Note: Descriptions are shown in the official language in which they were submitted.
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
2'-SUBSTITUTED OLIGOMERIC COMPOUNDS AND COMPOSITIONS
FOR USE IN GENE MODULATIONS
Cross-Reference To Related Applications
[0001] The present application is a continuation in part of U.S. Serial
Number 10/078,949 filed 2/20/2002 which is a continuation of 09/479,783 filed
1/7/2000, which is a divisional of U.S. Serial Number 08/870,608 filed
6/6/1997
which was issued as U.S. Patent 6,107,094 on 8/22/2002, which is a
continuation-
in-part of U.S. Serial Number 08/659,440 filed 6/6/1996 which was issued as
U.S.
Patent 5,898,031 on 4/27/1999, each of which is incorporated herein by
reference
in its entirety. The present application also claims benefit to U.S.
Provisional
Application Serial Number 60/423,760 filed 11/5/2002, U.S. Provisional
Application Serial Number 60/503,521 filed 9/16/2002, which are incorporated
herein by reference in their entirety.
Field of the Invention
[0002] The present invention provides modified oligomers that modulate
gene expression via a RNA interference pathway. The oligomers of the invention
include one or more modifications thereon resulting in differences in various
physical properties and attributes compared to wild type nucleic acids. The
modified oligomers are used alone or in compositions to modulate the targeted
nucleic acids. In preferred embodiments of the invention, the modifications
include a 2' substituent group on at least one sugar moiety of the oliogmer.
Background of the Invention
[0003] In many species, introduction of double-stranded RNA (dsRNA)
induces potent and specific gene silencing. This phenomenon occurs in both
plants
and animals and has roles in viral defense and transposon silencing
mechanisms.
This phenomenon was originally described more than a decade ago by researchers
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-2-
working with the petunia flower. While trying to deepen the purple color of
these
flowers, Jorgensen et al. introduced a pigment-producing gene under the
control
of a powerful promoter. Instead of the expected deep purple color, many of the
flowers appeared variegated or even white. Jorgensen named the observed
phenomenon "cosuppression", since the expression of both the introduced gene
and the homologous endogenous gene was suppressed (Napoli et al., Plant Cell,
1990, 2, 279-289; Jorgensen et al., Plaht Mol. Biol.,1996, 31, 957-973).
[0004] Cosuppression has since been found to occur in many species of
plants, fungi, and has been particularly well characterized in Neurospora
crassa,
where it is known as "quelling" (Cogoni and Macino, Gehes Dev. 2000, 10, 638-
643; Guru, Nature, 2000, 404, 804-808).
[0005] The first evidence that dsRNA could lead to gene silencing in
animals came from work in the nematode, Caeho~habditis elegahs. In 1995,
researchers Guo and Kemphues were attempting to use antisense RNA to shut
down expression of the par-1 gene in order to assess its function. As
expected,
injection of the antisense RNA disrupted expression of par-1, but quizzically,
injection of the sense-strand control also disrupted expression (Guo and
I~empheus, Cell, 1995, 81, 611-620). This result was a puzzle until Fire et
al.
inj ected dsRNA (a mixture of both sense and antisense strands) into C.
elegaus.
This inj ection resulted in much more efficient silencing than inj ection of
either the
sense or the antisense strands alone. Injection of just a few molecules of
dsRNA
per cell was sufficient to completely silence the homologous gene's
expression.
Furthermore, inj ection of dsRNA into the gut of the worm caused gene
silencing
not only throughout the worm, but also in first generation offspring (Fire et
al.,
Nature, 1998, 391, 806-811).
[0006] The potency of tlus phenomenon led Timmons and Fire to explore
the limits of the dsRNA effects by feeding nematodes bacteria that had been
engineered to express dsRNA homologous to the C. elegans unc-22 gene.
Surprisingly, these worms developed an unc-22 null-like phenotype (Timmons
and Fire, Nature 1998, 395, 854; Timmons et al., Gehe, 2001, 263, 103-112).
Further work showed that soaking worms in dsRNA was also able to induce
silencing (Tabara et al., Seiehce, 1998, 282, 430-431). PCT publication WO
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-3-
01/48183 discloses methods of inhibiting expression of a target gene in a
nematode worm involving feeding to the worm a food organism which is capable
of producing a double-stranded RNA structure having a nucleotide sequence
substantially identical to a portion of the target gene following ingestion of
the
food organism by the nematode, or by introducing a DNA capable of producing
the double-stranded RNA structure (Bogaert et al., 2001).
(0007] The posttranscriptional gene silencing defined in Caehor~habditis
elegahs resulting from exposure to double-stranded RNA (dsRNA) has since been
designated as RNA interference (RNAi). This term has come to generalize all
forms of gene silencing involving dsRNA leading to the sequence-specific
reduction of endogenous targeted mRNA levels; unlike co-suppression, in which
transgenic DNA leads to silencing of both the transgene and the endogenous
gene.
[0008] Introduction of exogenous double-stranded RNA (dsRNA) into
Caeho~habditis elegayas has been shown to specifically and potently disrupt
the
activity of genes containing homologous sequences. Montgomery et al. suggests
that the primary interference affects of dsRNA are post-transcriptional. This
conclusion being derived from examination of the primary DNA sequence after
dsRNA-mediated interference and a finding of no evidence of alterations,
followed by studies involving alteration of an upstream,operon having no
effect
on the activity of its downstream gene. These results argue against an effect
on
initiation or elongation of transcription. Finally using in situ hybridization
they
observed that dsRNA-mediated interference produced a substantial, although not
complete, reduction in accumulation of nascent transcripts in the nucleus,
while
cytoplasmic accumulation of transcripts was virtually eliminated. These
results
indicate that the endogenous mRNA is the primary target for interference and
suggest a mechanism that degrades the targeted mRNA before translation can
occur. It was also found that this mechanism is not dependent on the SMG
system,
an mRNA surveillance system in C. elegans responsible for targeting and
destroying aberrant messages. The authors further suggest a model of how dsRNA
might fiuiction as a catalytic mechanism to target homologous mRNAs for
degradation. (Montgomery et al., P~oc. Natl. Acad. Sci. U S A, 1998, 95, 15502-
15507).
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-4-
[0009] Recently, the development of a cell-free system from syncytial
blastoderm Drosophila embryos, which recapitulates many of the features of
RNAi, has been reported. The interference observed in this reaction is
sequence
specific, is promoted by dsRNA but not single-stranded RNA, functions by
specific mRNA degradation, and requires a minimum length of dsRNA.,
Furthermore, preincubation of dsRNA potentiates its activity demonstrating
that
RNAi can be mediated by sequence-specific processes in soluble reactions
(Tuschl et al., Genes Dev., 1999,13, 3191-3197).
[0010] In subsequent experiments, Tuschl et al, using the Drosophila in
vitro system, demonstrated that 21- and 22-nt RNA fragments are the sequence-
specific mediators of RNAi. These fragments, which they termed short
interfering
RNAs (siRNAs), were shown to be generated by an RNase III-like processing
reaction from long dsRNA. They also showed that chemically synthesized siRNA
duplexes with overhanging 3' ends mediate efficient target RNA cleavage in the
Drosophila lysate, and that the cleavage site is located near the center of
the
region spanned by the guiding siRNA. In addition, they suggest that the
direction
of dsRNA processing determines whether sense or antisense target RNA can be
cleaved by the siRNA-protein complex (Elbashir et al., Genes Dev., 2001, I5,
188-200). Further characterization of the suppression of expression of
endogenous and heterologous genes caused by the 21-23 nucleotide siRNAs have
been investigated in several mammalian cell lines, including human embryonic
lcidney (293) and HeLa cells (Elbashir et al., Nature, 2001, 411, 494-498).
[0011] The Drosophila embryo extract system has been exploited, using
green fluorescent protein and luciferase tagged siRNAs, to demonstrate that
siRNAs can serve as primers to transform the target mRNA into dsRNA. The
nascent dsRNA is degraded to eliminate the incorporated target mRNA while
generating new siRNAs in a cycle of dsRNA synthesis and degradation. Evidence
is also presented that mRNA-dependent siRNA incorporation to form dsRNA is
carried out by an RNA-dependent RNA polymerase activity (RdRP) (Lipardi et
al., Cell, 2001,107, 297-307).
[0012] The involvement of an RNA-directed RNA polymerase and siRNA
primers as reported by Lipardi et al. (Lipardi et al., Cell, 2001,107, 297-
307) is
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-5-
one of the many intriguing features of gene silencing by RNA interference.
This
suggests an apparent catalytic nature to the phenomenon. New biochemical and
genetic evidence reported by Nishikura et al. also shows that an RNA-directed
RNA polymerase chain reaction, primed by siRNA, amplifies the interference
caused by a small amount of "trigger" dsRNA (Nishikura, Cell, 2001,107, 415-
418).
[0013] Investigating the role of "trigger" RNA amplification during RNA
interference (RNAi) in Caeho~habditis elega~zs, Sijen et al revealed a
substantial
fraction of siRNAs that cannot derive directly from input dsRNA. Instead, a
population of siRNAs (termed secondary siRNAs) appeared to derive from the
action of the previously reported cellular RNA-directed RNA polymerase (RdRP)
on mRNAs that are being targeted by the RNAi mechanism. The distribution of
secondary siRNAs exhibited a distinct polarity (5'-3'; on the antisense
strand),
suggesting a cyclic amplification process in which RdRP is primed by existing
siRNAs. This amplification mechanism substantially augmented the potency of
RNAi-based surveillance, while ensuring that the RNAi machinery will focus on
expressed mRNAs (Sijen et al., Cell; 2001,107, 465-476).
[0014] Most recently, Tijsterman et al. have shown that, in fact, single-
stranded RNA oligomers of antisense polarity can be potent inducers of gene
silencing. As is the case for co-suppression, they showed that antisense RNAs
act
independently of the RNAi genes rde-1 and rde-4 but require the mutator/RNAi
gene mut-7 and a putative DEAD box RNA helicase, mut-14. According to the
authors, their data favor the hypothesis that gene silencing is accomplished
by
RNA primer extension using the mRNA as template, leading to dsRNA that is
subsequently degraded suggesting that single-stranded RNA oligomers are
ultimately responsible for the RNAi phenomenon (Tijsterman et al., Science,
2002, 295, 694-697).
[0015] Several recent publications have described the structural
requirements for the dsRNA trigger required for RNAi activity. Recent reports
have indicated that ideal dsRNA sequences are 2lnt in length containing 2 nt
3'-
end overhangs (Elbashir et al, EMBO (2001), 20, 6877-6887, Sabine Brantl,
Biochifnica
et Biophysica Acta, 2002,1575, 15-25.) In this system, substitution of the 4
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-6-
nucleosides from the 3'-end with 2'-deoxynucleosides has been demonstrated to
not affect activity. On the other hand, substitution with 2'-deoxynucleosides
or 2'-
OMe-nucleosides throughout the sequence (sense or antisense) was shown to be
deleterious to RNAi activity.
[0016] Investigation of the structural requirements for RNA silencing in
C. elegahs has demonstrated modification of the internucleotide linkage
(phosphorothioate) to not interfere with activity (Parrish et al., Molecular
Cell,
2000, 6, 1077-1087.) It was also shown by Parrish et al., that chemical
modification like 2'-amino or 5-iodouridine are well tolerated in the sense
strand
but not the antisense strand of the dsRNA suggesting differing roles for the 2
strands in RNAi. Base modification such as guanine to inosine (where one
hydrogen bond is lost) has been demonstrated to decrease RNAi activity
independently of the position of the modification (sense or antisense). Some
"position independent" loss of activity has been observed following the
introduction of mismatches in the dsRNA trigger. Some types of modifications,
for example introduction of sterically demanding bases such as 5-iodoU, have
been shown to be deleterious to RNAi activity when positioned in the antisense
strand, whereas modifications positioned in the sense strand were shown to be
less
detrimental to RNAi activity. As was the case for the 21 nt dsRNA sequences,
RNA-DNA heteroduplexes did not serve as triggers for RNAi. However, dsRNA
containing 2'-F-2'-deoxynucleosides appeared to be efficient in triggering
RNAi
response independent of the position (sense or antisense) of the 2'-F-2'-
deoxynucleosides.
[0017] In one study the reduction of gene expression was studied using
electroporated dsRNA and a 25mer morpholino oligomer in post implantation
mouse embryos (Mellitzer et al., Melaayaisms ofDevelopment, 2002, 118, 57-63).
The morpholino oligomer did show activity but was not as effective as the
dsRNA.
[0018] A number of PCT applications have recently been published that
relate to the RNAi phenomenon. These include: PCT publication WO 00/44895;
PCT publication WO 00/49035; PCT publication WO 00/63364; PCT publication
WO 01/36641; PCT publication WO 01/36646; PCT publication WO 99/32619;
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
PCT publication WO 00/44914; PCT publication WO 01/29058; and PCT
publication WO 01/75164.
[0019] U.S. patents 5,898,031 and 6,107,094, each of which is commonly owned
with tlus application and each of which is herein incorporated by reference,
describe
certain oligonucleotide having RNA like properties. When hybridized with RNA,
these
oligonucleotides serve as substrates for a dsRNase enzyme with resultant
cleavage of the
RNA by the enzyme.
[0020] In another recently published paper (Martinet et al., Cell, 2002, 110,
563-
574) it was shown that single stranded as well as double stranded siRNA
resides in the
RNA-induced silencing complex (RISC) together with e1F2C1 and e1f2C2 (human
GERp950) Argonaute proteins. The activity of 5'-phosphorylated single stranded
siRNA
was comparable to the double stranded siRNA in the system studied. In a
related study,
the inclusion of a 5'-phosphate moiety was shown to enhance activity of
siRNA's in vivo
in Drosophilia embryos (Boutla, et al., Curr. Biol., 2001, 1 l, 1776-1780). In
another
study, it was reported that the 5'-phosphate was required for siRNA function
in human
HeLa cells (Schwarz et al., Molecular Cell, 2002,10, 537-548).
[0021] In yet another recently published paper (Chiu et al., Molecular Cell,
2002,
10, 549-561) it was shown that the 5'-hydroxyl group of the siRNA is essential
as it is
phosphorylated for activity while the 3'-hydroxyl group is not essential and
tolerates
substitute groups such as biotin. It was further shown that bulge structures
in one or both
of the sense or antisense strands either abolished or severely lowered the
activity relative
to the unmodified siRNA duplex. Also shown was severe lowering of activity
when
psoralen was used to cross link an siRNA duplex.
[0022] Like the RNAse H pathway, the RNA interference pathway for
modulation of gene expression is an effective means for modulating the levels
of
specific gene products and, thus, would be useful in a number of therapeutic,
diagnostic, and research applications involving gene silencing. The present
invention therefore provides oligomeric compounds useful for modulating gene
expression pathways, including those relying on mechanisms of action such as
RNA interference acid dsRNA enzymes, as well as antisense and non-antisense
mechanisms. One having skill in the art, once armed with this disclosure will
be
able, without undue experimentation, to identify preferred oligonucleotide
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
_g_
compounds for these uses.
Summary of the Invention
[0023] In certain aspects, the invention relates to compositions comprising
a first oligomer and a second oligomer, each having linked nucleosidic bases.
At
least a portion of the first oligomer is capable of hybridizing with at least
a portion
of the second oligomer, at least a portion of the first oligomer is
complementary to
and capable of hybridizing to a selected target nucleic acid, and at least one
of the
first and second oligomers includes at least one sugar moiety having a 2'
substituent group that is not H or OH.
[0024] In certain other embodiments, the invention is directed to
oligonucleomer/protein compositions comprising an oligomer complementary to
and capable of hybridizing to a selected target nucleic acid, and at least one
protein comprising at least a portion of a RNA-induced silencing complex
(RISC).
The oligomer includes at least one nucleotide having a 2' substituent group on
the
sugar moiety that is not H or OH.
[0025] In other aspects, the invention relates to oligomershaving at least a
first region and a second region where the first region is complementary to
and
capable of hybridizing with the second region, and at least a portion of the
oligomer is complementary to and is capable of hybridizing to a selected
target
nucleic acid. The oligomer further includes at least one 2' substituent group
on a
sugar moiety that is other than H or OH.
[0026] The first and second oligomers preferably each have 10 to 40
nucleosidic bases. In other embodiments, each of the first and second
oligomers
have 18 to 30 nucleosidic bases. In yet other embodiments, the first and
second
oligomers have 21 to 24 nucleosidic bases.
[0027] Also provided by the present invention are pharmaceutical
compositions comprising any of the above compositions or oligomeric compounds
and a pharmaceutically acceptable carrier.
[0028] Methods for modulating the expression of a target nucleic acid in a
cell are also provided, wherein the methods comprise contacting the cell with
any
of the above compositions or oligomeric compounds.
[0029] Methods of treating or preventing a disease or condition associated
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-9-
with a target nucleic acid are also provided, wherein the methods comprise
achninistering to a patient having or predisposed to the disease or condition
a
therapeutically effective amount of any of the above compositions or
oligomeric
compounds.
Detailed Description of the Invention
[0030] The present invention provides oligomeric compounds useful in
the modulation of gene expression. Although not intending to be bound by
theory, oligomeric compounds of the invention modulate gene expression by
hybridizing to a nucleic acid target resulting in loss of normal function of
the
target nucleic acid. As used herein, the term "target nucleic acid" or
"nucleic acid
target" is used for convenience to encompass any nucleic acid capable of being
targeted including without limitation DNA, RNA (including pre-mRNA and
mRNA or portions thereof) transcribed from such DNA, and also cDNA derived
from such RNA. In a preferred embodiment of this invention modulation of gene
expression is effected via modulation of a RNA associated with the particular
gene RNA.
[0031] The invention provides for modulation of a target nucleic acid that
is a messenger RNA. The messenger RNA is degraded by the RNA interference
mechanism as well as other mechanisms in which double stranded RNAIRNA
structures are recognized and degraded, cleaved or otherwise rendered
inoperable.
[0032] The functions of RNA to be interfered with can include replication
and transcription. Replication and transcription, for example, can be from an
endogenous cellular template, a vector, a plasmid construct or otherwise. The
functions of RNA to be interfered with can include functions such as
translocation
of the RNA to a site of protein translation, translocation of the RNA to sites
within
the cell which are distant from the site of RNA synthesis, translation of
protein
from the RNA, splicing of the RNA to yield one or more RNA species, and
catalytic activity or complex formation involving the RNA which may be engaged
in or facilitated by the RNA. In the context of the present invention,
"modulation"
and "modulation of expression" mean either an increase (stimulation) or a
decrease (inhibition) in the amount or levels of a nucleic acid molecule
encoding
the gene, e.g., DNA or RNA. Inhibition is often the preferred form of
modulation
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-10-
of expression and mRNA is often a preferred target nucleic acid.
Compounds of the Invention
[0033] The compounds of the invention include oligomeric compounds
that comprise at least one monomeric unit that has a 2' substituent group on
the
sugar moiety. When compounds have more than one monomeric unit with a 2'
substituent, the substituents may be the same or different. In certain
embodiments, the substituent group is halogen, amino, trifluoroallcyl,
trifluoroalkoxy, azido, aminooxy, alkyl, alkenyl, alkynyl, O-, S-, or N(R*)-
alkyl;
O-, S-, or N(R*)-alkenyl; O-, S- or N(R*)-alkynyl; O-, S- or N-aryl, O-, S-,
or
N(R*)-aralkyl;wherein said alkyl, alkenyl, alkynyl, aryl and aralkyl may be
substituted or unsubstituted C1 to Clo alkyl, C2 to Clo alkenyl, C2 to Clo
alkynyl,
CS-C2o aryl or C6-CZO aralkyl; and said substituted C1 to Clo alkyl, C2 to Cio
alkenyl, Ca to Clo alkynyl, CS-C2o aryl or C6-C2o aralkyl comprising
substitution
with hydroxy, alkoxy, thioalkoxy, phthalimido, halogen, amino, keto, carboxyl,
nitro, nitroso, cyano, aryl, haloalkyl, haloalkoxy, imidazole, azido,
hydrazino,
aminooxy, isocyanato, sulfoxide, sulfone, disulfide, silyl, heterocycle,
carbocycle,
an intercalator, a reporter group, a conjugate, a polyamine, a polyamide, a
polyalkylene glycol, or a polyether of the formula (-O-allcyl)n,, where m is 1
to
about 10; and R* is hydrogen, or a protecting group. These substituents are
described in more detail in U.S. Patent Application Nos. 5,670,633, 5,914,396,
6,005,087, 6,222,025, 6,307,040, 6,531,584 and in U.S. Patent Application No.
101444,628. The disclosure of each of these patents and applications is
incorporated herein by reference in its entirety.
[0034] As discussed above, the 2' substituent may be a halogen. In some
preferred embodiments the halogen is F. Certain oligonucleotide that are N3'-
>PS'
phosphoramidates having 2' fluoro substituents have been shown to have
superior
acid stability. These compositions can be made by procedures taught is U.S.
Patent No. 5,684,143, the disclosure of which is incorporated herein in its
entirety.
[0035] Some preferred substituents are 2'-O-alkyl substituents. These
alkyl groups include lower alkyl groups having from about 1 to about 6 carbon
atoms. In some preferred embodiments, the allcyl is a methyl group. Other 2'
substituent groups include 2'-methoxyethoxy (MOE, 2'-OCH2CH20CH3) and 2'-
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-11-
O-[2-(2-N,N-dimethylaminoethyl)oxyethyl]. These substituents are described in
U.S. Patent Nos. 6,043,352 and 6,005,094, the disclosures of which are
incorporated herein by reference in their entirety.
[0036] In other embodiments, the 2' substituent is -O-Rz6-thin-Rz6 or -C-
RzG-thio-Rz6, wherein said Rz6 is independently a compound selected from a
group
consisting of alkyl, allyl, alkenyl, alkynyl, aryl, alkylaryl, carbocyclic
aryl,
heterocyclic aryl, amide and ester. In some embodiments, Rz6 is allcyl, allyl,
alkenyl, alkynyl, aryl, alkylaryl, carbocyclic aryl, or heterocyclic aryl. In
certain
embodiments, the 2' substituent is 2'-O-methylthiomethyl. In other
embodiments,
the 2' substituent is 2'-O-methylthioethyl. These substituents are described
in U.S.
Patent Nos. 5,716,824, 5,840,876 and 6,239,272, the disclosures of which are
incorporated by reference herein in their entirety.
[0037] In certain embodiments, the 2' substituent is cyano, fluoromethyl,
thioalkoxyl, fluoroalkoxyl, allcylsulfinyl, alkylsulfonyl, allyloxy or
alkeneoxy. In
other embodiments, the 2'-substituent is 2'-alkylsulfinyl or alkylsulfonyl. In
other
preferred embodiments, the 2'-substituent is 2'-thioalkoxyl, preferably, a 2'-
S-(Cl -
Czo alkyl) substituent. These subsitituents are described in U.S. Patent No.
5,859,221, the disclosure of which is incorporated herein by reference.
[0038] Some 2' substituents useful in the invention are of the formula X-
Y. X is O, S, NRz~, or CRz~z wherein each R is independently H or C1_6 alkyl.
Y is
a linlcer moiety, a drug residue optionally attached through a linker moiety,
a label
optionally attached through a linker moiety, or a property-affecting group
optionally attached through a linker moiety. In some embodiments, Y is a drug
moiety. In certain embodiments, the drug moiety is selected from the group
consisting of netropsin, anthramycin, quinoxaline antibiotics, actinomycin,
and
pyrrolo (1-4) benzodiazepine. In other embodiments, Y is substituted or
unsubstituted alkyl (Cz_zo), substituted or unsubstituted alkenyl (Cz_zo),
substituted
or unsubstituted aryl (C6_zo), wherein the substituents are selected from the
group
consisting of a hydroxyl, an amino, a mercaptyl, a carboxy or a lceto moiety, -
-
CHz,COOH, --CH2COONHz, --CHZCOOEt, --CH2CONHCH2CHzNHz and SiRz83
wherein Rz8 is alkyl (Cz_6). hi certain preferred embodiments, X is O or S.
These
substituents are described in U.S. Patent Nos. 5,466,786 and 5,792,847, the
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-12-
disclosures of which are incorporated herein by reference in their entirety.
[0039] Certain 2' substituents are of the formula:
-G1-G2-G3 where Gl is a bivalent linker, G2 is an aryl or heteroaryl or aryl
or
heteroaryl containing group and G3 is an RNA cleaving moiety having, for
example, general acid/base properties. In certain further preferred
embodiments of
the inventions, G3 further includes an electrophilic catalyst.
[0040] The bivalent liker may be a mono- or polyatomic linker. In some
embodiments, the bivalent linker is of the formula -Gl l-Giz. Gi i contains a
heteroatom and Glz contains an alkyl, alkenyl or alkynyl group. Preferred
heteroatoms include O, S, and N--H or N-alkyl. In some embodiments, the linker
may be methylene groups-i.e., --(CH2)" -- or may include heteroatoms and
functional groups, e.g., --CH20CH2CHa O-- or --CH20--CH2CHZNH-- or
--COOCH~CHZO--. In certain embodiments of the invention, Gl connects to the
internucleoside linkage, i.e. the sugar linking group.
[0041] G2 preferably is a polycyclic moiety having from 2 to 6 rings, at
least 2 of said rings being joined to form an electronically conjugated
system.
Representative G2 groups include naphthalene, anthracene, phenanthrene,
benzonaphthalene, fluorene, carbazole, pyrido[4,3-b]carbazole, acridine,
pyrene,
anthraquinone, quinoline, phenylquinoline, xanthene or 2,7-diazaanthracene
groups. Structures of this type preferably act as intercalators. Other
intercalators
believed to be useful are described by Deimy, Anti-Cancer Drug Design 1989, 4,
241.
