with IL-6. It is an exclusively cytosolic protein that
functions as a
unique adaptor for members of the type I interleukin-1 receptor (IL-1 R)/Toll
like
receptor (TLR) family. The MyD88 protein has a modular structure. At its N-
terminus it
has a 'death domain' (DD) similar to the cytoplasmic signalling domains found
in many
members of the tumour necrosis factor (TNF) receptor superFamily. Its C-
terminal
domain is conserved in all members of the TLR/IL-1 R superfamily, and is
therefore
termed the 'Toll/IL-1R' (TIR) domain. Both domains are required for MyD88
homodimerization, and are separated by a short intermediate domain (ID) of
unknown
function. The TIR domain of MyD88 forms a homophylic interaction with the TIR
domain of IL-1 R and IL-1 Receptor accessory protein (IL-1 RacP), IL-18R, and
several
TLRs, whereas the DD binds with the DD of both IL-1 receptor associated kinase
(IRAK) and IRAK-2. Interaction with MyD88 triggers IRAK phosphorylation.
Phosphorylated IRAK leaves the receptor complex and associates with TNF
receptor
associated factor 6 (TRAF 6), which forms a molecular link to activation of NF-
kappaB
and c-jun N-terminal kinase (JNK). Targeted disruption of the MyD88 gene
showed
unambiguously the importance of MyD88 in IL-1, IL-18 and TLR (including LPS)
signalling pathways. All IL-1 and IL-18 responses (including T-cell
proliferation and
induction of cytokines and acute phase proteins) were abrogated in MyD88-~-
cells and
no NF-kappaB or JNK activity was observed. MyD88-~- cells were resistant to
LPS-
induced endotoxic shock, but still showed delayed NF-kappaB translocation to
the
nucleus, which suggests redundancy at the level of MyD88 in the LPS-pathway.
1
CONFIRMATION COPY
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
MyD88 mRNA expression has been found to be constitutively expressed in many
adult
human tissues as a 2.6 kb mRNA species. In the present invention we describe
the
identification, characterization and uses of a splice variant of MyD88, termed
MyD88s,
which encodes for a protein lacking the ID. We have disclosed earlier the
occurrence
of an unknown splice variant of MyD88, lacking part of the TIR domain, that
can inhibit
IL1-induced NF-kappaB activation (Janssens S. and Beyaert R. (2000)
Scandinavian
J, of Immunology, 51 (Suppl. 7), 1.
A first aspect of the invention deals with endotoxin tolerance. Endotoxin
tolerance is
thought to be an adaptive response to protect the body from hyperactivation of
the
innate immune system during bacterial infections. However, although preventing
the
initial development of sepsis, endotoxin tolerance can also lead to a fatal
blunting of
the immune response to subsequent infections in survivors of sepsis (Kox et
al. (2000)
Intensive Care Med. 26, 124). Despite considerable efforts to find therapies
to treat
patients from septic shock, so far most clinical trials yielded disappointing
results (Kox
et al. (2000) Intensive Care Med. 26, 124). Most of them were aimed at
downregulation
of the hyperinflammatory state by administration of IL-1 antagonists or anti-
TNF or
anti-LPS-antibodies. One of the reasons for the failure of these therapies
might be the
delay between the onset of sepsis and the beginning of treatment thus, at the
time the
patient enters the hospital, the initial hyper-inflammatory state is already
counteracted
by a secondary hypo-inflammatory response. Therefore, new therapies focus on a
restoration of the immune response by treatment with pro-inflammatory
molecules
(Docke et al. (1997) Nature Med. 3(6) 678). However, restoration of the
response
might be hampered by cross-tolerance against IL-1 and TNF. Therefore, directly
interfering with the development of tolerance is a more attractive approach.
Endotoxin
tolerance is associated with monocyte deactivation which results in an
impaired
cytokine production or HLA-DR expression. The situation can be mimicked in
vitro by
pretreatment of monocytes with endotoxin which makes them refractory to
subsequent
LPS challenges (Adib-Conquy et al. (2000) Am. J. respir. Crit. Care Med. 164,
1877).
Several mechanisms have been proposed to explain the impaired response e.g.
diminished expression of TLR, changed p65/p50 ratio or expression of immuno-
inhibitory factors such as IL10. Recently, a paper by Li et al. (2000) J.
Biol. Chem. 275,
23340) shows that IRAK-phosphorylation upon LPS activation is impaired in
endotoxin
tolerant monocytes. Here we show that MyD88s, a splice variant of MyD88 which
blocks NF-xB activation, prevents IRAK-phosphorylation, and is upregulated in
2
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
endotoxin tolerant monocytes. The present invention shows that MyD88s has a
role in
the induction of endotoxin tolerance, the transient, secondary downregulation
of a
subset of endotoxin-driven responses after exposure to bacterial products. It
is shown
that MyD88s behaves as a dominant negative inhibitor of t_PS-, but not of TNF-
induced
NF-kappaB activation.
A second aspect of the invention deals with the so-called JNK and NF-kappaB
signaling pathways, both of which consist of tiers of protein kinases, and are
pivotal in
determining whether cells die or survive. The JNKs are part of the
evolutionarily
conserved mitogen-activated protein kinase family, and are implicated in cell-
death
pathways stimulated by environmental stresses and TNF. Once activated, JNK
proteins can move from the cytoplasm of the cell into the nucleus. There, they
phosphorylate and activate numerous transcription factors. However, the exact
mechanism by which JNKs contribute to cell death are still unknown, but mostly
cell
death requires a sustained activation of the JNK pathway. In contrast, NF-
kappaB
enhances cell survival by switching on genes that dampen pro-apoptotic
signals. It was
shown that NF-KB can downregulate pro-apoptotic JNK signalling in response to
TNF
and chemotherapeutic drugs by shifting the sustained JNK activation to a more
transient activation. The JNK inhibiting effect of NF-KB was mediated by the
transcriptional upregulation of specific proteins (XIAP, Gadd45~i). The
present
invention demonstrates that MyD88s allows specific activation of the JNK
pathway and
AP-1 dependent gene expression, while blocking NF-kappa B dependent gene
expression. Since it is known that the c-JUN N-terminal kinase pathway is
involved in
the control of programmed cell death, MyD88s can be used to stimulate
apoptosis in
for example cancer, or other situations where a lack of programmed cell death
occurs.
A third aspect of the invention deals with the expression of MyD88s in immune
privileged tissues. Immune privilege is an example of regional immunity:
immune
effector cells are not only differentiated for maximum ability to eliminate
pathogens, but
also for minimum ability to interfere with a specific organ or tissue's
physiological
function. It has been described in certain sites of the body (testis, eye,
brain, placenta)
which show a limited and controlled activation of the local immune response,
and has
been associated with immunosuppression and increased programmed cell death of
invading inflammatory cells (Streilein (1995) Science, 270, 1158; Ferguson and
Griffith
(1997) Immunol. Rev., 156, 167). The present invention shows that MyD88s is
specifically expressed in brain, testis, and eye of C57/BL6 mice, which is
consistent
3
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
with a role in immune privilege. The present invention also shows expression
of
MyD88s in the spleen under specific conditions (e.g. in Balb/c mice; in TNF-
treated
C57/BL6 mice). The spleen has a well-established role in immune regulation. As
a
lymphoid organ it provides a microenvironment where several immune cells come
into
close proximity, enabling a more efficient immune response (for review see
Delves and
Roitt (2000) New Engl. J. Med. 343, 108). Besides having a role in the
initiation of an
immune reaction, a more immunoregulatory and immunosuppressive role has also
been attributed to the spleen. In several situations such as graft-versus-host
disease
(Wall et al. (1988) J. Immunol., 140, 2970), cyclophosphamide treatment
(Angulo et al.
(2000) Blood, 95, 212), Vaccinia-virus infection (Bronte et al. (1998) J.
Immunol., 161,
5313) or in tumor models (Kusmartsev et al. (2000) J. Immunol., 165, 779), an
immune
suppressive cell population can be found in the spleen, accounting for the
marked
splenic B/T cell hyporesponsiveness occurring in these conditions. The exact
nature of
these so-called "natural suppressor" cells is far from clear and may be
difFerent in each
model system, although most data suggest that the immunosuppressive activity
can be
attributed to non-lymphoid cells, derived from the monocyte/macrophage lineage
(Bronte et al. (2000) Blood, 96, 3838). Therefore, MyD88s can be used to
obtain
immunosuppression (e.g. in the case of transplantation).
In conclusion, the invention shows that modulation of the expression of MyD88s
can
regulate the cellular responses to LPS and other immunological stimuli.
Brief description of figures
Fig. 1: Identification of a splice variant of MyD88, which lacks the
intermediate
domain.
(a) Schematic representation of the MyD88~ and MyD88S protein structure,
showing
the three different domains and the corresponding exons. Numbers refer to the
positioning of the amino acids. (b) RT-PCR with MyD88 specific primers on RNA
isolated from Mf4/4 cells. The second lane shows a control without reverse
transcriptase (RT). (c) PCR analysis on a Balb/c mouse tissue cDNA panel with
MyD88 and ~i-actin specific primers.
Fig. 2: MyD88S specifically inhibits IL-1- and LPS-induced NF-xB activation.
HEK293T cells (a)-(b) or Mf4/4 cells (c) were transiently transfected with the
NF-xB
4
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
dependent luciferase reporter plasmid pNFconluc and the (i-galactosidase
reporter
plasmid pPGKneogal, each time combined with an expression plasmid for either
MyD88S, MyD88~, MyD88-TIR or empty vector (EV) as indicated. 48 h post-
transfection
cells were either left untreated or stimulated for 6 h with 100 ng/ml IL-1 ~i
(a), 100 ng/ml
TNF (b) or 100 ng/ml LPS (c). Luciferase activity in cell extracts is
normalized for
differences in transfection efficiency on the basis of ~i-galactosidase
activity. Values
are the mean (~ standard error) of three different transfections within a
single
experiment, and are expressed as fold induction relative to the unstimulated
EV
control. (a Insert) Electrophoretic mobility shift assay with nuclear extracts
prepared
from HEK293T cells that were transiently transfected with empty vector (EV),
MyD88~
or MyD88S. The shift in migration of a 32P-labeled Ig ~cB DNA-oligo upon
binding of NF-
~cB is shown. Proper expression of MyD88s and MyD88~ was verified by western
blot
analysis (data not shown).
Fig. 3: MyD88S competes with MyD88~ for dimer formation (a) and recruitment to
the IL-1R (b). HEK293T cells were transiently transfected with different
expression
plasmids for epitope-tagged proteins (amounts shown in ~.g on top of each
figure). Cell
extracts were immunoprecipitated (IP) with anti-Flag antibody, and co-
immunoprecipitating proteins were revealed by western blotting (WB) with anti-
E-tag
antibody (upper panel). Immunoprecipitation of Flag-tagged proteins was
confirmed by
western blotting (middle panel). Expression of transfected proteins was
confirmed by
western blotting of total lysates (TL) with anti-E-tag antibody (lower panel).
Fig. 4: MyD88s still allows IRAK recruitment to the IL-1 R complex (a), but no
longer induces IRAK phosphorylation (b). (a) HEK293T cells were transiently
transfected with expression plasmids for epitope-tagged proteins (amounts
shown in
~,g on top of each figure). Cell extracts were immunoprecipitated (IP) with
anti-Flag
antibody, and co-immunoprecipitating proteins were revealed by western
blotting (WB)
with an anti-IRAK antibody (upper panel). Immunoprecipitation of Flag-tagged
proteins
was confirmed by western blotting (second panel). Expression of transfected
proteins
was confirmed by western blotting of total lysates (TL) with the indicated
antibodies
(two lower panels). Upper bands of IRAK represent phosphorylated proteins
(IRAK-P),
lower bands represent unphosphorylated IRAK. (b) HEK293T cells were
transiently
transfected with expression plasmids for epitope-tagged MyD88 (amounts shown
in ~.g
5
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
on top of the figure), in combination with either an expression plasmid for
IRAK(T66A)
or IRAK-N(T66A). Cell lysates were analysed by western blotting and probed
with anti-
IRAK (upper and middle panel) or anti-E-tag antibody (lower panel).
Fig. 5: Expression of endogenous MyD88S in LPS-pretreated human monocytes
is associated with a diminished LPS-response. THP-1 cells were either left
untreated or treated with 500 ng/ml LPS for 16 h, washed three times with
serumfree
RPMI, resuspended in fresh culture medium and restimulated with 500 ng/ml LPS
for
different time periods. (a)-(b) MyD88S and IKB-a expression levels were
analyzed by
western blotting after 2 h and 20 min restimulation with LPS, respectively.
(c) TNF
levels in the supernatant were measured in a TNF-bioassay after 3 h
restimulation with
LPS and are expressed as the mean ~ standard error of three different samples.
No
signal means that TNF levels were below the detection limit of the assay (=25
pg/ml).
Fig. 6: MyD88s does not inhibit IL-1 induced activation of JNK
HEK293T cells were transiently transfected with an expression plasmid for Flag-
tagged
JNK, together with increasing concentrations of different MyD88 proteins. 2
days later,
cells were treated for 30 min or 4h with IL-1 and analysed for JNK
phosphorylation by
immunoblotting with a phospho-JNK specific antibody (upper panel). Total
expression
of JNK was verified by western blotting with anti-Flag. This shows that IL-1
induces the
phosphorylation of JNK after 30 min as well as after 4h treatment.
Coexpression of
MyD88-TIR (deletion mutant of MyD88 which only expresses the TIR domain) or
MyD88-Ipr (point mutant in the death domain which disrupts the structure of
the death
domain), alriiost completely prevented the IL-1 induced JNK phosphorylation,
confirming the previously shown dominant-negative effect of these mutants. In
contrast
to MyD88-TIR and MyD88-Ipr, coexpression of MyD88s did not prevent IL-1-
induced
phosphorylation of JNK, although MyD88s inhibits IL-1 induced NF-~cB
activation under
similar conditions. Expression of all proteins was verified by Western blot
analysis
(other panels).
Fig. 7: MyD88s induces AP-1 dependent gene expression
HEK293T cells were transiently transfected with an AP-1 dependent luciferase
reporter
construct, together with increasing amounts of MyD88s, MyD88L or MyD88 TIR
expression plasmids. 2 days after transfection, cell extracts were prepared
and
6
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
luciferase activity determined. Differences in transfection efficiency were
normalized by
cotransfecting a constitutively expressed ~igal expression plasmid and values
are
expressed as luc/gal.
Aims and detailed description of the invention
MyD88 is an adaptor protein that is involved in signalling triggered by
various members
of the interleukin-1 receptor (IL-1 R) / Toll-like receptor (TLR) superfamily.
A role for
MyD88 has been shown in response to triggering of IL-1R, IL-18R, TLR2, TLR3,
TLR4,
TLR9. IL-1 and IL-18 are pleiotropic cytokines which play a central role in
the immune
response and in many inflammatory diseases such as rheumatoid arthritis or
septic
shock. TLRs behave as receptors for various microbial products (including
bacterial,
viral, yeast derived products). Members of the IL-1 R/TLR superfamily, as well
as
MyD88 have been shown to play an important role in both innate and adaptive
immune
responses.
