Note: Descriptions are shown in the official language in which they were submitted.
o~ :
10 ~
TITLE
Preparation of hepatitis B Virus Vaccine
FIELD OF THE_I~VENTIOM
The invention relates to cloning of a gene which codes
for hepatitis B surface antigen in yeast by use of
20 recombinant DNA ~echniques and preparation of a hepatitis B
virus vaccine from antigen produced by the yeast.
BACKGROUND OF INVENTION
Infection with he~alitis B vi L US ( HBV) is a serious,
widespread health problemO Infection can be manifested in
25 acute or chronic phases. The number of cases of acute
hepatitis in the United States is estimated to be at least
100,000 per year with a fatality rate of l to 2 per cent~
In the United States, the prevalence of ch~ronic carriers of
HBV among healthy adults varies between 0Ol and 1%
30 depending on age and social class. In Sollth America, the
prevalence of chronic carriers is about l to 3%; in the
U~SoS~Ro and southern Europe, about 3 to 6%; and in Asia
and Africa, more than 10%o
In developed countries, there exists a need for a
35 vaccine for people at high risk of exposure, such as
- 2 ~3L222~
patients and personnel in medical units where blood i8
handled, military personnel, spouses of chronic carriers,
travelers to areas of high HBV endemicity, newborns of
chronic carriers, homosexuals, prostitutes and drug
5 abusers~ In third world countries, there exists a need for
an inexpensive vaccine for mass immunization. Mass
immunization programs may ultimately affect not only the
incidence of acute hepatitis and the pool of chronic
carriers but may also reduce the morbidity and mortality
10 from chronic active hepatitis and hepatocellular carcinoma.
Dane particles, which are believed to be hepatitis B
virions and which are isolatable from infected patients,
have a diameter of about 42nm. Each consists of an
envelope comprising the hepatitis B surface antigen
15 (HBsAg), a capsid (HBcAg), an endogenous polymerase and a
DNA yenome. ~le genome is circular and double-stranded
with a single strand region consisting of about 200 bases.
The single strand region can be filled in, ln vitro, by the
action of the endogenous polymerase. The longer strand
20 contains approximately 3,200 bases.
It has been difficult to prepare HBV vaccines because
it has proven difficult to propagate the virus in tissue
culture and because the only known host is man. ~ma~l
amounts of authentic HBV antigens have been isolated from
20 infected humans. F-D-C Reports, pp. 3-4, July 19, 1982,
carries a report of clinical studies of a recently
developed Hepatitis B vaccine.
Valenzuela et al., ~ature, Volume 298~ 347-350 (1982),
report synthesis of HBsAg in yeast using an expression
25 vector wherein the HBsAg coding sequence is an 835 bp
Taql-Hpal fragment and the promotor is the yeast alcohol
dehydrogenase I promotorO Several earlier brief reports
noted research preceding this reference. These are
Valenzuela et al., Arch. Biol._Med. EXPD (Chile), Volume
30 14(1), 21-22 (1981), which reports expression in yeast of a
- 3 ~ Z'~
DNA frayment containing a sequence which codes for a
protein similar to HBsAg ligated to a yeast alcohol
dehydrogenase promotor region; a report in Scrip ~o. 616,
pO 14 (AugO 12, 1981), which states that a team oE U. S.
5 researchers including P. Valenzuela and W. ~. Rutter have
announced production in yeast of "the protein-coating
surrounding hepatitis B virus;" and Zuckerman, Nature,
Volume 295, 98-99 (1982), which reports that W. J. Rutter
has reported expression of glycosylated HBsAg in yeast
10 cells.
Antigenic components of HBV, such as ~BsAg, have been
prepared in bacteria following insertion of a recombinant
DNA molecule containing a gene which codes for the
an~igen. Burrell et al., Nature, Volume 279, Number 5708,
15 43-47 (1979), report expression in E. coli strain HB101 of
HBV DNA sequences cloned in plasmid pBR322.
Murray et al., European Patent Application 13,828,
disclose preparation of a recombinant vector which can code
for HBV antigens, including HBsAg, in E.coli strain HBlOlo
20 The vector is prepared from Dane particle DNA and plasmid
pBR322. The authors state that useful hosts may include
other bacterial hosts, yeasts and other fungi, animal or
plant cells and other hosts, although the only demonstrated
host is E. coli.
Charnay, et al., Nature, Volume 286, 893-895 (1980),
report construction of a bacteriophage carrying a fusion of
the B-galactosidase gene and the HBsAg structural geneO
The bacteriophage directs synthesis of a fusion protein
comprising antigenic determinants of both HBsAg and
30 B-galactosidase~
Tiollais et al., United Kingdom Patent Application
2,034,323, disclose preparation of a coliphage containing
HBV D~A. Fused phage-HBV D~A is transformed into E. coli
strain C600.