[0042] RNA-cleaving group G3 can be a functionality that has both
general acid and general base characteristics. It also can possess
electrophilic
catalytic characteristics. It can further possess metal ion coordinating
characteristics. Such substituents are described in U.S. Patent No. 6,358,931,
whose disclosure is incorporated by reference herein in its entirety.
[0043] The 2' substituent may be of the formula -O-G1-G2-G3 where
Gl is alkyl, alkenyl, or alkynyl; G2 is an aryl; and G3 includes at least one
imidazole. In some preferred embodiments, G3 is an imidazole or a bis-
imidazole
moiety. In other embodiments, Gl-G2-G3 is an alkynyl moiety. These
substituents are described in U.S. Patent No. 5,514,786, whose disclosure is
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-13-
incorporated herein by reference in its entirety.
[0044] Some useful 2' substituents are of the formula --C(X)--N(R29)(R3o)
where:
R29 and R3°, independently, are H, R33, R34, an amine protecting group
or have
formula R33-=N(R31)(R32)' C(~) R33' C(~r) R34 R33' C(X)_-Q R34 R33~ Or
C(X)--Q R33 ;
R31 and R3z, independently, are H, R33, R3a,. an amine protecting group or
have
formula C(X)-R33, C(X) R34 -R33~ C(X)__Q R34 R33~ Or C(X)_-Q R33
R33 is a steroid molecule, biotin, dinitrophenyl, a fluorescein dye, a
lipophilic
molecule, a reporter enzyme, a peptide, a protein, includes folic acid, or has
formula --Q--(CH2CHz--Q--)X R3s ;
R34 is alkyl having from 1 to about 10 carbon atoms;
XisOorS;
each Q is, independently, is NH, O, or S;
R35 is H, R34, C(O)OH, C(O)OR34, C(O)R41, R34- N3, Or R34--NH2 i
R41 is Cl, Br, I, SOaR42 or has structure:
n
S (CH2)m
a
m is 2 or 7; and
R42 alkyl having 1 to about 10 carbon atoms.
[0045] In some embodiments, R34 is allcyl having 1 to about 10 carbon
atoms, preferably having 6 carbon atoms. In other embodiments, R2~ is H and
R3o
is R33. Some compounds are such that R29 is H and R3° is alkyl having 1
to about
carbon atoms, preferably 1 or 2 carbon atoms. In certain embodiments, R29
and R3°, together, are phthalimido. In other embodiments, RZ~ is H and
R3° is R34-
-N(R3i)(R3a), These compounds are described in U.S. Patent No. 6,111,085,
whose disclosure is incorporated herein by reference in its entirety.
[0046] The sugar substituent may be a 2'-aminoalkoxy or a 2'-
imidazolylalkoxy substituent, wherein the allcoxy moiety of said substituent
is Cl -
C2°. In some embodiments the substituent is 2'-O-(aminoprop-3-yl)
or 2'-O-
(aminobut-4-yl). In other embodiments, the substituent is 2'-O->(imidazol-1-
yl)
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-14-
prop-3-yl or 2'-O->(imidazol-1-yl) but-4-yl. See, for example, U.S. Patent No.
5,872,232, which is incorporated herein by reference in its entirety.
[0047] Certain 2' modifications are groups of the formula:
(O)x (CH2)m O E or
Y
R36
(O)X (CH2)m O ~ CH -O E
( 2)m
Y
where m is from 0 to 10; y is from 1 to 10; x is l; E is N(R3~)(R38) or
N-C(Rs~)(R3a); ~d
each of R36, R3~ and R38 is, independently, H, C1 -C1° alkyl, and an
amino
protecting group, or R3~ and R38 together, are an amino protecting group or
wherein R3~ and R38 are joined in a C4 -Cl° ring structure that can
include at least
one heteroatom selected from N and O. In certain embodiments, R3' and R38 are
independently H or Cl -Cl° alkyl. In other embodiments R3~ and R38 are
joined in
a C4 -Cl° ring structure that optionally includes one or more
heteroatoms selected
from N and O. Some compounds of the invention comprise a ring structure that
is
an imidazolyl ring, a piperidinyl ring, a morpholinyl ring or a substituted
piperazinyl ring. Certain piperazine may be optionally substituted with a Cl -
Cla
alkyl. These substituent groups may be produced by methods taught by U.S.
Patent No. 6,127,533 and 6,172,209 the disclosures of which are incorporated
by
reference herein in their entirety.
[0048] In certain embodiments, the 2' substituent is of the formula:
R39-N C(~) O R4°
or
~(~~N(R2s)(R3o)
where R39 is alkyl having from 1 to about 10 carbon atoms or (CHa --CHZ --Q)X
;
R4° is alkenyl having 2 to about 10 carbon atoms;
R2~ and R3°, independently, are H, R33, R39, an amine protecting group
or have
formula R39-- -N(R31)~32)' C,(X)-R33' Cr(~)-R39 R33' Cr(X)_-Q R39-R33~ Or
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-15-
C(X)--Q-R33 ;
R31 and R32, independently, are H, R33, R39,. an amore protecting group or
have
formula C(X)-R33, C(X)-R39 R33, C(X)__Q R39 R33, Or C(X)__Q R33 ;
R33 is a steroid molecule, a reporter molecule, a lipophilic molecule, a
reporter
enzyme, a peptide, a protein, includes folic acid, or has formula --Q--(CHZCH~
--
Q-_)X R3s ;
XisOorS;
each Q is, independently, is NH, O, or S;
x is 1 to about 200;
R35 is H, R39, C(O)OH, C(O)OR39, C(O)R41, R39- N3, or R39--NHZ ;
R~1 is Cl, Br, I, S02R42 or has structure:
n
S+ (CH2)m
a
m is 2 or 7; and R42 is an alkyl having 1 to about 10 carbon atoms.
In some embodiments, R3~ is alkyl having 6 carbon atoms. In certain
embodiments, R4° is 2-propenyl. In other embodiments, R29 is H and
R3° is H. In
yet other embodiments, R29 is H and R3° is R33. In some compositions,
R29 is H
and R3° is alkyl having 1 to about 10 carbon atoms. In certain
embodiments, R~'9
and R3°, together, are phthalimido. In other embodiments, Ra9 is H and
R3° is R39-
-N(R31)(R3a). In certain compositions of the invention, R31 is H and R32 is
R33. In
other compositions, R31 is H and R32 is allcyl having 1 to about 10 carbon
atoms.
In yet other compositions, R3° is H and R3~ is an alkyl having 1 or 2
carbon atoms.
In yet other compositions, R31 and R32, together, are phthalimido. These
substituents may be synthesized by methods taught by U.S. Patent No.
6,166,188,
the disclosure of which is incorporated herein by reference in its entirety.
[0049] Some 2' substituents are of the formula:
O
~E1
O CH2-C N\
\E2
wherein each El and EZ is, independently, H, C1-Cl° all~yl, Ca -
C1° all~enyl, C2 -
Cl° all~ynyl, C6 -C14 aryl, (CH2)m --S-R43 where m is from 1 to 10, --
~(CH~)"" --
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-16-
N(H))"nn --(CHz)nnNHz where each nn is an integer from 2 to 4 and nnn is an
integer from 2 to 10, a polypeptide having from 2 to 10 peptide linked amino
acids, a folic acid moiety optionally bearing a linking group attaching said
folic
acid moiety from the a or ~y carboxyl group to the 2'-substituent wherein said
linking group is --N(H)--(CHz)6 --, or a cholesterol moiety optionally bearing
a
linl~ing group attaching said cholesterol moiety from the hydroxyl group to
the 2'-
substituent, wherein said linking group is --C(=O)--N(H)--(CHz)6 --; and R43
is H,
Cl -Clo alkyl, Cz -Clo alkenyl, Cz -C1o alkynyl, C6-C14 aryl or a thio
protecting
group. In some embodiments, each El and Ez is independently Cl -Clo alkyl.
[0050] In some embodiments, each El and Ez is, independently, C1 -Clo
all~yl, or one of El and Ez is H and the other of El and Ez is --CH3 ;
or each El and Ez is, independently, H, --(CHz)m --S-R43 where m is from 1 to
10, --{(CHz)"" --N(H))""" --(CHz)""NHz where each nn is from 2 to 4 and nnn is
from 2 to 10, a polypeptide having from 2 to 10 peptide linked amino acids, a
folic
acid moiety optionally bearing a linking group attaching said folic acid
moiety
from the a or y carboxyl group to the 2'-substituent wherein said linking
group is -
-N(H)--(CHz)6 --, or a cholesterol moiety optionally bearing a linking group
attaching said cholesterol moiety from the hydroxyl group to the 2'-
substituent,
wherein said linking group is --C(=O)--N(H)--(CHz)6 --, provided that only one
of
El and Ez is H; and R43 is H, C1-Clo allcyl, Cz -Clo alkenyl, Cz -Clo alkynyl,
C6 -
Ci4 aryl or a thio protecting group.
[0051] In certain embodiments, El is H and Ez is --(CHz)m --S-R43. In
other embodiments, R43 is Cl -Cio alkyl. Further embodiments are those where
R4s
is methyl. In yet other embodiments, Ez is {(CHz)"" --N(H)S""" (CHz)"" NHz
where each im is from 2 to 4 and nnn is from 2 to 10. In some compositions, Ez
is
__(CHz)3 __N(H)--(CHz)4 __N(H)__(CHz)3 -NHz or --(CHz)4 -_N(g)__(CHz)3 --NHz.
In certain embodiments, Ez is said polypeptide. In some embodiments, the
polypeptide is Lys-Tyr-Lys, Lys-Trp-Lys or Lys-Lys-Lys-Lys. In yet other
embodiments, Ez is a linked folic acid or 5-methyl-tetrahydrofolic acid
moiety. In
further embodiments, Ez is a cholesterol moiety. These substituents may be
made
may methods disclosed in U.S. Patent No. 6,147,200, whose disclosure is
incorporated by reference herein in its entirety.
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-17-
[0052] Other 2' substituent groups of the invention are of the formula:
X (CR7~ R~2)n-O S02-O- Y+
where X is a O, S, or N; R'1 and R'2 are independently H, alkyl, aryl, O-
alkyl, O-
aryl, carboxylic acid, amide, ester, halogen, trifluoromethyl, or amine; n is
an
integer from about 2 to about 10; and, Y is H, Li, Na, K, Cs or an amine. The
synthesis of compounds with these substituent groups is described in U.S.
Patent
No. 6,227,982, the disclosure of which is incorporated herein in its entirety.
[0053] Some 2' substituents are of the formula:
R46
N R47
(H2C)n (O)m
N R4$
R49
where:
each Z is, independently, a single bond, O, N or S;
each R46, R4', R48, and R49 is, independently, hydrogen, C(O)RS°,
substituted or
unsubstituted C1 -Clo alkyl, substituted or unsubstituted C2 -Clo alkenyl,
substituted or unsubstituted C2 -Clo all{ynyl, all~ylsulfonyl, arylsulfonyl, a
chemical functional group or a conjugate group, wherein the substituent groups
are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, vitro,
thiol,
thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl;
or R4g and R4', together, are R51;
each RS° is, independently, substituted or unsubstituted C1 -Clo alkyl,
trifluoromethyl, cyanoethyloxy, methoxy, ethoxy, t-butoxy, allyloxy, 9-
fluorenylmethoxy, 2-(trimethylsilyl)-ethoxy, 2,2,2-trichloroethoxy, benzyloxy,
butyryl, iso-butyryl, phenyl or aryl;
each R51 is, independently, hydrogen or forms a phthalimide moiety with the
nitrogen atom to which it is attached;
each m is, independently, zero or 1; and
each n is, independently, an integer from 1 to about 6. These substituents may
be
synthesized by methods taught in U.S. Patent No. 6,534,639, whose disclosure
is
incorporated herein by reference in its entirety.
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-18-
[0054] In certain embodiments, the 2' modification is of the formula -
ORsa where Rsz is
CH2-CH O R5s
n
(Ia)
Z
or
O
H2C
(Ic)
where Rs3 is hydrogen, C1 -C21 allcyl, C2 -CZ1 allcenyl, C2 -C21 allcynyl or --
C(=O)-
alkyl; Rs4 is hydrogen, Cl -Cio alkyl, --CH2--O-Rss or a radical of formula
Ib;
Rss is hydrogen, Cl -C22 alkyl, C3 -CZ1 alkenyl, or partially or completely
fluorine-
substituted Cl -Clo alkyl or --[(CH2)Z--O]",-Rs6 ; Rs~ is hydrogen or C1 -C21
alkyl;
Z is --(CH2) p -- or --(CHZ --CH2--O)q -CHaCH2 --, it being possible for Z in
the
case of --CH2 -- to be unsubstituted or substituted by one or more identical
or
different substituents selected from Cl -Clo alkyl, Cs -C6 cycloalkyl and
unsubstituted or C1 -C4 alkyl-substituted phenyl; n is an integer from 1 to
12; m is
an integer from 1 to 4; p is an integer from 1 to 10; and q is an integer from
1 to 4.
Such substituents are described in U.S. Patent No. 5,969,116, the disclosure
of
which is incorporated herein by reference in its entirety.
[0055] Some 2' substituents may be cyclic compositions of the formula:
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-19-
O
Yn
3
~2
/R
where L1, L~, and L3 form a ring system having from about 4 to about 7 carbon
atoms or having from about 3 to about 6 carbon atoms and 1 or 2 hetero atoms
wherein said hetero atoms are oxygen, nitrogen or sulfur and wherein said ring
system is aliphatic, unsaturated aliphatic, aromatic or heterocyclic;
R is OX, SX, N(H)X or NX2 ;
X is H, C1 -C8 alkyl, Cl -C8 haloalkyl, C(--NH)N(H)Z, C(=O)N(H)Z amd
OC(=O)N(H)Z;
Y is alkyl or haloalkyl having 1 to about 10 carbon atoms, alkenyl having 2 to
about 10 carbon atoms, alkynyl having 2 to about 10 carbon atoms, aryl having
6
to about 14 carbon atoms, N(H)X, NX2, OX, halo, SX or CN;
n is 0, 1 or 2; and
Z is H or C1-C$ alkyl.
[0056] In certain embodiments, the ring system is phenyl, pyridyl,
cyclopentyl, cyclobutyl, cyclohexyl, cycloheptyl, morpholino, piperidyl or
piperazinyl with the proviso that the elected ring system is mono-, di-, or
tri-
substituted. In other embodiments, R is OH, SH, OCH3, N(H)C(--NH)NH2,
N(H)C(=O)NH2, NH2, or OC(=O)NH2. W some embodiments, Ll and La are each
carbon atoms. In yet other embodiments, Ll and L2 are carbon atoms and the
other of Ll and L2 is a heteroatom selected fiom O, S and N. These ligands may
be made by methods taught by U.S. Patent No. 6,271,358, whose disclosure is
incorporated herein by reference in its entirety.
[0057] In some embodiments, the 2' position of the sugar ring can have
two substituents, Yl and Y2; provided that both Yl and Y2 are not H and that
when one of Y1 and Y2 is H and the other of Y1 and Y2 is OH, the sugar ring is
other than a ribose sugar. In certain embodiments, Yl and Y2 are each
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-20-
independently hydrogen; hydroxyl; halogen; C2_4 alkenyl, C2_4 alkynyl, or Cl-4
allcyl optionally substituted with amino, hydroxy, or 1 to 3 fluorine atoms;
Cl-10
alkoxy, optionally substituted with Cl_3 alkoxy, Cl_3 thioalkoxy or 1 to 3
fluorine atoms; C2_6 alkenyloxy; Cl_4 alkylthio; Cl_g alkylcarbonyloxy;
aryloxycarbonyl; azido; amino; Cl_4 alkylamino; di(Cl_4 alkyl)amino; or Y3. Y3
is a conjugate molecule or a reporter molecule. These substituents are
described
in more detail in commonly owned U.S. Patent Application No. 10/444,628, the
disclosure of which is incorporated by reference in its entirety. In some
preferred embodiments Y1 is C2_4 alkenyl, C2_4 alkynyl, or Cl_4 alkyl, wherein
the alkyl is unsubstituted or substituted with hydroxy, amino, Cl_4 alkoxy, Cl-
4
all~ylthio, or one to three fluorine atoms and Y2 is hydrogen, fluorine,
hydroxy,
C1-10 a~oxy, or Cl_10 alkyl. In other preferred embodiments, Yl is alkyl
unsubstituted or substituted with hydroxy, amino, C 1 _4 alkoxy, C 1 _4
all~ylthio, or
one to three fluorine atoms, particularly where Y1 is methyl or
trifluoromethyl. In
yet other preferred compounds, Y2 is hydrogen or hydroxyl. These substituents
are described in commonly omned U.S. Patent Application No. 10/444,298, the
disclosure of which is incorporated herein by reference in its entirety.
Hybridization
[0058] In the context of this invention, "hybridization" means the pairing
of complementary strands of oligomeric compounds. In the present invention,
the
preferred mechanism of pairing involves hydrogen bonding, which may be
Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between
complementary nucleoside or nucleotide bases (nucleobases) of the strands of
oligomeric compounds. For example, adenine and thymine are complementary
nucleobases that pair through the formation of hydrogen bonds. Hybridization
can
occur mzder varying circumstances.
[0059] An oligomeric compound of the invention is believed to
specifically hybridize to the target nucleic acid and interfere with its
normal
function to cause a loss of activity. There is preferably a sufficient degree
of
complementarity to avoid non-specific binding of the oligomeric compound to
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-21-
non-target nucleic acid sequences under conditions in which specific binding
is
desired, i.e., under physiological conditions in the case of ira vivo assays
or
therapeutic treatment, and under conditions in which assays are performed in
the
case of ih vitro assays.
[0060] In the context of the present invention the phrase "stringent
hybridization conditions" or "stringent conditions" refers to conditions under
which an oligomeric compound of the invention will hybridize to its target
sequence, but to a minimal number of other sequences. Stringent conditions are
sequence-dependent and will vary with different circumstances and in the
context
of this invention; "stringent conditions" under which oligomeric compounds
hybridize to a target sequence are determined by the nature and composition of
the
oligomeric compounds and the assays in which they are being investigated.
[0061] "Complementary," as used herein, refers to the capacity for precise
pairing of two nucleobases regardless of where the two are located. For
example,
if a nucleobase at a certain position of an oligomeric compound is capable of
hydrogen bonding with a nucleobase at a certain position of a target nucleic
acid,
then the position of hydrogen bonding between the oligomer and the target
nucleic
acid is considered to be a complementary position. The oligomeric compound and
the target nucleic acid are complementary to each other when a sufficient
number
of complementary positions in each molecule are occupied by nucleobases that
can hydrogen bond with each other. Thus, "specifically hybridizable" and
"complementary" are terms which are used to indicate a sufficient degree of
precise pairing or complementarity over a sufficient number of nucleobases
such
that stable and specific binding occurs between the oligomer and a target
nucleic
acid.
[0062] It is understood in the art that the sequence of the oligomeric
compound need not be 100% complementary to that of its target nucleic acid to
be
specifically hybridizable. Moreover, an oligomeric compound may hybridize over
one or more segments such that intervening or adjacent segments are not
involved
in the hybridization event (e.g., a loop structure or hairpin structure). It
is
preferred that the oligomeric compounds of the present invention comprise at
least
70% sequence complementarity to a target region within the target nucleic
acid,
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-22-
more preferably that they comprise 90% sequence complementarity and even
more preferably comprise 95% sequence complementarity to the target region
within the target nucleic acid sequence to which they are targeted. For
example,
an oligomeric compound in which 18 of 20 nucleobases of the oligomeric
compound are complementary to a target region, and would therefore
specifically
hybridize, would represent 90 percent complementarity. In this example, the
remaining noncomplementary nucleobases may be clustered or interspersed with
complementary nucleobases and need not be contiguous to each other or to
complementary nucleobases. As such, an oligomeric compound which is 18
nucleobases in length having 4 (four) noncomplementary nucleobases which are
flanked by two regions of complete complementarity with the target nucleic
acid
would have 77.8% overall complementarity with the target nucleic acid and
would
thus fall within the scope of the present invention. Percent complementarity
of an
oligomeric compound with a region of a target nucleic acid can be determined
routinely using BLAST programs (basic local alignment search tools) and
PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990,
215,
403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).
Targets of the invention
[0063] "Targeting" an oligomeric compound to a particular nucleic acid
molecule, in the context of this invention, can be a multistep process. The
process
usually begins with the identification of a target nucleic acid whose function
is to
be modulated. This target nucleic acid may be, for example, a mRNA transcribed
from a cellular gene whose expression is associated with a particular disorder
or
disease state, or a nucleic acid molecule from an infectious agent.
[0064] The targeting process usually also includes determination of at
least one target region, segment, or site within the target nucleic acid for
the
interaction to occur such that the desired effect, e.g., modulation of
expression,
will result. Within the context of the present invention, the term "region" is
defined as a portion of the target nucleic acid having at least one
identifiable
structure, function, or characteristic. Within regions of target nucleic acids
are
segments. "Segments" are defined as smaller or sub-portions of regions within
a
target nucleic acid. "Sites," as used in the present invention, are defined as
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-23-
positions within a target nucleic acid. The terms region, segment, and site
can
also be used to describe an oligomeric compound of the invention such as for
example a gapped oligomeric compound having 3 separate segments.
[0065] Since, as is known in the art, the translation initiation codon is
typically 5'-AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding
DNA molecule), the translation initiation codon is also referred to as the
"AUG
codon," the "start codon" or the "AUG start codon". A minority of genes have a
translation initiation codon having the RNA sequence 5'-GUG, 5'-UUG or
5'-CUG, and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function ih vivo.
Thus, the terms "translation initiation codon" and "start codon" can encompass
many codon sequences, even though the initiator amino acid in each instance is
typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It
is
also known in the art that eukaryotic and prokaryotic genes may have two or
more
alternative start codons, any one of which may be preferentially utilized for
translation initiation in a particular cell type or tissue, or under a
particular set of
conditions. In the context of the invention, "start codon" and "translation
initiation codon" refer to the codon or codons that are used in vivo to
initiate
translation of an mRNA transcribed from a gene encoding a nucleic acid target,
regardless of the sequences) of such codons. It is also known in the art that
a
translation termination codon (or "stop codon") of a gene may have one of
three
sequences, i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences
are 5'-TAA, 5'-TAG and 5'-TGA, respectively).
[0066] The terms "start codon region" and "translation initiation codon
region" refer to a portion of such an mRNA or gene that encompasses from about
25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3')
from a
translation initiation codon. Similarly, the terms "stop codon region" and
"translation termination codon region" refer to a portion of such an mRNA or
gene that encompasses from about 25 to about 50 contiguous nucleotides in
either
direction (i.e., 5' or 3') from a translation termination codon. Consequently,
the
"start codon region" (or "translation initiation codon region") and the "stop
codon
region" (or "translation termination codon region") are all regions which may
be
targeted effectively with the antisense oligomeric compounds of the present
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-24-
invention.
[0067] The open reading frame (ORF) or "coding region," which is
known in the art to refer to the region between the translation initiation
codon and
the translation termination codon, is also a region which may be targeted
effectively. Within the context of the present invention, a preferred region
is the
intragenic region encompassing the translation initiation or termination codon
of
the open reading frame (ORF) of a gene.
[0068] Other target regions include the 5' untranslated region (5'UTR),
l~nown in the art to refer to the portion of an mRNA in the 5' direction from
the
translation initiation codon, and thus including nucleotides between the 5'
cap site
and the translation initiation codon of an mRNA (or corresponding nucleotides
on
the gene), and the 3' untranslated region (3'UTR), known in the art to refer
to the
portion of an mRNA in the 3' direction from the translation termination codon,
and thus including nucleotides between the 'translation termination codon and
3'
end of an mRNA (or corresponding nucleotides on the gene). The 5' cap site of
an
mRNA comprises an N7-methylated guanosine residue joined to the 5'-most
residue of the mRNA via a 5'-5' triphosphate linkage. The 5' cap region of an
mRNA is considered to include the 5' cap structure itself as well as the first
50
nucleotides adjacent to the cap site. It is also preferred to target the 5'
cap region.
[0069] Although some eukaryotic mRNA transcripts are directly
translated, many contain one or more regions, known as "introns," which are
excised from a transcript before it is translated. The remaining (and
therefore
translated) regions are known as "exons" and are spliced together to form a
continuous mRNA sequence. Targeting splice sites, i.e., intron-exon junctions
or
exon-intron junctions, may also be particularly useful in situations where
aberrant
splicing is implicated in disease, or where an overproduction of a particular
splice
product is implicated in disease. Aberrant fusion junctions due to
rearrangements
or deletions are also preferred target sites. mRNA transcripts produced via
the
process of splicing of two (or more) mRNAs from different gene sources are
l~nown as "fusion transcripts". It is also known that introns can be
effectively
targeted using oligomeric compounds targeted to, for example, pre-mRNA.
[0070] It is also known in the art that alternative RNA transcripts can be
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-25-
produced from the same genomic region of DNA. These alternative transcripts
are generally known as "variants". More specifically, "pre-mRNA variants" are
transcripts produced from the same genomic DNA that differ from other
transcripts produced from the same genomic DNA in either their start or stop
position and contain both intronic and exonic sequences.
[0071] Upon excision of one or more exon or intron regions, or portions
thereof during splicing, pre-mRNA variants produce smaller "mRNA variants".
Consequently, mRNA variants are processed pre-mRNA variants and each unique
pre-mRNA variant must always produce a unique mRNA variant as a result of
splicing. These mRNA variants are also known as "alternative splice variants".
If
no splicing of the pre-mRNA variant occurs then the pre-mRNA variant is
identical to the mRNA variant.