In the present invention we provide a splice variant of MyD88, MyD88s, which
lacks its
intermediate domain, the domain in between the N-terminal death domain
(necessary
for interaction with IRAK) and the C-terminal TIR domain (necessary for
interaction
with the IL-1 R or TLR). Deletion of the intermediate domain abolishes the
ability of
MyD88s to activate NF-KB. In contrast, MyD88s acts as a dominant negative
inhibitor
of the IL-1-and LPS-induced signaling pathway to NF-KB by interfering at the
level of
IRAK phosphorylation. In contrast to full length MyD88, we show that MyD88s
does not
mediate phosphorylation of co-expressed IRAK. Because MyD88 is also essential
for
the activation of JNK in response to IL-1 R and TLR triggering, we were
interested to
see if MyD88s still allows IL-1 induced JNK activation. We surprisingly found
that
MyD88S indeed allows activation of JNK and AP-1, whereas the NF-~cB pathway is
completely blocked.
In a first embodiment the invention provides an isolated polypeptide,
designated as the
splice form MyD88s, having the primary structural information of amino acids 1-
251 as
set forth in SEQ ID NO: 2, or a homologue or functional fragment thereof,
possessing
the biological properties of (1 ) down-regulating the TLR-induced nuclear
factor kappa
B activation and (2) activating the c-JUN N-terminal kinase pathway.
In a particular embodiment said TLR functions as a receptor for
lipopolysaccharide
(LPS).
7
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
The wording 'TLR-induced' or 'Toll Like Receptor-induced' is further
clarified. TLRs
recognize so-called pathogen-associated molecular patterns or PAMPs. PAMPs are
conserved motifs, unique to micro-organisms and essential for their metabolism
and
thus survival. Up to now, ten different TLRs have been identified in humans,
which
mediate recognition of diverse classes of pathogens. It is now clear that one
group of
pathogens is not exclusively recognized by one TLR (e.g. both TLR2 and TLR4
recognize Gram-positive derived PAMPs) and that one TLR can respond to many
structurally unrelated ligands, which are often derived from different groups
of
pathogens (e.g. TLR4 recognizes both viral components as well as gram-negative
LPS). In contrast, other TLRs, like TLR3, 5 and 9, seem to be more ligand-
specific and
at least up to now, appear to recognize only one type of ligand. Most TLR
ligands
identified so far are conserved microbial products which signal the presence
of an
infection. Besides, TLR7 and TLR8 have been shown to recognize synthetic anti-
viral
compounds with strong immunostimulatory capacity, belonging to the group of
imidazoquinolines. The natural ligands of TLR7 and TLR8 remain to be
identified
however. Finally, TLRs also recognize host derived ligands such as the extra
domain A
of the extracellular matrix protein fibronectin or heat shock proteins.
Extracellular
matrix proteins are often proteolytically cleaved during infection to
facilitate access of
macrophages and other immune effector cells to the site of infection. The
extra domain
A (EDA) of fibronectin is encoded by an alternatively spliced exon, which is
induced
only upon tissue injury. Heat shock proteins are normally expressed in the
cytoplasm,
thus not available for recognition by cell-surface receptors, but can be
released by
necrotic cells during tissue injury or viral infection. In this way, fragments
of fibronectin
containing the EDA region or heat shock proteins alert TLRs for an abnormal
situation,
e.g. tissue injury. Activation of TLRs by endogenous ligands implies that they
do not
only distinguish between self and non-self, but rather sense the presence of
'danger'
which can be either non-self or harmful self. MyD88 proved to be essential for
cytokine
induction after stimulation with a variety of ligands such as IL-1 beta, IL-
18, LPS,
mycoplasmal macrophage-activating lipopeptide-2 (MALP-2), bacterial CpG DNA,
poly(I:C) and many others. All these ligands have been demonstrated to signal
through
different receptors of the TLR/IL-1 R superfamily, suggesting that MyD88 is a
universal
adaptor for the TLR/IL-1 R superfamily. MALP-2 signals through TLR2, LPS
through
TLR4, Poly(I:C) double stranded RNA through TLR3, CpG DNA through TLR9.
s
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
As used herein, "fragment" refers to a polypeptide or polynucleotide of at
least about 9
amino acids or 27 base pairs, typically 50 to 75, or more amino acids or base
pairs,
wherein the polypeptide contains an amino acid core sequence. A fragment may
be
for example a truncated MyD88s isoform, modified MyD88s isoform (as by amino
acid
substitutions, deletions, or additions outside of the core sequence), or other
variant
polypeptide sequence, but is not a naturally-occurring MyD88s isoform that is
present
in a human individual. If desired, the fragment may be fused at either
terminus to
additional amino acids or base pairs, which may number from 1 to 20, typically
50 to
100, but up to 250 to 500 or more. A "functional fragment" means a polypeptide
fragment of MyD88s possessing the biological properties described above or a
polynucleotide fragment encoding said MyD88s polypeptide fragment possessing
the
biological properties described above. According to still further features in
the
described preferred embodiments the polynucleotide sequence which encodes a
polypeptide designated as MyD88s and has the biological properties of MyD88s
and
shares at least 60% homology, preferably at least 70% homology more preferably
at
least 80% homology, most preferably at least 90% homology with SEQ ID N0:1.
Homology is determined using default parameters of a DNA sequence analysis
software package developed by the Genetic Computer Group (GCG) at the
University
of Wisconsin. Also forming part of the invention are allelic variants. The
wording "allelic
variant" means any of two or more alternative forms of a gene occupying the
same
chromosomal locus. Allelic variation arises naturally through mutation, and
may result
in phenotypic polymorphism within populations. Gene mutations can be silent
(no
change in the encoded polypeptide) or may encode polypeptides having altered
amino
acid sequence. The term allelic variant also means a protein encoded by an
allelic
variant of a gene.
The term "down-regulating the TLR-induced nuclear factor kappa B activation"
means
that MyD88s down-regulates the NF-kappaB activation, with respect to the cell
which
was activated with LPS or other TLR ligands, with at least 50%, 60%, 70%, 80%
or
preferentially with 90%, 95%, 99% or even 100%. The term "activating" in the
wording
"activating the c-JUN N-terminal kinase pathway" means that the c-JUN N-
terminal
kinase pathway is still active while the NF-kappaB-pathway is shut down.
The scientific relevance and background of the wording 'activating the c-JUN N-
terminal kinase pathway' is herein further explained.
9
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
It is known in the art that stimulation of IL-1 R and TLR activates several
intracellular
signalling pathways that include the IKB kinase (IKK)-pathway and three
mitogen-
activated protein kinase (MAPK) pathways: extracellular signal-regulated
kinases
(ERK) 1 and 2, c-Jun N-terminal kinase (JNK) and p38. The IKK-pathway in turn
activates the transcription factor NF-KB, whereas JNK activates several other
transcription factors, including AP-1, Elk-1, NF-AT, ATF-2, as well as a
number of
other substrates (e.g. bcl-X~) (Barr et al. (2001) Int J. Biochem. Cell Biol.
33:1047. The
transcription factor AP-1 by phosphorylating the c-jun and ATF-2 component.
Both,
NF-KB and AP-1, coordinate the induction of various genes encoding
inflammatory
mediators, anti-apoptotic proteins, and many others. Targeted gene knock out
studies
have also demonstrated a role for JNK in T cell activation, thymic development
and
Th1/Th2 differentiation. Recently, a link between the NF-KB and JNK pathways
has
been established. It was shown that NF-KB can downregulate pro-apoptotic JNK
signalling in response to TNF and chemotherapeutic drugs by shifting the
sustained
JNK activation to a more transient activation. The JNK inhibiting effect of NF-
~cB was
mediated by the transcriptional upregulation of specific proteins (XIAP,
Gadd45~3).
Finally, JNK activation has also been implicated in cell death (e.g.
excitotoxicity
induced apoptosis in the hippocampus; IL-1 induced cell death of pancreatic ~3
cells;
death following cardiac ischemia-reperfusion; UV-induced apoptosis of small
cell lung
carcinoma; degenerating neurones in Alzheimer's disease). Interestingly, cell
death
has been correlated with a sustained JNK activation, whereas transient
activation is
not associated with cell death, but in contrast, might have a survival role
(e.g.
protection of myocytes from nitric oxide-induced apoptosis, protection of HeLa
cells
from apoptosis following photodynamic therapy) (Roulston et al. (1998) J.
Biol. Chem.
273:10232; Assefa et al. (1999) J. Biol. Chem. 274:8766).
In another embodiment the invention provides a polynucleotide encoding a
polypeptide
designated as the splice form MyD88s, having the primary structural
information of
amino acids 1-251 as set forth in SEQ ID NO: 2, or any homologue or functional
fragment thereof, possessing the biological properties of (1 ) down-regulating
the TLR-
induced nuclear factor kappa B activation and (2) activating the c-JUN N-
terminal
kinase pathway. In a particular embodiment said TLR-induced nuclear factor
kappa B
activation is an LPS-induced nuclear factor kappa B activation.
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
As used herein, the words "polynucleotide" may be interpreted to mean the DNA
and
cDNA sequence as detailed by Yoshikai et al. (1990) Gene 87:257, with or
without a
promoter DNA sequence as described by Salbaum et al. (1988) EMBO J. 7(9):2807.
In a particular embodiment the invention provides a polynucleotide as
described herein
before as set forth in SEQ ID NO: 1.
In yet another embodiment the invention provides a molecule which comprises a
region specifically binding to the intermediate domain of MyD88 or nucleic
acids
encoding said intermediate domain of MyD88, and modulates NF-kappaB activation
and/or IRAK phosphorylation andlor activation of the c-JUN N-terminal kinase
pathway. The term 'modulates' can either mean activates (meaning also for
example
stimulates or enhances) or inhibits (meaning also for example downregulates or
suppresses).
In yet another embodiment the invention provides a molecule which comprises a
region specifically binding to the intermediate domain of MyD88 or nucleic
acids
IS encoding said intermediate domain of MyD88, and suppresses or prevents
MyD88
expression but not MyD88s expression, and activates the c-JUN N-terminal
kinase
pathway and inhibits the TLR-mediated nuclear factor kappa B pathway.
In yet another embodiment the molecule which comprises a region specifically
binding
to the intermediate domain of MyD88 or nucleic acids encoding said
intermediate
domain of MyD88, and suppresses or prevents MyD88 expression but not MyD88s
expression, and activates the c-JUN N-terminal kinase pathway is chosen from
the
group comprising an antibody or any fragment thereof, a small molecule, a
ribozyme,
an oligonucleotide, a peptide or a peptidomimetic.
The term 'antibody' or 'antibodies' relates to an antibody characterized as
being
specifically directed against the intermediate domain of MyD88, with said
antibodies
being preferably monoclonal antibodies; or an antigen-binding fragment
thereof, of the
F(ab')2, Flab) or single chain Fv type, or any type of recombinant antibody
derived
fihereof. These antibodies of the invention, including specific polyclonal
antisera
prepared against the intermediate domain of MyD88, have no cross-reactivity to
other
proteins. The monoclonal antibodies of the invention can for instance be
produced by
any hybridoma liable to be formed according to classical methods from splenic
cells of
an animal, particularly of a mouse or rat immunized against the intermediate
domain of
MyD88, and of cells of a myeloma cell line, and to be selected by the ability
of the
hybridoma to produce the monoclonal antibodies recognizing the intermediate
domain
11
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
of MyD88 which have been initially used for the immunization of the animals.
The
monoclonal antibodies according to this embodiment of the invention may be
humanized versions of the mouse monoclonal antibodies made by means of
recombinant DNA technology, departing from the mouse and/or human genomic DNA
sequences coding for H and L chains or from cDNA clones coding for H and L
chains.
Alternatively the monoclonal antibodies according to this embodiment of the
invention
may be human monoclonal antibodies. Such human monoclonal antibodies are
prepared, for instance, by means of human peripheral blood lymphocytes (PBL)
repopulation of severe combined immune deficiency (SCID) mice as described in
PCT/EP 99/03605 or by using transgenic non-human animals capable of producing
human antibodies as described in US patent 5,545,806. Also fragments derived
from
these monoclonal antibodies such as Fab, F(ab)'2 and scFv ("single chain
variable
fragment"), providing they have retained the original binding properties, form
part of
the present invention. Such fragments are commonly generated by, for instance,
enzymatic digestion of the antibodies with papain, pepsin, or other proteases.
It is well
known to the person skilled in the art that monoclonal antibodies, or
fragments thereof,
can be modified for various uses. The antibodies involved in the invention can
be
labeled by an appropriate label of the enzymatic, fluorescent, or radioactive
type.
The antibody against the intermediate domain of MyD88 can also be camel
antibody
or a functional fragment thereof. Camel antibodies are fully described in
W094/25591,
W094/04678 and in W097/49805.
Processes are described in the art which make it possible that antibodies can
be used
to hit intracellular targets. Since the intermediate domain of MyD88 is such
an
intracellular target, the antibodies or fragments thereof with a specificity
for said ID
domain must be delivered into the cells. One such technology uses lipidation
of the
antibodies. The latter method is fully described in WO 94/01131, which is
herein
incorporated by reference.
Also within the scope of the invention are oligonucleotide sequences that
include anti
sense RNA and DNA molecules and ribozymes that function to inhibit the
translation of
MyD88 but not the translation of MyD88s. Anti-sense RNA and DNA molecules act
to
directly block the translation of the part of the mRNA that encode the
intermediate
domain of MyD88 by binding to the targeted mRNA and preventing protein
translation.
Ribozymes are enzymatic RNA molecules capable of catalyzing the specific
cleavage
of RNA. The mechanism of ribozyme action involves sequence specific
hybridization of
12
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
the ribozyme molecule to complementary target RNA, thus to the mRNA encoding
the
ID-domain of MyD88, followed by a endonucleolytic cleavage within this region.
Within
the scope of the invention are engineered hammerhead motif ribozyme molecules
that
specifically and efficiently catalyze endonucleolytic cleavage within the
intermediate
domain sequence of MyD88. Specific ribozyme cleavage sites within any
potential
RNA target are initially identified by scanning the target molecule for
ribozyme
cleavage sites, which include the following sequences, GUA, GUU and GUC. Once
identified, short RNA sequences of between 15 and 20 ribonucleotides
corresponding
to the region of the target gene containing the cleavage site (here the target
being the
intermediate domain of MyD88) may be evaluated for predicted structural
features
such as secondary structure that may render the oligonucleotide sequence
unsuitable.
The suitability of candidate targets may also be evaluated by testing their
accessibility
to hybridization with complementary oligonucleotides, using ribonuclease
protection
assays.
Both anti-sense RNA and DNA molecules and ribozymes of the invention may be
prepared by any method known in the art for the synthesis of RNA molecules.
These
include techniques for chemically synthesizing oligodeoxyribonucleotides well
known in
the art such as for example solid phase phosphoramidite chemical synthesis.
Alternatively, RNA molecules may be generated by in vitro and in vivo
transcription of
DNA sequences encoding the antisense RNA molecule. Such DNA sequences may be
incorporated into a wide variety of vectors, which incorporate suitable RNA
polymerase
promoters such as the T7 or SP6 polymerase promoters. Alternatively, antisense
cDNA constructs that synthesize anti-sense RNA constitutively or inducibly,
depending
on the promoter used, can be introduced stably into cell lines.