4 ~2'70~
In United Kingdom Patent Application 2,070,621, first
published as PCT application WO81/00577, a plasmid which
comprises a part of the HBsAg gene and the promotor and the
Z gene of the lactose operon and which can be cloned in E.
5 coli is disclosed.
Rutter et al., European Patent Application 20,251,
disclose recombinant vectors including a recombinant vector
comprising plasmid pBR322 and BamHI fragments of HBV DNA,
which can be used to transform E. coli. Another vector,
10 comprising a BamHI fragment of HBV D~A and a portion of the
tryptophan operon, was used to obtain expression in E. coli
strain HB101.
Edman et al., Nature, Volume 291, Number 5815, 503-506
(1981), describe construction of plasmids which direct
15 synthesis of HBcAg and a ~-lactamase-HBsAg fusion protein,
under the control of the tryptophan operon regulatory
region, in E. coliO
Other references disclosing insertion of HBV DNA into
bacteria include Charnay, et al., Pro~. Med VirolO, Volume
20 27~ 88-92 (1981), MacKay et al, Proc. Natl. AcadO Sci.
U.S., Volume 78, Number 7, 4510-4514 (1981); Fritsch et
al!, C. R. Acad. Sci. Volume 287, Number 16, 1453 (1978),
U. K. Patent Specification 2,034,323 (Derwent ~o. 468;4C).
and Pasek et al., Nature, Volume 282 No. 6, 575 (1979).
HBV D~A has also been cloned in mammalian cells.
These include, human, mouse, and human hepatoma cell
lines. For example, Dubois et al., Proc. Natl. Acad. Sci.
U. S., Volume 77, Number 8, 4549-4553 (1980), report
transformation of mouse cells with a plasmid containing the
30 HBV genome and expression of HBsAg; Hirschman et al., Proc.
Natl. Acad. Sci. U.S., Volume 77, ~umber 9, 5507-5511
(1980), report production of HBV-like particles by HeLa
cells transformed with HBV DNA~
Procedures for preparing HBV vaccine using HBsAg from
35 human blood are reported by Funakoshi et al., Prog. Med.
7~
Virol., Volume 27, 163-167 (1981), and Maupas et al., Prog.
Med. Virol~, Volume 27, 185-201 (1981). The vaccine
prepared by Funakoshi et al. contains 40 ~g of purified,
formalin-treated HBsAg, phosphate sodium chloride, 20 mg of
5 mannitol; and 0.1% of aluminlum hydroxide as adjuvant. In
the latter paper, Maupas et al. report that one dose of
vaccine was 1 ml of purified, formalin-treated HBsAg
containing 2-10 ~g/ml of protein (Lowry's method) and 0.1%
of aluminum hydroxideO The protocol used in the study
10 reported by Maupas et alO called for three injections at
one month intervals with a booster after one year; the
authors propose a protocol consisting of two injections of
concentrated HBsAg at three month intervals.
Additional references to preparation of HBV vaccines
15 include Maupas et al., Adamowicz et alO, and Funakoshi et
al. at pages 3, 37 and 57, respectively, of Hepatitis B
Vaccine INSERM Symposium No. 18, editO by Maupas and
Guesry, 1981, Elsevier/North-Holland Biomedical Press.
Yeasts have been used as host organisms for certain
20 other DNA sequences. For example, Fraser et al., UO K3
Patent Application 2,068,969, disclose preparation of
chicken ovalbumin in yeast; Scrip NoO 640, pO 11 (NovO 4,
1981) contains a report that a type of interferon is being
prapared in yeast. In European Patent 11,562 (Derwent NoO
25 38762C) are reported hybrid yeast plasmids containing the
ura3 yeast gene in the 2 ~ plasmid.
SU~ARY OF THE INVENTION
The invention relates to the preparation of a
30 recombinant DNA molecule comprising a nucleotide sequence
which can code for HBsAg and a regulatory region derived
from the yeast ~ 3 gene which can effect transcription of
the H~sAg sequence in the yeast, Saccharomyces cerevisiae.
The molecule includes vectors in which the HBsAg sequence
35 and the regulatory region have been inserted, which vectors
'~2~Z~
-- 6 --
can be used to prepare a yeast vector or to maintain the
HBsAg and regulatory re~ions. Microorganisms containing
the recombinant D~A molecule, such as microorganisms
transformed with plasmids of the invention, are included
5 within the invention. The invention also includes a
plasmid having the ~3 regulatory region and a restriction
site proximate thereto for insertion of a coding sequence,
such as an HBsAg sequence, such that the protein
synthesi~ed by expression of the coding sequence is devoid
10 of extraneous amino acid residues.