[0072] It is also known in the art that variants can be produced through
the use of alternative signals to start or stop transcription and that pre-
mRNAs and
mRNAs can possess more that one start codon or stop codon. Variants that
originate from a pre-mRNA or mRNA that use alternative start codons are known
as "alternative start variants" of that pre-mRNA or mRNA. Those transcripts
that
use an alternative stop codon are known as "alternative stop vaxiants" of that
pre-
mRNA or mRNA. One specific type of alternative stop variant is the "polyA
variant" in which the multiple transcripts produced result from the
alternative
selection of one of the "polyA stop signals" by the transcription machinery,
thereby producing transcripts that terminate at unique polyA sites. Within the
context of the invention, the types of variants described herein are also
preferred
target nucleic acids.
[0073] The locations on the target nucleic acid to which preferred
compounds and compositions of the invention hybridize are herein below
referred
to as "preferred taxget segments." As used herein the term "preferred target
segment" is defined as at least an 8-nucleobase portion of a target region to
which
an active antisense oligomeric compound is targeted. While not wishing to be
bound by theory, it is presently believed that these target segments represent
portions of the target nucleic acid that are accessible for hybridization.
[0074] Once one or more target regions, segments or sites have been
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-26-
identified, oligomeric compounds are chosen which are sufficiently
complementary to the target, i.e., hybridize sufficiently well and with
sufficient
specificity, to give the desired effect.
[0075] In accordance with an embodiment of the this invention, a series of
nucleic acid duplexes comprising the antisense strand oligomeric compounds of
the present invention and their respective complement sense strand compounds
can be designed for a specific taxget or targets. The ends of the strands may
be
modified by the addition of one or more natural or modified nucleobases to
form
an overhang. The sense strand of the duplex is designed and synthesized as the
complement of the antisense strand and may also contain modifications or
additions to either terminus. For example, in one embodiment, both strands of
the
duplex would be complementary over the central nucleobases, each having
overhangs at one or both termini.
[0076] For the purposes of describing an embodiment of this invention,
the combination of an antisense strand and a sense strand, each of can be of a
specified length, for example from 18 to 29 nucleotides long, is identified as
a
complementary pair of siRNA oligomers. This complementary pair of siRNA
oligomers can include additional nucleotides on either of their 5' or 3' ends.
Further they can include other molecules or molecular structures on their 3'
or 5'
ends such as a phosphate group on the 5' end. A preferred group of compounds
of
the invention include a phosphate group on the 5' end of the antisense strand
compound. Other preferred compounds also include a phosphate group on the 5'
end of the sense strand compound. An even further preferred compounds would
include additional nucleotides such as a two base overhang on the 3' end.
[0077] For example, a preferred siRNA complementary pair of oligomers
comprise an antisense strand oligomeric compound having the sequence
CGAGAGGCGGACGGGACCG (SEQ ID NO:1) and having a two-nucleobase
overhang of deoxythymidine(dT) and its complement sense strand. These
oligomers would have the following structure:
5' cgagaggcggacgggaccgTT 3' AntisenseStrand(SEQIDN0:2)
3' TTgctctc cg cct gcectggc 5' Complement Strand(SEQIDN0:3)
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-27-
[0078] In an additional embodiment of the invention, a single oligomer
having both the antisense portion as a first region in the oligomer and the
sense
portion as a second region in the oligomer is selected. The first and second
regions are linked together by~-either a nucleotide linker (a string of one or
more
nucleotides that are linked together in a sequence) or by a non-nucleotide
linker
region or by a combination of both a nucleotide and non-nucleotide structure.
In
each of these structures, the oligomer, when folded back on itself, would be
complementary at least between the first region, the antisense portion, and
the
second region, the sense portion. Thus the oligomer would have a palindrome
within it structure wherein the first region, the antisense portion in the 5'
to 3'
direction, is complementary to the second region, the sense portion in the 3'
to 5'
direction.
[0079] liz a further embodiment, the invention includes oligomer/protein
compositions. Such compositions have both an oligomer component and a protein
component. The oligomer component comprises at least one oligomer, either the
antisense or the sense oligomer but preferably the antisense oligomer (the
oligomer that is antisense to the target nucleic acid). The oligomer component
can
also comprise both the antisense and the sense strand oligomers. The protein
component of the composition comprises at least one protein that forms a
portion
of the RNA-induced silencing complex, i.e., the RISC complex.
[0080] RISC is a ribonucleoprotein complex that contains an oligomer
component and proteins of the Argonaute family of proteins, among others.
While we do not wish to be bound by theory, the Argonaute proteins make up a
highly conserved family whose members have been implicated in RNA
interference and the regulation of related phenomena. Members of this family
have been shown to possess the canonical PAZ and Piwi domains, thought to be a
region of protein-protein interaction. Other proteins containing these domains
have been shown to effect target cleavage, including the RNAse, Dicer. The
Argonaute family of proteins includes, but depending on species, are not
necessary limited to, elF2C1 and e1F2C2,. e1F2C2 is also known as human
GERp95. While we do not wish to be bound by theory, at least the antisense
oligomer strand is bound to the protein component of the RISC complex.
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-28-
Additional, the complex might also include the sense strand oligomer. Carmell
et
al, Genes and Development 2002, 16, 2733-2742.
[0081] Also while we do not wish to be bound by theory, it is further
believed that the RISC complex may interact with one or more of the
translation
machinery components. Translation machinery components include but are not
limited to proteins that effect or aid in the translation of an RNA into
protein
including the ribosomes or polyribosome complex. Therefore, in a further
embodiment of the invention, the oligomer component of the invention is
associated with a RISC protein component and further associates with the
translation machinery of a cell. Such interaction with the translation
machinery of
the cell would include interaction with structural and enzymatic proteins of
the
translation machinery including but not limited to the polyribosome and
ribosomal
subunits.
[0082] In a further embodiment of the invention, the oligomer of the
invention is associated with cellular factors such as transporters or
chaperones.
These cellular factors can be protein, lipid or carbohydrate based and can
have
structural or enzymatic functions that may or may not require the complexation
of
one or more metal ions.
[0083] Furthermore, the oligomer of the invention itself may have one or
more moieties which are bound to the oligomer which facilitate the active or
passive transport, localization or compartmentalization of the oligomer.
Cellular
localization includes, but is not limited to, localization to within the
nucleus, the
nucleolus or the cytoplasm. Compartmentalization includes, but is not limited
to,
any directed movement of the oligomers of the invention to a cellular
compartment including the nucleus, nucleolus, mitochondrion, or imbedding into
a cellular membrane surrounding a compartment or the cell itself.
[0084] In a further embodiment of the invention, the oligomer of the
invention is associated with cellular factors that affect gene expression,
more
specifically those involved in RNA modifications. These modifications include,
but are not limited to posttrascriptional modifications such as methylation.
Furthermore, the oligomer of the invention itself may have one or more
moieties
which are bound to the oligomer which facilitate the posttranscriptional
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-29-
modification.
[0085] The oligomeric compounds of the invention may be used in the
form of single-stranded, double-stranded, circular or hairpin oligomeric
compounds and may contain structural elements such as internal or terminal
bulges or loops. Once introduced to a system, the oligomeric compounds of the
invention may interact with or elicit the action of one or more enzymes or may
interact with one or more structural proteins to effect modification of the
target
nucleic acid.
[0086] One non-limiting example of such an interaction is the RISC
complex. Use of the RISC complex to effect cleavage of RNA targets thereby
greatly enhances the efficiency of oligomer-mediated inhibition of gene
expression. Similar roles have been postulated for other ribonucleases such as
those in the RNase III and ribonuclease L family of enzymes.
[0087] Preferred forms of oligomeric compound of the invention include a
single-stranded antisense oligomer that binds in a RISC complex, a double
stranded antisense/sense pair of oligomer or a single strand oligomer that
includes
both an antisense portion and a sense portion. Each of these compounds or
compositions is used to induce potent and specific modulation of gene
function.
Such specific modulation of gene function has been shown in many species by
the
introduction of double-stranded structures, such as double-stranded RNA
(dsRNA) molecules and has been shown to induce potent and specific antisense-
mediated reduction of the function of a gene or its associated gene products.
This
phenomenon occurs in both plants and animals and is believed to have an
evolutionary connection to viral defense and transposon silencing.
[0088] The compounds and compositions of the invention are used to
modulate the expression of a target nucleic acid. "Modulators" are those
oligomeric compounds that decrease or increase the expression of a nucleic
acid
molecule encoding a target and which comprise at least an 8-nucleobase portion
that is complementary to a preferred target segment. The screening method
comprises the steps of contacting a preferred target segment of a nucleic acid
molecule encoding a target with one or more candidate modulators, and
selecting
for one or more candidate modulators which decrease or increase the expression
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-30-
of a nucleic acid molecule encoding a target. Once it is shown that the
candidate
modulator or modulators are capable of modulating (e.g. either decreasing or
increasing) the expression of a nucleic acid molecule encoding a target, the
modulator may then be employed in further investigative studies of the
function of
a target, or for use as a research, diagnostic, or therapeutic agent in
accordance
with the present invention.
Oligomeric Compounds
[0089] In the context of the present invention, the term "oligomeric
compound" refers to a polymeric structure capable of hybridizing a region of a
nucleic acid molecule. This term includes oligonucleotides, oligonucleosides,
oligonucleotide analogs, oligonucleotide mimetics and combinations of these.
Oligomeric compounds routinely prepared linearly but can be joined or
otherwise
prepared to be circular and may also include branching. Oligomeric compounds
can hybridized to form double stranded compounds 'that can be blunt ended or
may include overhangs. In general an oligomeric compound comprises a
backbone of linked momeric subunits where each linked momeric subunit is
directly or indirectly attached to a heterocyclic base moiety. The linkages
joining
the monomeric subunits, the sugar moieties or surrogates and the heterocyclic
base moieties can be independently modified giving rise to a plurality of
motifs
for the resulting oligomeric compounds including hemimers, gapmers and
chimeras.
[0090] As is known in the art, a nucleoside is a base-sugar combination.
The base portion of the nucleoside is normally a heterocyclic base moiety. The
two most common classes of such heterocyclic bases are purines and
pyrimidines.
Nucleotides axe nucleosides that fw-ther include a phosphate group covalently
linked to the sugar portion of the nucleoside. For those nucleosides that
include a
pentofuranosyl sugar, the phosphate group can be linked to either the 2', 3'
or 5'
hydroxyl moiety of the sugar. In forming oligomers, the phosphate groups
covalently link adjacent nucleosides to one another to form a linear polymeric
compound. The respective ends of this linear polymeric structure can be joined
to
form a circular structure by hybridization or by formation of a covalent bond,
however, open linear structures are generally preferred. Within the oligomer
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-31-
structure, the phosphate groups are commonly referred to as forming the
internucleoside linkages of the oligomer. The normal internucleoside linkage
of
RNA and DNA is a 3' to 5' phosphodiester linkage.
[0091] In the context of this invention, the term "oligonucleotide" refers
to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid
(DNA). This term includes oligonucleotides composed of naturally-occurring
nucleobases, sugars and covalent internucleoside linkages. The term
"oligonucleotide analog" refers to oligonucleotides that have one or more non-
naturally occurring portions which function in a similar manner to
oligonulceotides. Such non-naturally occurnng oligonucleotides are often
preferred the naturally occurring forms because of desirable properties such
as, for
example, enhanced cellular uptalee, enhanced affinity for nucleic acid target
and
increased stability in the presence of nucleases.
[0092] In the context of this invention, the term " oligonucleoside" refers
to nucleosides that are joined by internucleoside linkages that do not have
phosphorus atoms. Internucleoside linkages of this type include short chain
alkyl,
cycloalkyl, mixed heteroatom alkyl, mixed heteroatom cycloalkyl, one or more
short chain heteroatomic and one or more short chain heterocyclic. These
internucleoside linkages include but are not limited to siloxane, sulfide,
sulfoxide,
sulfone, acetal, fonnacetal, thioformacetal, methylene formacetal,
thioformacetal,
alkeneyl, sulfamate; methyleneimino, methylenehydrazino, sulfonate,
sulfonamide, amide and others having mixed N, O, S and CH2 component parts.
[0093] In addition to the modifications described above, the nucleosides
of the oligomeric compounds of the invention can have a variety of other
modification so long as these other modifications either alone or in
combination
with other nucleosides enhance one or more of the desired properties described
above. Thus, for nucleotides that are incorporated into oligomers of the
invention,
these nucleotides can have sugar portions that correspond to naturally-
occurnng
sugars or modified sugars. Representative modified sugars include carbocyclic
or
acyclic sugars, sugars having substituent groups at one or more of their 2',
3' or 4'
positions and sugars having substituents in place of one or more hydrogen
atoms
of the sugar. Additional nucleosides amenable to the present invention having
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-32-
altered base moieties and or altered sugar moieties are disclosed in United
States
Patent 3,687,808 and PCT application PCT/LTS89/02323.
[0094] Altered base moieties or altered sugar moieties also include other
modifications consistent with the spirit of this invention. Such oligomers are
best
described as being structurally distinguishable from, yet functionally
interchangeable with, naturally occurring or synthetic wild type
oligonucleotides.
All such oligomers are comprehended by this invention so long as they function
effectively to mimic the structure of a desired RNA or DNA strand. A class of
representative base modifications include tricyclic cytosine analog, termed "G
clamp" (Lin, et al., J. Am. Chem. Soc. 1998, 120, 8531). This analog makes
four
hydrogen bonds to a complementary guanine (G) within a helix by simultaneously
recognizing the Watson-Crick and Hoogsteen faces of the targeted G. This G
clamp modification when incorporated into phosphorothioate oligomers,
dramatically enhances antisense potencies in cell culture. The oligomers of
the
invention also can include phenoxazine-substituted bases of the type disclosed
by
Flanagan, et al., Nat. Bi~techhol. 1999, 17(1), 48-52.
[0095] The oligomeric compounds in accordance with this invention
preferably comprise from about 8 to about 80 nucleobases (i.e. from about 8 to
about 80 linked nucleosides). One of ordinary skill in the art will appreciate
that
the invention embodies oligomeric compounds of 8, 9, 10, 11, 12, 13, 14, 15,
16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28', 29, 30, 31, 32, 33, 34, 35,
36, 37, 38,
39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57,
58, 59, 60,
61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or
80
nucleobases in length.
[0096] In one preferred embodiment, the oligomeric compounds of the
invention are 12 to 50 nucleobases in length. One having ordinary skill in the
art
will appreciate that this embodies oligomeric compounds of 12, 13, 14, 15, 16,
17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
37, 38, 39,
40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleobases in length.
[0097] In another preferred embodiment, the oligomeric compounds of
the invention are 15 to 30 nucleobases in length. One having ordinary slcill
in the
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-33-
art will appreciate that this embodies oligomeric compounds of 15, 16, 17, 18,
19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length.
[0098] Particularly preferred oligomeric compounds are oligomers from
about 12 to about 50 nucleobases, even more preferably those comprising from
about 15 to about 30 nucleobases.
General Oligomer Synthesis
[0099] Oligomerization of modified and unmodified nucleosides is
performed according to literature procedures for DNA like compounds (Protocols
for Oligonucleotides and Analogs, Ed. Agrawal (1993), Humana Press) and/or
RNA like compounds (Scaringe, Methods (2001), 23, 206-217. Gait et al.,
Applications of Chemically synthesized RNA in RNA:Protein Interactions, Ed.
Smith (1998), 1-36. Gallo et al., Tetrahedron (2001), 57, 5707-5713) synthesis
as
appropriate. In addition specific protocols for the synthesis of oligomeric
compounds of the invention are illustrated in the examples below.
[0100] RNA oligomers can be synthesized by methods disclosed herein
or purchased from various RNA synthesis companies such as for example
Dharmacon Research Inc., (Lafayette, CO).
[0101] Irrespective of the particular protocol used, the oligomeric
compounds used in accordance with this invention may be conveniently and
routinely made through the well-known technique of solid phase synthesis.
Equipment for such synthesis is sold by several vendors including, for
example,
Applied Biosystems (Foster City, CA). Any other means for such synthesis
known in the art may additionally or alternatively be employed.
[0102] For double stranded structures of the invention, once synthesized,
the complementary strands preferably are amzealed. The single strands are
aliquoted and diluted to a concentration of 50 uM. Once diluted, 30 uL of each
strand is combined with lSuL of a SX solution of annealing buffer. The final
concentration of the buffer is 100 mM potassium acetate, 30 mM HEPES-I~OH
pH 7.4, and 2mM magnesium acetate. The final volume is 75 uL. This solution is
incubated for 1 minute at 90°C and then centrifuged for 15 seconds. The
tube is
allowed to sit for 1 hour at 37°C at which time the dsRNA duplexes are
used in
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-34-
experimentation. The final concentration of the dsRNA compound is 20 uM.
This solution can be stored frozen (-20°C) and freeze-thawed up to 5
times.
[0103] Once prepared, the desired synthetic duplexes are evaluated for
their ability to modulate target expression. When cells reach 80% confluency,
they are treated with synthetic duplexes comprising at least one oligomeric
compound of the invention. For cells grown in 96-well plates, wells are washed
once with 200 ~,L OPTI-MEM-1 reduced-serum medium (Gibco BRL) and then
treated with 130 ~,L of OPTI-MEM-1 containing 12 ~,g/mL LIPOFECTIN (Gibco
BRL) and the desired dsRNA compound at a final concentration of 200 nM. After
hours of treatment, the medium is replaced with fresh medium. Cells are
harvested 16 hours after treatment, at which time RNA is isolated and target
reduction measured by RT-PCR.
Oligomer and Monomer Modifications
[0104] As is known in the art, a nucleoside is a base-sugar combination.
The base portion of the nucleoside is normally a heterocyclic base. The two
most
common classes of such heterocyclic bases are the purines and the pyrimidines.
Nucleotides are nucleosides that further include a phosphate group covaleritly
linked to the sugar portion of the nucleoside. For those nucleosides that
include a
pentofuranosyl sugar, the phosphate group can be linked to either the 2', 3'
or 5'
hydroxyl moiety of the sugar. In forming oligomers, the phosphate groups
covalently link adjacent nucleosides to one another to form a linear polymeric
compound. In turn, the respective ends of this linear polymeric compound can
be
further joined to form a circular compound, however, linear compounds are
generally preferred. In addition, linear compounds may have internal
nucleobase
complementarity and may therefore fold in a manner as to produce a fully or
partially double-stranded compound. Within oligomers, the phosphate groups are
commonly referred to as forming the internucleoside linkage or in conjunction
with the sugar ring the backbone of the oligomer. The normal internucleoside
linkage that makes up the backbone of RNA and DNA is a 3' to 5' phosphodiester
lineage.
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-35-
Modified Interuucleoside Linkages
(0105] Specific examples of preferred antisense oligomeric compounds
useful in tlus invention include oligomers containing modified e.g. non-
naturally
occurring internucleoside linkages. As defined in tlus specification,
oligomers
having modified internucleoside linkages include internucleoside linkages that
retain a phosphorus atom and internucleoside linkages that do not have a
phosphorus atom. For the purposes of this specification, and as sometimes
referenced in the art, modified oligomers that do not have a phosphorus atom
in
their internucleoside backbone can also be considered to be oligonucleosides.
[0106] In the C. elegafas system, modification of the internucleotide
linkage (phosphorothioate) did not significantly interfere with RNAi activity.
Based on this observation, it is suggested that certain preferred oligomeric
compounds of the invention can also have one or more modified internucleoside
linkages. A preferred phosphorus containing modified internucleoside linkage
is
the phosphorothioate internucleoside linkage.
[0107] Preferred modified oligomer backbones containing a phosphorus
atom therein include, for example, phosphorothioates, chiral
phosphorothioates,
phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and
other alkyl phosphonates including 3'-alkylene phosphonates, 5'-allcylene
phosphonates and chiral phosphonates, phosphinates, phosphoramidates including
3'-amino phosphoramidate and aminoalkylphosphoramidates,
thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters,
selenophosphates and boranophosphates having normal 3'-5' linkages, 2'-5'
linlced analogs of these, and those having inverted polarity wherein one or
more
internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage.
Preferred oligomers
having inverted polarity comprise a single 3' to 3' linkage at the 3'-most
internucleotide linkage i.e. a single inverted nucleoside residue which may be
abasic (the nucleobase is missing or has a hydroxyl group in place thereof).
Various salts, mixed salts and free acid forms are also included.
[0108] Representative United States patents that teach the preparation of
the above phosphorus-containing linkages include, but are not limited to,
U.S.:
3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423;
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-36-
5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;
5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111;
5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218;
5,672,697 and 5,625,050, certain of which are commonly owned with this
application, and each of which is herein incorporated by reference.
(0109] In more preferred embodiments of the invention, oligomeric
compounds have one or more phosphorothioate and/or heteroatom internucleoside
linkages, in particular -CHZ-NH-O-CHZ-, -CHa-N(CH3)-O-CH2- [known as a
methylene (methylimino) or MMI backbone, -CH2-O-N(CH3)-CH2-, -CH2-
N(CH~)-N(CH3)-CHZ- and -O-N(CH3)-CHa-CH2- [wherein the native
phosphodiester internucleotide linkage is represented as -O-P(=O)(OH)-O-CH2-].
The MMI type internucleoside linkages are disclosed in the above referenced
U.S.
patent 5,489,677. Preferred amide internucleoside linkages are disclosed in
the
above referenced U.S. patent 5,602,240.
[0110] Preferred modified oligomer backbones that do not include a
phosphorus atom therein have backbones that are formed by short chain alkyl or
cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl
internucleoside linkages, or one or more short chain heteroatomic or
heterocyclic
internucleoside linkages. These include those having morpholino linkages
(formed in part from the sugar portion of a nucleoside); siloxane backbones;
sulfide, sulfoxide and sulfone backbones; formacetal and thioformacetal
backbones; methylene formacetal and thioformacetal backbones; riboacetal
backbones; alkene containing backbones; sulfamate backbones; methyleneimino
and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide
backbones; and others having mixed N, O, S and CH2 component parts.
[0111] Representative United States patents that teach the preparation of
the above oligonucleosides include, but are not limited to, U.S.: 5,034,506;
5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564;
5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704;
5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and
5,677,439,
certain of which are commonly owned with this application, and each of which
is
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-37-
herein incorporated by reference.
Oligomer Mimetics
(0112] Another preferred group of oligomeric compounds amenable to the
present invention includes oligonucleotide mimetics. The term mimetic as it is
applied to oligonucleotides is intended to include oligomeric compounds
wherein
only the furanose ring or both the furanose ring and the internucleotide
linlcage are
replaced with novel groups, replacement of only the furanose ring is also
referred
to in the art as being a sugar surrogate. The heterocyclic base moiety or a
modified heterocyclic base moiety is maintained for hybridization with an
appropriate target nucleic acid. One such oligomeric compound, an
oligonucleotide mimetic that has been shown to have excellent hybridization
properties, is referred to as a peptide nucleic acid (PNA). In PNA oligomeric
compounds, the sugar-backbone of an oligonucleotide is replaced with an amide
containing backbone, in particular an aminoethylglycine backbone. The
nucleobases are retained and are bound directly or indirectly to aza nitrogen
atoms
of the amide portion of the backbone. Representative United States patents
that
teach the preparation of PNA oligomeric compounds include, but are not limited
to, U.S.: 5,539,082; 5,714,331; and 5,719,262, each of which is herein
incorporated by reference. Further teaching of PNA oligomeric compounds can
be found in Nielsen et al., Science,1991, 254, 1497-1500.
[0113] One oligonucleotide mimetic that has been reported to have
excellent hybridization properties is peptide nucleic acids (PNA). The
backbone
in PNA compounds is two or more linked aminoethylglycine units which gives
PNA an amide containing backbone. The heterocyclic base moieties are bound
directly or indirectly to aza nitrogen atoms of the amide portion of the
backbone.
Representative United States patents that teach the preparation of PNA
compounds include, but are not limited to, U.S.: 5,539,082; 5,714,331; and
5,719,262, each of wluch is herein incorporated by reference. Further teaching
of
PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.
(0114] PNA has been modified to incorporate numerous modifications
since the basic PNA structure was first prepared. The basic structure is shown
below:
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-38-
Bx Bx
O O
O O
T4\N N _ N N - Ts
H H
n
wherein
Bx is a heterocyclic base moiety;
T4 is hydrogen, an amino protecting group, -C(O)R5, substituted or
unsubstituted C1-Clo allcyl, substituted or unsubstituted C2-Clo alkenyl,
substituted
or unsubstituted C2-Clo alkynyl, alkylsulfonyl, arylsulfonyl, a chemical
functional
group, a reporter group, a conjugate group, a D or L a-amino acid linked via
the
a-carboxyl group or optionally through the w-carboxyl group when the amino
acid is aspartic acid or glutamic acid or a peptide derived from D, L or mixed
D
and L amino acids linked through a carboxyl group, wherein the substituent
groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl,
vitro,
thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl;
TS is -OH, -N(Zl)ZZ, R5, D or L a-amino acid linked via the a-amino
group or optionally through the cu-amino group when the amino acid is lysine
or
ornithine or a peptide derived from D, L or mixed D and L amino acids linked
through an amino group, a chemical functional group, a reporter group or a
conjugate group;
Z1 is hydrogen, Cl-C6 alkyl, or an amino protecting group;
Z2 is hydrogen, Cl-C6 alkyl, an amino protecting group, -C(=O)-(CHZ)n J-
Z3, a D or L a,-amino acid linked via the a-carboxyl group or optionally
through
the cu-carboxyl group when the amino acid is aspartic acid or glutamic acid or
a
peptide derived from D, L or mixed D and L amino acids linked through a
carboxyl group;
Z3 is hydrogen, an amino protecting group, -Cl-C6 alkyl, -C(=O)-CH3,
benzyl, benzoyl, or -(CH2)n N(H)Zl;
each J is O, S or NH;
RS is a carbonyl protecting group; and
n is from 2 to about 50.