Beside the inhibition of translation the anti-sense oligonucleotide sequences
can work
through the use of RNA inhibition (RNAi) with here in the invention applying
anti-sense
oligonucleotides that are specifically directed to the sequence that encodes
the
intermediate domain of MyD88 that is missing in MyD88s and forms a siRNA
duplex.
RNAi is based on the degradation of particular target sequences by the design
of short
interference RNA oligo's (siRNA) which recognize the target sequence and
subsequently trigger their degradation by a poorly understood pathway. The
siRNA
duplexes should be shorter than 30 nucleotides, because longer stretches of
dsRNA
activate the PKR pathway in mammalian cells, which results in a global a-
specific shut-
down of protein synthesis. Target regions should be AA(N 19)TT or AA(N21 ),
should be
13
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
specific for the gene of interest and should have a GC content of appr. 50%.
The
siRNAs duplexes can for example be transfected in the cells of interest by
oligofectamin (Life Technologies) and the transfection efficiency reaches 90-
95%.
In addition to inhibition of mRNA translation or inducing RNA interference,
anti-sense
oligonucleotides can also alter mRNA structure by modulating splicing of pre-
mRNA.
Oligonucleotide-induced alteration of splicing includes shifting of
alternative splicing
pathways, skipping of exons or inclusion of introns. Since splicing is a
nuclear process,
the anti-sense molecules must be active in the nuclei of the cells. It has
been shown in
the art how anti-sense oligonucleotides can be used to manipulate the splicing
'equilibrium' and redirect alternative splicing routes (Kole R. and Sazani P.K
(2001)
Curr. Opinion Mol. Therapeutics 3, 229. An oligonucleotide targeted towards
the 5'
splice site competes, for example, with U1 snRNP thus decreasing its binding
and
driving the utilization of an alternative 5' splice site. Because of the
predominance of
alternative splicing, its gene-specific modification is of significant
clinical interest.
In yet another embodiment the invention provides a peptide or a peptidomimetic
thereof which is derived from a region of MyD88, amino acids 95 till 172,
depicted in
SEQ ID NO: 14. SEQ ID NO: 14 comprises the ID domain of MyD88. Said ID domain
is depicted in SEQ ID NO: 15 (which is defined as a region encompassing amino
acids
110 till 154 of MyD88). Preferably said peptide or peptidomimetic comprises at
least 5
residues, 10 residues, 15 residues, 20 residues or more derived from the
sequence
depicted in SEQ ID NO: 15. The wording 'peptidomimetic' is described further.
The
term 'peptidomimetic' means a molecule able to mimic the biological activity
of a
peptide but is no longer peptidic in chemical nature. By strict definition, a
peptidomimetic is a molecule that no longer contains any peptide bonds (that
is, amide
bonds between amino acids). However, the term peptide mimetic is sometimes
used to
describe molecules that are no longer completely peptidic in nature, such as
pseudo-
peptides, semi-peptides and peptoids. Whether completely or partially non-
peptide,
peptidomimetics according to this invention provide a spatial arrangement of
reactive
chemical moieties that closely resembles the three-dimensional arrangement of
active
groups in the peptide on which the peptidomimetic is based. As a result of
this similar
active-site geometry, the peptidomimetic has effects on biological systems,
which are
similar to the biological activity of the peptide. The peptidomimetic of this
invention are
preferably substantially similar in both three-dimensional shape and
biological activity
to the peptides set forth above. Substantial similarity means that the
geometric
14
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
relationship of groups in the peptide that react with for example the ID
region of MyD88
or SEQ ID NO: 14 is preserved. There are clear advantages for using a mimetic
of a
given peptide rather than the peptide itself, because peptides commonly
exhibit two
undesirable properties: (1) poor bioavailability; and (2) short duration of
action. Peptide
mimetics offer an obvious route around these two major obstacles, since the
molecules
concerned are small enough to be both orally active and have a long duration
of
action. There are also considerable cost savings and improved- patient
compliance
associated with peptide mimetics, since they can be administered orally
compared with
parenteral administration for peptides. Furthermore, peptide mimetics are much
cheaper to produce than peptides. Finally, there are problems associated with
stability,
storage and immunoreactivity for peptides that are not experienced with
peptide
mimetics. The peptides described in the present invention have utility in the
development of such small chemical compounds with similar biological
activities and
therefore with similar therapeutic utilities. The techniques of developing
peptidomimetics are conventional. Thus, peptide bonds can be replaced by non-
peptide bonds that allow the peptidomimetic to adopt a similar structure, and
therefore
biological activity, to the original peptide. Further modifications can also
be made by
replacing chemical groups of the amino acids with other chemical groups of
similar
structure. The development of peptidomimetics can be aided by determining the
tertiary structure of the original peptide, either free or bound to a
substrate, e.g. the ID
region of MyD88, by NMR spectroscopy, crystallography and/or computer-aided
molecular modelling. These techniques aid in the development of novel
compositions
of higher potency and/or greater bioavailability and/or greater stability than
the original
peptide (Dean (1994), BioEssays, 16: 683-687; Cohen and Shatzmiller (1993), J.
Mol.
Graph., 11: 166-173; Wiley and Rich (1993), Med. Res. Rev., 13: 327-384; Moore
(1994), Trends Pharmacol. Sci., 15: 124-129; Hruby (1993), Biopolymers, 33:
1073-
1082; Bugg et al. (1993), Sci. Am., 269: 92-98, all incorporated herein by
reference].
Once a potential peptidomimetic compound is identified, it may be synthesized
and
assayed using the method described herein to assess its activity. It will
furthermore be
apparent that the peptidomimetics of this invention can be further used for
the
development of even more potent non-peptidic compounds, in addition to their
utility as
therapeutic compounds.
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
In yet another embodiment the invention provides a molecule which comprises a
region specifically binding to nuclear pre-RNA encoding MyD88 or mRNA encoding
MyD88s, and suppresses or prevents MyD88s expression but not MyD88 expression,
and inhibits the down-regulation of TLR-induced nuclear factor kappa B
activation. In a
particular embodiment said molecule is an oligonucleotide.
In another particular embodiment in said TLR-induced nuclear factor kappa B
activation, TLR functions as a receptor for LPS.
In yet another embodiment the invention provides a molecule which comprises a
region specifically binding to nuclear pre-RNA encoding MyD88 or mRNA encoding
MyD88s, and induces or stimulates MyD88s expression but not MyD88 expression,
and induces the down-regulation of TLR-induced nuclear factor kappa B
activation and
wherein said molecule is an oligonucleotide.
We have shown in this invention that there occurs a high expression of MyD88s
in
immune privileged tissues. Indeed it is shown that MyD88s is specifically
expressed in
brain, testis, and eye of C57/BL6 mice, which is consistent with a role in
immune
privilege. Therefore in another embodiment molecules able to modulate the
expression
of MyD88s can be used to modulate immunosuppression (e.g. in the case of
transplantation it is desired that there occurs a stimulation of
immunosuppression).
As used herein, the term "oligonucleotide" is intended to include both
naturally
occurring and non-naturally occurring (i.e., "synthetic") oligomers of linked
nucleosides.
Although such linkages generally are between the 3' carbon of one nucleoside
and the
5' carbon of a second nucleoside (i.e., 3'-5' linkages), other linkages (such
as 2'-5'
linkages) can be formed. Naturally occurring oligonucleotides are those which
occur in
nature; for example ribose and deoxyribose phosphodiester oligonucleotides
having
adenine, guanine, cytosine, thymine and uracil nucleobases. As used herein,
non-
naturally occurring oligonucleotides are oligonucleotides that contain
modified sugar,
internucleoside linkage and/or nucleobase moieties. Such oligonucleotide
analogs are
typically structurally distinguishable from, yet functionally interchangeable
with,
naturally occurring or synthetic wild type oligonucleotides. Thus, non-
naturally
occurring oligonucleotides include all such structures which function
effectively to
mimic the structure and/or function of a desired RNA or DNA strand, for
example, by
hybridizing to a target. Representative nucleobases include adenine, guanine,
cytosine, uridine, and thymine, as well as other non-naturally occurring and
natural
16
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
nucleobases such as xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other
alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives
of
adenine and guanine, 5-halo uracil and cytosine, 6-azo uracil, cytosine and
thymine, 5-
uracil (pseudo uracil), 4-thiouracil, 8-halo, oxa, amino, thiol, thioa(ky(,
hydroxyl and
other 8-substituted adenines and guanines, 5-trifluoromethyl and other 5-
substituted
uracils and cytosines, 7-methylguanine. Further naturally and non naturally
occurring
nucleobases include those disclosed in U.S. Pat. No. 3,687,808 (Merigan, et
al.), in
chapter 15 by Sanghvi, in Antisense Research and Application, Ed. S. T. Crooke
and
B. Lebleu, CRC Press, 1993, in Englisch et al., Angewandte Chemie,
International
Edition, 1991, 30, 613-722 (see especially pages 622 and 623, and in the
Concise
Encyclopedia of Polymer Science and Engineering, J. I. Kroschwitz Ed., John
Wiley &
Sons, 1990, pages 858-859, Cook, Anti-Cancer Drug Design 1991, 6, 585-607,
each
of which are hereby incorporated by reference in their entirety). The term
"nucleosidic
base" is further intended to include heterocyclic compounds that can serve as
like
nucleosidic bases including certain "universal bases" that are not nucleosidic
bases in
the most classical sense but serve as nucleosidic bases. Especially mentioned
as a
universal base is 3-nitropyrrole. Sugars having O-substitutions on the ribosyl
ring are
also amenable to the present invention. Additional modifications may also be
made at
other positions on the oligonucleotide, particularly the 3' position of the
sugar on the 3'
terminal nucleotide and the 5' position of 5' terminal nucleotide. For
example, one
additional modification of the oligonucleotides of the invention involves
chemically
linking to the oligonucleotide one or more moieties or conjugates which
enhance the
activity, cellular distribution or cellular uptake of the oligonucleotide.
Such moieties
include but are not limited to lipid moieties such as a cholesterol moiety,
cholic acid, a
thioether, e.g., hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain,
e.g., dodecandiol
or undecyl residues; a phospholipid, a polyamine or a polyethylene glycol
chain, or
adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-
carbonyl-oxycholesterol moiety. Oligonucleotides according to the present
invention
that are hybridizable to a target nucleic acid preferably comprise from about
5 to about
50 nucleosides. It is more preferred that such compounds comprise from about 8
to
about nucleosides, with 15 to 25 nucleosides being particularly preferred. As
used
herein, a target nucleic acid is any nucleic acid that can hybridize with a
complementary nucleic acid-like compound. Further in the context of this
invention,
"hybridization" shall mean hydrogen bonding, which may be Watson-Crick,
Hoogsteen
17
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
or reversed Hoogsteen hydrogen bonding between complementary nucleobases.
"Complementary" as used herein, refers to the capacity for precise pairing
between
two nucleobases. For example, adenine and thymine are complementary
nucleobases,
which pair through the formation of hydrogen bonds. "Complementary" and
"specifically hybridizable," as used herein, refer to precise pairing or
sequence
complementarity between a first and a second nucleic acid-like oligomers
containing
nucleoside subunits. For example, if a nucleobase at a certain position of the
first
nucleic acid is capable of hydrogen bonding with a nucleobase at the same
position of
the second nucleic acid, then the first nucleic acid and the second nucleic
acid are
considered to be complementary to each other at that position. The first and
second
nucleic acids are complementary to each other when a sufficient number of
corresponding positions in each molecule are occupied by nucleobases, which
can
hydrogen bond with each other. Thus, "specifically hybridizable" and
"complementary"
are terms which are used to indicate a sufficient degree of complementarity
such that
stable and specific binding occurs between a compound of the invention and a
target
RNA molecule. It is understood that an oligomeric compound of the invention
need not
be 100% complementary to its target RNA sequence to be specifically
hybridizable. An
oligomeric compound is specifically hybridizable when binding of the
oligomeric
compound to the target RNA molecule interferes with the normal function of the
target
RNA to cause a loss of utility, and there is a sufficient degree of
complementarity to
avoid non-specific binding of the oligomeric compound to non-target sequences
under
conditions in which specific binding is desired, i.e. under physiological
conditions in the
case of in vivo assays or therapeutic treatment, or in the case of in vitro
assays, under
conditions in which the assays are performed. Phosphorothioate linkages in the
oligonucleotides of the invention are prepared using standard phosphoramidite
chemistry on, for example, an automated DNA synthesizer (e.g., Applied
Biosystems
model 380B) and oxidation with 0.2 M solution of 3H-1,2-benzodithiole-3-one
1,1-
dioxide in acetonitrile for the stepwise thiation of the phosphite linkages.
Phosphorothioate linkages that have Sp configuration can be prepared generally
according to the procedures described in U.S. Pat. Nos. 5,212,295, 5,587,361
and
5,599,797. In preferred embodiments, 2'-modified amidites are used to
synthesize
compounds of the invention according to standard phosphoramidite regimes. In
especially preferred embodiments, the amidites have a 2'-methoxyethoxy ("MOE")
substituent. As will be recognized, this invention concerns oligonucleotides
that exhibit
18
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
increased stability relative to their naturally occurring counterparts.
Extracellular and
intracellular nucleases generally do not recognize (and, therefore, do not
bind to) the
compounds of the invention. The modified internucleoside linkages of this
invention
preferably replace naturally-occurring phosphodiester-5'-methylene linkages to
confer
nuclease resistance.
In another embodiment a molecule comprising a region specifically binding to
the
intermediate domain of MyD88 or nucleic acids encoding said intermediate
domain of
MyD88, and (1) suppresses or prevents MyD88 expression but not MyD88s
expression, and (2) activates the c-JUN N-terminal kinase pathway or
alternatively in
another embodiment the invention provides a molecule which comprises a region
specifically binding to nuclear pre-RNA encoding MyD88 or mRNA encoding
MyD88s,
and (1 ) suppresses or prevents MyD88s expression but not MyD88 expression,
and
(2) inhibits the down-regulation of TLR-induced nuclear factor kappa B
activation and
wherein said molecules comprise an antibody or any fragment thereof, a small
molecule, a ribozyme, anti-sense nucleic acids or an oligonucleotide, a
peptide or a
peptidomimetic thereof for use as a medicament.
Thus in another embodiment the above described molecules that can suppress or
prevent MyD88s expression but not MyD88 expression, and inhibit the down-
regulation
?0 of TLR-induced nuclear factor kappa B activation can be used for the
manufacture of a
medicament to treat endotoxin tolerance. Since endotoxin tolerance is a
manifestation
that occurs during sepsis said molecules can be used for the manufacture of a
medicament to treat sepsis
The term 'medicament to treat' relates to a composition comprising molecules
as
'S described above and a pharmaceutically acceptable carrier or excipient
(both terms
can be used interchangeably) to treat diseases as indicated above. Suitable
carriers
or excipients known to the skilled man are saline, Ringer's solution, dextrose
solution,
Hank's solution, fixed oils, ethyl oleafie, 5% dextrose in saline, substances
that
enhance isotonicity and chemical stability, bufFers and preservatives. Other
suitable
~0 carriers include any carrier that does not itself induce the production of
antibodies
harmful to the individual receiving the composition such as proteins,
polysaccharides,
polyiactic acids, polyglycolic acids, polymeric amino acids and amino acid
copolymers.