The invention also includes the preparation of a
vaccine for stimulating protection against HBV infection in
humans comprising a vaccinal amount of HBsAg prepared in
accordance with this invention and a suitable carrierO
Further, the invention includes processes for
preparing the recombinant DNA molecule and microorganisms
containing the molecules as well as processes for preparing
HBsAg and HBsAg containing vaccine.
BRIEF DES RIPTION OF T~E FIGURES
Figure 1 is a restriction endonuclease cleavage map of
pRIT10601.
Figure 2 is a restriction endonuclease cleavage map of
pRIT10616.
Figure 3 is a restriction endonuclease cleavage map of
25 pMC200.
Figure 4 is the nucleotide sequence of a portion of
the 3300 bp HindIII yeast DN~ insert i~ pMC200 ~hich
portion contains HincII, BglII and EcoRI sites.
Figure S is a flow sheet illustrating preparation of
30 pRIT10671 and pRITl06730
Figure 6 is a flow sheet illustrating preparation of
pRIT10749~
Figure 7 is a flow sheet illustrating preparation
ofpRIT10761 and pRIT10764.
. 7 _ ~Z2~7~7
DETAILED DESCRIPTION OF THE INVENTION
The recombinant DNA molecule is prepared by fusing a
nucleotide sequence which includes a structural gene for
HBsAg with the yeast ~3 regulatory region, which
5 regulatory region can direct transcription of the HBsAg
sequence in yeast, thereby effecting expression thereof.
By "recombinant DNA molecule" is meant a DNA fragment
containing the HBsAg coding sequence and the regulatory
region as well as other DNA molecules containing the
10 fragment, such as plasmid or phage vectors.
By "regulatory region" is meant a sequence which
contains a promotor region and other sequences necessary
for transcription. The yeast arg3 regulatory region is
especially advantageous because it can be a powerful
15 promotor for expression of an HBsAg coding sequenceO
By "HBsAg" is meant a protein which is structurally
identical to authentic HBsAg or has substantially the same
antigenic determinants as authentic HBsAg, that is, is
capable of stimulating production of antibodies which
20 specifically recognize and react with authentic HBsAg o~ is
specîfically recognized by anti-HBsAg antibodies.
The HBsAg coding sequence can be isolated from DNA
extracted from Dane particles in lnfected huma~ serum by
filling in the single strand region with a DNA polymerase,
25 preerably the endogenous polymerase, followed by digestion
with a restriction endonuclease. The choice of
endonuclease will depend, in part, on the particular Dane
particles. For example, as illustrated in the Examples
below, the HBsAg coding sequence of HBV DNA of certain Dane
30 particles of the adw serotype can be isolated on a single
BamHI fragment; the HBsAg coding sequence of HBV DNA of
certain Dane particles of the ayw serotype can be isolated
on a HhaI fragment. HBV DNA of Dane particles of the same
7~7
~,'..
-- 8 --
serotype may also exhibit different patterns of restriction
sites,
Restriction of D~A to prepare DNA fragments used in
the invention, ligation of such fragments to prepare
5 recombinant D~A molecules used in the invention and
insertion into microorganisms are carried out by Xnown
techniques such as techniques disclosed in the previously
and subsequently cited references. Conditions are selected
to avoid denaturation of the DNA and enzymes~ For example,
10 the pH is buffered to remain at about 7.0 to 11.0 and the
temperature is kept below about 60 CO Preferably
restriction is carried out at a temperature of about 30 to
40C and ligation is carried out at about O to 10C.
Restriction enzymes and ligases used in carrying out this
15 invention are commercially available and should be used in
accordance with instructions included therewith. T4 Dl~A
~igase is the preferred ligase.
Fusing of the HBsAg sequence to the regulatory region
can be accomplished by use of intermediate vectors as
20 illustrated in the Examples, below. Alternatively, the
HBsAg sequence can be inserted directly into a vector which
contains the regulatory region~ A vector is DNA which can
carry and maintain the D~A fragment of the invention,
including, for example, phages and plasmids. Techniques
25 for cloning DNA fragments in phages are disclosed, for
example, by Charnay et al. Nature, Volume 286, 893-895
(1980) and Tiollais, United Kingdom Patent Application
2,034,3230 Preferably, the HBsAg sequence is positioned
relative to the regulatory region such that the HBsAg
30 synthesized by expression of the HBsAg sequence is devoid
of extraneous amino acid residues.
A regulatory region which has been found to be
especially useful is derived from the yeast arg3 gene which
codes for ornithine carbamoyltransferase (OCT). Use of the
35 arg3 regulatory region is advantageous because its activity
. g
is subject to both specific and general control
mechanismsO It has been cloned in Eo coli on plasmid
pYeura3arg3 as reported by Crabeel et al., Proc. Natl.