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-39-
[0115] Another class of oligonucleotide mimetic that has been studied is
based on linked morpholino units (morpholino nucleic acid) having heterocyclic
bases attached to the morpholino ring. A number of linking groups have been
reported that link the morpholino monomeric units in a morpholino nucleic
acid.
A preferred class of linking groups have been selected to give a non-ionic
oligomeric compound. The non-ionic morpholino-based oligomeric compounds
are less likely to have undesired interactions with cellular proteins.
Morpholino-
based oligomeric compounds are non-ionic mimics of oligonucleotides which are
less likely to form undesired interactions with cellular proteins (Dwaine A.
Braasch and David R. Corey, Bioche~zist~y, 2002, 41 (14), 4503-4510).
Morpholino-based oligomeric compounds are disclosed in United States Patent
5,034,506, issued July 23, 1991. The morpholino class of oligomeric compounds
have been prepared having a variety of different linking groups joining the
monomeric subunits.
[0116] Morpholino nucleic acids have been prepared having a variety of
different linking groups (L2) joining the monomeric subunits. The basic
formula
is shown below:
Ti Q
'N
I
Lr Bx
wherein
Tl is hydroxyl or a protected hydroxyl;
TS is hydrogen or a phosphate or phosphate derivative;
L2 is a linking group; and
n is from 2 to about 50.
[0117] A further class of oligonucleotide mimetic is referred to as
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-40-
cyclohexenyl nucleic acids (CeNA). The furanose ring normally present in an
DNA/RNA molecule is replaced with a cyclohenyl ring. CeNA DMT protected
phosphoramidite monomers have been prepared and used for oligomeric
compound synthesis following classical phosphoramidite chemistry. Fully
modified CeNA oligomeric compounds and oligomers having specific positions
modified with CeNA have been prepared and studied (see Wang et al., J. Am.
Chem. Soc., 2000,122, 8595-8602). In general the incorporation of CeNA
monomers into a DNA chain increases its stability of a DNA/RNA hybrid. CeNA
oligoadenylates formed complexes with RNA and DNA complements with similar
stability to the native complexes. The study of incorporating CeNA structures
into natural nucleic acid structures was shown by NMR and circular dichroism
to
proceed with easy conformational adaptation. Furthermore the incorporation of
CeNA into a sequence targeting RNA was stable to serum and able to activate E.
Coli RNase resulting in cleavage of the target RNA strand.
[0118] The general formula of CeNA is shown below:
x
T T2
wherein
each Bx is a heterocyclic base moiety;
Tl is hydroxyl or a protected hydroxyl; and
T2 is hydroxyl or a protected hydroxyl.
[0119] Another preferred group of oligomeric compounds amenable to
the present invention includes oligonucleotide mimetics. The term mimetic as
it is
applied to oligomers is intended to include oligomeric compounds wherein only
the furanose ring or both the furanose ring and the internucleotide linkage
are
replaced with novel groups, replacement of only the furanose ring is also
referred
to in the art as being a sugar surrogate. The heterocyclic base moiety or a
modified heterocyclic base moiety is maintained for hybridization with an
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-41-
appropriate target nucleic acid.
[0120] A~iother class of oligonucleotide mimetic (anhydrohexitol nucleic
acid) can be prepared from one or more anhydrohexitol nucleosides (see,
Wouters
and Herdewijn, Bioorg. Med. Chef~a. Lett.,1999, 9, 1563-1566) and would have
the general formula:
T
T2
[0121] A further preferred modification includes Locked Nucleic Acids
(LNAs) in which the 2'-hydroxyl group is linked to the 4' carbon atom of the
sugar
ring thereby forming a 2'-C,4'-C-oxymethylene linkage thereby forming a
bicyclic
sugar moiety. The linkage is preferably a methylene (-CH2-)" group bridging
the
2' oxygen atom and the 4' carbon atom wherein n is 1 or 2 (Singh et al., Chem.
Commun., 1998, 4, 455-456). LNA and LNA analogs display very high duplex
thermal stabilities with complementary DNA and RNA (Tm = +3 to +10 C),
stability towards 3'-exonucleolytic degradation and good solubility
properties.
The basic structure of LNA showing the bicyclic ring system is shown below:
T
Ta
[0122] The conformations of LNAs determined by 2D NMR
spectroscopy have shown that the locked orientation of the LNA nucleotides,
both
in single-stranded LNA and in duplexes, constrains the phosphate backbone in
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-42-
such a way as to introduce a higher population of the N-type conformation
(Petersen et al., J. Mol. Recognit., 2000, 13, 44-53). These conformations are
associated with improved stacking of the nucleobases (Wengel et al.,
Nucleosides
Nucleotides, 1999, 18, 1365-1370).
[0123] LNA has been shown to form exceedingly stable LNA:LNA
duplexes (Koshkin et al., J. Am. Chem. Soc., 1998, 120, 13252-13253).
LNA:LNA hybridization was shown to be the most thermally stable nucleic acid
type duplex system, and the RNA-mimicking character of LNA was established at
the duplex level. Introduction of 3 LNA monomers (T or A) significantly
increased melting points (Tm = +15/+11) toward DNA complements. The
universality of LNA-mediated hybridization has been stressed by the formation
of
exceedingly stable LNA:LNA duplexes. The RNA-mimicking of LNA was
reflected with regard to the N-type conformational restriction of the monomers
and to the secondary structure of the LNA:RNA duplex.
[0124] LNAs also form duplexes with complementary DNA, RNA or
LNA with high thermal affinities. Circular dichroism (CD) spectra show that
duplexes involving fully modified LNA (esp. LNA:RNA) structurally resemble an
A-form RNA:RNA duplex. Nuclear magnetic resonance (NMR) examination of
an LNA:DNA duplex confirmed the 3'-endo conformation of an LNA monomer.
Recognition of double-stranded DNA has also been demonstrated suggesting
strand invasion by LNA. Studies of mismatched sequences show that LNAs obey
the Watson-Crick base pairing rules with generally improved selectivity
compared
to the corresponding unmodified reference strands.
[0125] Novel types of LNA-oligomeric compounds, as well as the
LNAs, are useful in a wide range of diagnostic and therapeutic applications.
Among these are antisense applications, PCR applications, strand-displacement
oligomers, substrates for nucleic acid polymerases and generally as nucleotide
based drugs.
[0126] Potent and nontoxic antisense oligomers containing LNAs have
been described (Wahlestedt et al., Proc. Natl. Acad. Sci. U. S. A., 2000, 97,
5633-
5638.) The authors have demonstrated that LNAs confer several desired
properties to antisense agents. LNA/DNA copolymers were not degraded readily
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-43-
in blood serum and cell extracts. LNA/DNA copolymers exhibited potent
antisense activity in assay systems as disparate as G-protein-coupled receptor
signaling in living rat brain and detection of reporter genes in Escherichia
coli.
Lipofectin-mediated efficient delivery of LNA into living human breast cancer
cells has also been accomplished.
[0127] The synthesis and preparation of the LNA monomers adenine,
cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their
oligomerization, and nucleic acid recognition properties have been described
(Koshl~in et al., Tetrahedron, 1998, 54, 3607-3630). LNAs and preparation
thereof
are also described in WO 98/39352 and WO 99/14226.
[0128] The first analogs of LNA, phosphorothioate-LNA and 2'-thio-
LNAs, have also been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998,
8,
2219-2222). Preparation of locked nucleoside analogs containing
oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases
has
also been described (Wengel et al., PCT International Application WO 98-DI~393
19980914). Furthermore, synthesis of 2'-amino-LNA, a novel conformationally
restricted high-affinity oligonucleotide analog with a handle has been
described in
the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2'-
Amino- and 2'-methylamino-LNA's have been prepared and the thermal stability
of their duplexes with complementary RNA and DNA strands has been previously
reported.
[0129] Further oligonucleotide mimetics have been prepared to include
bicyclic and tricyclic nucleoside analogs having the formulas (amidite
monomers
shown):
DM
NCB O~P~N iPr NCB ~P~N iPr
O ( )2 O ( )2
(see Steffens et al., Helv. Chim. Acta,1997, 80, 2426-2439; Steffens et al.,
J. Am.
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-44-
Chem. Soc., 1999,121, 3249-3255; and Renneberg et al., J. Am. Chem. Soc.,
2002,124, 5993-6002). These modified nucleoside analogs have been
oligomerized using the phosphoramidite approach and the resulting oligomeric
compounds containing tricyclic nucleoside analogs have shown increased thermal
stabilities (Tm's) when hybridized to DNA, RNA and itself. Oligomeric
compounds containing bicyclic nucleoside analogs have shown thermal
stabilities
approaching that of DNA duplexes.
[0130] Another class of oligonucleotide mimetic is referred to as
phosphonomonoester nucleic acids incorporate a phosphorus group in a backbone
the backbone. This class of olignucleotide mimetic is reported to have useful
physical and biological and pharmacological properties in the areas of
inhibiting
gene expression (antisense oligonucleotides, ribozymes, sense oligonucleotides
and triplex-forming oligonucleotides), as probes for the detection of nucleic
acids
and as auxiliaries for use in molecular biology.
[0131] The general formula (for definitions of variables see: United
States Patents 5,74,553 and 6,127,346 herein incorporated by reference in
their
entirety) is shown below.
Z AFB Z A~B
I RS I I RS I
~~ Y~L\D~G~X Y L.D~G ~ Q
R6 Rs n
[0132] Another oligonucleotide mimetic has been reported wherein the
fuxanosyl ring has been replaced by a cyclobutyl moiety.
Modified lVucleobaseslNatu~ally occurring nucleobases
[0133] Oligomeric compounds may also include nucleobase (often
referred to in the art simply as "base" or "heterocyclic base moiety")
modifications
or substitutions. As used herein, "unmodified" or "natural" nucleobases
include
the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine
(T), cytosine (C) and uracil (U). Modified nucleobases also referred herein as
heterocyclic base moieties include other synthetic and natural nucleobases
such as
5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine,
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-45-
2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-
propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-
thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C---C-
CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-
azo
uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-
amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and
guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-
substituted
uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-
amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-
deazaadenine and 3-deazaguanine and 3-deazaadenine.
[0134] Heterocyclic base moieties may also include those in which the
purine or pyrimidine base is replaced with other heterocycles, for example 7-
deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further
nucleobases include those disclosed in United States Patent No. 3,687,808,
those
disclosed in The Concise Eyacyclopedia Of PolymeY Science And Engineering,
pages 858-859, I~roschwitz, J.L, ed. John Wiley & Sons, 1990, those disclosed
by
Englisch et al., Angewandte Cheyraie, International Edition, 1991, 30, 613,
and
those disclosed by Sanghvi, Y.S., Chapter 15, Antisense Research and
Applications, pages 289-302, Crooke, S.T. and Lebleu, B. , ed., CRC Press,
1993.
Certain of these nucleobases are particularly useful for increasing the
binding
affinity of the oligomeric compounds of the invention. These include 5-
substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted
purines, including 2-aminopropyladenine, 5-propynyluracil and 5-
propynylcytosine. 5-methylcytosine substitutions have been shown to increase
nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Croolce,
S.T. and
Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton,
1993, pp. 276-278) and are presently preferred base substitutions, even more
particularly when combined with 2'-O-methoxyethyl sugar modifications.
[0135] In one aspect of the present invention oligomeric compounds are
prepared having polycyclic heterocyclic compounds in place of one or more
heterocyclic base moieties. A number of tricyclic heterocyclic compounds have
been previously reported. These compounds are routinely used in antisense
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-46-
applications to increase the binding properties of the modified strand to a
target
strand. The most studied modifications are targeted to guanosines hence they
have been termed G-clamps or cytidine analogs. Many of these polycyclic
heterocyclic compounds have the general formula:
R13
R14
R1
[0136] Representative cytosine analogs that make 3 hydrogen bonds with
a guanosine in a second strand include 1,3-diazaphenoxazine-2-one (Rlo= O, Rli
-
R14= H) [Kurchavov, et al., Nucleosides and Nucleotides, 1997, 16, 1837-1846],
1,3-diazaphenothiazine-2-one (Rlo= S, Rli - Ri4= H), [Lin, K.-Y.; Jones, R.
J.;
Matteucci, M. J. Am. Chem. Soc. 1995, 117, 3873-3874] and 6,7,8,9-tetrafluoro-
1,3-diazaphenoxazine-2-one (Rlo = O, Rl1- R14 = F) [Wang, J.; Lin, K.-Y.,
Matteucci, M. Tetrahedron Lett. 1998, 39, 8385-8388]. Incorporated into
oligonucleotides these base modifications were shown to hybridize with
complementary guanine and the latter was also shown to hybridize with adenine
and to enhance helical thermal stability by extended stacking
interactions(also see
U.S. Patent Application entitled "Modified Peptide Nucleic Acids" filed May
24,
2002, Serial number 10/155,920; and U.S. Patent Application entitled "Nuclease
Resistant Chimeric Oligonucleotides" filed May 24, 2002, Serial number
10/013,295, both of which are commonly owned with this application and are
herein incorporated by reference in their entirety).
[0137] Further helix-stabilizing properties have been observed when a
cytosine analog/substitute has an aminoethoxy moiety attached to the rigid 1,3-
diazaphenoxazine-2-one scaffold (Rlo= O, Rll = -O-(CHZ)2-NH2, Rla-i4=H ) [Lin,
K.-Y.; Matteucci, M. J. Am. Chem. Soc. 1998, 120, 8531-8532]. Binding studies
demonstrated that a single incorporation could enhance the binding affinity of
a
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-47-
model oligonucleotide to its complementary target DNA or RNA with a DT", of up
to 18° relative to 5-methyl cytosine (dCSme), which is the highest
known affinity
eWancement for a single modification, yet. On the other hand, the gain in
helical
stability does not compromise the specificity of the oligomers. The Tm data
indicate an even greater discrimination between the perfect match and
mismatched
sequences compared to dCSme. It was suggested that the tethered amino group
serves as an additional hydrogen bond donor to interact with the Hoogsteen
face,
namely the 06, of a complementary guanine thereby forming 4 hydrogen bonds.
This means that the increased affinity of G-clamp is mediated by the
combination
of extended base stacking and additional specific hydrogen bonding.
[0138] Further tricyclic heterocyclic compounds and methods of using
them that are amenable to the present invention are disclosed in United States
Patent Serial Number 6,028,183, which issued on May 22, 2000, and United
States Patent Serial Number 6,007,992, which issued on December 28, 1999, the
contents of both are commonly assigned with this application and are
incorporated
herein in their entirety.
[0139] The enhanced binding affinity of the phenoxazine derivatives
together with their uncompromised sequence specificity make them valuable
nucleobase analogs for the development of more potent antisense-based drugs.
In
fact, promising data have been derived from in vitro experiments demonstrating
that heptanucleotides containing phenoxazine substitutions are capable to
activate
RNaseH, enhance cellular uptake and exhibit an increased antisense activity
[Lin,
I~-Y; Matteucci, M. J. Am. Chem. Soc. 1998, 120, 8531-8532]. The activity
enhancement was even more pronounced in case of G-clamp, as a single
substitution was shown to significantly improve the in vitro potency of a
20mer
2'-deoxyphosphorothioate oligonucleotides [Flanagan, W. M.; Wolf, J.J.; Olson,
P.; Grant, D.; Lin, K.-Y.; Wagner, R. W.; Matteucci, M. Proc. Natl. Acad. Sci.
USA, 1999, 96, 3513-3518]. Nevertheless, to optimize oligomer design and to
better understand the impact of these heterocyclic modifications on the
biological
activity, it is important to evaluate their effect on the nuclease stability
of the
oligomers.
[0140] Further modified polycyclic heterocyclic compounds useful as
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-48-
heterocyclcic bases are disclosed in but not limited to, the above noted U.S.
3,687,808, as well as U.S.: 4,845,205; 5,130,302; 5,134,066; 5,175,273;
5,367,066; 5,432,272; 5,434,257; 5,457,187; 5,459,255; 5,484,908; 5,502,177;
5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985;
5,646,269; 5,750,692; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, and
Unites States Patent Application Serial number 09/996,292 filed November 28,
2001, certaiiz of which are commonly owned with the instant application, and
each
of which is herein incorporated by reference.
Coyzjugates
[0141] A further preferred substitution that can be appended to the
oligomeric compounds of the invention involves the linkage of one or more
moieties or conjugates which enhance the activity, cellular distribution or
cellular
uptake of the resulting oligomeric compounds. In one embodiment such modified
oligomeric compounds are prepared by covalently attaching conjugate groups to
functional groups such as hydroxyl or amino groups. Conjugate groups of the
invention include intercalators, reporter molecules, polyamines, polyamides,
poly-
ethylene glycols, polyethers, groups that enhance the pharmacodynamic
properties
of oligomers, and groups that enhance the pharmacol~inetic properties of
oligomers. Typical conjugates groups include cholesterols, lipids,
phospholipids,
biotin, phenazine, folate, phenanthridine, anthraquinone, acridine,
fluoresceins,
rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic
properties, in the context of this invention, include groups that improve
oligomer
uptalce, enhance oligomer resistance to degradation, and/or strengthen
sequence-
specific hybridization with RNA. Groups that enhance the pharmacokinetic
properties, in the context of this invention, include groups that improve
oligomer
uptake, distribution, metabolism or excretion. Representative conjugate groups
are disclosed in International Patent Application PCT/IJS92/09196, filed
October
23, 1992 the entire disclosure of which is incorporated herein by reference.
[0142] Conjugate moieties include but are not limited to lipid moieties
such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci.
USA,1989,
~6, 6553-6556), cholic acid (Manoharan et al., Bioofg. Meel. Chem. Let.,1994,
4,
1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Anh. N.
Y.
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-49-
Acad. Sci.,1992, 660, 306-309; Manoharan et al., Bioorg. Med. Clzem. Let.,
1993,
3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res.,1992,
20,
533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-
Behmoaras et al., EMBO J.,1991,10, 1111-1118; Kabanov et al., FEBS Lett.,
1990, 259, 327-330; Svinarchuk et al., Biochimie,1993, 75, 49-54), a
phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-
hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett.,
1995, 36, 3651-3654; Shea et al., Nucl. Acids Res.,1990, l8, 3777-3783), a
polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides &
Nucleotides,1995, l4, 969-973), or adamantane acetic acid (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1995,1264, 229-237), or an octadecylamine or
hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp.
Tl2er.,1996, 277, 923-937.
[0143] The oligomeric compounds of the invention may also be
conjugated to active drug substances, for example, aspirin, warfarin,
phenylbuta-
zone, ibuprofen, suprofen, fenbufen, ketoprofen, (S~-(+)-pranoprofen,
carprofen,
dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a
benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a
cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an
antibiotic.
Oligonucleotide-drug conjugates and their preparation are described in United
States Patent Application 09/334,130 (filed June 15, 1999) wluch is
incorporated
herein by reference in its entirety.
(0144] Representative United States patents that teach the preparation of
such oligomer conjugates include, but are not limited to, U.S.: 4,828,979;
4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717,
5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025;
4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013;
5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022;
5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241,
5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552;
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-50-
5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;
5,599,928 and 5,688,941, certain of which are commonly owned with the instant
application, and each of which is herein incorporated by reference.
Clzime~ic oligomeric compounds
[0145] It is not necessary for all positions in an oligomeric compound to
be uniformly modified, and in fact more than one of the aforementioned
modifications may be incorporated in a single oligomeric compound or even at a
single monomeric subunit such as a nucleoside within a oligomeric compound.
The present invention also includes oligomeric compounds which are chimeric
oligomeric compounds. "Chimeric" oligomeric compounds or "chimeras," in the
context of this invention, are oligomeric compounds that contain two or more
chemically distinct regions, each made up of at least one monomer unit, i.e.,
a
nucleotide in the case of a nucleic acid based oligomer.
[0146] Chimeric oligomeric compounds typically contain at least one
region modified so as to confer increased resistance to nuclease degradation,
increased cellular uptake, and/or increased binding affinity for the target
nucleic
acid. An additional region of the oligomeric compound may serve as a substrate
for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of
example, RNase H is a cellular endonuclease which cleaves the RNA strand of an
RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the
RNA target, thereby greatly enhancing the efficiency of inhibition of gene
expression. Consequently, comparable results can often be obtained with
shorter
oligomeric compounds when chimeras are used, compared to for example
phosphorothioate deoxyoligonucleotides hybridizing to the same target region.
Cleavage of the RNA target can be routinely detected by gel electrophoresis
and,
if necessary, associated nucleic acid hybridization techniques known in the
art.
[0147] Chimeric oligomeric compounds of the invention may be formed
as composite structures of two or more oligonucleotides, oligonucleotide
analogs,
oligonucleosides andlor oligonucleotide mimetics as described above. Such
oligomeric compounds have also been referred to in the art as hybrids
hemimers,
gapmers or inverted gapmers. Representative United States patents that teach
the
preparation of such hybrid structures include, but are not limited to, U.S.:
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-51-
5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133;
5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, certain of which
are
commonly owned with the instant application, and each of which is herein
incorporated by reference in its entirety.
3'-endo modificatiofzs
[0148] In one aspect of the present invention oligomeric compounds
include nucleosides synthetically modified to induce a 3'-endo sugar
conformation. A nucleoside can incorporate synthetic modifications of the
heterocyclic base, the sugar moiety or both to induce a desired 3'-endo sugar
conformation. These modified nucleosides are used to mimic RNA like
nucleosides so that particular properties of an oligomeric compound can be
enhanced while maintaining the desirable 3'-endo conformational geometry.
There is an apparent preference for an RNA type duplex (A form helix,
predominantly 3'-endo) as a requirement (e.g. trigger) of RNA interference
which
is supported in part by the fact that duplexes composed of 2'-deoxy-2'-F-
nucleosides appears efficient in triggering RNAi response in the C. elegans
system. Properties that are enhanced by using more stable 3'-endo nucleosides
include but aren't limited to modulation of pharmacokinetic properties through
modification of protein binding, protein off rate, absorption and clearance;
modulation of nuclease stability as well as chemical stability; modulation of
the
binding affinity and specificity of the oligomer (affinity and specificity for
enzymes as well as for complementary sequences); and increasing efficacy of
RNA cleavage. The present invention provides oligomeric triggers of RNAi
having one or more nucleosides modified in such a way as to favor a C3'-endo
type conformation.
Scheme 1
2~ 4~
1 eq 3 e9
4eq - a 2 q
3~ 1~
C2'-endo/Southern C3'-endo/Northern
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-52-
[0149] Nucleoside conformation is influenced by various factors
including substitution at the 2', 3' or 4'-positions of the pentofuranosyl
sugar.
Electronegative substituents generally prefer the axial positions, while
sterically
demanding substituents generally prefer the equatorial positions (Principles
of
Nucleic Acid Structure, Wolfgang Sanger, 1984, Springer-Verlag.) Modification
of the 2' position to favor the 3'-endo conformation can be achieved while
maintaining the 2'-OH as a recognition element, as illustrated in Figure 2,
below
(Gallo et al., Tetrahedron (2001), 57, 5707-5713. Harry-O'kuru et al., J. Org.
Chem.,
(1997), 62(6), 1754-1759 and Tang et al., J. Org. Chem. (1999), 64, 747-754.)
Alternatively, preference for the 3'-endo conformation can be achieved by
deletion
of the 2'-OH as exemplified by 2'deoxy-2'F-nucleosides (Kawasaki et al., J.
Med.
Chem. (1993), 36, 831-841), which adopts the 3'-endo conformation positioning
the
electronegative fluorine atom in the axial position. Other modifications of
the
ribose ring, for example substitution at the 4'-position to give 4'-F modified
nucleosides (Guillerm et al., Bioorganic and Medicinal Chemistry Letters
(1995), 5,
1455-1460 and Owen et al., J. Org. Chem. (1976), 41, 3010-3017), or for
example
modification to yield methanocarba nucleoside analogs (Jacobson et al., J.
Med.
Chem. Lett. (2000), 43, 2196-2203 and Lee et al., Bioorganic and Medicinal
Chemistry
Letters (2001), 11, 1333-1337) also induce preference for the 3'-endo
conformation.
Along similar lines, oligomeric triggers of RNAi response might be composed of
one or more nucleosides modified in such a way that conformation is locked
into a
C3'-endo type conformation, i.e. Locked Nucleic Acid (LNA, Singh et al, Chem.
Commun. (1998), 4, 455-456), and ethylene bridged Nucleic Acids (ENA, Morita
et
al, Bioorganic & Medicinal Chemistry Letters (2002), 12, 73-76.) Examples of
modified nucleosides amenable to the present invention are shown below in
Table
I. These examples are meant to be representative and not exhaustive.
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-53-
Table I
HO O B HO O B HO O B
CH H C~~. CH ~CF
3 3 . . 3 _ _ 3
HO OH HO OH HO OH
HO O B HO O B HO O B
F~~'
HO N3 HO OCH3 HO OH
HO O B HO B HO O B
HO CH3 v,
H3C OH HO OH HO\O
HO O B HO O B HO O B
HO
HO Cl pH HO O
HO B HO O B HO O B
CHEF
HO OH HO OH HO OMOE
HO O B HO S B HO B
CH3 \ /~CH3
pH HO OH HO OH
HO O B
HO NH2
[0150] The preferred conformation of modified nucleosides and their
oligomers can be estimated by various methods such as molecular dynamics
calculations, nuclear magnetic resonance spectroscopy and CD measurements.