The 'medicament' may be administered by any suitable method within the
knowledge
of the skilled man. The preferred route of administration is parenterally. In
parental
79
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
administration, the medicament of this invention will be formulated in a unit
dosage
injectable form such as a solution, suspension or emulsion, in association
with the
pharmaceutically acceptable excipients as defined above. However, the dosage
and
mode of administration will depend on the individual. Generally, the
medicament is
administered so that the protein, polypeptide, peptide of the present
invention is given
at a dose between 1 pg/kg and 10 mg/kg, more preferably between 10 pg/kg and 5
mg/kg, most preferably between 0.1 and 2 mg/kg. Preferably, it is given as a
bolus
dose. Continuous infusion may also be used and includes continuous
subcutaneous
delivery via an osmotic minipump. If so, the medicament may be infused at a
dose
between 5 and 20 pg/kg/minute, more preferably between 7 and 15 pg/kg/minute.
In yet another embodiment the molecules that comprise a region specifically
binding to
the intermediate domain of MyD88 or nucleic acids encoding said intermediate
domain
of MyD88, and suppress or prevent MyD88 expression but not MyD88s expression
and activate the c-JUN N-terminal kinase pathway can be used for the
manufacture of
a medicament to activate the c-JUN N-terminal pathway. Since the c-JUN N-
terminal
kinase stimulation is involved in the induction of apoptosis the molecules of
the present
invention can be used for the manufacture of a medicament to treat
insufficiency of
apoptosis. Insufficiency of apoptosis is a manifestation that frequently
occurs in cancer
growth and hence the MyD88s of the present invention can be used for treatment
of
cancer.
In another embodiment a polynucleotide encoding MyD88s or any homologue or
functional fragment thereof, possessing the biological properties of (1) down-
regulating
the TLR-induced nuclear factor kappa B activation and (2) activating the c-JUN
N-
terminal kinase pathway can be used as a medicament. Therefore this aspect of
administration for treatment involves the use of gene therapy to deliver the
polynucleotide encoding MyD88s or a functional fragment thereof or a homologue
thereof for the treatment of insufficiency of apoptosis. In yet another
embodiment a
polynucleotide encoding MyD88s or a functional fragment thereof or a homologue
thereof can be used in a gene therapeutic method for the inhibition of
diseases where
TLR-induced nuclear factor kappa B activation occurs as for example in the
case of an
infection (for example an infection from a pathogen such as a virus or
bacterium) and
for example in the case of rheumatoid arthritis since recently it has been
shown in the
art that TLR-induced nuclear factor kappa B activation is involved in
rheumatoid
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
arthritis. The present invention provides the nucleic acids of MyD88s or a
functional
fragment thereof or a homologue thereof for the transfection of cells in vitro
and in vivo.
These nucleic acids can be inserted into any of a number of well-known vectors
for the
transfection of target cells and organisms as described below. The nucleic
acids are
transfected into cells, ex vivo or in vivo, through the interaction of the
vector and the
target cell. Said nucleic acids, under the control of a promoter, then
expresses MyD88s
or a functional fragment thereof or a homologue thereof, thereby mitigating
the effects
of absent, partial inactivation, or abnormal expression of MyD88s or a
functional
fragment thereof or a homologue thereof. Such gene therapy procedures have
been
used in the art to correct acquired and inherited genetic defects, cancer, and
viral
infection in a number of contexts. The ability to express artificial genes in
humans
facilitates the prevention andlor cure of many important human diseases,
including
many diseases which are not amenable to treatment by other therapies (for a
review of
gene therapy procedures, Nabel & Felgner, TIBTECH 11:211-217 (1993); Mintani &
Caskey, TIBTECH 11:162-166 (1993); Mulligan, Science 926-932 (1993); Dillon,
TIBTECH 11:167-175 (1993); Van Brunt, Biotechnology 6(10):1149-1154 (1998);
Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Ifremer &
Perricaudet, British Medical Bulletin 51(1); 31-44 (1995); Haddada et al., in
Current
Topics in Microbiology and Immunology (Doerfler & Bohm eds., 1995); and Yu et
al.,
Gene Therapy 1:13-26 (1994)). Delivery of the gene or genetic material into
the cell is
the first critical step in gene therapy treatment of disease. A large number
of delivery
methods are well known to those of skill in the art. Preferably, the nucleic
acids are
administered for in vivo or ex vivo gene therapy uses. Non-viral vector
delivery
systems include DNA plasmids, naked nucleic acid, and nucleic acid complexed
with a
delivery vehicle such as a liposome. Viral vector delivery systems include DNA
and
RNA viruses, which have either episomal or integrated genomes after delivery
to the
cell. Methods of non-viral delivery of nucleic acids include lipofection,
microinjection,
biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:
nucleic acid
conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA.
Lipofection is described in, e.g., US Pat. No. 5,049,386, US Pat No.
4,946,787; and US
Pat. No. 4,897,355 and lipofection reagents are sold commercially (e.g.,
TransfectamTM and LipofectinTM). Cationic and neutral lipids that are suitable
for
efficient receptor-recognition lipofection of polynucleotides include those of
Flegner,
WO 91 /17424, WO 91 /16024. Delivery can be to cells (ex vivo administration)
or target
21
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
tissues (in vivo administration). The preparation of lipid: nucleic acid
complexes,
including targeted liposomes such as immunolipid complexes, is well known to
one of
skill in the art (see, e.g., Crystal, Science 270:404-410 (1995); Blaese et
al., Cancer
Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994);
Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy
2:710-
722 (1995); U.S. Pat. Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975,
4,485,054,
4,501,728, 4,774,085, 4,837,028, and 4,946,787). The use of RNA or DNA viral
based
systems for the delivery of nucleic acids take advantage of highly evolved
processes
for targeting a virus to specific cells in the body and trafficking the viral
payload to the
nucleus. Viral vectors can be administered directly to patients (in vivo) or
they can be
used to treat cells in vitro and the modified cells are administered to
patients (ex vivo).
Conventional viral based systems for the delivery of nucleic acids could
include
retroviral, lentivirus, adenoviral, adeno-associated and herpes simplex virus
vectors for
gene transfer. Viral vectors are currently the most efficient and versatile
method of
gene transfer in target cells and tissues. Integration in the host genome is
possible with
the retrovirus, lentivirus, and adeno-associated virus gene transfer methods,
often
resulting in long-term expression of the inserted transgene. Additionally,
high
transduction efficiencies have been observed in many different cell types and
target
tissues. The tropism of a retrovirus can be altered by incorporating foreign
envelope
proteins, expanding the potential target population of target cells.
Lentiviral vectors are
retroviral vector that are able to transduce or infect non-dividing cells and
typically
produce high viral titers. Selection of a retroviral gene transfer system
would therefore
depend on the target tissue. Retroviral vectors are comprised on cis-acting
long
terminal repeats with packaging capacity for up to 6-10 kb of foreign
sequence. The
minimum cis-acting LTRs are sufficient for replication and packaging of the
vectors,
which are then used to integrate the therapeutic gene into the target cell to
provide
permanent transgene expression. Widely used retroviral vectors include those
based
upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian
immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and
combinations
thereof (see, e.g., Buchscher et al., J. Virol. 66:2731-2739 (1992);
PCT/US94/05700.
In applications where transient expression of the nucleic acid is preferred,
adenoviral based systems are typically used. Adenoviral based vectors are
capable of
very high transduction efficiency in many cell types and do not require cell
division.
With such vectors, high titer and levels of expression have been obtained.
This vector
22
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
can be produced in large quantities in a relatively simple system. Adeno-
associated
virus ("AAV") vectors are also used to transduce cells with target nucleic
acids, e.g., in
the in vitro production of nucleic acids and peptides, and for in vivo and ex
vivo gene
therapy procedures (see, e.g., U.S. Patent No. 4,797,368; WO 93/24641; Kotin,
Human Gene Therapy 5:793-801 (1994); Muzyczka. Construction of recombinant AAV
vectors are described in a number of publications, including U.S. Pat. No.
5,173,414;
Hermonat & Muzyczka, Proc. Natl. Acad. Sci. U.S.A. 81:6466-6470 (1984); and
Samulski et al., J.Virol. 63:03822-3828 (1989). In particular, at least six
viral vector
approaches are currently available for gene transfer in clinical trials, with
retroviral
vectors by far the most frequently used system. All of these viral vectors
utilize
approaches that involve complementation of defective vectors by genes inserted
into
helper cell lines to generate the transducing agent. pLASN and MFG-S are
examples
are retroviral vectors that have been used in clinical trials (Dunbar et al.,
Blood
85:3048-305 (1995); Kohn et al., Nat. Med. 1:1017-102 (1995); Malech et al.,
Proc.
Natl. Acad. Sci. U.S.A. 94/22 12133-12138 (1997)); Pa317lpLASN was the first
therapeutic vector used in a gene therapy trials. (Blaese et al., Science
270:475-480
(1995)). Transduction efficiencies of 50% greater have been observed for MFG-S
packaged vectors (Ellem et al. lmmunol Immunother. 44(1):10-20 (1997); Dranoff
et
al., Hum. Gene Ther. 1:111-2 (1997)). Recombinant adeno-associated virus
vectors
(rAAV) are a promising alternative gene delivery systems based on the
defective and
non-pathogenic parvovirus adeno-associated type 2 virus. All vectors are
derived from
a plasmid that retains only the AAV 145 by inverted terminal repeats flanking
the
transgene expression cassette. Efficient gene transfer and stable transgene
delivery
due to integration into the genomes of the transduced cell are key features
for this
vector system (Wagner et aL, Lancet 351:9117 1702-3 (1998). Replication-
deficient
recombinant adenoviral vectors (Ad) are predominantly used in transient
expression
gene therapy, because they can be produced at high titer and they readily
infect a
number of different cell types. Most adenovirus vectors are engineered such
that a
transgene replaced the Ad E1 a, E1 b, and E3 genes; subsequently the
replication
deficient vector is propagated in human 293 cells that supply deleted gene
function in
trans. Ad vectors can transduce multiple types of tissues in vivo, including
nondividing,
differentiated cells such as those found in the liver, kidney and muscle
system tissues.
Conventional Ad vectors have a large carrying capacity. An example of the use
of an
Ad vector in a clinical trial involved polynucleotide therapy for antitumor
immunization
23
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
with intramuscular injection (Sterman et al., Hum. Gene Ther. 7:1083-9
(1998)).
Additional examples of the use of adenovirus vectors for gene transfer in
clinical trials
include Sterman et al., Hum. Gene Ther. 9:7 1083-1089 (1998); Alvarez et al.,
Hum.
Gene Ther. 5:597-613 (1997); Topf et al., Gene Ther. 5:507-513 (1998)).
Packaging
cells are used to form virus particles that are capable of infecting a host
cell. Such cells
include 293 cells, which package adenovirus, and yr2 cells or PA317 cells,
which
package retrovirus. Viral vectors used in gene therapy are usually generated
by
producer cell line that packages a nucleic acid vector into a viral particle.
The vectors
typically contain the minimal viral sequences required for packaging and
subsequent
integration into a host, other viral sequences being replaced by an expression
cassette
for the protein to be expressed. The missing viral functions are supplied in
trans by the
packaging cell line. For example, AAV vectors used in gene therapy typically
only
possess ITR sequences from the AAV genome which are required for packaging and
integration into the host genome. Viral DNA is packaged in a cell line, which
contains a
helper plasmid encoding the other AAV genes, namely rep and cap, but lacking
ITR
sequences. The cell line is also infected with adenovirus as a helper. The
helper virus
promotes replication of the AAV vector and expression of AAV genes from the
helper
plasmid. The helper plasmid is not packaged in significant amounts due to a
lack of
ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat
treatment to which adenovirus is more sensitive than AAV. In many gene therapy
applications, it is desirable that the gene therapy vector be delivered with a
high
degree of specificity to a particular tissue type. A viral vector is typically
modified to
have specificity for a given cell type by expressing a ligand as a fusion
protein with a
viral coat protein on the viruses outer surface. The ligand is chosen to have
afFinity for
a receptor known to be present on the cell type of interest. For example, Han
et al.,
Proc. Natl. Acad. Sci. U.S.A. 92/9747-9751 (1995), reported that Moloney
murine
leukemia virus can be modified to express human heregulin fused to gp70, and
the
recombinant virus infects certain human breast cancer cells expressing human
epidermal growth factor receptor. This principle can be extended to other
pairs of virus
expressing a ligand fusion protein and target cell expressing a receptor. For
example,
filamentous phage can be engineered to display antibody fragments (e.g., FAB
or Fv)
having specific binding affinity for virtually any chosen cellular receptor.
Although the
above description applies primarily to viral vectors, the same principles can
be applied
to non-viral vectors. Such vectors can be engineered to contain specific
uptake
24
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
sequences thought to favour uptake by specific target cells. Gene therapy
vectors can
be delivered in vivo by administration to an individual patient, typically by
systemic
administration (e.g., intravenous, intra-peritoneal, intra-muscular, sub-
dermal, or intra-
cranial infusion) or topical application, as described below. Alternatively,
vectors can
be delivered to cells ex vivo, such as cells explanted from an individual
patient (e.g.,
lymphocytes, bone marrow aspirates, tissue biopsy) or universal donor
hematopoietic
stem cells, followed by reimplantation of the cells into a patient, usually
after selection
for cells which have incorporated the vector. Ex vivo cell transfection for
diagnostics,
research, or for gene therapy (e.g., via re-infusion of the transfected cells
into the host
organism) is well known to those of skill in the art. In a preferred
embodiment, cells are
isolated from the subject organism, transfected with a nucleic acid (gene or
cDNA),
and re-infused back into the subject organism (e.g., patient). Various cell
types suitable
for ex vivo transfection are well known to those of skill in the art (see,
e.g., Freshney et
al., Culture of Animal Cells, A Manual of basic Technique (3~d ed. 1994)) and
the
references cited therein for a discussion of how to isolate and culture cells
from
patients).
In one embodiment, stem cells are used in ex vivo procedures for cell
transfection and
gene therapy. The advantage to using stem cells is that they can be
differentiated into
other cell types in vitro, or can be introduced into a mammal (such as the
donor of the
cells) where they will engraft in the bone marrow. Methods for differentiating
CD34+
cells in vitro into clinically important immune cell types using cytokines
such a GM-
CSF, IFN-y and TNF-a are known (see Inaba et al., J. Exp. Med. 176: 1693-1702
(1992)). Stem cells are isolated for transduction and differentiation using
known
methods. For example, stem cells are isolated from bone marrow cells by
panning the
bone marrow cells with antibodies which bind unwanted cells, such as CD4+ and
CD8+ (T cells), CD45+ (pang cells), GR-1 (granulocytes), and lad
(differentiated
antigen presenting cells) (see Inaba et al., J. Exp. Med. 176:1693-1702
(1992)).
Vectors (e.g., retroviruses, adenoviruses, liposomes, etc.) containing
therapeutic
nucleic acids can be also administered directly to the organism for
transduction of cells
in vivo. Alternatively, naked DNA can be administered. Administration is by
any of the
routes normally used for introducing a molecule into ultimate contact with
blood or
tissue cells. Suitable methods of administering such nucleic acids are
available and
well known to those of skill in the art, and, although more than one route can
be used
to administer a particular composition, a particular route can often provide a
more
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
immediate and more effective reaction than another route. Administration is by
any of
the routes normally used for introducing a molecule into ultimate contact with
blood or
tissue cells. The nucleic acids are administered in any suitable manner,
preferably with
pharmaceutically acceptable carriers. Suitable methods of administering such
nucleic
acids are available and well known to those of skill in the art, and, although
more than
one route can be used to administer a particular composition, a particular
route can
often provide a more immediate and more effective reaction than another route.
It is known from the art that JNK is also required for T-cell differentiation
(Dung et al.
(2000) Nature 405:91; Sabapathy et al. (2001) J. Exp. Med. 193:317), and is
involved
in T helper 1 (Th1) versus Th2 cell polarization during infection (Rincon et
al. (2000)
Free Radical Biology and Medicine 28:1328; Jankovic et al. (2001) Trends in
immunology 22:450). The present invention demonstrates that MyD88s is
constitutively expressed in spleen of Balb/c mice, whereas in the spleen of
C57/BL6
IS mice MyD88s is not expressed. The difference in MyD88s expression
corresponds wifih
a firue difference in immunological response between both mice strains. It has
been
well established that in the Leishmania major model, mice of the Balb/c strain
produce
a polarized Th2 response and fail to promote resistance, whereas mice of the
C57/BL6
strain produce a polarized Th1 response and are resistant (Refiner et al.
(1995) Annu.
Rev. Immunol. 13 :151 ; Guler et al. (1996) Science 271: 984). Since it is
known that
the Th1/Th2 balance is perturbed during several immunological diseases in a
specific
embodiment a polynucleotide encoding MyD88s or any homologue or functional
fragment thereof can be used for the manufacture of a medicament to modulate
Th1/Th2 cell polarization.
In yet another embodiment a polynucleotide encoding MyD88s or any homologue or
functional fragment thereof can be used for the manufacture of a medicament to
modulate immunosuppression.
In another embodiment the invention provides a pharmaceutical composition
comprising molecules that (1) comprise a region specifically binding to the
intermediate
domain of MyD88 or nucleic acids encoding said intermediate domain of MyD88,
and
wherein said molecules can suppress or prevent MyD88 expression but not MyD88s
expression, and activate the c-JUN N-terminal kinase pathway. In a particular
26
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
embodiment said molecules comprise an antibody or any fragment thereof, a
small
molecule, a ribozyme, oligonucleotides, peptides or peptidomimetics.
In yet another embodiment the invention provides a pharmaceutical composition
comprising molecules that (1 ) comprise a region specifically binding to
nuclear pre-
RNA encoding MyD88 or mRNA encoding MyD88s, and wherein said molecules can
suppress or prevent MyD88s expression but not MyD88 expression, and inhibit
the
down-regulation of TLR-induced nuclear factor kappa B activation. In a
particular
embodiment said molecules comprise at least one oligonucleotide.
In yet another embodiment the invention provides a polypeptide, designated as
MyD88s or any homologue or functional fragment thereof, possessing the
biological
properties of (1) down-regulating the TLR-induced nuclear factor kappa B
activation
and (2) activating the c-JUN N-terminal kinase pathway, for use as a
medicament.
In another embodiment the invention provides a method to identify molecules
comprising (a) exposing the intermediate domain of MyD88 or nucleic acids
encoding
said intermediate domain of MyD88 to at least one molecule whose ability to
activate
the c-JUN N-terminal kinase pathway and down-regulate the TLR-induced nuclear
factor kappa B activation is sought to be determined, (b) determining binding
or
hybridising of said molecules) to the intermediate domain of MyD88 or nucleic
acids
encoding said intermediate domain, and monitoring said activation of the c-JUN
N-
terminal kinase pathway and down-regulation of the TLR-induced nuclear factor
kappa
B activation when administering at least one of said molecule(s).
In yet another embodiment the invention provides a method to identify
molecules
comprising (a) exposing the nuclear pre-RNA encoding MyD88 or mRNA encoding
MyD88 to at least one molecule whose ability to inhibit the down-regulation of
TLR
induced nuclear factor kappa B activation is sought to be determined, (b)
determining
binding or hybridising of said molecules) to the nuclear pre-RNA encoding
MyD88 or
mRNA encoding MyD88s, and (c) monitoring said inhibition of down-regulation of
TLR
induced nuclear factor kappa B activation when administering at least one of
said
molecule(s).
In yet another embodiment the invention provides a method to identify
molecules
comprising exposing alregion comprising the intermediate domain of MyD88 (SEQ
ID
NO 14 (amino acid 95 till 172) or nucleic acids encoding SEQ ID NO: 14 of
MyD88 to
27
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
at least one molecule whose ability to activate the c-JUN N-terminal kinase
pathway
and to activate the nuclear factor kappa B activation is sought to be
determined,
determining binding or hybridising of said molecules) to the intermediate
domain of
MyD88 or nucleic acids encoding said intermediate domain and, monitoring said
activation of the c-JUN N-terminal kinase pathway and nuclear factor kappa B
activation when administering at least one of said molecule(s).
Thus the invention provides methods for identifying compounds or molecules
(both
words can be used interchangeable in this invention) which bind on the ID
domain of
MyD88 or nucleic acids encoding said ID domain or the nuclear pre-RNA encoding
MyD88 or mRNA encoding MyD88. These methods are also referred to as 'drug
screening assays' or 'bioassays' and typically include the step of screening a
candidate/test compound or agent for the ability to interact with the ID
domain of
MyD88 or nucleic acids encoding said ID domain or the nuclear pre-RNA encoding
MyD88 or mRNA encoding MyD88. 'Compound' in relation to the screening methods
described herein above means any anorganic or organic compound, including
simple
or complex inorganic or organic molecules, oligonucleotides, peptides, peptido
mimetics, proteins, antibodies, carbohydrates, nucleic acids or derivatives
thereof.
Candidate/test compounds such as small molecules, e.g. small organic
molecules, and
other drug candidates can be obtained, for example, from combinatorial and
natural
product libraries.
Typically, the assays are cell-free assays which include the steps of
combining for
example the ID domain of MyD88 protein or a nucleic acid encoding said ID
domain
and a candidate/test compound, e.g., under conditions which allow for
interaction of
(e.g. binding of) the candidate/test compound with for example the ID domain
of
MyD88 protein or a nucleic acid encoding said ID domain to form a complex, and
detecting the formation of a complex, in which the ability of the candidate
compound to
interact with for example the ID domain of MyD88 protein or a nucleic acid
encoding
said ID domain is indicated by the presence of the candidate compound in the
complex. Formation of complexes between for example the ID domain of MyD88
protein or a nucleic acid encoding said ID domain and the candidate compound
can be
quantitated, for example, using standard immunoassays. For example the ID
domain
of MyD88 protein or a nucleic acid encoding said ID domain in such a test may
be free
in solution, affixed to a solid support, borne on a cell surface, or located
intracellularly.
28
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
To perform the above described drug screening assays, it is feasible to
immobilize for
example the ID domain of MyD88 protein or a nucleic acid encoding said ID
domain to
facilitate separation of complexes from uncomplexed forms of one or both of
the
proteins, as well as to accommodate automation of the assay. interaction
(e.g.,
binding of) of for example the ID domain of MyD88 protein or a nucleic acid
encoding
said ID domain to a target molecule, can be accomplished in any vessel
suitable for
containing the reactants. Examples of such vessels include microtiter plates,
test
tubes, and microcentrifuge tubes. In a particular embodiment, a fusion protein
can be
provided which adds a domain that allows the protein to be bound to a matrix.
For
example, the ID domain of MyD88 that is tagged can be adsorbed onto Ni-NTA
microtiter plates, or a particular heterotetrameric channel -ProtA fusions
adsorbed to
IgG, which are then combined with the cell lysates (e.g., 35S-labeled) and the
candidate compound, and the mixture incubated under conditions conducive to
complex formation (e.g., at physiological conditions for salt and pH).
Following
i5 incubation, the plates are washed to remove any unbound label, and the
matrix
immobilized and radiolabel determined directly, or in the supernatant after
the
complexes are dissociated. Alternatively, the complexes can be dissociated
from the
matrix, separated by SDS-PAGE, and the level of the ID domain of MyD88 -
binding
protein found in the bead fraction quantitated from the gel using standard
electrophoretic techniques. Other techniques for immobilizing protein on
matrices can
also be used in the drug screening assays of the invention. For example, the
ID
domain of MyD88 can be immobilized utilizing conjugation of biotin and
streptavidin.
Biotinylated particular ID domain of MyD88 can be prepared from biotin-NHS (N-
hydroxy-succinimide) using techniques well known in the art (e.g.,
biotinylation kit,
Pierce Chemicals, Rockford, III.), and immobilized in the wells of
streptavidin-coated
96 well plates (Pierce Chemical). Alternatively, antibodies reactive with the
ID domain
of MyD88 can be derivatized to the wells of the plate, and the ID domain of
MyD88
can be trapped in the wells by antibody conjugation. As described above,
preparations of the ID domain of MyD88 and a candidate compound are incubated
in
particular MyD88 ID domain -presenting wells of the plate, and the amount of
complex
firapped in the well can be quantitated. Methods for detecting such complexes,
in
addition to those described above for the GST-immobilized complexes, include
immunodetection of complexes using antibodies reactive with the 1D domain of
MyD88
-target molecule, or which are reactive with the ID domain of MyD88 and
compete with
29
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
the target molecule; as well as enzyme-linked assays which rely on detecting
an
enzymatic activity associated with the target molecule. Another technique for
drug
screening which provides for high throughput screening of compounds having
suitable
binding affinity to the ID domain of MyD88s is described in detail in
"Determination of
Amino Acid Sequence Antigenicity" by Geysen HN, WO 84/03564, published on
13/09/84. In summary, large numbers of different small peptide test compounds
are
synthesized on a solid substrate, such as plastic pins or some other surface.
The
protein test compounds are reacted with the ID domain of MyD88 and washed.
Bound
ID domain of MyD88 is then detected by methods well known in the art. A
purified ID
domain of MyD88 can also be coated directly onto plates for use in the
aforementioned drug screening techniques. Alternatively, non-neutralizing
antibodies
can be used to capture the peptide and immobilize it on a solid support. This
invention
also contemplates the use of competitive drug screening assays in which
neutralizing
antibodies capable of binding the ID domain of MyD88 specifically compete with
a test
compound for binding the ID domain of MyD88.
Examples
Identification of an inducible splice variant of MyD88
The mouse MyD88 gene is organized in five axons and four introns. The first
axon
(corresponding to amino acids 1-109) encodes the DD, the second axon
(corresponding to amino acids 110-154) the ID, and the three last axons
(corresponding to amino acids 155-296) the TIR domain (see Figure 1a). RT-PCR
for
MyD88 on RNA isolated from the murine macrophage cell line Mf414 revealed two
cDNA species of 890 and 747 bp, respectively (Figure 1 b). The sequence of the
more
abundant, larger isoform (also termed MyD88~) was found to be identical to the
published sequence of full length MyD88 (6, 7). Sequence analysis of the
smaller
isoform showed that it corresponds to a splice variant of MyD88, lacking axon
2, and
subsequenty referred to as MyD88s. Excision of axon 2 in MyD88S leads to an in-
frame
deletion of the complete ID (aa 110-154), resulting in a protein isoform of
approximately 27 kDa (Figure 1a). The expression pattern of MyD88s mRNA was
analysed by PCR on a Balb/c mouse multiple tissue cDNA panel (Figure 1 c).
MyD88~
mRNA was present in all adult mouse tissues examined, though at different
expression
levels. In contrast, MyD88S could be detected only in the spleen and weakly in
the
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
brain, suggesting that its expression is tightly regulated. Interestingly,
MyD88 mRNA
was the major species in splenic extracts from C57/BL6 mice. However, MyD88s
mRNA levels in the spleen of these mice were strongly upregulated 1 h after
injection of
mice with TNF. Sequencing of this upregulated mRNA species, as well as PCR
amplification of a MyD88s specific band of 438 by with a primer that was
designed
across the exon 1-exon 3 boundary, confirmed its identity as MyD88s. MyD88s
expression in spleen of TNF-treated mice was also studied at the protein
level. For
these purposes, C57/BL6 mice were injected with 20 ~g TNF, and spleen
homogenates were prepared 1 h, 4h, or 13h after TNF injection, respectively.
Immunoblotting of these extracts with MyD88 specific antibodies showed that
MyD88
was constitutively expressed in untreated and TNF-treated mice. In contrast,
MyD88s
expression was not detectable in untreated mice or mice treated for 1 h with
TNF.
However, after 4h and 13h TNF treatment, specific induction of a 27 kDa band
corresponding to MyD88s was observed. In conclusion, these results clearly
demonstrate the mouse strain-specific and inducible expression of MyD88s in
the
spleen. Apart from the constitutive expression of MyD88s in the spleen and
brain of
Balb/c mice, and the inducible expression of MyD88s in C57/BL6 mice, we also
found
constitutive expression of MyD88s in testis and eye of C57/BL6 mice. Based on
the
homology between mouse and human MyD88s we cloned the human equivalent of
MyD88s (depicted in SEQ ID NO: 1 for the nucleotide sequence and SEQ ID NO: 2
for
the amino acid sequence). The murine MyD88s is depicted in SEQ ID NO: 3 for
the
nucleotide sequence and SEQ ID NO: 4 for the amino acid sequence.
MYD88s does not activate NF-kappaB but behaves as a dominant negative
inhibitor
Previous reports clearly showed that ectopic expression of MyD88 strongly
activates
NF-KB (1-3). To test whether MyD88S activates NF-KB, HEIC293T cells were
transiently
transfected and analysed for NF-~cB activation by reporter gene (Figure 2a) or
gel shift
assay (Figure 2a insert). In contrast to MyD88~, MyD88S overexpression did not
induce
DNA binding of NF-xB or NF-KB reporter gene activation. These results point to
an
important role for the ID of MyD88 in NF-KB activation and are in agreement
with
previous findings of Medzhitov et al. (2), who demonstrated that the DD alone
is
insufficient for NF-KB activation. Co-expression of MyD88~ with increasing
amounts of
MyD88S showed that already low expression levels of MyD88s significantly
reduced
the ability of MyD88~ to activate NF-KB. In line with these results, MyD88s
31
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
overexpression almost completely inhibited IL-1-induced NF-xB activation
(Figure 2a),
which is similar to the previously described effect of overexpression of the
TIR domain
of MyD88 (1 ). As expected, we did not observe any inhibitory effect of MyD88s
on
TNF-induced NF-KB activation (Figure 2b). Because HEK 293T cells are
unresponsive
to LPS, we tested the effect of MyD88s on LPS-induced NF-KB activation in
Mf4/4
macrophages. Only a partial inhibitory effect of MyD88S could be observed
(Figure 2c),
probably due to the presence of MyD88-independent signalling pathways emerging
from the TLR4 receptor (14). In conclusion, these results demonstrate that
MyD88s
can function as a negative regulator of IL-1- and LPS-induced NF-KB
activation.