Hence, modifications predicted to induce RNA like conformations, A-form duplex
geometry in an oligomeric context, are selected for use in the modified
oligomers
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-54-
of the present invention. The synthesis of numerous of the modified
nucleosides
amenable to the present invention are known in the art (see for example,
Chemistry of Nucleosides and Nucleotides Vol 1-3, ed. Leroy B. Townsend, 1988,
Plenum press., and the examples section below.) Nucleosides known to be
inhibitors/substrates for RNA dependent RNA polymerases (for example HCV
NSSB
[0151] In one aspect, the present invention is directed to oligomers that
are prepared having enhanced properties compared to native RNA against nucleic
acid targets. A target is identified and an oligomer is selected having an
effective
length and sequence that is complementary to a portion of the target sequence.
Each nucleoside of the selected sequence is scrutinized for possible enhancing
modifications. A preferred modification would be the replacement of one or
more
RNA nucleosides with nucleosides that have the same 3'-endo conformational
geometry. Such modifications can enhance chemical and nuclease stability
relative to native RNA while at the same time being much cheaper and easier to
synthesize and/or incorporate into an oligomer. The selected sequence can be
further divided into regions and the nucleosides of each region evaluated for
enhancing modifications that can be the result of a chimeric configuration.
Consideration is also given to the S' and 3'-termini as there axe often
advantageous
modifications that can be made to one or more of the terminal nucleosides. The
oligomeric compounds of the present invention include at least one 5'-modified
phosphate group on a single strand or on at least one 5'-position of a double
stranded sequence or sequences. Further mbdifications are also considered such
as intemucleoside linkages, conjugate groups, substitute sugars or bases,
substitution of one or more nucleosides with nucleoside mimetics and any other
modification that can enhance the selected sequence for its intended target.
[0152] The terms used to describe the conformational geometry of
homoduplex nucleic acids are "A Form" for RNA and "B Form" for DNA. The
respective conformational geometry for RNA and DNA duplexes was determined
fiom X-ray diffraction analysis of nucleic acid fibers (Arnott and Hulcins,
BiocheJn. Biophys. Res. Cofyan~., 1970, 47, 1504.) In general, RNA:RNA
duplexes
are more stable and have higher melting temperatures (Tm's) than DNA:DNA
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-55-
duplexes (Sanger et al., Principles of Nucleic Acid Structure, 1984, Springer-
Verlag; New York, NY.; Lesiik et al., Biochemistry, 1995, 34, 10807-10815;
Conte et al., Nucleic Acids Res., 1997, 25, 2627-2634). The increased
stability of
RNA has been attributed to several structural features, most notably the
improved
base stacking interactions that result from an A-form geometry (Searle et al.,
Nucleic Acids Res., 1993, 21, 2051-2056). The presence of the 2' hydroxyl in
RNA biases the sugar toward a C3' endo pucker, i.e., also designated as
Northern
pucker, which causes the duplex to favor the A-form geometry. In addition, the
2'
hydroxyl groups of RNA can form a network of water mediated hydrogen bonds
that help stabilize the RNA duplex (Egli et al., Biochemistry, 1996, 35, 8489-
8494). On the other hand, deoxy nucleic acids prefer a C2' endo sugar pucker,
i.e., also known as Southern pucker, which is thought to impart a less stable
B-
form geometry (Sanger, W. (1984) Principles of Nucleic Acid Structure,
Springer-
Verlag, New York, NY). As used herein, B-form geometry is inclusive of both
C2'-endo pucker and 04'-endo pucker. This is consistent with Bergen et. al.,
Nucleic Acids Research, 1998, 26, 2473-2480, who pointed out that in
considering
the fuxanose conformations which give rise to B-form duplexes consideration
should also be given to a 04'-endo pucker contribution.
[0153] DNA:RNA hybrid duplexes, however, are usually less stable than
pure RNA:RNA duplexes, and depending on their sequence may be either more or
less stable than DNA:DNA duplexes (Searle et al., Nucleic Acids Res., 1993,
21,
2051-2056). The structure of a hybrid duplex is intermediate between A- and B-
form geometries, which may result in poor stacking interactions (Lane et al.,
Eu~.
J. Biochem.,1993, 21 S, 297-306; Fedoroff et al., J. Mol. Biol.,1993, 233, 509-
523; Gonzalez et al., Biochemist~y,1995, 34, 4969-4982; Horton et al., J. Mol.
Biol.,1996, X64, 521-533). The stability of the duplex formed between a target
RNA and a synthetic sequence is central to therapies such as but not limited
to
antisense and RNA interference as these mechanisms require the binding of a
synthetic oligomer strand to an RNA target strand. In the case of antisense,
effective inhibition of the mRNA requires that the antisense DNA have a very
high binding affinity with the mRNA. Otherwise the desired interaction between
the synthetic oligomer strand and target mRNA strand will occur infrequently,
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-56-
resulting in decreased efficacy.
[0154] One routinely used method of modifying the sugar puckering is
the substitution of the sugar at the 2'-position with a substituent group that
influences the sugar geometry. The influence on ring conformation is dependant
on the nature of the substituent at the 2'-position. A number of different
substituents have been studied to determine their sugar puckering effect. For
example, 2'-halogens have been studied showing that the 2'-fluoro derivative
exhibits the largest population (65%) of the C3'-endo form, and the 2'-iodo
exhibits the lowest population (7%). The populations of adenosine (2'-OH)
versus
deoxyadenosine (2'-H) are 36% and 19%, respectively. Furthermore, the effect
of
the 2'-fluoro group of adenosine dimers (2'-deoxy-2'-fluoroadenosine -
2'-deoxy-2'-fluoro-adenosine) is further correlated to the stabilization of
the
stacked conformation.
[0155] As expected, the relative duplex stability can be enhanced by
replacement of 2'-OH groups with 2'-F groups thereby increasing the C3'-endo
population. It is assumed that the highly polar nature of the 2'-F bond and
the
extreme preference for C3'-endo puckering may stabilize the stacked
conformation in an A-form duplex. Data from UV hypochromicity, circular
dichroism, and 1H NMR also indicate that the degree of stacking decreases as
the
electronegativity of the halo substituent decreases. Furthermore, steric bulk
at the
2'-position of the sugar moiety is better accommodated in an A-form duplex
than a
B-form duplex. Thus, a 2'-substituent on the 3'-terminus of a dinucleoside
monophosphate is thought to exert a number of effects on the stacking
conformation: steric repulsion, furanose puckering preference, electrostatic
repulsion, hydrophobic attraction, and hydrogen bonding capabilities. These
substituent effects are thought to be determined by the molecular size,
electronegativity, and hydrophobicity of the substituent. Melting temperatures
of
complementary strands is also increased with the 2'-substituted adenosine
diphosphates. It is not clear whether the 3'-endo preference of the
conformation
or the presence of the substituent is responsible for the increased binding.
However, greater overlap of adjacent bases (stacking) can be achieved with the
3'-endo conformation.
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-57-
[0156] One synthetic 2'-modification that imparts increased nuclease
resistance and a very lugh binding affinity to nucleotides is the 2-
methoxyethoxy
(2'-MOE, 2'-OCH2CHaOCH3) side chain (Baker et al., J. Biol. Chem.,1997, 272,
11944-12000). One of the immediate advantages of the 2'-MOE substitution is
the improvement in binding affinity, which is greater than many similar 2'
modifications such as O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides
having the 2'-O-methoxyethyl substituent also have been shown to be antisense
inhibitors of gene expression with promising features for in vivo use (Martin,
P.,
Helv. Chim. Acta,1995, 7~, 486-504; Altmann et al., Chirnia,1996, 50, 168-176;
Altmann et al., Biochem. Soc. Ti~ahs., 1996, 24, 630-637; and Altmann et al.,
Nucleosides Nucleotides, 1997,16, 917-926). Relative to DNA, the oligomers
having the 2'-MOE modification displayed improved RNA affinity and higher
nuclease resistance. Chimeric oligomers having 2'-MOE substituents in the wing
nucleosides and an internal region of deoxy-phosphorothioate nucleotides (also
termed a gapped oligomer or gapmer) have shown effective reduction in the
growth of twnors in animal models at low doses. 2'-MOE substituted oligomers
have also shomz outstanding promise as antisense agents in several disease
states.
One such MOE substituted oligomer is presently being investigated in clinical
trials for the treatment of CMV retinitis.
Chemistries Defined
[0157] Unless otherwise defined herein, alkyl means Cl-C12, preferably
C1-C8, and more preferably Cl-C6, straight or (where possible) branched chain
aliphatic hydrocarbyl.
[0158] Unless otherwise defined herein, heteroalkyl means Cl-Cla,
preferably C1-C8, and more preferably C1-C~, straight or (where possible)
branched chain aliphatic hydrocarbyl containing at least one, and preferably
about
1 to about 3, hetero atoms in the chain, including the terminal portion of the
chain.
Preferred heteroatoms include N, O and S.
[0159] Unless otherwise defined herein, cycloallcyl means C3-C1~,
preferably C3-C8, and more preferably C3-C~, aliphatic hydrocarbyl ring.
[0160] Unless otherwise defined herein, allcenyl means C2-C12,
preferably CZ-C8, and more preferably CZ-C6 alkenyl, which may be straight or
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-58-
(where possible) branched hydrocarbyl moiety, which contains at least one
carbon-carbon double bond.
[0161] Unless otherwise defined herein, alkynyl means C2-Clz,
preferably C2-C8, and more preferably C2-C6 alkynyl, which may be straight or
(where possible) branched hydrocarbyl moiety, which contains at least one
carbon-caxbon triple bond.
[0162] Unless otherwise defined herein, heterocycloalkyl means a ring
moiety containing at least three ring members, at least one of which is
carbon, and
of which 1, 2 or three ring members are other than carbon. Preferably the
number
of carbon atoms varies from 1 to about 12, preferably 1 to about 6, and the
total
number of ring members varies from three to about 15, preferably from about 3
to
about 8. Preferred ring heteroatoms are N, O and S. Preferred heterocycloalkyl
groups include morpholino, thiomorpholino, piperidinyl, piperazinyl,
homopiperidinyl, homopiperazinyl, homomorpholino, homothiomorpholino,
pyrrolodinyl, tetrahydrooxazolyl, tetrahydroimidazolyl, tetrahydrothiazolyl,
tetrahydroisoxazolyl, tetrahydropyrrazolyl, furanyl, pyranyl, and
tetrahydroisothiazolyl.
[0163] Unless otherwise defined herein, aryl means any hydrocarbon
ring structure containing at least one aryl ring. Preferred aryl rings have
about 6
to about 20 ring carbons. Especially preferred aryl rings include phenyl,
napthyl,
anthracenyl, and phenanthrenyl.
[0164] Unless otherwise defined herein, hetaryl means a ring moiety
containing at least one fully unsaturated ring, the ring consisting of carbon
and
non-carbon atoms. Preferably the ring system contains about 1 to about 4
rings.
Preferably the number of carbon atoms varies from 1 to about 12, preferably 1
to
about 6, and the total number of ring members varies from three to about 15,
preferably from about 3 to about 8. Preferred ring heteroatoms are N, ~ and S.
Preferred hetaryl moieties include pyrazolyl, thiophenyl, pyridyl, imidazolyl,
tetrazolyl, pyridyl, pyrimidinyl, purinyl, quinazolinyl, quinoxalinyl,
benzimidazolyl, benzothiophenyl, etc.
[0165] The term haloallcyl is defined as an alkyl containing one or more
halogen atoms. In some embodiments, the alkyl is fully halogenated. For
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-59-
example, the haloalkyl may be trifluoromethyl. Similarly, the term haloalkoxy
is
defined as an alkoxy group where the all~yl group is a haloalkyl. For example,
the
haloallcoxy may be trifluoroalkoxy.
[0166] Unless otherwise defined herein, where a moiety is defined as a
compound moiety, such as hetarylalkyl (hetaryl and alkyl), aralkyl (aryl and
allcyl), etc., each of the sub-moieties is as defined herein.
[0167] Unless otherwise defined herein, an electron withdrawing group
is a group, such as the cyano or isocyanato group that draws electronic charge
away from the carbon to which it is attached. Other electron withdrawing
groups
of note include those whose electronegativities exceed that of carbon, for
example
halogen, vitro, or phenyl substituted in the ortho- or para-position with one
or
more cyano, isothiocyanato, intro or halo groups.
[0168] Unless otherwise defined herein, the terms halogen and halo have
their ordinary meanings. Preferred halo (halogen) substituents are Cl, Br, and
I.
The aforementioned optional substituents are, unless otherwise herein defined,
suitable substituents depending upon desired properties. Included are halogens
(Cl, Br, I), alkyl, alkenyl, and alkynyl moieties, N02, NH3 (substituted and
unsubstituted), acid moieties (e.g. -C02H, -OSO3Ha, etc.), heterocycloalkyl
moieties, hetaryl moieties, aryl moieties, etc.
In all the preceding formulae, the squiggle (~) indicates a bond to an oxygen
or
sulfur of the 5'-phosphate.
[0169] Phosphate protecting groups include those described in US
Patents Nos. 5,760,209, 5,614,621, 6,051,699, 6,020,475, 6,326,478, 6,169,177,
6,121,437, 6,465,628 each of which is expressly incorporated herein by
reference
in its entirety.
[0170] Phosphotioate groups include those described in U.S. Patent Nos.
3,687,808, 5,188,897, 5,278,302, 5,286,717, 5,405,939, 5,453,496, and
5,587,361.
[0171] Alkylphosphoroamidate groups include those described in U.S.
Patent No. 5,536,821 and 5,541,306,
[0172] Unless otherwise defined herein, alkoxy is defined as -O-alkyl
where alkyl is as defined above.
[0173] Unless otherwise defined herein, alkylthio is defined as -S-alkyl
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-60-
where alkyl is as defined above.
[0174] As used herein, the terms alkyl, heteroalkyl, cycloalkyl, alkenyl,
alkynyl, heterocycloalkyl, aryl, and hetaryl include moieties that are
optionally
substituted. Sitable substituents are well known to those skilled in the art.
These
substituents include C1-CZO alkyl, C2-C2o alkenyl, C2-C2o alkynyl, CS-CZO
aryl, -O-
allcyl, -O-alkenyl, -O-alkynyl, -O-alkylamino, -O-alkylalkoxy, -O-allcylamino-
alkyl, -O-alkyl imidazole, -OH, -SH, -S-alkyl, -S-alkenyl, -S-alkynyl, -N(H)-
alkyl,
-N(H)-alkenyl, -N(H)-alkynyl, -N(alkyl)2, -O-aryl, -S-aryl, -NH-aryl, -ON02, -
O-
arallcyl, -S-aralkyl, -N(H)-aralkyl, phthalimido (attached at N), halogen,
amino,
lceto (-C(=O)-R), carboxyl (-C(=O)OH), vitro (-N02), nitroso (-N=O), cyano (-
CI~, trifluoromethyl (-CF3), trifluoromethoxy (-O-CF3), imidazole, azido (-
N3),
hydrazino (-N(H)-NHZ), aminooxy (-O-NHZ), isocyanato (-N=C=O), sulfoxide (-
S(=O)-R), sulfone (-S(=O)a-R), disulfide (-S-S-R), silyl, heterocycle,
carbocycle,
intercalator, reporter group, conjugate, polyamine, polyamide, polyalkylene
glycol, and polyethers of the formula (-O-alkyl)",, where m is 1 to about 10;
wherein each R is, independently, hydrogen, a protecting group alkyl, alkenyl,
or
all~ynyl.
Screening, Target Validation and Drug Discovery
[0175] For use in screening and target validation, the compounds and
compositions of the invention are used to modulate the expression of a
selected
protein. "Modulators" are those oligomeric compounds and compositions that
decrease or increase the expression of a nucleic acid molecule encoding a
protein
and which comprise at least an 8-nucleobase portion which is complementary to
a
preferred target segment. The screening method comprises the steps of
contacting
a preferred target segment of a nucleic acid molecule encoding a protein with
one
or more candidate modulators, and selecting for one or more candidate
modulators
which decrease or increase the expression of a nucleic acid molecule encoding
a
protein. Once it is shown that the candidate modulator or modulators are
capable
of modulating (e.g. either decreasing or increasing) the expression of a
nucleic
acid molecule encoding a peptide, the modulator may then be employed in
further
investigative studies of the function of the peptide, or for use as a
research,
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-61-
diagnostic, or therapeutic agent in accordance with the present invention.
[0176] The conduction such screening and target validation studies,
oligomeric compounds of invention canbe used combined with their respective
complementary strand oligomeric compound to form stabilized double-stranded
(duplexed) oligomers. Double stranded oligomer moieties have been shown to
modulate target expression and regulate translation as well as RNA processing
via
an antisense mechanism. Moreover, the double-stranded moieties may be subj ect
to chemical modifications (Fire et al., Natuz~e,1998, 391, 806-811; Timmons
and
Fire, Nature 1998, 395, 854; Timmons et al., Gene, 2001, 263, 103-112; Tabara
et
al., Science, 1998, 282, 430-431; Montgomery et al., Proc. Natl. Acad. Sci.
USA,
1998, 95, 15502-15507; Tuschl et al., Genes Dev.,1999, l3, 3191-3197; Elbashir
et al., Nature, 2001, 411, 494-498; Elbaslur et al., Genes Dev. 2001,15, 188-
200 ;
Nishikura et al., Cell (2001), 107, 415-416; and Bass et al., Cell (2000),
101, 235-
238.) For example, such double-stranded moieties have been shown to inhibit
the
target by the classical hybridization of antisense strand of the duplex to the
target,
thereby triggering enzymatic degradation of the target (Tijsterman et al.,
Science,
2002, 295, 694-697).
[0177] For use in drug discovery and target validation, oligomeric
compounds of the present invention are used to elucidate relationships that
exist
between proteins and a disease state, phenotype, or condition. These methods
include detecting or modulating a target peptide comprising contacting a
sample,
tissue, cell, or organism with the oligomeric compounds and compositions of
the
present invention, measuring the nucleic acid or protein level of the target
and/or a
related phenotypic or chemical endpoint at some time after treatment, and
optionally comparing the measured value to a non-treated sample or sample
treated with a further oligomeric compound of the invention. These methods can
also be performed in parallel or in combination with other experiments to
determine the fiuiction of unknown genes for the process of target validation
or to
determine the validity of a particular gene product as a target for treatment
or
prevention of a disease or disorder.
Kits, Research Reagents, Diagnostics, and Therapeutics
[0178] The oligomeric compounds and compositions of the present
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-62-
invention can additionally be utilized for diagnostics, therapeutics,
prophylaxis
and as research reagents and kits. Such uses allows for those of ordinary
skill to
elucidate the function of particular genes or to distinguish between functions
of
various members of a biological pathway.
[0179] For use in kits and diagnostics, the oligomeric compounds and
compositions of the present invention, either alone or in combination with
other
compounds or therapeutics, can be used as tools in differential and/or
combinatorial analyses to elucidate expression patterns of a portion or the
entire
complement of genes expressed within cells and tissues.
[0180] As one non-limiting example, expression patterns within cells or
tissues treated with one or more compounds or compositions of the invention
are
compared to control cells or tissues not treated with the compounds or
compositions and the patterns produced are analyzed for differential levels of
gene
expression as they pertain, for example, to disease association, signaling
pathway,
cellular localization, expression level, size, structure or function of the
genes
examined. These analyses can be performed on stimulated or unstimulated cells
and in the presence or absence of other compounds that affect expression
patterns.
[0181] Examples of methods of gene expression analysis known in the
art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett., 2000, 480,
17-24; Celis, et al., FEBS Lett., 2000, 480, 2-16), SAGE (serial analysis of
gene
expression)(Madden, et al., D~ugDiscov. Today, 2000, 5, 415-425), READS
(restriction enzyme amplification of digested cDNAs) (Prashar and Weissman,
Methods Ehzymol., 1999, 303, 258-72), TOGA (total gene expression analysis)
(Sutcliffe, et al., P~oc. Natl. Acad. Sci. U. S. A., 2000, 97, 1976-81),
protein arrays
and proteomics (Celis, et al., FEBSLett., 2000, 480, 2-16; Jungblut, et al.,
Elect~opho~esis, 1999, 20, 2100-10), expressed sequence tag (EST) sequencing
(Celis, et al., FEBSLett., 2000, 480, 2-16; Larsson, et al., J. Bioteclauol.,
2000, 80,
143-57), subtractive RNA fingerprinting (SURF) (Fuchs, et al., Anal. Biochem.,
2000, 286, 91-98; Larson, et al., Cytomet~y, 2000, 41, 203-208), subtractive
cloning, differential display (DD) (Jurecic and Belmont, Cur. Opifx.
Mic~obiol.,
2000, 3, 316-21), comparative genomic hybridization (Carulli, et al., J. Cell
Biochem. Suppl., 1998, 31, 286-96), FISH (fluorescent iu situ hybridization)
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-63-
techniques (Going and Gusterson, Eur. J. Cahcer, 1999, 35, 1895-904) and mass
spectrometry methods (To, Comb. Clzena. High Throughput Screen, 2000, 3, 235-
41).
[0182] The compounds and compositions of the invention are useful for
research and diagnostics, because these compounds and compositions hybridize
to ,
nucleic acids encoding proteins. Hybridization of the compounds and
compositions of the invention with a nucleic acid can be detected by means
known in the art. Such means may include conjugation of an enzyme to the
compound or composition, radiolabelling or any other suitable detection means.
Kits using such detection means for detecting the level of selected proteins
in a
sample may also be prepared.
[0183] The specificity and sensitivity of compounds and compositions
can also be harnessed by those of skill in the art for therapeutic uses.
Antisense
oligomeric compounds have been employed as therapeutic moieties in the
treatment of disease states in animals, including humans. Antisense oligomer
drugs, including ribozymes, have been safely and effectively administered to
humans and numerous clinical trials are presently underway. It is thus
established
that oligomeric compounds can be useful therapeutic modalities that can be
configured to be useful in treatment regimes for the treatment of cells,
tissues and
animals, especially humans.
[0184] For therapeutics, an animal, preferably a human, suspected of
having a disease or disorder that can be treated by modulating the expression
of a
selected protein is treated by administering the compounds and compositions.
For
example, in one non-limiting embodiment, the methods comprise the step of
administering to the animal in need of treatment, a therapeutically effective
amount of a protein inhibitor. The protein inhibitors of the present invention
effectively inhibit the activity of the protein or inhibit the expression of
the
protein. In one embodiment, the activity or expression of a protein in an
animal is
inhibited by about 10%. Preferably, the activity or expression of a protein in
an
animal is inhibited by about 30%. More preferably, the activity or expression
of a
protein in an animal is inhibited by 50% or more.
[0185] For example, the reduction of the expression of a protein may be
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-64-
measured in serum, adipose tissue, liver or any other body fluid, tissue or
organ of
the animal. Preferably, the cells contained within the fluids, tissues or
organs
being analyzed contain a nucleic acid molecule encoding a protein and/or the
protein itself.
[0186] The compounds and compositions of the invention can be utilized
in pharmaceutical compositions by adding an effective amount of the compound
or composition to a suitable pharmaceutically acceptable diluent or carrier.
Use of
the oligomeric compounds and methods of the invention may also be useful
prophylactically.
Formulations
[0187] The compounds and compositions of the invention may also be
admixed, encapsulated, conjugated or otherwise associated with other
molecules,
molecule structures or mixtures of compounds, as for example, liposomes,
receptor-targeted molecules, oral, rectal, topical or other formulations, for
assisting in uptal~e, distribution and/or absorption. Representative United
States
patents that teach the preparation of such uptalce, distribution and/or
absorption-
assisting formulations include, but are not limited to, U.S.: 5,108,921;
5,354,844;
5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721;
4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221;
5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295;
5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756, each of
which is herein incorporated by reference.
[0188] The compounds and compositions of the invention encompass
any pharmaceutically acceptable salts, esters, or salts of such esters, or any
other
compound which, upon administration to an animal, including a human, is
capable
of providing (directly or indirectly) the biologically active metabolite or
residue
thereof. Accordingly, for example, the disclosure is also drawn to prodrugs
and
pharmaceutically acceptable salts of the oligomeric compounds of the
invention,
pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
[0189] The term "prodrug" indicates a therapeutic agent that is prepared
in an inactive form that is converted to an active form (i.e., drug) within
the body
or cells thereof by the action of endogenous enzymes or other chemicals and/or
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-65-
conditions. In particular, prodrug versions of the oligomers of the invention
are
prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives according to
the
methods disclosed in WO 93/24510 to Gosselin et al., published December 9,
1993 or in WO 94/26764 and U.S. 5,770,713 to Imbach et al.
[0190] The term "pharmaceutically acceptable salts" refers to
physiologically and pharmaceutically acceptable salts of the compounds and
compositions of the invention: i.e., salts that retain the desired biological
activity
of the parent compound and do not impart undesired toxicological effects
thereto.
For oligomers, preferred examples of pharmaceutically acceptable salts and
their
uses are further described in U.S. Patent 6,287,860, which is incorporated
herein
in its entirety.
[0191] The present invention also includes pharmaceutical compositions
and formulations that include the compounds and compositions of the invention.
The pharmaceutical compositions of the present invention may be administered
in
a number of ways depending upon whether local or systemic treatment is desired
and upon the area to be treated. Administration may be topical (including
ophthalmic and to mucous membranes including vaginal and rectal delivery),
pulmonary, e.g., by inhalation or insufflation of powders or aerosols,
including by
nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or
parenteral.
Parenteral administration includes intravenous, intraarterial, subcutaneous,
intraperitoneal or intramuscular injection or infusion; or intracranial, e.g.,
intrathecal or intraventricular, administration. Pharmaceutical compositions
and
formulations for topical administration may include transdermal patches,
ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and
powders.
Conventional pharmaceutical carriers, aqueous, powder or oily bases,
thickeners
and the like may be necessary or desirable. Coated condoms, gloves and the
like
may also be useful.