MyD88s competes with MyD88L for binding to the IL-1 R/IL-1 Race complex
To find a mechanistic explanation for the dominant negative effect of MyD88s
in the IL-
1-induced signalling pathway to NF-KB, we investigated by co-
immunoprecipitation
whether the splice variant is still present in the IL-1 R/IL-1 RAcP complex.
MyD88 has
previously been shown to be recruited as a homodimer to the activated IL-1 R
(3). Both
the DD and the TIR domain are required for homodimerization (3). Therefore, we
first
tested if MyD88s was still able to form dimers with MyD88 upon expression in
HEK293T cells. The results shown in Figure 3a demonstrate that E-MyD88s as
well as
E-MyD88~ are co-immunoprecipitated specifically with Flag-MyD88~. Furthermore,
increasing the concentration of E-MyD88s favours the formation of MyD88s-
MyD88~
heterodimers. Next, we investigated the binding of MyD88s to the IL-1 R/IL-1
RAcP
complex. Co-immunoprecipitation revealed that MyD88s still binds to the IL-1
R/IL-
1 RAcP complex (Figure 3b). This is in' agreement with previous reports
showing that
the TIR domain of MyD88 - which is intact in MyD88s - is necessary and
sufficient for
IL-1R binding (1). When MyD88s and MyD88 were co-expressed, low amounts of
MyD88s already competed with MyD88 for binding to the IL-1 R/IL-1 RAcP complex
(Figure 3b). In summary, these results demonstrate that upon expression of
MyD88s,
MyD88-MyD88s heterodimers are formed and recruited to the IL-1 R complex,
suggesting that the dominant negative effect induced by MyD88s is related to
its
inability to bind or to activate downstream signalling molecules, an obvious
candidate
being I RAK.
32
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
MyD88s still allows the recruitment of IRAK to the IL-1 R, but does not induce
IRAK
~hosphorylation
MyD88 binds IRAK primarily through DD-DD interactions, therefore it was
unlikely that
removal of the ID would interfere with IRAK binding. Indeed, MyD88S still
binds IRAK
(data not shown) and has no effect on its recruitment into the IL-1 R complex
(Figure
4a). Previously we have shown that MyD88 triggers IRAK phosphorylation (4).
This
can simply be demonstrated by co-expression of MyD88 and a mutant version of
IRAK, IRAK(T66A) which, in contrast to wild type IRAK, is not rapidly degraded
by co-
expression with MyD88. IRAK(T66A) migrates as a series of phosphospecies,
which
are converted to a hyperphosphorylation state (corresponding to the slower
migrating
species) by co-expressing MyD88 (Figure 4b upper panel and (4)). We therefore
wished to test whether MyD88S could similarly induce phosphorylation of
IRAK(T66A)
and found that MyD88s did not induce IRAK phosphorylation. Similar results
were .
obtained when we used an N-terminal deletion construct of IRAK(T66A) (IRAK-
N(T66A), residues 1-208 (Burns K et al. (2000) Nat. Cell. Biol. 2:346)), that,
in contrast
to full length IRAK, migrates as a single species in unstimulated conditions
(Figure 4b,
middle panel). Many studies provided evidence that IRAK undergoes
hyperphosphorylation, and presumably ubiquitination, upon receptor recruitment
(10,
11, 3). Phosphorylation of IRAK has previously been shown to be essential for
interaction of IRAK with TRAF6 (12), Li et al. (2001 ) PNAS 98 :4461 )
demonstrated
that deletion mutants of IRAK that are not modified upon IL-1 stimulation are
unable to
activate NF-KB. The inability of MyD88s to activate NF-~cB as well as to
induce IRAK
phosphorylation further suggests that both events are correlated. Although
MyD88 is
known to be important for IRAK phosphorylation ~(4), the exact mechanism of
IRAK
phosphorylation is still unknown. Reconstitution experiments of IRAK deficient
cells
with kinase-inactive IRAK have shown that kinase-inactive IRAK still becomes
phosphorylated in response to IL-1 (11), demonstrating that IRAK
phosphorylation
must be due to another kinase.
M~~D88 is reauired for IRAK-4-induced IRAK-1 phosphorylation
For sometime it was speculated that IRAK-1 was phosphorylated via its own
kinase
activity. However this idea was challenged by the discovery that a kinase dead
mutant
of IRAK-1 (subsequently referred to as IRAK-1 KD) was phosphorylated in an
IRAK-1
deficient cell line. A second kinase was postulated to phosphorylate IRAK-1
and
33
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
perhaps to activate IRAK-1's own kinase activity. Recently IRAK-4, so called
for its
homology to other members of the IRAK-1 family (other members include the
kinase
inactive IRAK-2 and IRAK-M/3), was identified as a candidate for the IRAK-1
kinase
(Wesche H. et al (1999) J. Biol. Chem. 274: 19403). This was based on in vitro
kinase
assays and the observation that IL-1-induced degradation of IRAK-1 was
partially
blocked by overexpression of a kinase-inactive mutant of IRAK-4. To obtain
additional
evidence that IRAK-4 is a kinase for IRAK-1, we developed a co-expression
assay in
HEK293T cells. IRAK-4 was cotransfected together with IRAK-1 KD (IRAK-1 D340N)
(used because it cannot self-phosphorylate like overexpressed wildtype IRAK-1)
and
phosphorylation monitored by the appearance of a slower migrating species in
SDS-
PAGE. As predicted, IRAK-4 induced phosphorylation of IRAK-1 KD. That
phosphorylation was specifically induced by IRAK-4 was confirmed by the
observation
that coexpression of IRAK-1 KD with two different IRAK-4 kinase dead mutants,
IRAK-
4KD (IRAK-4KK213AA or IRAK-4D311 N), did not similarly induce IRAK-1 KD
phosphorylation. Although coexpression of IRAK-4 clearly induced IRAK-1
phosphorylation, only a partial conversion to the phosphorylated species was
observed. Addition of MyD88 however, significantly enhanced IRAK-4 induced
IRAK-
1 KD phosphorylation, suggesting that MyD88 stimulates IRAK-4's activity. This
was
confirmed by an in vitro kinase assay carried out on immunoprecipitated IRAK-1
KD
showing significant phosphorylation of IRAK-1 KD, when immunoprecipitated from
cell
extracts coexpressing MyD88 and IRAK-4, but not IRAK-4KD. As MyD88 binds to
IRAK-1 KD (MyD88 does not bind the hyperphosphorylated form of IRAK-1 induced
by
its overexpression and was recently reported to bind IRAK-4, the simplest
explanation
for the observed finding was that MyD88 modulates contact of IRAK-1 and IRAK-
4. To
test this IRAK-1 KD and IRAK-4 interactions were analyzed in the presence or
absence
of MyD88 and/or MyD88s. As previously reported, IRAK-4 and IRAK-1 KD do not
directly associate. However, addition of MyD88 but not MyD88s permitted
assembly of
a complex containing both IRAKs. MyD88 thereby appears to act like a hinge
inducing
the proximity of IRAK-1 and IRAK-4. Interestingly phosphorylated IRAK-1 is
stably
detected together with MyD88, IRAK-1 and IRAK-4, suggesting that MyD88/IRAK-1
interactions are destabilized only after multiple sites are phosphorylated on
IRAK-1.
34
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
MyD88s blocks IRAK-4-induced IRAK-1 phosphorylation.
Unlike MyD88, MyD88s does not stimulate IRAK-4 -induced IRAK-1 KD
phosphorylation. In fact in vitro phosphorylation of IRAK-1 KD induced by IRAK-
4
coexpression was completely inhibited when MyD88s was coexpressed. Further,
MyD88s inhibited MyD88's stimulatory effect on IRAK-4-induced IRAK-1 KD
phosphorylation in a dose dependent manner.
MyD88s does not bind to IRAK-4 and blocks recruitment of IRAK-4 to the fL-1 Rs
To characterize the underlying mechanism by which MyD88s blocks 1RAK-1
phosphorylation, we initially analyzed if MyD88 and IRAK-4 associate. We did
not
expect the contrary, considering that MyD88 binds IRAK primarly through DD-DD
interactions. However, MyD88s/IRAK-4 complexes were not detected, despite the
strong association of MyD88s and IRAK-1 KD under similar conditions of
coimmunoprecipitation. This therefore suggested that the ID of MyD88 is
required for
this association with IRAK-4. To confirm this, the precise region of MyD88
mediating its
interaction with IRAK-4 was mapped by yeast 2-hybrid and co-
immunoprecipitation
binding assays. These assays confirm that MyD88 does, and MyD88s does not
interact with IRAK4. However, the ID in itself is insufficient, suggesting
that MyD88
interacts with IRAK-4 via a peptide spanning both the ID and adjacent amino
acids in
the DD (we cannot exclude that the first 17 amino acids of the TIR are
important for
binding) or that the ID induces a conformation of MyD88, exposing residues in
the DD
that are critical for interactions between the two proteins.
The above examples show that MyD88s acts as a negative regulator by its
incapacity
to bind to IRAK-4 and thus to prevent IRAK-4-induced IRAK-1 phosphorylation.
Under
chronic conditions of inflammation or following prolonged exposure to LPS
MyD88s is
expressed. As a result the above sequence of events is halted. IRAK-4 is not
recruited
to the IL-1 Rs/TLRs therefore IRAK-1 is not phosphorylated/activated, and as a
consequence signal transmission is interrupted. In conclusion, MyD88s acts as
a
negative regulator of IL-1beta/LPS -induced NF-kB activation by preventing
IRAK-4's
access to its substrate.
M~iD88s is involved in endotoxin tolerance
If MyD88S indeed functions as a negative regulator of IL-1 and LPS signaling
pathways, we rationalized that the expression of endogenous MyD88S must be
tightly
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
controlled. Analysis of MyD88S protein expression in cell lines of different
origin did not
reveal any detectable expression level. However, prolonged incubation (16 h)
of the
human THP-1 monocytic cell line with LPS resulted in MyD88s expression (Figure
5a).
We then tested if the induction of endogenous MyD88s correlated with a defect
in LPS-
signalling to NF-~cB. Indeed, LPS-induced IKB degradation and TNF secretion is
inhibited in LPS-pretreated monocytes (Figure 5b and 5c). It has been well
established
that prolonged incubation with LPS induces endotoxin tolerance in monocytes
which
makes them refractory to subsequent LPS challenges. Although one cannot
exclude
additional mechanisms in the development of endotoxin tolerance, it is worth
mentioning that recently, a defect in the phosphorylation and activation of
IRAK has
been described in endotoxin-tolerant cells. Taking into consideration that
MyD88S
expression prevents the phosphorylation of IRAK, it is possible that LPS-
inducible
expression of MyD88S contributes to endotoxin tolerance.
In conclusion, the tissue-specific and inducible expression of a splice
variant of MyD88
that acts as a dominant-negative inhibitor of IL-1 and LPS-induced NF-KB
activation
implicates an important role for alternative splicing of MyD88 in the
regulation of the
cellular response to IL-1, LPS and possibly other triggers of the IL-1 RITLR
superfamily.
Furthermore, our results also demonstrate that MyD88 not only functions as a
passive
adaptor protein, but also plays an active role in the phosphorylation and
activation of
IRAK through its ID.
Analysis of MyD88s in sepsis patients
MyD88s expression is analyzed in freshly isolated peripheral blood mononuclear
cells
(PBMC) that are isolated from sepsis patients. Blood samples are taken on day1
(_
day of arrival at intensive care unit) and day 7. Serum is prepared from a
fraction of the
blood sample, and used in bioassays for the determination of the presence of
cytokines (TNF, IL-1). Another fraction is used for the preparation of PBMC,
in which
the expression of MyD88s is analyzed by western blotting.
M D88s which inhibits IL-1 induced NF-KB activation does not inhibit IL-1
induced
activation of JNK
HEK 293T cells which stably express the IL-1 R, were transiently transfected
with an
expression plasmid for Flag-tagged JNK and increasing concentrations of
different
MyD88 proteins. Cells were treated for 30 min or 4h with IL-1 and analysed for
JNK
36
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
phosphorylation by immunoblotting with a phospho-JNK specific antibody (upper
panel
of figure 6). Total expression of JNK was verified by western blotting with
anti-Flag.
This shows that IL-1 induces the phosphorylation of JNK after 30 min as well
as after
4h treatment. Coexpression of MyD88-TIR (deletion mutant of MyD88 which only
expresses the TIR domain) or MyD88-Ipr (point mutant in the death domain which
disrupts the structure of the death domain), almost completely prevented the
IL-1
induced JNK phosphorylation, confirming the previously shown dominant-negative
effect of these mutants. In contrast to MyD88-TIR and MyD88-Ipr, coexpression
of
MyD88S did not prevent IL-1-induced phosphorylation of JNK, although MyD88s
inhibits IL-1 induced NF-xB activation under similar conditions Expression of
all
proteins was verified by western blot analysis. These results demonstrate that
MyD88s
expression can specifically prevent IL-1 induced NF-KB activation, without
changing
JNK activation.
MyD88s which is ineffective to activate NF-KB dependent Gene expression, still
activates JNK and induces AP-1 (c-fos/c-jun) dependent Gene expression
MyD88s is no longer able to activate NF-KB dependent gene expression. In order
to
analyze whether MyD88s is still able to activate AP-1 dependent gene
expression, we
transiently transfected HEK293 cells with an AP-1 dependent luciferase
reporter
construct, together with increasing amounts of MyD88s, MyD88L or MyD88 TIR
expression plasmids. Cell extracts were prepared and luciferase activity
determined.
Differences in transfection efficiency were normalized by cotransfecting a
constitutively
expressed (3gal expression plasmid and values are expressed as luc/gal. As
shown in
figure 7, both MyD88S and MyD88L still activate an AP-1 dependent reporter
construct. Since AP-1 is regulated by JNK, we investigated if MyD88s was still
able to
activate JNK phosphorylation. We cotransfected a Flag-tagged expression vector
for
JNK1 with expression plasmids for MyD88 or MyD88s, and analyzed JNK
phosphorylation by immunoblotting with phospho-JNK specific antibodies. Both
in the
presence of MyD88 as well as in the presence of MyD88s, a marked induction of
phosphorylated JNK could be observed. These data show that the NF-KB and
JNK/AP-
1 pathways diverge at the level of MyD88. MyD88s allows specific activation of
the
JNK pathway and AP-1 dependent gene expression, while blocking NF-KB dependent
gene expression. Obtaining specificity might be important in view of
specifically
modulating gene expression linked with inflammationlimmunity and T cell
37
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
differentiation, but also to modulate the role of JNK in cell survival (e.g.
IL-1 induced
apoptosis of islet cells; TNF-induced apoptosis of cancer cells; neuronal
apoptosis),
without modulating the anti-apoptotic NF-KB pathway.
Specific downreaulation of MyD88 via RNA-inhibition
It is possible to selectively knock-down MyD88~ through the use of RNA
inhibition
(RNAi) with a siRNA duplex that is specifically directed to the sequence that
encodes
the intermediate domain of MyD88 that is missing in MyD88S. The siRNAs
duplexes
are transfected in the cells of interest by oligofectamin (Life Technologies)
and the
transfection efficiency reaches 90-95%. Efficient knock-down of the gene of
interest is
verified by western blot analysis or RT-PCR.
The following sequences (corresponding to part of the intermediate domain) are
used
to specifically knock down MyD88~:
murine MyD88: 5'-AACCAGGAGTCCGAGAAGCCTTT-3'
human MyD88: 5'-AAGCCTTTACAGGTGGCCGCTGT-3'
MyD88s, which lacks the ID, will not be affected by these siRNA duplexes. This
allows
to study the effect of MyD88s expression in a MyD88~ negative background. Such
cells
should only respond to LPS or IL-1 by JNK and AP-1 activation, whereas NF-~eB
activation is blunted. Moreover, JNK activation will be sustained because of
the
inhibiting effect of NF-xB on the JNK pathway is no longer occurring.
Specific downregulation of MyD88s via RNA-inhibition
It is possible to selectively knock-down MyD88s through the use of RNAi with a
siRNA
duplex that is specifically directed to the sequence that forms the boundary
between
the death domain and TIR domain of MyD88s.
The following sequences (corresponding to the boundary of the DD and TIR
domain
(exon 1-exon 3 boundary) are used to specifically knock down MyD88s:
murine MyD88: 5'-AAGTCGCGCATCGGACAAACG-3'
human MyD88: 5'-CATTGGGCATATGCCTGAGCG-3'
MyD88~, which lacks this exon 1-exon 3 boundary, will not be affected by these
siRNA
duplexes. This allows to study the response of cells in the absence of MyD88s
expression, and will prevent the negative regulation of NF-~B activation in
tolerant
cells.
38
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
_Interference with alternative splicing of MyD88
We demonstrated that in THP-1, which were treated for 16 h with LPS, MyD88s
expression is induced by alternative splicing of MyD88. Alternative splicing
of MyD88 to
MyD88s can be prevented by the use of antisense oligo's, which target a
particular 3'
intron-exon junction, and make it less likely that this site shall be
recognized as
acceptor site in the splicing process (Lim and Hertel (2001) J Biol Chem 276:
14476).
MyD88S is formed by exon skipping of exon 2. This means that the 3' acceptor
splice
sites of exon 2 and exon 3 compete with each other for the 5' donor site from
exon 1.
The underlying molecular mechanism is unknown, but might involve the LPS-
induced
disruption of a putative exon splicing enhancer in exon 2, an element which
promotes
splice site and exon recognition by assisting in the recruitment of the
splicing
machinery (e.g. SR proteins, hnRNP proteins; Chabot (1996) Trends in Genetics
12:472),. By administration of antisense oligo's designed against the intron-
exon
junction of the 3' acceptor splice site of exon 3, the balance may be tilted
to favor exon
2 inclusion. A drawback of this approach is that, in several cases, also an
incorrrectly
spliced MyD88~ isoform in which the intron between exon 2 and exon 3 is still
present
will be formed.
We use the following antisense oligo to prevent alternative splicing of human
MyD88 to
MyD88s: 5'-GGCAUAUGCCCUGGGUGCAGA-3'
Alternatively, administration of antisense oligo's designed against the intron-
exon
junction of the 3' acceptor splice site of exon 2, the balance may be tilted
to favor
exon2 exclusion and formation of MyD88s.
We use the following antisense oligo to induce alternative splicing of human
MyD88 to
MyD88s: 5'-GCAAUCCUCCUCUGUGGGGAA-3'
Alternatively, differential splicing of MyD88 can also be modulated by
overexpression
of specific splicing factors (e.g. SR proteins, hnRNP proteins; Chabot (1996)
Trends in
Genetics 12:472). A similar approach has been followed to modulate alternative
splicing of CD45 by overexpression of specific SR proteins (ten Dam et al.
(2000) J.
Immunol. 164:5287)
Materials and Methods
Cell culture and biological reagents
Cells were grown in RPMI 1640 (in case of mouse macrophage Mf4/4 and human
monocyte THP-1 cells) or DMEM (in case of human embryonic kidney (HEK) 293T
39
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
cells), supplemented with 10% fetal calf serum, 2 mM L-glutamine, 100 U/ml
penicillin,
100 wg/ml streptomycin, 1 mM sodium pyruvate, and 50 ~,M 2-mercaptoethanol.
Recombinant mouse TNF-alfa, and IL-1beta was provided by Apotech (San Diego,
USA) and Sigma, respectively. Lipopolysaccharide (LPS) from Salmonella abortus
equi was purchased from Sigma (Saint Louis, USA). The source of the various
antibodies used in this study is as follows: anti-Flag/M2 (Eastman Kodak
Company),
anti-VSV (Sigma), anti-IRAK-1 (Alexis or Santa Cruz), anti-MyD88 (ProSci
Incorporated) and anti-E (Pharmacia) antibodies.
PCR amplification of MyD88
Total RNA was reverse transcribed with Superscript II RNase H- reverse
transcriptase
(Gibco BRL, Life Technologies, Paisley, UK)) and oligo (dT) primer. A Balb/c
mouse
multiple tissue cDNA panel was purchased from Clontech (Palo Alto, CA, USA).
The
quality of the cDNA was verified by PCR amplification of ~i-actin. Primers,
hybridizing to
the 5'-end (5'-GGAATTCCCATGGGCGGCCGCGATGTCTGCGGGAGACCCCCGC-3')
and 3'-end (5'-CGCCCTGCAGCTCGAGTCAGGGCAGGGACAAAGCCTTGGCAAG-
3') of the open reading frame of murine MyD88 were used for PCR amplification
of
MyD88.
Expression plasmids and yeast 2-hybrid constructs
pCAGGS-E-MyD88~ and pCAGGS-E-MyD88s were obtained by in frame cloning of
RT-PCR fragments of MyD88 with an N-terminal E-tag into the eukaryotic
expression
vector pCAGGS. pCDNA3-AU1-MyD88-TIR(152-296) was a generous gift of Dr. M.
Muzio (Mario Negri Institute, Milan) and was described in Muzio M. et al
(1997)
Science 278: 1612. pPCRllI-Flag-MyD88, pPCRllI-Flag-IL1 R, pPCRllI-Flag-IL1
RAcP,
pcDNA3-IRAK(T66A) and pcDNA3-IRAK-N(T66A) were described in Burns K. et al
(2000) Nat. Cell Biol. 2:346. pNFconluc, containing the luciferase reporter
gene driven
by a minimal NF-KB responsive promoter, was a gift of Dr. A. Israel (Institut
Pasteur,
Paris). pPGK-neogal, containing the ~i-galactosidase gene after the PGK
promotor,
was obtained from Dr. P. Soriano (Fred. Hutchinson Cancer Research Institute,
Seattle). IRAK-4 was PCR amplified from an EST clone and inserted into pCRlll
containing an N-terminal Flag or VSV tag or into pGAD10. Kinase dead mutants
of
IRAK-4 (IRAK-4KK213AA or IRAK-4D311 N) were generated by double PCR and
inserted into a pCRlll vector with an N-terminal tag. pGBT9 MyD88, pGBT9 MyD88-
N
(aa 1-172), pGBT9 MyD88-TIR (aa 161-296), expressing pGALDB (the GAL4 DNA-
binding domain) fused to full-length MyD88 or the indicated deletion mutants
have
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
been described previously (Burns et al (1998) J. Biol. Chem. 273: 12203-
12209).
pGBT9 MyD88-ID (aa 110-157 ) and pGBT9 MyD88-DD (aa 1-110) were prepared by
inserting PCR generated fragments into pGBT9. The sequence of all PCR
generated
cDNAs were confirmed by DNA sequencing. pGAD10 IRAK-4 expressing Gal4AD-
IRAK4 (a fusion protein of GAL4 transcription activation with full-length IRAK-
4) was
made by inserting IRAK-4 cDNA as an EcoRl fragment into pGAD10. An AP-1
dependent luciferase reporter construct, pAP-1luc, was purchased from
Stratagene
(PathDetect System).
Transient transfections and NF-KB or AP-7 reporter gene assays
HEK 293T cells were seeded in 6-well plates at 2 x 105 cells/well and
transiently
transfected by the DNA-calcium phosphate precipitation method with 100 ng
pNFconluc or 100 ng pAP-1luc, 100 ng pGK-neogal and different concentrations
of
specific MyD88 expression plasmids. The total amount of DNA was kept constant
by
adding empty vector up to 1 ~g DNA per well. Transfections were done in
triplicate. 6 h
post transfection, cells were trypsinized and seeded at a density of 2 x 104
cells/well in
24-well plates. 3 x 106 Mf4/4 cells were transiently transfected by
electroporation
(conditions: 300 V and 1350 ~F) with 1 ~g pPGKneogal, 4 pg pNFconluc and 5 ~,g
of a
MyD88 expression plasmid. Transfected cells were seeded at a density of 2.5 x
105
c/well in a 24-well plate. 48 h post transfection cells were stimulated for 6
h with 100
ng/ml IL1-(i, 100 ng/ml TNF, 100 ng/ml LPS or left untreated. NF-KB and AP-1
activity
was determined by measuring the luciferase activity present in cell extracts.
Luciferase
values were normalized for differences in transfection efficiency on the basis
of ~i-
galactosidase activity in the same extracts, and expressed as fold induction
values
relative to the unstimulated empty vector control.
Gel retardation assays
HEK 293T cells were seeded at 1.5 x 106 cells/10 cm petridish and transfected
with
pCAGGS-E-MyD88s, pCAGGS-E-Myd88~ or empty vector. Nuclear fractions were
prepared as described by Dignam JD et al (1983) Nucleic Acid Res. 11:1475. NF-
KB
DNA binding activity was analyzed by incubating 8 ~.g nuclear proteins for 30
min with
the 32P-end-labeled oligonucleotide 5'-agctATGTGGGATTTTCCCATGGAGCagct-3',
corresponding to the NF-KB recognition sequence of the Ig KB promotor.
DNA/nucleoprotein complexes were separated from free probe on a .4%
polyacrylamide gel.
41
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
Co-immunoprecipitation and western blotting
2 x 106 HEK293T cells were plated on 10-cm petridishes and transiently
transfected
with 1 p,g of the indicated expression plasmids. The total amount of DNA was
kept at 5
~,g per petridish by adding empty vector. 24 h post-transfection cells were
washed with
PBS, and lysed in 500 ~I lysis buffer (50 mM HEPES pH7.6, 250 mM NaCI, 0.1 %
NP-
40, 5 mM EDTA, supplemented with protease and phosphatase inhibitors). Lysates
were incubated for 16h with 5 pg anti-Flag (Sigma). Immunocomplexes were
immobilized on protein A-Trisacryl beads (Pierce Chemical Co., Rockford, USA).
The
beads were washed twice with lysis buffer and twice with lysis buffer
containing 1 M
NaCI. Bound proteins were eluted by boiling in Laemli buffer and analyzed by
10%
SDS-PAGE and Western blotting. Western blots were blocked with 5% milk and
incubated overnight with primary antibodies. Antibodies raised against the C-
terminal
part of MyD88 were purchased from Immucor (Roedermark, Germany). An E-tag
antibody was purchased from Amersham Pharmacia Biotech (Rainham, UK), an IRAK-
antibody from Alexis (San Diego, CA, USA) and an IKB-a antibody from Santa
Cruz
Biotechnology Inc.(Santa Cruz, CA, USA). HRP-conjugated anti-mouse or HRP-
conjugated anti-rabbit secondary antibodies were purchased from Amersham
Pharmacia Biotech and incubated with the blots for 1 h. Immunoreactive bands
were
revealed by enhanced chemiluminescence (ECL, Amersham Pharmacia Biotech). For
detection of JNK phosphorylation, cell lysates were prepared in RIPA buffer
(25 mM
Tris pH8.2, 50 mM NaCI, 0.5% NP-40, 0.5% deoxycholic acid, 0.1% SDS, 10~,M
iodoacetate) supplemented with protease and phosphatase inhibitors. Lysates
were
analyzed by 10% SDS-PAGE and Western blotting with anti-JNK or anti-phospoJNK
(Cell Signaling, Beverly, MA, USA).
TNF bio-assay
TNF levels in the supernatans of THP-1 cells were measured in a bioassay for
TNF
which is based on TNF cytotoxicity for the mouse fibroblast cell line L929 in
the
presence of 1 wg/ml actinomycin D, as described in Schotte P. et al (2001) J.
Biol.
Chem. 276: 25939.
Yeast 2-f~ybrid interaction studies.
Interaction of full-length IRAK-4 with different deletion mutants of MyD88 was
evaluated by yeast-two-hybrid interaction studies, performed as described
previously
(De Valck et al (1996) FEBS Lett. 384: 61-64. Briefly, yeast cells of the S.
cerevisiae
strain HF7c were cotransformed with the pGAD10 IRAK-4 and pGBT9 MyD88 or
42
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
pGBT9 fused to different MyD88 deletion mutants. Transformation efficiency was
verified by growth on appropriate synthetic media using Trp and Leu selection
markers. Protein interaction was revealed by His auxotrophy and assessed by b
galactosidase expression filter assays. All pGBT9 MyD88 fusion proteins were
negative for autoactivation.
Immunoprecipitation and Kinase Assays.
Transfected 293T cells were lysed in lysis bufFer (1 %NP-40, 20 mM HEPES, pH
7.9,
250 mM NaCI, 20 mM b-glycerophosphate, 10 mM NaF, 1 mM sodium orthovanadate,
2 mM dithiothreitol, 1 mM EDTA and a protease inhibitor cocktail). Following
lysis, the
cell extracts were incubated with one of the following antibodies for 2 hrs at
4°C: (1 pg)
anti-M2, anti-VSV, anti-IRAK-1, or anti-E that were preincubated with protein
G
Sepharose. After incubation the beads were washed 6 times with lysis buffer,
separated by SDS-PAGE, transferred to Nitrocellulose and analyzed by
immunoblotting. For the kinase assays, transiently transfected HEK 293T cells
were
lysed in 500 pl of 20 mM Tris pH 7.5, 50 mM KCI, 5 mM MgCl2 , 400 mM NaCI, 2
mM
DTT, 1% Triton-X-100, 20% glycerol and protease and phosphatase inhibitors.
IRAK-
1KD was immunoprecipitated for 2 h at 4°C with an anti-IRAK-1 antibody
(Alexis),
followed by addition of protein A trisacryl (Pierce). Immune complexes were
washed
twice with lysis buffer and twice with kinase bufFer containing 20 mM Tris-
HCI, pH 7.5,
50 mM KCI, 2 mM MgCl2 , 2 mM MnCl2 , 5% glycerol and protease inhibitors.