[0192] The pharmaceutical formulations of the present invention, which
may conveniently be presented in unit dosage form, may be prepared according
to
conventional techniques well known in the pharmaceutical industry. Such
techniques include the step of bringing into association the active
ingredients with
the pharmaceutical carriers) or excipient(s). In general, the formulations are
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-66-
prepared by uniformly and intimately bringing into association the active
ingredients with liquid carriers or finely divided solid carriers or both, and
then, if
necessary, shaping the product.
[0193] The compounds and compositions of the present invention may
be formulated into any of many possible dosage forms such as, but not limited
to,
tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and
enemas.
The compositions of the present invention may also be formulated as
suspensions
in aqueous, non-aqueous or mixed media. Aqueous suspensions may further
contain substances which increase the viscosity of the suspension including,
for
example, sodium carboxymethylcellulose, sorbitol and/or dextran. The
suspension may also contain stabilizers.
[0194] Pharmaceutical compositions of the present invention include, but
are not limited to, solutions, emulsions, foams and liposome-containing
formulations. The pharmaceutical compositions and formulations of the present
invention may comprise one or more penetration enhancers, carriers, excipients
or
other active or inactive ingredients.
[0195] Emulsions are typically heterogenous systems of one liquid
dispersed in another in the form of droplets usually exceeding 0.1 p,m in
diameter.
Emulsions may contain additional components in addition to the dispersed
phases,
and the active drug that may be present as a solution in either the aqueous
phase,
oily phase or itself as a separate phase. Microemulsions are included as an
embodiment of the present invention. Emulsions and their uses are well known
in
the art and are further described in U.S. Patent 6,287,860, which is
incorporated
herein in its entirety.
[0196] Formulations of the present invention include liposomal
formulations. As used in the present invention, the term "liposome" means a
vesicle composed of amphiphilic lipids arranged in a spherical bilayer or
bilayers.
Liposomes are unilamellar or multilamellar vesicles which have a membrane
formed from a lipophilic material and an aqueous interior that contains the
composition to be delivered. Cationic liposomes are positively charged
liposomes
which are believed to interact with negatively charged DNA molecules to form a
stable complex. Liposomes that are pH-sensitive or negatively-charged are
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-67-
believed to entrap DNA rather than complex with it. Both cationic and
noncationic liposomes have been used to deliver DNA to cells.
[0197] Liposomes also include "sterically stabilized" liposomes, a term
which, as used herein, refers to liposomes comprising one or more specialized
lipids that, when incorporated into liposomes, result in enhanced circulation
lifetimes relative to liposomes lacking such specialized lipids. Examples of
sterically stabilized liposomes are those in which part of the vesicle-forming
lipid
portion of the liposome comprises one or more glycolipids or is derivatized
with
one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety.
Liposomes and their uses are further described in U.S. Patent 6,287,860, which
is
incorporated herein in its entirety.
[0198] The pharmaceutical formulations and compositions of the present
invention may also include surfactants. The use of surfactants in drug
products,
formulations and in emulsions is well known in the art. Surfactants and their
uses
are further described in U.S. Patent 6,287,860, which is incorporated herein
in its
entirety.
[0199] In one embodiment, the present invention employs various
penetration enhancers to effect the efficient delivery of nucleic acids,
particularly
oligomers. In addition to aiding the diffusion of non-lipophilic drugs across
cell
membranes, penetration enhancers also enhance the permeability of lipophilic
drugs. Penetration enhancers may be classified as belonging to one of five
broad
categories, i. e., surfactants, fatty acids, bile 'salts, chelating agents,
and non-
chelating non-surfactants. Penetration enhancers and their uses are further
described in U.S. Patent 6,287,860, wluch is incorporated herein in its
entirety.
[0200] One of skill in the art will recognize that formulations are
routinely designed according to their intended use, i.e. route of
administration.
[0201] Preferred formulations for topical administration include those in
which the oligomers of the invention are in aclinixture with a topical
delivery
agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids,
chelating
agents and surfactants. Preferred lipids and liposomes include neutral (e.g.
dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline
DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-68-
glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and
dioleoylphosphatidyl ethanolamine DOTMA).
[0202] For topical or other administration, compounds and compositions
of the invention may be encapsulated within liposomes or may form complexes
thereto, in particular to catioiuc liposomes. Alternatively, they~may be
complexed
to lipids, in particular to cationic lipids. Preferred fatty acids and esters,
pharmaceutically acceptable salts thereof, and their uses axe further
described in
U.S. Patent 6,287,860, which is incorporated herein in its entirety. Topical
formulations are described in detail in United States patent application
09/315,298
filed on May 20, 1999, which is incorporated herein by reference in its
entirety.
[0203] Compositions and formulations for oral administration include
powders or granules, microparticulates, nanoparticulates, suspensions or
solutions
in water or non-aqueous media, capsules, gel capsules, sachets, tablets or
minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing
aids or
binders may be desirable. Preferred oral formulations are those in which
oligomers of the invention are administered in conjunction with one or more
penetration enhancers surfactants and chelators. Preferred surfactants include
fatty acids and/or esters or salts thereof, bile acids and/or salts thereof.
Preferred
bile acids/salts and fatty acids and their uses are further described in U.S.
Patent
6,287,860, which is incorporated herein in its entirety. Also preferred are
combinations of penetration enhancers, for example, fatty acids/salts in
combination with bile acids/salts. A particularly preferred combination is the
sodium salt of lauric acid, capric acid and UDCA. Further penetration
enhancers
include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether.
Compounds and compositions of the invention may be delivered orally, in
granular form including sprayed dried particles, or complexed to form micro or
nanoparticles. Complexing agents and their uses are further described in U.S.
Patent 6,287,860, which is incorporated herein in its entirety. Certain oral
formulations for oligomers and their preparation are described in detail in
United
States applications 09/108,673 (filed July 1, 1998), 09/315,298 (filed May 20,
1999) and 10/071,822, filed February 8, 2002, each of which is incorporated
herein by reference in their entirety.
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-69-
[0204] Compositions and formulations for parenteral, intrathecal or
intraventricular administration may include sterile aqueous solutions that may
also
contain buffers, diluents and other suitable additives such as, but not
limited to,
penetration enhancers, carrier compounds and other pharmaceutically acceptable
carriers or excipients.
[0205] Certain embodiments of the invention provide pharmaceutical
compositions containing one or more of the compounds and compositions of the
invention and one or more other chemotherapeutic agents that function by a non-
antisense mechanism. Examples of such chemotherapeutic agents include but are
not limited to cancer chemotherapeutic drugs such as daunorubicin, daunomycin,
dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin,
mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea,
busulfan, mitomycin C, actinomycin D, mithramycin, prednisone,
hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procaxbazine,
hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine,
chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan,
cyclophosphamide, 6-mercaptopurine, 6-th'ioguanine, cytarabine, 5-azacytidine,
hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclophosphoramide, 5-
fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX),
colchicine, taxol, vincristine, vinblastine, etoposide (Vl'-16), trimetrexate,
irinotecan, topotecan, gemcitabine, teniposide, cisplatin and
diethylstilbestrol
(DES). When used with the oligomeric compounds of the invention, such chemo-
therapeutic agents may be used individually (e.g., 5-FU and oligomer),
sequentially (e.g., 5-FU and oligomer for a period of time followed by MTX and
oligomer), or in combination with one or more other such chemotherapeutic
agents (e.g., 5-FU, MTX and oligomer, or 5-FU, radiotherapy and oligomer).
Anti-inflammatory drugs, including but not limited to nonsteroidal anti-
inflammatory drugs and corticosteroids, and antiviral drugs, including but not
limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be
combined
in compositions of the invention. Combinations of compounds and compositions
of the invention and other drugs are also within the scope of this invention.
Two
or more combined compounds such as two oligomeric compounds or one
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-70-
oligomeric compound combined with fiu they compounds may be used together or
sequentially.
[0206] In another related embodiment, compositions of the invention
may contain one or more of the compounds and compositions of the invention
targeted to a first nucleic acid and one or more additional compounds such as
antisense oligomeric compounds targeted to a second nucleic acid target.
Numerous examples of antisense oligomeric compounds are known in the art.
Alternatively, compositions of the invention may contain two or more
oligomeric
compounds and compositions targeted to different regions of the same nucleic
acid target. Two or more combined compounds may be used together or
sequentially
Dosing
[0207] The formulation of therapeutic compounds and compositions of
the invention and their subsequent administration (dosing) is believed to be
within
the shill of those in the art. Dosing is dependent on severity and
responsiveness of
the disease state to be treated, with the course of treatment lasting from
several
days to several months, or until a cure is effected or a diminution of the
disease
state is achieved. Optimal dosing schedules can be calculated from
measurements
of drug accumulation in the body of the patient. Persons of ordinary skill can
easily determine optimum dosages, dosing methodologies and repetition rates.
Optimum dosages may vary depending on the relative potency of individual
oligomers, and can generally be estimated based on ECsos found to be effective
in
ifZ vitro and in vivo animal models. In general, dosage is from 0.01 ug to 100
g
per kg of body weight, and may be given once or more daily, weekly, monthly or
yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art
can
easily estimate repetition rates for dosing based on measured residence times
and
concentrations of the drug in bodily fluids or tissues. Following successful
treatment, it may be desirable to have the patient undergo maintenance therapy
to
prevent the recurrence of the disease state, wherein the oligomer is
administered
in maintenance doses, ranging from 0.01 ug to 100 g per kg of body weight,
once
or more daily, to once every 20 years.
[0208] While the present invention has been described with specificity in
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-71-
accordance with certain of its preferred embodiments, the following examples
serve only to illustrate the invention and are not intended to limit the same.
[0209] The entire disclosure of each patent, patent application, and
publication cited or described in this document is hereby incorporated by
reference.
Example 1
Synthesis of Nucleoside Phosphoramidites
[0210] The following compounds, including amidites and their
intermediates were prepared as described in US Patent 6,426,220 and published
PCT WO 02/36743; 5'-O-Dimethoxytrityl-thymidine intermediate for 5-methyl
dC amidite, 5'-O-Dimethoxytrityl-2'-deoxy-5-methylcytidine intermediate for 5-
methyl-dC amidite, 5'-O-Dimethoxytrityl-2'-deoxy-N4-benzoyl-5-methylcytidine
penultimate intermediate for 5-methyl dC amidite, [5'-O-(4,4'-
Dimethoxytriphenylinethyl)-2'-deoxy-N4-benzoyl-5-methylcytidin-3'-Q-yl]-2-
cyanoethyl-N,N diisopropylphosphoramidite (5-methyl dC amidite), 2'-
Fluorodeoxyadenosine, 2'-Fluorodeoxyguanosine, 2'-Fluorouridine, 2'-
Fluorodeoxycytidine, 2'-O-(2-Methoxyethyl) modified amidites, 2'-O-(2-
methoxyethyl)-5-methyluridine intermediate, 5'-O-DMT-2'-O-(2-methoxyethyl)-
5-methyluridine penultimate intermediate, [5'-O-(4,4'-
Dimethoxytriphenylmethyl)-2'-~-(2-methoxyethyl)-5-methyluridin-3'-O-yl]-2-
cyanoethyl-N,N diisopropylphosphoramidite (MOE T amidite), 5'-O-
Dimethoxytrityl-2'-O-(2-methoxyethyl)-5-methylcytidine intermediate, 5'-O-
dimethoxytrityl-2'-O-(2-methoxyethyl)-N4-benzoyl-5-methyl-cytidine penultimate
intermediate, [5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-O-(2-methoxyethyl)-N4-
benzoyl-5-methylcytidin-3'-O-yl]-2-cyanoethyl-N,N diisopropylphosphoramidite
(MOE 5-Me-C amidite), [5'-O-(4,4'-Dimethoxytriphenylmethyl)-2'-O-(2-
methoxyethyl)-N~-benzoyladenosin-3'-O-yl]-2-cyanoethyl-N,N
diisopropylphosphoramidite (MOE A amdite), [5'-O-(4,4'-
Dimethoxytriphenylmethyl)-2'-O-(2-methoxyethyl)-N4-isobutyrylguanosin-3'-O-
yl]-2-cyanoethyl-N,N diisopropylphosphoramidite (MOE G amidite), 2'-O-
(Aminooxyethyl) nucleoside amidites and 2'-O-(dimethylaminooxyethyl)
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-72-
nucleoside amidites, 2'-(Dimethylaminooxyethoxy) nucleoside amidites, 5'-O-
tert-
Butyldiphenylsilyl-02-2'-anhydro-5-methyluridine , 5'-O-tent-
Butyldiphenylsilyl-
2'-O-(2-hydroxyethyl)-5-methyluridine, 2'-O-([2-phthalimidoxy)ethyl]-5'-t-
butyldiphenylsilyl-5-methyluridine , 5'-O-test-butyldiphenylsilyl-2'-O-[(2-
formadoximinooxy)ethyl]-5-methyluridine, 5'-O-tent-Butyldiphenylsilyl-2'-O-
[N,N dimethylaminooxyethyl]-5-methyluridine, 2'-O-(dimethylaminooxyethyl)-5-
methyluridine, 5'-O-DMT-2'-O-(dimethylaminooxyethyl)-5-methyluridine, 5'-O-
DMT-2'-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3'-[(2-cyanoethyl)-
N,N-diisopropylphosphoramidite], 2'-(Aminooxyethoxy) nucleoside amidites, N2-
isobutyryl-6-O-diphenylcaxbamoyl-2'-O-(2-ethylacetyl)-5'-O-(4,4'-
dimethoxytrityl)guanosine-3'-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite],
2'-dimethylaminoethoxyethoxy (2'-DMAEOE) nucleoside amidites, 2'-O-[2(2-
N,N-dimethylaminoethoxy)ethyl]-5-methyl uridine, 5'-O-dimethoxytrityl-2'-O-
[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl uridine and 5'-O-
Dimethoxytrityl-2'-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl uridine-
3'-O-(cyanoethyl-N,N-diisopropyl)phosphoramidite.
Example 2
Oligonucleotide and oligonucleoside synthesis
[0211] Oligonucleotides: Unsubstituted and substituted phosphodiester
(P=O) oligonucleotides are synthesized on an automated DNA synthesizer
(Applied Biosystems model 394) using standard phosphoramidite chemistry with
oxidation by iodine.
[0212] Phosphorothioates (P=S) are synthesized similar to phosphodiester
oligonucleotides with the following exceptions: thiation was effected by
utilizing
a 10% w/v solution of 3,H-1,2-benzodithiole-3-one 1,1-dioxide in acetonitrile
for
the oxidation of the phosphite linkages. The thiation reaction step time was
increased to 180 sec and preceded by the normal capping step. After cleavage
from the CPG column and deblocking in concentrated ammonium hydroxide at
55°C (12-16 hr), the oligonucleotides were recovered by precipitating
with >3
volumes of ethanol from a 1 M NH4OAc solution. Phosphinate oligonucleotides
are prepared as described in U.S. Patent 5,508,270, herein incorporated by
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-73-
reference.
[0213] Alkyl phosphonate oligonucleotides are prepared as described in
U.S. Patent 4,469,863, herein incorporated by reference.
[0214] 3'-Deoxy-3'-methylene phosphonate oligonucleotides are prepared
as described in U.S. Patents 5,610,289 or 5,625,050, herein incorporated by
reference.
[0215] Phosphoramidite oligonucleotides are prepared as described in U.S.
Patent, 5,256,775 or U.S. Patent 5,366,878, herein incorporated by reference.
[0216] Alkylphosphonothioate oligonucleotides are prepared as described
in published PCT applications PCT/LJS94/00902 and PCT/US93/06976 (published
as WO 94/17093 and WO 94/02499, respectively), herein incorporated by
reference.
[0217] 3'-Deoxy-3'-amino phosphoramidate oligonucleotides are prepared
as described in U.S. Patent 5,476,925, herein incorporated by reference.
[0218] Phosphotriester oligonucleotides are prepared as described in U.S.
Patent 5,023,243, herein incorporated by reference.
[0219] Borano phosphate oligonucleotides are prepaxed as described in
U.S. Patents 5,130,302 and 5,177,198, both herein incorporated by reference.
[0220] Oligonucleosides: Methylenemethylimino linked oligonucleosides,
also identified as MMI linked oligonucleosides, methylenedimethylhydrazo
linked
oligonucleosides, also identified as MDH linked oligonucleosides, and
methylenecarbonylamino linked oligonucleosides, also identified as amide-3
linlced oligonucleosides, and methyleneaminocarbonyl linked oligonucleosides,
also identified as amide-4 linked oligonucleosides, as well as mixed backbone
oligomeric compounds having, for instance, alternating MMI and P=O or P=S
linkages are prepared as described in U.S. Patents 5,378,825, 5,386,023,
5,489,677, 5,602,240 and 5,610,289, all of which are herein incorporated by
reference.
[0221] Formacetal and thioformacetal linked oligonucleosides are
prepared as described in U.S. Patents 5,264,562 and 5,264,564, herein
incorporated by reference.
[0222] Ethylene oxide linked oligonucleosides are prepared as described
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-74-
in U.S. Patent 5,223,618, herein incorporated by reference.
Example 3
RNA Synthesis
[0223] In general, RNA synthesis chemistry is based on the selective
incorporation of various protecting groups at strategic intermediary
reactions.
Although one of ordinary skill in the art will understand the use of
protecting
groups in organic synthesis, a useful class of protecting groups includes
silyl
ethers. In particular bulky silyl ethers are used to protect the 5'-hydroxyl
in
combination with an acid-labile orthoester protecting group on the 2'-
hydroxyl.
This set of protecting groups is then used with standard solid-phase synthesis
technology. It is important to lastly remove the acid labile orthoester
protecting
group after all other synthetic steps. Moreover, the early use of the silyl
protecting groups during synthesis ensures facile removal when desired,
without
undesired deprotection of 2 ° hydroxyl.
[0224] Following this procedure for the sequential protection of the 5'-
hydroxyl in combination with protection of the 2'-hydroxyl by protecting
groups
that are differentially removed and are differentially chemically labile, RNA
oligonucleotides were synthesized.
[0225] RNA oligonucleotides are synthesized in a stepwise fashion. Each
nucleotide is added sequentially (3'- to 5 °-direction) to a solid
support-bound
oligonucleotide. The first nucleoside at the 3'-end of the chain is covalently
attached to a solid support. The nucleotide precursor, a ribonucleoside
phosphoramidite, and activator are added, coupling the second base onto the 5'-
end of the first nucleoside. The support is washed and any unreacted 5'-
hydroxyl
groups are capped with acetic anhydride to yield 5 °-acetyl moieties.
The linkage is
then oxidized to the more stable and ultimately desired P(V) linkage. At the
end
of the nucleotide addition cycle, the 5'-silyl group is cleaved with fluoride.
The
cycle is repeated for each subsequent nucleotide.
[0226] Following synthesis, the methyl protecting groups on the
phosphates are cleaved in 30 minutes utilizing 1 M disodium-2-carbamoyl-2-
cyanoethylene-1,1-dithiolate trihydrate (SaNa2) in DMF. The deprotection
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-75-
solution is washed from the solid support-bound oligonucleotide using water.
The
support is then treated with 40% methylamine in water for 10 minutes at 55
°C.
This releases the RNA oligonucleotides into solution, deprotects the exocyclic
amines, and modifies the 2'- groups. The oligonucleotides can be analyzed by
anion exchange HPLC at this stage.
[0227] The 2'-orthoester groups are the last protecting groups to be
removed. The ethylene glycol monoacetate orthoester protecting group developed
by Dharmacon Research, Inc. (Lafayette, CO), is one example of a useful
orthoester protecting group which, has the following important properties. It
is
stable to the conditions of nucleoside phosphoramidite synthesis and
oligonucleotide synthesis. However, after oligonucleotide synthesis the
oligonucleotide is treated with methylamine which not only cleaves the
oligonucleotide from the solid support but also removes the acetyl groups from
the
orthoesters. The resulting 2-ethyl-hydroxyl substituents on the orthoester are
less
electron withdrawing than the acetylated precursor. As a result, the modified
orthoester becomes more labile to acid-catalyzed hydrolysis. Specifically, the
rate
of cleavage is approximately 10 times faster after the acetyl groups axe
removed.
Therefore, this orthoester possesses sufficient stability in order to be
compatible
with oligonucleotide synthesis and yet, when subsequently modified, permits
deprotection to be carried out under relatively mild aqueous conditions
compatible
with the final RNA oligonucleotide product.
[0228] Additionally, methods of RNA synthesis are well known in the art
(Scaringe, S. A. Ph.D. Thesis, University of Colorado, 1996; Scaringe, S. A.,
et
al., J. Am. Clzem. Soc.,1998,120, 11820-11821; Matteucci, M. D. and Caruthers,
M. H. J. Am. Chem. ,Soc., 1981,103, 3185-3191; Beaucage, S. L. and Caruthers,
M. H. Tet~ahed~on Lett., 1981, 22, 1859-1862; Dahl, B. J., et al., Acta Chem.
Scand,. 1990, 44, 639-641; Reddy, M. P., et al., Tet~ahedrom Lett.,1994, 25,
4311-4314; Wincott, F. et al., Nucleic Acids Res., 1995, 23, 2677-2684;
Griffin, B.
E., et al., Tetrahedron, 1967, 23, 2301-2313; Griffin, B. E., et al.,
TetYahedrorz,
1967, 23, 2315-2331).
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-76-
Example 4
Synthesis of Chimeric Oligonucleotides
[0229] Chimeric oligonucleotides, oligonucleosides or mixed
oligonucleotides/oligonucleosides of the invention can be of several different
types. These include a first type wherein the "gap" segment of linked
nucleosides
is positioned between 5' and 3' "wing" segments of linked nucleosides and a
second "open end" type wherein the "gap" segment is located at either the 3'
or the
5' terminus of the oligomeric compound. Oligonucleotides of the first type are
also known in the art as "gapmers" or gapped oligonucleotides.
Oligonucleotides
of the second type are also known in the art as "hemimers" or "wingmers".
[2'-O-Me]--[2'-deoxy]--[2'-O-Me] Chimeric Phosphorothioate
Oligonucleotides
[0230] Chimeric oligonucleotides having 2'-O-alkyl phosphorothioate and
2'-deoxy phosphorothioate oligonucleotide segments are synthesized using an
Applied Biosystems automated DNA synthesizer Model 394, as above.
Oligonucleotides are synthesized using the automated synthesizer and 2'-deoxy-
5'-dimethoxytrityl-3'-O-phosphoramidite for the DNA portion and 5'-dimethoxy-
trityl-2'-O-methyl-3'-O-phosphoramidite for 5' and 3' wings. The standard
synthesis cycle is modified by incorporating coupling steps with increased
reaction times for the 5'-dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite.
The
fully protected oligonucleotide is cleaved from the support and deprotected in
concentrated ammonia (NH4OH) for 12-16 hr at 55°C. The deprotected
oligo is
then recovered by an appropriate method (precipitation, column chromatography,
volume reduced in vacuo and analyzed spetrophotometrically for yield and for
purity by capillary electrophoresis and by mass spectrometry.
[2'-O-(2-Methoxyethyl)]--[2'-deoxy]--[2'-O-(Methoxyethyl)] Chimeric
Phosphorothioate Oligonucleotides
[0231] [2'-O-(2-methoxyethyl)]--[2'-deoxy]--[-2'-O-(methoxyethyl)]
chimeric phosphorothioate oligonucleotides were prepared as per the procedure
above for the 2'-O-methyl chimeric oligonucleotide, with the substitution of
2'-O-
(methoxyethyl) amidites for the 2'-O-methyl amidites.
[2'-O-(2-Methoxyethyl)Phosphodiester]--[2'-deoxy Phosphorothioate]-
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-77-
-[2' -O-(2-Methoxyethyl) Phosphodiester] Chimeric Oligonucleotides
[0232] [2'-O-(2-methoxyethyl phosphodiester]--[2'-deoxy
phosphorothioate]--[2'-O-(methoxyethyl) phosphodiester] chimeric oligonucleo-
tides are prepared as per the above procedure for the 2'-O-methyl chimeric
oligonucleotide with the substitution of 2'-O-(methoxyethyl) amidites for the
2'-
O-methyl amidites, oxidation with iodine to generate the phosphodiester
internucleotide linkages within the wing portions of the chimeric structures
and
sulfizrization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage
Reagent) to generate the phosphorothioate internucleotide linkages for the
center
gap.
[0233] Other chimeric oligonucleotides, chimeric oligonucleosides and
mixed chimeric oligonucleotidesloligonucleosides are synthesized according to
United States patent 5,623,065, herein incorporated by reference.
Example 5
Synthesis of 2'-Deoxy-2'-fluoro Modified Oligonucleotides
[0234] 2'-Deoxy-2'-fluoro modified oligonucleotides may be prepared by
methods taught in U.S. Patent No. 6,531,584.
Example 6
Synthesis of 2'-Deoxy-2'-O-alkyl Modified Oligonucleotides
[0235] 2'-Deoxy-2'-O-alkyl modified oligonucleotides may be prepared by
methods taught in U.S. Patent No. 6,531,584.
Example 7
Synthesis of 2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl Uridine
[0236] 2'-O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl uridine may
be prepared by methods taught in U.S. Patent No. 6,043,352.
Example 8
Synthesis of 5'-O-Dimethoxytrityl-2'-O-methyl-3'-O-(N,N-diisopropylamino-
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-78-
O-[3-cyano ethylphosphine)-N-benzoyladenosine
[0237] 5'-O-Dimethoxytrityl-2'-O-methyl-3'-O-(N,N-diisopropylamino-O-
beta.-cyano ethylphosphine)-N-benzoyladenosine may be prepared by methods
taught in U.S. Patent No. 6,005,094.
Example 9
Synthesis of 5'-O-Dimethoxytrityl-2'-O-Methylthiomethyl-Nucleotides
[0238] 5'-O-Dimethoxytrityl-2'-O-methylthiomethyl-nucleotides may be
prepared by methods taught in U.S. Patent No. 6,239,272.
Example 10
Synthesis of 2'-Deoxy-2'-(vinyloxy) Modified Oligonucleotides
[0239] 2'-Deoxy-2'-(vinyloxy) modified oligonucleotides may be prepared
by methods taught in U.S. Patent No. 5,859,221.
Example 11
Synthesis of 2'-Deoxy-2'-(methylthio), (methylsulfinyl) and (methylsulfonyl)
Modified Oligonucleotides
[0240] 2'-Deoxy-2'-(methylthio), (methylsulfinyl) and (methylsulfonyl)
modified oligonucleotides may be prepared by methods taught in U.S. Patent No.
5,859,221.
Example 12
Synthesis of Oligonucleotides Bearing 2'-OCHZCOOEt Substituents
[0241] 2'-OCHZCOOEt modified oligonucleotides may be prepared by
methods taught in U.S. Patent No. 5,792,847.
Example 13
Synthesis of 9-(2-(O-2-Propynyloxy)-[3-D-ribofuranosyl) Adenine
[0242] 9-(2-(O-2-Propynyloxy)-(3-D-ribofuranosyl) adenine may be
prepared by methods taught in U.S. Patent No. 5,514,786.
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-79-
Example 14
Synthesis of 3'-O-(N-Allyloxycarbonyl-6-aminohexyl)-5'-O-dimethoxytrityl-
uridine
[0243] 3'-O-(N-Allyloxycarbonyl-6-aminohexyl)-5'-O-dimethoxytrityl-
uridine may be prepared by methods taught in U.S. Patent No. 6,111,085.
Example 15
Synthesis of 2'-O-(N-phthalimido) prop-3-yl adenosine
[0244] 2'-O-(N-phthalimido) prop-3-yl adenosine may be prepared by
methods taught in U.S. Patent No. 5,872,232.
Example 16
Synthesis of 2'-O-(2-Phthalimido-N-hydroxyethyl)-3',5'-O-(1,1,3,3-
tetraisopropyldisiloxane-1,3-diyl)adenosine
[0245] 2'-O-(2-Phthalimido-N-hydroxyethyl)-3',5'-O-(1,1,3,3-
tetraisopropyldisiloxa ne-1,3-diyl)adenosine may be prepared by methods taught
in U.S. Patent No. 6,172,209.
Example 17
Synthesis of 5'-O-Dimethoxytrityl-2'-O-(carbonylaminohexyl
aminocarbonyloxy cholesteryl)-N4 -benzolyl chloride
[0246] 5'-O-Dimethoxytrityl-2'-O-(carbonylaminohexyl
aminocarbonyloxy cholesteryl)-N4 -benzolyl chloride may be prepared by
methods taught in U.S. Patent No. 6,166,188.
Example 18
Synthesis of 5'-O-[(2,2-dimethyl-1,1-diphenyl-1-silapropoxy)methyl]-2'-O-
((N,N-dimethyla minoethyleneamino)carbonylmethylene)adenosine
[0247] 5'-O-[(2,2-dimethyl-1,1-diphenyl-1-silapropoxy)methyl]-2'-O-
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-80-
((N,N-dimethyla minoethyleneamino)carbonylinethylene)adenosine may be
prepared by methods taught in U.S. Patent No. 6,147,200.
Example 19
Synthesis of 2'-O-(Propylsulfonic acid) Sodium Salt-N-3-(Benzyloxy) Methyl-
5-Methyluridine
[0248] 2'-O-(Propylsulfonic acid) sodium salt-N-3-(benzyloxy) methyl-5- '
methyluridine may be prepared by methods taught in U.S. Patent No. 6,277,982.
Example 20
O
Synthesis of 2~-O H20~Modified Oli onucleotides
g
[0249] These oligonucleotides may be prepared by methods taught in U.S.
Patent No. 5,969,116.
Example 21
Synthesis of 5'-Dimethoxytrityl-2'-O-(traps-2-methoxycyclohexyl)-5-methyl
Uridine
[0250] 5'-Dimethoxytrityl-2'-O-(traps-2-methoxycyclohexyl)-5-methyl
uridine may be prepared by methods taught in U.S. Patent No. 6,277,982.
Example 22
Synthesis of 2'-OH, 2'-Me Modified Compounds
NH2
\N ~ N
HO O N N
Me
HO ~OH
[0251] The above compound was prepared following the methods
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-81-
described in J.lIIed. Chem. 41: 1708 (1998).
Example 23
4-Amino-7-(2-C methyl-(i-D-arabinofuranosyl)-7H pyrrolo[2,3-rl]pyrimidine
NH2
/ ~N
HO O N~N
OH
.:
HO Me
[0252] To Cr03 (1.57 g, 1.57 mmol) in dichloromethane (DCM) (10 mL)
at 0°C was added acetic anhydride (145 mg; 1.41 mmol) and then pyridine
(245
mg, 3.10 mmol). The mixture was stirred for 15 min, then a solution of 7-[3,5-
0-
[ 1,1,3,3-tetrakis(1-methylethyl)-1,3-disiloxanediyl]-(3-D-ribofuranosyl]-7H
pyrrolo[2,3-d]pyrimidin-4-amine [for preparation, see J. Am. Chem. Soc. 105:
4059 (1983)] (508 mg, 1.00 mmol) in DCM (3 mL) was added. The resulting
solution was stirred for 2h and then poured into ethyl acetate (10 mL), and
subsequently filtered through silica gel using ethyl acetate as the eluent.
The
combined filtrates were evaporated in vacuo, taken up in diethyl ether/THF (l
:l)
(20 mL), cooled to -78°C and methylmagnesium bromide (3M, in THF) (3.30
mL,
mmol) was added dropwise. The mixture was stirred at -78°C for 10 min,
then
allowed to come to room temperature (rt) and quenched by addition of saturated
aqueous ammonium chloride (10 mL) and extracted with DCM (20 mL). The
organic phase was evaporated in vacuo and the crude product purified on silica
gel
using 5% methanol in dichloromethane as eluent. Fractions containing the
product were pooled and evaporated in vacuo. The resulting oil was taken up in
THF (5 mL) and tetrabutylammonium fluoride (TBAF) on silica (l.l mmol/g on
silica) (156 mg) was added. The mixture was stirred at rt for 30 min,
filtered, and
evaporated ita vacuo. The crude product was purified on silica gel using 10%
methanol in dichloromethane as eluent. Fractions containing the product were
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-82-
pooled and evaporated ih vacuo to give the desired compound (49 mg) as a
colorless solid.
[0253] 1H NMR (DMSO-d6): S 1.08 (s, 3H), 3.67 (m, 2H), 3.74 (m, 1H),
3.83 (m, 1H), 5.19 (m, 1H), 5.23 (m, 1H), 5.48 (m, 1H), 6.08 (1H, s), 6.50 (m,
1H), 6.93 (bs, 2H), 7.33 (m, 1H), 8.02 (s, 1H).
Example 24
Design and screening of duplexed oligomeric compounds targeting a target
[0254] In accordance with the present invention, a series of nucleic acid
duplexes comprising the antisense oligomeric compounds of the present
invention
and their complements can be designed to target a target. The ends of the
strands
may be modified by the addition of one or more natural or modified nucleobases
to form an overhang. The sense strand of the dsRNA is then designed and
synthesized as the complement of the antisense strand and may also contain
modifications or additions to either terminus. For example, in one embodiment,
both strands of the dsRNA duplex would be complementary over the central
nucleobases, each having overhangs at one or both termini.
[0255] For example, a duplex comprising an antisense strand having the
sequence CGAGAGGCGGACGGGACCG (SEQ ID NO:1) and having a two-
nucleobase overhang of deoxythymidine(dT) would have the following structure:
5' cgagaggcggacgggaccgTT 3' AntisenseStrand(SEQIDN0:2)
3' TTgctctc cg cct gccctggc 5' Complement Strand(SEQIDN0:3)
[0256] RNA strands of the duplex can be synthesized by methods
disclosed herein or purchased from Dhannacon Research Inc., (Lafayette, CO).
Once synthesized, the complementary strands are annealed. The single strands
are
aliquoted and diluted to a concentration of 50 uM. Once diluted, 30 uL of each
strand is combined with lSuL of a SX solution of annealing buffer. The final
concentration of said buffer is 100 mM potassium acetate, 30 mM HEPES-KOH
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-83-
pH 7.4, and 2mM magnesium acetate. The final volume is 75 uL. This solution is
incubated for 1 minute at 90°C and then centrifuged for 15 seconds. The
tube is
allowed to sit for 1 hour at 37°C at which time the dsRNA duplexes axe
used in
experimentation. The final concentration of the dsRNA duplex is 20 uM. This
solution can be stored frozen (-20°C) and freeze-thawed up to 5 times.
[0257] Once prepared, the duplexed antisense oligomeric compounds are
evaluated for their ability to modulate a taxget expression.
[0258] When cells reached 80% confluency, they are treated with
duplexed antisense oligomeric compounds of the invention. For cells grown in
96-well plates, wells axe washed once with 200 p,L OPTI-MEM-1 reduced-serum
medium (Gibco BRL) and then treated with 130 ~,L of OPTI-MEM-1 containing
12 ~,g/mL LIPOFECTIN (Gibco BRL) and the desired duplex antisense
oligomeric compound at a final concentration of 200 nM. After 5 hours of
treatment, the medium is replaced with fresh medium. Cells are harvested 16
hours after treatment, at which time RNA is isolated and target reduction
measured by RT-PCR.
Example 25
Oligonucleotide Isolation
[0259] After cleavage from the controlled pore glass solid support and
deblocking in concentrated ammonium hydroxide at 55°C for 12-16 hours,
the
oligonucleotides or oligonucleosides are recovered by precipitation out of 1 M
NH40Ac with >3 volumes of ethanol. Synthesized oligonucleotides were
analyzed by electrospray mass spectroscopy (molecular weight determination)
and
by capillary gel electrophoresis and judged to be at least 70% full length
material.
The relative amounts of phosphorothioate and phosphodiester linl~ages obtained
in
the synthesis was determined by the ratio of correct molecular weight relative
to
the -16 amu product (+/-32 +/-48). For some studies oligonucleotides were
purified by HPLC, as described by Chiang et al., J. Biol. Chem. 1991, 266,
18162-
18171. Results obtained with HPLC-purified material were similar to those
obtained with non-HPLC purified material.
Example 26
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-84-
Oligonucleotide Synthesis - 96 Well Plate Format
[0260] Oligonucleotides were synthesized via solid phase P(III)
phosphoramidite chemistry on an automated synthesizer capable of assembling 96
sequences simultaneously in a 96-well format. Phosphodiester internucleotide
linkages were afforded by oxidation with aqueous iodine. Phosphorothioate
internucleotide linkages were generated by sulfurization utilizing 3,H-1,2
benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile.
Standard base-protected beta-cyanoethyl-diiso-propyl phosphoramidites were
purchased from commercial vendors (e.g. PE-Applied Biosystems, Foster City,
CA, or Phannacia, Piscataway, NJ). Non-standard nucleosides are synthesized as
per standard or patented methods. They axe utilized as base protected beta-
cyanoethyldiisopropyl phosphoramidites.
[0261] Oligonucleotides were cleaved from support and deprotected with
concentrated NH40H at elevated temperature (55-60°C) for 12-16 hours
and the
released product then dried iyz vacuo. The dried product was then re-suspended
in
sterile water to afford a master plate from which all analytical and test
plate
samples are then diluted utilizing robotic pipettors.
Example 27
Oligonucleotide Analysis - 96-Well Plate Format
[0262] The concentration of oligonucleotide in each well was assessed by
dilution of samples and LTV absorption spectroscopy. The full-length integrity
of
the individual products was evaluated by capillary electrophoresis (CE) in
either
the 96-well format (Beckman P/ACETM MDQ) or, for individually prepared
samples, on a commercial CE apparatus (e.g., Beckman P/ACETM 5000, ABI 270).
Base and backbone composition was confirmed by mass analysis of the
oligomeric compounds utilizing electrospray-mass spectroscopy. All assay test
plates were diluted from the master plate using single and mufti-channel
robotic
pipettors. Plates were judged to be acceptable if at least 85% of the
oligomeric
compounds on the plate were at least 85% full length.
Example 28
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-85-
Cell culture and oligonucleotide treatment
[0263] The effect of oligomeric compounds on target nucleic acid
expression can be tested in any of a variety ~of cell types provided that the
target
nucleic acid is present at measurable levels. This can be routinely determined
using, for example, PCR or Northern blot analysis. The following cell types
are
provided for illustrative purposes, but other cell types can be routinely
used,
provided that the target is expressed in the cell type chosen. This can be
readily
determined by methods routine in the art, for example Northern blot analysis,
ribonuclease protection assays, or RT-PCR.
T-24 cells:
[0264] The human transitional cell bladder carcinoma cell line T-24 was
obtained from the American Type Culture Collection (ATCC) (Manassas, VA).
T-24 cells were routinely cultured in complete McCoy's SA basal media
(Invitrogen Corporation, Carlsbad, CA) supplemented with 10% fetal calf serum
(Invitrogen Corporation, Carlsbad, CA), penicillin 100 units per mL, and
streptomycin 100 micrograms per mL (Invitrogen Corporation, Carlsbad, CA).
Cells were routinely passaged by trypsinization and dilution when they reached
90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria
#353872) at a density of 7000 cells/well for use in RT-PCR analysis.
[0265] For Northern blotting or other analysis, cells may be seeded onto
100 mm or other standard tissue culture plates and treated similarly, using
appropriate volumes of medium and oligonucleotide.
A549 cells:
[0266] The human lung carcinoma cell line A549 was obtained from the
American Type Culture Collection (ATCC) (Manassas, VA). A549 cells were
routinely cultured in DMEM basal media (Invitrogen Corporation, Carlsbad, CA)
supplemented with 10% fetal calf serum (Invitrogen Corporation, Carlsbad, CA),
penicillin 100 units per mL, and streptomycin 100 micrograms per mL
(Invitrogen
Corporation, Carlsbad, CA). Cells were routinely passaged by trypsinization
and
dilution when they reached 90% confluence.
NHDF cells:
[0267] Human neonatal dermal fibroblast (NHDF) were obtained from the
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-86-
Clonetics Corporation (Walkersville, MD). NHDFs were routinely maintained in
Fibroblast Growth Medium (Clonetics Corporation, Walkersville, MD)
supplemented as recommended by the supplier. Cells were maintained for up to
passages as recommended by the supplier.
HEK cells:
[0268] Human embryonic keratinocytes (HEK) were obtained from the
Clonetics Corporation (Walkersville, MD). HEKs were routinely maintained in
Keratinocyte Growth Medium (Clonetics Corporation, Walkersville, MD)
formulated as recommended by the supplier. Cells were routinely maintained for
up to 10 passages as recommended by the supplier.
Treatment with antisense oligomeric compounds:
[ 02 69 ~ When cells reached 65-75% confluency, they were treated
with oligonucleotide. For cells grown in 96-well plates, wells were washed
once
with 100 ~,L OPTI-MEMTM-1 reduced-serum medium (Invitrogen Corporation,
Carlsbad, CA) and then treated with 130 p.L of OPTI-MEMTM-1 containing 3.75
~.g/mL LIPOFECTINTM (Invitrogen Corporation, Carlsbad, CA) and the desired
concentration of oligonucleotide. Cells are treated and data are obtained in
triplicate. After 4-7 hours of treatment at 37°C, the medium was
replaced with
fresh medium. Cells were harvested 16-24 hours after oligonucleotide
treatment.
[0270] The concentration of oligonucleotide used varies from cell line to
cell line. To determine the optimal oligonucleotide concentration for a
particular
cell line, the cells are treated with a positive control oligonucleotide at a
range of
concentrations. For human cells the positive control oligonucleotide is
selected
from either ISIS 13920 (TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 1)
which is targeted to human H-ras, or ISIS 18078,
(GTGCGCGCGAGCCCGAAATC, SEQ ID NO: 2) which is targeted to human
Jun-N-terminal kinase-2 (JNK2). Both controls are 2'-O-methoxyethyl gapmers
(2'-O-methoxyethyls shown in bold) with a phosphorothioate backbone. For
mouse or rat cells the positive control oligonucleotide is ISIS 15770,
ATGCATTCTGCCCCCAAGGA, SEQ ID NO: 3, a 2'-O-methoxyethyl gapmer
(2'-O-methoxyethyls shown in bold) with a phosphorothioate backbone which is
targeted to both mouse and rat c-raf. The concentration of positive control
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
87
oligonucleotide that results in 80% inhibition of c-H-ras (for ISIS 13920),
JNK2
(for ISIS 18078) or c-raf (for ISIS 15770) mRNA is then utilized as the
screening
concentration for new oligonucleotides in subsequent experiments for that cell
line. If 80% inhibition is not achieved, the lowest concentration of positive
control oligonucleotide that results in 60% inhibition of c-H-ras, JNK2 or c-
raf
mRNA is then utilized as the oligonucleotide screening concentration in
subsequent experiments for that cell line. Tf 60% inhibition is not achieved,
that
particular cell line is deemed as unsuitable for oligonucleotide transfection
experiments. The concentrations of antisense oligonucleotides used herein are
from 50 nM to 300 nM.
Example 29
Analysis of oligonucleotide inhibition of a target expression
[0271] Modulation of a target expression can be assayed in a variety of
ways known in the art. For example, a target mRNA levels can be quantitated
by,
e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or
real-
time PCR (RT-PCR). Real-time quantitative PCR is presently preferred. RNA
analysis can be performed on total cellular RNA or poly(A)+ mRNA. The
preferred method of RNA analysis of the present invention is the use of total
cellular RNA as described in other examples herein. Methods of RNA isolation
are well known in the art. Northern blot analysis is also routine in the art.
Real-
time quantitative (PCR) can be conveniently accomplished using the
commercially available ABI PRISMTM 7600, 7700, or 7900 Sequence Detection
System, available from PE-Applied Biosystems, Foster City, CA and used
according to manufacturer's instructions.
[0272] Protein levels of a target can be quantitated in a variety of ways
well lrnown in the art, such as inununoprecipitation, Western blot analysis
(immunoblotting), enzyme-linked immunosorbent assay (ELISA) or fluorescence-
activated cell sorting (FACS). Antibodies directed to a target can be
identified
and obtained from a variety of sources, such as the MSRS catalog of antibodies
(Aerie Corporation, Birmingham, MI), or can be prepared via conventional
monoclonal or polyclonal antibody generation methods well known in the art.
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
_88_
Example 30
Design of phenotypic assays and ifZ vivo studies for the use of a target
inhibitors
Phenotypic assays
[0273] Once a target inhibitors have been identified by the methods
disclosed herein, the oligomeric compounds are further investigated in one or
more phenotypic assays, each having measurable endpoints predictive of
efficacy
in the treatment of a particular disease state or condition.
[0274] Phenotypic assays, kits and reagents for their use are well known to
those skilled in the art and are herein used to investigate the role and/or
association of a target in health and disease. Representative phenotypic
assays,
which can be purchased from any one of several commercial vendors, include
those for determining cell viability, cytotoxicity, proliferation or cell
survival
(Molecular Probes, Eugene, OR; PerkinElmer, Boston, MA), protein-based assays
including enzymatic assays (Panvera, LLC, Madison, WI; BD Biosciences,
Franklin Lakes, NJ; Oncogene Research Products, San Diego, CA), cell
regulation, signal transduction, inflammation, oxidative processes and
apoptosis
(Assay Designs Inc., Ann Arbor, MI), triglyceride accumulation (Sigma-Aldrich,
St. Louis, MO), angiogenesis assays, tube formation assays, cytokine and
hormone assays and metabolic assays (Chemicon International Inc., Temecula,
CA; Amersham Biosciences, Piscataway, NJ).
[0275] In one non-limiting example, cells determined to be appropriate for
a particular phenotypic assay (i.e., MCF-7 cells selected for breast cancer
studies;
adipocytes for obesity studies) are treated with a target inhibitors
identified from
the ifx vitro studies as well as control compounds at optimal concentrations
which
are determined by the methods described above. At the end of the treatment
period, treated and untreated cells are analyzed by one or more methods
specific
for the assay to determine phenotypic outcomes and endpoints.
Phenotypic endpoints include changes in cell morphology over time or treatment
dose as well as changes in levels of cellular components such as proteins,
lipids,
nucleic acids, hormones, saccharides or metals. Measurements of cellular
status
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-89-
which include pH, stage of the cell cycle, intake or excretion of biological
indicators by the cell, are also endpoints of interest.
[0276] Analysis of the geneotype of the cell (measurement of the
expression of one or more of the genes of the cell) after treatment is also
used as
an indicator of the efficacy or potency of the target inhibitors. Hallmark
genes, or
those genes suspected to be associated with a specific disease state,
condition, or
phenotype, are measured in both treated and untreated cells.
Ih vivo studies
[0277] The individual subjects of the iyZ vivo studies described herein are
warm-blooded vertebrate animals, which includes humans.
The clinical trial is subjected to rigorous controls to ensure that
individuals are not
unnecessarily put at risk and that they are fully informed about their role in
the
study.
[0278] To account for the psychological effects of receiving treatments, '
volunteers are randomly given placebo or a target inhibitor. Furthermore, to
prevent the doctors from being biased in treatments, they are not informed as
to
whether the medication they are administering is a a target inhibitor or a
placebo.
Using this randomization approach, each volunteer has the same chance of being
given either the new treatment or the placebo.
[0279] Volunteers receive either the a target inhibitor or placebo for eight
week period with biological parameters associated with the indicated disease
state
or condition being measured at the beginning (baseline measurements before any
treatment), end (after the final treatment), and at regular intervals during
the study
period. Such measurements include the levels of nucleic acid molecules
encoding
a target or a target protein levels in body fluids, tissues or organs compared
to pre-
treatment levels. Qther measurements include, but are not limited to, indices
of
the disease state or condition being treated, body weight, blood pressure,
serum
titers of phannacologic indicators of disease or toxicity as well as ADME
(absorption, distribution, metabolism and excretion) measurements.
Information recorded for each patient includes age (years), gender, height
(cm),
family history of disease state or condition (yes/no), motivation rating
(some/moderate/great) and number and type of previous treatment regimens for
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-90-
the indicated disease or condition.
[0280] Volunteers taking part in this study are healthy adults (age 18 to 65
years) and roughly an equal number of males and females participate in the
study.
Volunteers with certain characteristics are equally distributed for placebo
and a
target inhibitor treatment. In general, the volunteers treated with placebo
have
little or no response to treatment, whereas the volunteers treated with the
target
inhibitor show positive trends in their disease state or condition index at
the
conclusion of the study.
Example 31
RNA Isolation
Poly(A)+ mRNA isolation
[0281] Poly(A)+ mRNA was isolated according to Miura et al., (Clip.
Chem., 1996, 42, 1758-1764). Other methods for poly(A)+ mRNA isolation are
routine in the art. Briefly, for cells grown on 96-well plates, growth medium
was
removed from the cells and each well was washed with 200 ~,L cold PBS. 60 ~,L
lysis buffer (10 mM Tris-HCI, pH 7.6, 1 mM EDTA, 0.5 M NaCI, 0.5% NP-40,
20 mM vanadyl-ribonucleoside complex) was added to each well, the plate was
gently agitated and then incubated at room temperature for five minutes. 55 ~L
of
lysate was transferred to Oligo d(T) coated 96-well plates (ACCT Inc., Irvine
CA). Plates were incubated for 60 minutes at room temperature, washed 3 times
with 200 ~,L of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCI).
After the final wash, the plate was blotted on paper towels to remove excess
wash
buffer and then air-dried for 5 minutes. 60 ~.L of elution buffer (5 mM Tris-
HCl
pH 7.6), preheated to 70°C, was added to each well, the plate was
incubated on a
90°C hot plate for 5 minutes, and the eluate was then transferred to a
fresh 96-well
plate.
[0282] Cells grown on 100 mm or other standard plates may be treated
similarly, using appropriate volumes of all solutions.
Total RNA Isolation
[0283] Total RNA was isolated using an RNEASY 96TM lit and buffers
purchased from Qiagen Inc. (Valencia, CA) following the manufacturer's
recommended
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-91-
procedures. Briefly, for cells grown on 96-well plates, growth medium was
removed
from the cells and each well was washed with 200 ~.L cold PBS. 150 ~,L Buffer
RLT was
added to each well and the plate vigorously agitated for 20 seconds. 150 ~.L
of 70%
ethanol was then added to each well and the contents mixed by pipetting three
times up
and down. The samples were then transferred to the RNEASY 96TM well plate
attached
to a QIAVACTM manifold fitted with a waste collection tray and attached to a
vacuum
source. Vacuum was applied for 1 minute. 500 p,L of Buffer RWl was added to
each
well of the RNEASY 96TM plate and incubated for 15 minutes and the vacuum was
again
applied for 1 minute. An additional 500 p.L of Buffer RWl was added to each
well of the
RNEASY 96TM plate and the vacuum was applied for 2 minutes. 1 mL of Buffer RPE
was
then added to each well of the RNEASY 96TM plate and the vacuum applied for a
period
of 90 seconds. The Buffer RPE wash was then repeated and the vacuum was
applied for
an additional 3 minutes. The plate was then removed from the QIAVACTM manifold
and
blotted dry on paper towels. The plate was then re-attached to the QIAVACTM
manifold
fitted with a collection tube rack containing 1.2 mL collection tubes. RNA was
then
eluted by pipetting 140 ~,L of RNAse free water into each well, incubating 1
minute, and
then applying the vacuum for 3 minutes.
[0284] The repetitive pipetting and elution steps may be automated using a
QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia CA). Essentially, after lysing
of the cells on the culture plate, the plate is transferred to the robot deck
where the
pipetting, DNase treatment and elution steps are carried out.