After the
last wash, immune complexes were resuspended in 40 pl kinase buffer. For each
kinase reaction 10 ml of the respective immune complexes were mixed with 5 pCi
of
gamma 32P] ATP (3000 Ci/mmol) in total volume of 25 pl. Reactions were allowed
to
proceed for 15 min at 30°C and then directly analysed by SDS-PAGE and
autoradiography. A reaction without ATP added was set up in parallel and
analysed by
western blot to estimate the input.
43
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
References
1. Wesche H, Henzel WJ, Shillinglaw W, Li S, Cao Z: MyD88: an adapter that
recruits IRAK to the IL-1 receptor complex. Immunity 1997, 7:837-847.
2. Medzhitov R, Preston-Hurlburt P, Kopp E, Stadlen A, Chen C, Ghosh S,
Janeway C
Jr: MyD88 is an adaptor protein in the hToIIIIL-1 receptor family signaling
pathways. Mol Cell 1998, 2:253-258.
3. Burns K, Martinon F, Esslinger C, Pahl H, Schneider P, Bodmer J-L, Di Marco
F,
French L, Tschopp J: MyD88, an adaptor protein involved in interleukin-1
signaling. J Biol Chem 1998, 273:12203-12209.
4. Burns K, Clatworthy J, Martin L, Martinon F, Plumpton C, Maschera B, Lewis
A, Ray
K, Tschopp J, Voipe F: Tollip, a new component of the IL1 pathway, links IRAK
to
the IL1 receptor. Nat Cell Bio12000, 2:346-351.
5. Li X, Commane M, Jiang Z, Stark, GR: IL-1-induced NFKB and c-Jun N-terminal
kinase (JNK) activation diverge at 1L-1 receptor-associated kinase (IRAK).
Proc
Natl Acad Sci USA 2001, 98:4461-4465.
6. Hardiman G, Jenkins NA, Copeland NG, Gilbert DJ, Garcia DK, Nayfor SL,
Kastelein RA, Bazan JF: Genetic structure and chromosomal mapping of MyD88.
Genomics 1997, 45:332-340.
7. Lord KA, Hoffman-Liebermann B, Liebermann DA: Nucleotide sequence and
expression of a cDNA encoding MyD88, a novel myeloid differentiation primary
response gene induced by IL6. Oncogene 1990, 5:1095-1101.
8. Adachi O, Kawai T, Takeda K, Matsumoto M, Tsutsui H, Sakagami M, Nakanishi
K,
Akira S: Targeted disruption of the MyD88 gene results in loss of IL-1- and IL-
18-
mediated function. Immunity 1998, 9:143-150.
9. Lomaga MA, Yeh WC, Sarosi I, Duncan GS, Furlonger C, Ho A, Morony S,
Capparelli C, Van G, Kaufman S, van der Heiden A, Itie A, Wakeham A, Khoo W,
Sasaki T, Cao Z, Penninger JM, Paige CJ, Lacey DL, Dunstan CR, Boyle WJ,
Goeddel
DV, Mak TW: TRAF6 deficiency results in osteopetrosis and defective
interleukin-
1, CD40, and LPS signaling. Genes Dev 1999, 13:1015-1024.
10. Cao Z, Henzel WJ, Gao X: IRAK: a kinase associated with the interleukin-1
receptor. Science 1996, 271:1128-1131.
11. Li X, Commane M, Burns C, Vithalani K, Cao Z, Stark GR: Mutant cells that
do
not respond to interleukin-1 (tL-1) reveal a novel role for IL-1 receptor
associated
kinase. Mol CellBiol 1999, 19:4643-4652.
44
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
12. Cao Z, Ziong J, Takeuchi M, Kurama T, Goeddel DV: TRAF6 is a signal
transducer for interleukin-1. Nature 1996b, 383:443-446.
13. Kawai T, Adachi O, Ogawa T, Takeda K, Akira S.: Unresponsiveness of MyD88-
deficient mice to endotoxin. Immunity 1999, 11:115-122.
14. Henneke P, Golenbock DT: TIRAP: how Toll receptors fraternize. Nature
Immunol 2001, 2:828-830.
15. Ziegler-Heitbrock HWL, Frankenberger M, Wedel A: Tolerance to
lipopolysaccharide in human blood monocytes. Immunobiol 1995, 193:217-223.
16. Nomura F, Akashi S, Sakao Y, Sato S, Kawai T, Matsumoto M, Nakanishi K,
Kimoto M, Miyake K, Takeda K, Akira S: Cutting edge: Endotoxin tolerance in
mouse peritoneal macrophages correlates with down-regulation of surface toll-
like receptor 4 expression. J Immunol 2000, 164:3476-3479.
17. Li L, Cousart S, Hu J, McCall CE: Characterization of interleukin-1
receptor-
associated kinase in normal and endotoxin-tolerant cells. J Biol Chem 2000
275:23340-23345.
45
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
1/7
SEQUENCE LISTING
<110> vlaams Interuniversitair Instituut voor Biotechnologie vzw
<120> A novel splice variant of MyD88 and use thereof
<130> RBE/MyD/v107
<150> EP02075068.3
<151> 2002-01-10
<160> 15
<170> Patentln version 3.1
<210>1
<211>756
<212>DNA
<213>Homo sapiens
<400>
1
atggctgcaggaggtcccggcgcggggtctgcggccccggtctcctccacatcctccctt60
cccctggctgctctcaacatgcgagtgcggcgccgcctgtctctgttcttgaacgtgcgg120
acacaggtggcggccgactggaccgcgctggcggaggagatggactttgagtacttggag180
atccggcaactggagacacaagcggaccccactggcaggctgctggacgcctggcaggga240
cgccctggcgcctctgtaggccgactgctcgagctgcttaccaagctgggctgcgacgac300
gtgctgctggagctgggacccagcattgggcatatgcctgagcgtttcgatgccttcatc360
tgctattgccccagcgacatccagtttgtgcaggagatgatccggcaactggaacagaca420
aactatcgactgaagttgtgtgtgtctgaccgcgatgtcctgcctggcacctgtgtctgg480
tctattgctagtgagctcatcgaaaagaggtgccgccggatggtggtggttgtctctgat540
gattacctgcagagcaaggaatgtgacttccagaccaaatttgcactcagcctctctcca600
ggtgcccatcagaagcgactgatccccatcaagtacaaggcaatgaagaaagagttcccc660
agcatcctgaggttcatcactgtctgcgactacaccaacccctgcaccaaatcttggttc720
tggactcgccttgccaaggccttgtccctgccctga 756
<210>Z
<211>251
<212>PRT
<213>Homo sapiens
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
2/7
<400> 2
Met Ala Ala Gly Gly Pro Gly Ala Gly Ser Ala Ala Pro Val 5er ser
1 5 10 15
Thr Ser ser Leu Pro Leu Ala Ala Leu Asn Met Arg Val Arg Arg Arg
20 25 30
Leu Ser Leu Phe Leu Asn Val Arg Thr Gln Val Ala Ala Asp Trp Thr
35 40 45
Ala Leu Ala Glu Glu Met Asp Phe Glu Tyr Leu Glu Ile Arg Gln Leu
50 55 60
Glu Thr Gln Ala Asp Pro Thr Gly Arg Leu Leu Asp Ala Trp Gln Gly
65 70 75 80
Arg Pro Gly Ala Ser Val Gly Arg Leu Leu Glu Leu Leu Thr Lys Leu
85 90 95
Gly Arg Asp Asp Val Leu Leu Glu Leu Gly Pro Ser Ile Gly His Met
100 105 110
Pro Glu Arg Phe Asp Ala Phe Ile Cys Tyr Cys Pro 5er Asp Ile Gln
115 120 125
Phe Val Gln Glu Met Ile Arg Gln Leu Glu Gln Thr Asn Tyr Arg Leu
130 135 140
Lys Leu Cys val Ser Asp Arg Asp Val Leu Pro Gly Thr Cys Val Trp
145 150 155 160
Ser Ile Ala Ser Glu Leu Ile Glu Lys Arg Cys Arg Arg Met Val Val
165 170 175
Val Val 5er Asp Asp Tyr Leu Gln Ser Lys Glu Cys Asp Phe Gln Thr
180 185 190
Lys Phe Ala Leu ser Leu Ser Pro Gly Ala His Gln Lys Arg Leu Ile
195 200 205
Pro Ile Lys Tyr Lys Ala Met Lys Lys Glu Phe Pro Ser Ile Leu Arg
210 215 220
Phe Ile Thr Val Cys Asp Tyr Thr Asn Pro Cys Thr Lys Ser Trp Phe
225 230 235 240
Trp Thr Arg Leu Ala Lys Ala Leu Ser Leu Pro
245 250
<210> 3
<211> 756
<212> DNA
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
3/7
<213> Mus musculus
<400>
3 gagacccccgcgtgggatccgggtccctggactccttcatgttctccata60
atgtctgcgg
cccttggtcgcgcttaacgtgggagtgaggcgccgcctatcgctgttcttgaaccctcgg120
acgcccgtggcggccgactggaccttgctcccggaggagatgggcttcgagtacttggag180
atccgagagctggaaacgcgccctgaccccactcgcagtttgttggatgcctggcagggg240
cgctctggcgcgtctgtcggcaggctgctagagctgctggccttgttagaccgtgaggat300
atactgaaggagctgaagtcgcgcatcggacaaacgccggaacttttcgatgcctttatc360
tgctactgccccaacgatatcgagtttgtgcaggagatgatccggcaactagaacagaca420
gactatcggcttaagttgtgtgtgtccgaccgtgacgtcctgccgggcacctgtgtctgg480
tccattgccagcgagctaattgagaaaaggtgtcgccgcatggtggtggttgtttctgac540
gattatctacagagcaaggaatgtgacttccagaccaagtttgcactcagcctgtctcca600
ggtgtccaacagaagcgactgattcctattaaatacaaggcgatgaagaaggactttccc660
agtatcctgcggttcatcactatatgcgactataccaacccttgcaccaagtcctggttc720
tggacccgccttgccaaggctttgtccctgccctga 756
<210>4
<211>251
<212>PRT
<213>Mus musculus
<400> 4
Met Ser Ala Gly Asp Pro Arg Val Gly Ser Gly Ser Leu Asp Ser Phe
1 5 10 15
Met Phe Ser Ile Pro Leu Val Ala Leu Asn Val Gly Val Arg Arg Arg
20 25 30
Leu Ser Leu Phe Leu Asn Pro Arg Thr Pro Val Ala Ala Asp Trp Thr
35 40 45
Leu Leu Pro Glu Glu Met Gly Phe Glu Tyr Leu Glu Ile Arg Glu Leu
50 55 60
Glu Thr Arg Pro Asp Pro Thr Arg Ser Leu Leu Asp Ala Trp Gln Gly
65 70 75 80
Arg Ser Gly Ala Ser Val Gly Arg Leu Leu Glu Leu Leu Ala Leu Leu
85 90 95
Asp Arg Glu Asp Ile Leu Lys Glu Leu Lys Ser Arg Ile Gly Gln Thr
100 105 110
Pro Glu Leu Phe Asp Ala Phe Ile Cys Tyr Cys Pro Asn Asp Ile Glu
115 120 125
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
4/7
Phe Val Gln Glu Met Ile Arg Gln Leu Glu Gln Thr Asp Tyr Arg Leu
130 135 140
Lys Leu Cys Val Ser Asp Arg Asp Val Leu Pro Gly Thr Cys Val Trp
145 150 155 160
Ser Ile Ala Ser Glu Leu Ile Glu Lys Arg Cys Arg Arg Met Val Val
165 170 175
Val Val Ser Asp Asp Tyr Leu Gln Ser Lys Glu Cys Asp Phe Gln Thr
180 185 190
Lys Phe Ala Leu Ser Leu Ser Pro Gly Val Gln Gln Lys Arg Leu Ile
195 200 205 -
Pro Ile Lys Tyr Lys Ala Met Lys Lys Asp Phe Pro Ser Ile Leu Arg
210 215 220
Phe Ile Thr Ile Cys Asp Tyr Thr Asn Pro Cys Thr Lys Ser Trp Phe
225 230 235 240
Trp Thr Arg Leu Ala Lys Ala Leu Ser Leu Pro
245 Z50
<210> 5
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> sequence used to knock down MyD88L - murine MyD88
<400> 5
aaccaggagt ccgagaagcc ttt 23
<210> 6
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> sequence used to knock down MyD88L - human MyD88
<400> 6
aagcctttac aggtggccgc tg 22
<210> 7
<211> 21
<212> DNA
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
5/7
<213> Artificial Sequence
<220>
<223> sequence used to knock down MyD88s - murine MyD88
<400> 7
aagtcgcgca tcggacaaac g 21
<210> 8
<211> 21
<212> DNA
<213> Artificial Sequence
<220> '
<223> sequence used to knock down MyD88s - human MyD88
<400> 8
cattgggcat atgcctgagc g 21
<210> 9
<211> 21
<212> RNA
<213> Artificial sequence
<220>
<223> antisense oligo used to prevent alternative splicing of human MyD
88 to MyD885
<400> 9
ggcauaugcc cugggugcag a 21
<210> 10
<211> 21
<212> RNA
<213> Artificial Sequence
<220>
<223> antisense oligo used for inducing alternative splicing of human M
yD88 to MyD885
<400> 10
gcaauccucc ucugugggga a 21
<210> 11
<211> 43
<212> DNA
<213> Artificial sequence
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
6/7
<220>
<223> primer hybridizing, to the 5'-end of the oRF of murine MyD88 used
for PCR amplification of MyD88
<400> 11
ggaattccca tgggcggccg cgatgtctgc gggagacccc cgc 43
<210> 12
<211> 43
<212> DNA
<213> Artificial sequence
<220>
<223> primer hybridizing to the 3'-end of the oRF of murine MyD88 used
for PCR amplification of MyD88
<400> 12
cgccctgcag ctcgagtcag ggcagggaca aagccttggc aag 43
<210> 13
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> 32-P-end-labeled oligonucleotide
<400> 13
agctatgtgg gattttccca tggagcagct 30
<210>14
<211>77
<212>PRT
<213>Homo sapiens
<400> 14
Leu Gly Arg Asp Asp Val Leu Leu Glu Leu Gly Pro Ser Ile Glu Glu
1 5 10 15
Asp Cys Gln Lys Tyr Ile Leu Lys Gln Gln Gln Glu Glu Ala Glu Lys
ZO 25 30
Pro Leu Gln Val Ala Ala Val Asp Ser Ser Val Pro Arg Thr Ala Glu
35 40 45
Leu Ala Gly Ile Thr Thr Leu Asp Asp Pro Leu Gly His Met Pro Glu
50 55 60
CA 02472927 2004-07-08
WO 03/057728 PCT/EP03/00381
7/7
Arg Phe Asp Ala Phe Ile Cys Tyr Cys Pro Ser Asp Ile
65 70 75
<210>15
<211>44
<212>PRT
<213>Homo Sapiens
<400> 15
Glu Asp Cys Gln Lys Tyr Ile Leu Lys Gln Gln Gln Glu Glu Ala Glu
1 5 10 15
Lys Pro Leu Gln Val Ala Ala Val Asp Ser Ser Val Pro Arg Thr Ala
20 25 30
Glu Leu Ala Gly Ile Thr Thr Leu Asp Asp Pro Leu
35 40