Example 32
Real-time Quantitative PCR Analysis of a target mRNA Levels
[0285] Quantitation of a target mRNA levels was accomplished by real-
time quantitative PCR using the ABI PRISMTM 7600, 7700, or 7900 Sequence
Detection System (PE-Applied Biosystems, Foster City, CA) according to
manufacturer's instructions. This is a closed-tube, non-gel-based,
fluorescence
detection system which allows high-throughput quantitation of polymerase chain
reaction (PCR) products in real-time. As opposed to standard PCR in which
amplification products are quantitated after the PCR is completed, products in
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-92-
real-time quantitative PCR are quantitated as they accmnulate. This is
accomplished by including in the PCR reaction an oligonucleotide probe that
amleals specifically between the forward and reverse PCR primers, and contains
two fluorescent dyes. A reporter dye (e.g., FAM or JOE, obtained from either
PE-
Applied Biosystems, Foster City, CA, Operon Technologies Inc., Alameda, CA or
Integrated DNA Technologies Inc., Coralville, IA) is attached to the 5' end of
the
probe and a quencher dye (e.g., TAMR.A, obtained from either PE-Applied
Biosystems, Foster City, CA, Operon Technologies Inc., Alameda, CA or
Integrated DNA Technologies Inc., Coralville, IA) is attached to the 3' end of
the
probe. When the probe and dyes are intact, reporter dye emission is quenched
by
the proximity of the 3' quencher dye. During amplification, annealing of the
probe to the target sequence creates a substrate that can be cleaved by the 5'-
exonuclease activity of Taq polymerase. During the extension phase of the PCR
amplification cycle, cleavage of the probe by Taq polymerase releases the
reporter
dye from the remainder of the probe (and hence from the quencher moiety) and a
sequence-specific fluorescent signal is generated. With each cycle, additional
reporter dye molecules are cleaved from their respective probes, and the
fluorescence intensity is monitored at regular intervals by laser optics built
into
the ABI PRISMTM Sequence Detection System. In each assay, a series of parallel
reactions containing serial dilutions of mRNA from untreated control samples
generates a standard curve that is used to quantitate the percent inhibition
after
antisense oligonucleotide treatment of test samples.
[0286] Prior to quantitative PCR analysis, primer-probe sets specific to the
target gene being measured are evaluated for their ability to be "multiplexed"
with
a GAPDH amplification reaction. In multiplexing, both the target gene and the
internal standard gene GAPDH are amplified concurrently in a single sample. In
this analysis, mRNA isolated from untreated cells is serially diluted. Each
dilution is amplified in the presence of primer-probe sets specific for GAPDH
only, target gene only ("single-plexing"), or both (multiplexing). Following
PCR
amplification, standard curves of GAPDH and target mRNA signal as a function
of dilution are generated from both the single-plexed and multiplexed samples.
If
both the slope and correlation coefficient of the GAPDH and target signals
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-93-
generated from the multiplexed samples fall within 10% of their corresponding
values generated from the single-plexed samples, the primer-probe set specific
for
that target is deemed multiplexable. Other methods of PCR are also known in
the
art.
[0287] PCR reagents were obtained from Invitrogen Corporation,
(Carlsbad, CA). RT-PCR reactions were carried out by adding 20 ~,L PCR
cocktail (2.5x PCR buffer minus MgCl2, 6.6 mM MgCl2, 375 ~.M each of dATP,
dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125
nM of probe, 4 Units RNAse inhibitor, 1.25 Units PLATINCTM~ Taq, 5 Units
MuLV reverse transcriptase, and 2.5x ROX dye) to 96-well plates containing 30
p,L total RNA solution (20-200 ng). The RT reaction was carried out by
incubation for 30 minutes at 48°C. Following a 10 minute incubation at
95°C to
activate the PLATINUM~ Taq, 40 cycles of a two-step PCR protocol were
carried out: 95°C for 15 seconds (denaturation) followed by 60°C
for 1.5 minutes
(annealing/extension).
[0288] Gene target quantities obtained by real time RT-PCR are
normalized using either the expression level of GAPDH, a gene whose expression
is constant, or by quantifying total RNA using RiboGreenTM (Molecular Probes,
Inc. Eugene, OR). GAPDH expression is quantified by real time RT-PCR, by
being run simultaneously with the target, multiplexing, or separately. Total
RNA
is quantified using RiboGreenTM RNA quantification reagent (Molecular Probes,
Inc. Eugene, OR). Methods of RNA quantification by RiboGreenTM are taught in
Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374).
[0289] In this assay, 170 p,L of RiboCIreenTM working reagent
(RiboGreenTM reagent diluted 1:350 in lOmM Tris-HCI, 1 mM EDTA, pH 7.5) is
pipetted into a 96-well plate containing 30 ~,L purified, cellular RNA. The
plate is
read in a CytoFluor 4000 (PE Applied Biosystems) with excitation at 485nm and
emission at 530nm.
[0290] Probes and primers are designed to hybridize to a human a target
sequence, using published sequence information.
Example 33
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-94-
Northern blot analysis of a target mRNA levels
[0291] Eighteen hours after treatment, cell monolayers were washed twice
with cold PBS and lysed in 1 mL RNAZOLTM (TEL-TEST "B" Inc., Friendswood,
TX). Total RNA was prepared following manufacturer's recommended protocols.
Twenty micrograms of total RNA was fractionated by electrophoresis through
1.2% agarose gels containing 1.1% formaldehyde using a MOPS buffer system
(AMRESCO, Inc. Solon, OH). RNA was transferred from the gel to
HYBONDTM-N+ nylon membranes (Amersham Pharmacia Biotech, Piscataway,
NJ) by overnight capillary transfer using a Northern/Southern Transfer buffer
system (TEL-TEST "B" Inc., Friendswood, TX). RNA transfer was confirmed by
UV visualization. Membranes were fixed by UV cross-linking using a
STR.ATALINKERTM UV Crosslinker 2400.(Stratagene, Inc, La Jolla, CA) and
then probed using QUICKI3YBTM hybridization solution (Stratagene, La Jolla,
CA) using manufacturer's recommendations for stringent conditions.
[0292] To detect human a target, a human a target specific primer probe
set is prepared by PCR To normalize for variations in loading and transfer
efficiency membranes are stripped and probed for human glyceraldehyde-3-
phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, CA).
[0293] Hybridized membranes were visualized and quantitated using a
PHOSPHORIMAGERTM and IMAGEQUANTTM Software V3.3 (Molecular
Dynamics, Sunnyvale, CA). Data was normalized to GAPDH levels in untreated
controls.
Example 34
Inhibition of human a target expression by oligonucleotides
[0294] In accordance with the present invention, a series of oligomeric
compounds are designed to target different regions of the human target RNA.
The
oligomeric compounds are analyzed for their effect on human target mRNA levels
by quantitative real-time PCR as described in other examples herein. Data are
averages from three experiments. The target regions to which these preferred
sequences are complementary are herein referred to as "preferred target
segments"
and are therefore preferred for targeting by oligomeric compounds of the
present
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-95-
invention. The sequences represent the reverse complement of the preferred
antisense oligomeric compounds.
[0295]As these "preferred target segments" have been found by
experimentation to be open to, and accessible for, hybridization with the
antisense
oligomeric compounds of the present invention, one of skill in the art will
recognize or be able to ascertain, using no more than routine experimentation,
further embodiments of the invention that encompass other oligomeric compounds
that specifically hybridize to these preferred target segments and
consequently
inhibit the expression of a target.
[0296] According to the present invention, antisense oligomeric
compounds include antisense oligomeric compounds, antisense oligonucleotides,
ribozymes, external guide sequence (EGS) oligonucleotides, alternate splicers,
primers, probes, and other short oligomeric compounds that hybridize to at
least a
portion of the target nucleic acid.
Example 35
Western blot analysis of a target protein levels
[0297] Western blot analysis (immunoblot analysis) is carried out using
standard methods. Cells are harvested 16-20 h after oligonucleotide treatment,
washed once with PBS, suspended in Laemmli buffer (100 ul/well), boiled for 5
minutes and loaded on a 16% SDS-PAGE gel. Gels are run for 1.5 hours at 150
V, and transferred to membrane for western blotting. Appropriate primary
antibody directed to a target is used, with a radiolabeled or fluorescently
labeled
secondary antibody directed against the primary antibody species. Bands are
visualized using a PHOSPHORIMAGERTM (Molecular Dynamics, Sunnyvale
CA).
Example 36
Blockmer walk of 5 2'-O-methy modified. nucleosides in the antisense strand
of siRNA's assayed for PTEN mRNA levels against untreated control
[0298] The antisense (AS) strands listed below having SEQ m NO: 8
were individually duplexed with the sense (S) strand having SEQ ID NO: 7 and
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-96-
the activity was measured to determine the relative positional effect of the 5
modifications.
SEQ ID NO:/ISIS Seguence
NO
7/271790 (S) 5'-CAAAUCCAGAGGCUAGCAG-dTdT-3'
8/271071 (AS) 3'-dTdT-GUUUAGGUCUCCGAUCGUC-5'
8/271072(AS) 3'-dTdT-GUUUAGGUCUCCGAUGGUC-5'
8/271073 (AS) 3'-dTdT-GUUUAGGUCUCCGAUCGUC-5'
8/271074(AS) 3'-dTdT-GUUUAGGUCUCCGAUCGUC-5'
8/271075 (AS) 3'-dTdT-GUUUAGGUCUCCGAUCGUC-5'
[0299] Underlined nucleosides are 2'-O-methyl modified nucleosides,
dT's are deoxy thymidines, all other nucleosides are ribonucleosides and all
internucleoside linkages are phosphodiester.
SEO ID NO: Seguence (5'-3')
7 CAAAUCCAGAGGCUAGCAGTT
8 CUGCUAGCCUCUGGAUUUGTT
[0300] The siRNA's having 5, 2'-O-methyl groups at least 2 positions
removed from the 5'-end of the antisense strand reduced PTEN mRNA levels to
from 25 to 35% of untreated control. The remaining 2 constructs increased PTEN
mRNA levels above untreated control.
Example 37
Solid block of 2'-O-methyl modified nucleosides in the antisense strand of
siRNA's assayed for PTEN mRNA levels against untreated control
[0301] The antisense strands listed below having SEQ ID N0:9 were
individually duplexed with the sense strand having SEQ ID N0:7 and the
activity
was measured to determine the relative effect of adding either 9 or 14, 2'-O-
methyl modified nucleosides at the 3'-end of the resulting siRNA's.
SEQ ID NO:/ISIS NO Seguence
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-97-
7/271790 (S) 5'-CAAAUCCAGAGGCUAGCAG-dTdT-3'
9/271079(AS) 3'-UUGUUUAGGUCUCCGAUCGUC-5'
9/271081(AS) 3'-UUGUUUAGGUCUCCGAUCGUC-5'
[0302] Underlined nucleosides are 2'-O-methyl modified nucleosides,
dT's are deoxy thymidines, all other nucleosides are ribonucleosides and all
internucleoside linkages are phosphodiester.
SEQ ID NO: Seauence (5'-3')
9 CUGCUAGCCUCUGGAUUUGUU
[0303] The siRNA having 9, 2'-O-methyl nucleosides reduced PTEN
mRNA levels to about 40% of untreated control whereas the construct having 14,
2'-O-methyl nucleosides only reduced PTEN mRNA levels to about 98% of
control.
Example 38
2'-O-methy blockmers (siRNA vs asRNA)
[0304] A series of bloclcmers were prepared as duplexed siRNA's and
also as single strand asRNA's. The antisense strands were identical for the
siRNA's and the asRNA's.
SEQ ID
NO:/ISIS
NO Seauence
5'-3'
10/308746 5'-AAGUAAGGACCAGAGACAAA-3' (PO)
(S)
11/303912 3'-UUCAUUCCUGGUCUCUGUUU-P 5' (PS)
(AS)
11/316449 3'-UUCAUUCCUGGUCUCUGUUU-P 5' (PS)
(AS)
11/335223 3'-UUCAUUCCUGGUCUCUGUUU-P 5' (PS)
(AS)
11/335224 3'-UUCAUUCCUGGUCUCUGUUU-P 5' (PS)
(AS)
11/335225 3'-UUCAUUCCUGGUCUCUGUUU-P 5' (PS)
(AS)
11/335226 3'-UUCAUUCCUGGUCUCUGUUU-P 5' (PS) -
(AS)
11/335227 3'-UUCAUUCCUGGUCUCUGUUU-P 5' (PS)
(AS)
11/335228 3'-UUCAUUCCUGGUCUCUGUUU-P 5' (PS)
(AS)
[0305] Underlined nucleosides are 2'-O-methylnucleosides,
modified all
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-98-
other nucleosides are ribonucleosides and all internucleoside linkages for the
AS
strands are phosphorothioate and the internucleoside linkages for the S strand
are
phosphodiester.
SEp ID NO: Seguence (5'-3')
AAGUAAGGACCAGAGACAAA
11 UUUGUCUCUGGUCCUUACUU
[0306] The constructs were assayed for activity for measuring the levels
of PTEN mRNA in T24 cells against untreated control levels. All of the asRNA's
and siRNA's showed activity with the asRNA's having the best activity in each
case. A clear dose response was seen for all the siRNA constructs (20, 40, 80
and
150 nm doses). There was a good dose response for the asRNA's for 50, 100 and
200 nm doses. In general the siRNA's were more active in this system at lower
doses than the asRNA's and at the 150 nm dose was able to reduce PTEN mRNA
levels to from 15 to 40% of mitreated control. The unmodified siRNA 303912
reduced PTEN mRNA levels to about 19% of the untreated control.
Example 39
3'-Hemimer 2'-O-methyl siRNA constructs
[0307] Blunt and overhanging siRNA constructs were prepared having a
block of 5, 2'-O-methyl nucleosides at the 3'-terminus.
SEO ID NO:/ISIS NO Seguence (overhangs)
7/271790 (S) 5'-CAAAUCCAGAGGCUAGCAG-dTdT-3'
9/xxxxxx (AS) 3'-UUGUUUAGGUCUCCGAUCGUC-5'
SEO ID NO:/ISIS NO Seguence (blunt)
12/xxxxx(S) 5'-GUCAAAUCCAGAGGCUAGCAG-3'
13/xxxxxx (AS) 3'-CAGUUUAGGUCUCCGAUCGUC-5'
[0308] Underlined nucleosides are 2'-O-methyl modified nucleosides, all
other nucleosides are ribonucleosides and all internucleoside linlcages for
the AS
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-99-
strands are phosphorothioate and the internucleoside linkages for the S strand
are
phosphodiester.
SEQ ID NO: Seguence (5'-3')
12 GUCAAAUCCAGAGGCUAGCAG
13 CUGCUAGCCUCUGGAUUUGAC
[0309] The construct having overhangs was able to reduce PTEN mRNA
levels to about 36% of untreated control whereas the blunt ended construct was
able to reduce the PTEN mRNA levels to about 27% of untreated control.
Example 40
siRNA hemimer constructs
[0310] Three siRNA hemimer constructs were prepared and examined in a
PTEN assay. The hemimer constructs had 7, 2'-O-methyl nucleosides at the 3'-
end.
The hemimer was put in the sense strand only, the antisense strand only and in
both
strands to compare the effects.
SEQ ID NO:/ISIS NO Constructs (overhangs)
14/271068 5'-CAAAUCCAGAGGCUAGCAGUU-3'
(S)
9/ (AS) 3'-UUGUUUAGGUCUCCGAUCGUC-5'
14/271068 5'-CAAAUCCAGAGGCUAGCAGUU-3'
(S)
9/ (AS) 3'-UUGUUUAGGUCUCCGAUCGUC-5'
14/ (S) 5'-CAAAUCCAGAGGCUAGCAGUU-3'
9/ (AS) 3'-UUGUWAGGUCUCCGAUCGUC-5'
[0311] Underlined nucleosides are 2'-O-methyl modified
nucleosides, all
other nucleosides are ribonucleosides and all internucleoside linkages for the
AS
strands are phosphorothioate and the internucleoside linkages for the S strand
are
phosphodiester.
SEQ ID NO: Seguence (5'-3')
14 CAAAUCCAGAGGCUAGCAGUU
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-100-
[0312] The construct having the 7, 2'-O-methyl nucleosides only in the
antisense strand reduced PTEN mRNA levels to about 23% of untreated control.
The construct having the 7, 2'-O-methyl nucleosides in both strands reduced
the
PTEN mRNA levels to about 25% of untreated control. When the 7, 2'-O-methyl
nucleosides were only in the sense strand PTEN mRNA levels were reduced to
about 31 % of untreated control.
Example 41
siRNA vs asRNA hemimers
[0313] Four hemimers were prepared and assayed as the asRNA's and
also as the siRNA's in a PTEN assay. The unmodified sequence was also tested
as
the asRNA and as the siRNA.
SEQ ID NO:/ISIS NO Constructs (overhangs)
10/308746 5'-AAGUAAGGACCAGAGACAAA-3'
(S)
11/303912 3'-UUCAUUCCUGGUCUCUGUUU-P 5'
(AS)
11/316449 3'-UUCAUUCCUGGUCUCUGUUU-P 5'
(AS)
11/319013 3'-UUCAUUCCUGGUCUCUGUUU-P 5'
(AS)
11/319014 3'-UUCAUUCCUGGUCUCUGUUU-P 5'
(AS)
11/319015 3'-UUCAUUCCUGGUCUCUGUUU-P 5'
(AS)
[0314] Underlined nucleosides are 2'-O-methyl modified
nucleosides, all
other nucleosides
are ribonucleosides
and all
internucleoside
linkages
for the
AS
strands are phosphorothioate and the internucleoside linkages for the S strand
are
phosphodiester.
ConstructsiRNA (%mRNA) asRNA (%mRNA)
11/30391221 32
11 /31644917 26
11/31901334 32
11/31901454 42
11/31901551 42
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-101-
[0315] Percent mRNA is relative to untreated control in PTEN assay.
Example 42
Representative siRNA's prepared having 2'O-Me gapmers
[0316] The following antisense strands of siRNA's were hybridized to
the complementary full phosphodiester sense strand. Bolded monomers are 2'-
OMe containing monomers. Underlined monomers have PS linkages. Monomers
without underlines have PO linkages.
SEQ ID NO/ISIS NO
15/300852 ~ 5'-OH-CUG CUA GCC UCU GGA UUU GA (OMe/PO)
15/300853 5'-P- CUG CUA GCC UCU GGA LTUU GA (OMe/PO)
15/300854 5'-OH- CUG CUA GCC UCU GGA LTUU GA (OMe/PO)
15/300855 5'-P- CUG CUA GCC UCU GGA UUU GA (OMe/PO/P~
16/300856 5'OH- CUA GCC UCU GGA UUU GA ~OMe/PO/P~
15/300858 5'-OH- CUG CUA GCC UCU GGA LTiJU GA (OMe/PS~
15/300859 5'-P- CUG CUA GCC UCU GGA LTUU GA (OMe/P~
16/300860 5'-OH- CUA GCC UCU GGA LTUU GA (OMe/PS
17/303913 5'-OH- GUC UCU GGU CCU UAC UU (OMe/~
18/303915 5'-OH- UUU UGU CUC UGG UCC UU (OMe/P~
19/303917 5'-OH- CUG GUC CUU ACU UCC CC (OMe/PS)
20/308743 5'P- UUU GUC UCU GGU CCU UAC UU (OMe/P~
21/308744 5'-P- UCU CUG GUC CULT ACU UCC CC (OMe/P~
22/328795 5'-P- LTUU GUC UCU GGU CCU UAC UU (OMe/P~
Example 43
Representative siRNA's prepared having 2'-O-methyl modified nucleosides
[0317] The following antisense strands of siRNA's were hybridized to
the complementary full phosphodiester sense strand. Where the antisense strand
has a TT 3'-terminus the corresponding sense strand also has a 3'-TT
(deoxyT's)
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-102-
SEQ ID NO./ISIS NO.
23/ 271065 CUG CUA GCC UCU GGA UUU GTT PO
24/271067 CUG CUA GCC UCU GGA UUU GUU PO
25/271069 CUG CUA GCC UCU GGA UUU GUT PO
23/271071 CUG CUA GCC UCU GGA UUU GTT PO
23/271072 CUG CUA GCC UCU GGA UUU GTT PO
23/271073 CUG CUA GCC UCU GGA UUU GTT PO
23/271074 CUG CUA GCC UCU GGA UUU GTT PO
23/271075 CUG CUA GCC UCU GGA UUU GTT PO
23/271076 CUG CUA GCC UCU GGA UUU GTT PO
23/271077 CUG CUA GCC UCU GGA UUU GTT PO
23/271078 CUG CUA GCC UCU GGA UUU GTT PO
24/271079 CUG CUA GCC UCU GGA UUU GUU PO
25/271081 CUG CUA GCC TCT GGA TTT GUU PO
26/271082 CUG CUA GCC UCU GGA UUU GAC POPS
25/271083 CUG CUA GCC UCU GGA UUU GUU POPS
23/271084 CUG CUA GCC UCU GGA UUU GTT PO
23/283547 CUG CUA GCC UCU GGA UUU GTT PO
23/293999 CUG CUA GCC UCU GGA UUU GTT PO
23/294000 CUG CUA GCC UCU GGA UUU GTT PO
23/290223 CUG CUA GCC UCU GGA UUU GTT PO
Example 44
Representative siRNA's prepared having 2'-F-methyl modified nucleosides
[0318] The following antisense strands of silZNA's were hybridized to
the complementary full phosphodiester sense strand. Bolded monomers are 2'-F
containing monomers. Underlined monomers have PS linkages. Monomers
without underlines have PO linkages. Sense stands (S) are listed 3' -> 5'.
Antisense strands (AS) are listed 5' -> 3'.
SEQ ID NOIISIS NO Seauence Features
27/279471 AS '"CUG '"CUA G"'C"'C U"'CU GGA UUU G dTdT (F/PO)
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-103-
28/279467S "'CAA AU"'C "'CAG AGG "'CUA
Gn'CA G dTdT (F/PO)
29/319018AS UU UGU CUC UGG UCC UUA CUU (F/PO)
30/319019S AAG UAA GGA CCA GAG ACA AA (F/PO)
29/319022AS UU UGU CUC UGG UCC UUA CUU (F/PS)
29/333749AS UU UGU CUC UGG UCC UUA CUU (F/OH/PS)
29/333750AS UU UGU CUC UGG UCC UUA CUU (F/OH/PS)
29/333751AS UU UGU CUC UGG UCC UUA CUU (F/OH/PS)
29/333752AS UU UGU CUC UGG UCC UUA CUU
(F/OH/PS)
29/333753AS UU UGU CUC UGG UCC UUA CUU
(F/OH/PS)
29/333754AS UU UGU CUC UGG UCC UUA CUU
(F/OH/PS)
29/333756AS UU UGU CUC UGG UCC UUA CUU
(F/OH/PS)
29/334253AS UU UGU CUC UGG UCC UUA CUU
(F/OH/PS)
29/334254AS UU UGU CUC UGG UCC UUA CUU (F/OH/PS)
29/334255AS UU UGU CUC UGG UCC UUA CUU (F/OH/PS)
29/334256AS UU UGU CUC UGG UCC UUA CUU (F/OH/PS)
29/334257AS UU UGU CUC UGG UCC ULTA CUU (F/OH/PS)
29/317466AS UUU GUC UCU GGU CCU UAC UU PS
29/317468AS UUU GUC UCU GGU CCU UAC UU PO
29/317502AS UUU GUC UCU GGU CCU UAC UU PS
[0319] Res ults from a PTEN assay are Percent mRNA
presented below.
is relative
to untreated
control
in PTEN
assay.
mRNA
Construct100
nM
asRNA
100
nM
siRNA
303912 35 18
317466 -- 28
317408 -- 18
317502 -- 21
334254 -- 33
333756 42 19
334257 34 23
334255 44 21
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-104-
333752 42 lg
334253 38 15
333750 43 21
333749 34 21
Example 45
Representative siRNA's prepared having 2'-F and 2'-OMe monomers
[0320] The following antisense strands of siRNA's were hybridized to
the complementary full phosphodiester sense strand. Where the antisense strand
has a TT 3'-terminus the corresponding sense strand also has a 3'-TT
(deoxyT's).
Bolded monomers are 2'-F containing monomers. Underlined monomers axe 2'-
OMe. Monomers that are not bolded or underlined do not contain a sugar
surrogate. Linkages axe shown in the parenthesis after the sequence.
SEQ ID NO./ ISIS NO. Composition (5' 3') Features
31/283546 CUG CUA GCC UCU GGA UUU GU.dT-3' (OMe/F/PO)
32/336240 UUU GUC UCU GGU CCU UAC UU
- (OMe/F/PS)
Example 46
Representative siRNA's prepared having 2'-MOE modified nucleosides
assayed for PTEN mRNA levels against untreated control
[0321] The following antisense strands of siltNA's were hybridized to
the complementary full phosphodiester sense strand. Bolded monomers are 2'-
OMOE. Linkages are phosphothioate.
SEQ ID NO Composition ~ PTEN mRNA level
(%UTC) 100 nM
oligomer
CA 02504554 2005-04-29
WO 2004/044140 PCT/US2003/035087
-105-
33 UUC AUU CCU GGU CUC UGU UU --
33 UUC AUU CCU GGU CUC UGU UU 50
33 UUC AUU CCU GGU CUC UGU UU --
33 UUC AUU CCU GGU CUC UGU UU 43
33 UUC AUU CCU GGU CUC UGU UU 42
33 UUC AUU CCU GGU CUC UGU UU 47
33 UUC AUU CCU GGU CUC UGU UU 63
33 UUC AUU CCU GGU CUC UGU UU 106