~cad. Sci. U.S.A., Volume 78, 5026 (1981)o Preferred hosts
5 are _. cerevisiae strains in which the arginine
biosynthetic pathway is derepressed, such as strain
lc1697do Use of such strains results in increased
expression from the ~3 promotor as compared to the other
strain which was used in the Examples, strain DC50
The preferred vector ~or cloning the fused DNA
fragment into yeast is the plasmid YEpl3, which is capable
of replication and maintenance in both E. coli and S0
cerevisiae and is, therefore, known as a shuttle vectorO
-
Several other yeast vectors are known and availableO The
15 HBsAg and regulatory regions can be inserted into a yeast
vector sequentially or, as illustrated in the Examples,
below, simultaneously. Transformation with plasmid vectors
will normally result in incorporation of the DNA molecule
of the invention as a plasmid. However, other reactions,
20 such as recombination events, can result in incorporation
of the DNA molecule into chromosomal DNA.
Vaccines for stimulating protection against HBV
infection in humans comprising HBsAg produced by yeast in
accordance with the invention and a suitable carrier can be
25 prepared by known techniques. Use of an adjuvant~ such as
aluminum hydroxide, is desirable. The HBsAg so produced
can also be combined with other immunogens to prepare
combination vaccines The HBV or combination vaccines can
be administered, for example, by the subcutaneous,
30 intravenous or intramuscular route. The DNA fragment of
the invention and the HBsAg produced thereby, can also be
used as a probe for detection of HBV in biological samples
by DNA hydridization techniques and various immunoassays.
-- 10 --
EXAMPLES
__
In the following examples of the invention, which are
illustrative and not limiting, all percentages are by
weight and all temperatures are in degrees CelsiusO
Example 1 Preparation of Intermediate Plasmid,
RIT10601, bv Combinin~ HBV DNA with pBR322
p ~ _ __ _
HBs~g positive serum of ~y~ serotype was defibrinated
by addition of CaC12 to a final concentration of 0.28%
10 and centrifuged for 2 h at 27,000 rpm in a SW 27 rotor on
10-20% sucrose gradients made up in a buffer (pH 7O5)
containing 10 mM tromethamine-HCl, 1 M NaCl and 1 mM ~DTAo
A transparent pellet containing Dane particles was
resuspended in the same buffer and centrifuged on buffered
15 20~ sucrose layered on a 65% sucrose cushion. An
opalescent band at the cushion interface was recovered and
centri~uged on a similar 20-65~ gradient at 200,000 x C for
4 h to pellet the Dane particles.
A. Single strand regions of the HBV genome within the
20 Dane .particles were repai.red using the endogenous DNA
polymerase by resuspending the Dane particles in a reaction
mixture (pH 8.0) containing 50 mM tromethamine-HCl, 10 mM
MgC12, 500 mM NaCl, 0.5 mM dithiothreitol, 50 mM eacn of
dATP, dCTP and dGTP and 8 ~uM of P-dTTP (350 Ci/mmole)
25 and incubating the resuspended particles for 5 h at 37O
The resuspension was diluted to pH 7O5 with a buffer
containing 10 mM tromethamine-HCl, 10 mM EDTA, 100 mM NaCL
and 0.02~ sodium dodecyl sulfate (pH 7.5) and incubated
with 0.5 mg/ml of pronase for 1 h at 37 followed by
30 phenol extraction and ethanol precipitationO
Digestion of the DNA with BamHI restriction
endonuclease, yielded two radioactive fragments with sizes
of about 1450 bp and 1600 bp as judged by agarose gel
electrophoresis and autoradiography of the gel.
2~7
B. About 30 ng of Dane particle DNA was repaired
with the endogenous DNA polymerase in the presence o
non-labelled dTTP, and was extracted and recovered, as
described above. The DNA was mixed with 100 ng of plasmid
5 pBR322 which had been previously digested with BamHI
restriction endonuclease and treated with alkaline
phosphatase. Plasmid pBR322 is commonly used in
recombinant DNA procedures and is on deposit, without
restriction on availability, in the American Type Culture
10 Collection under accession number 37017. The mixture was
extracted with phenol, precipitated with ethanol,
centrifuged, dried, resuspended in 12 ul of a mixture (pH
7.5) containing 50 mM tromethamine-HCl, 1 mM ATP, 10 mM
MgC12, 10 mM dithiothreitol, 50/ug/ml gelatin and 2
15 units/ml T4 DNA ligase. The suspension was incubated for 4
h at 10 and then held on ice for 18 h.
The ligated DNA mixture was used to transform
competent cells of E~ coli K12 strain- C600 prepared
according to the procedure of Cohen et al., Proc; ~atl.
20 Acad. Sci. U. S., Volume 69, 2110 (1972~. Transformants
were selected on a solid medium containing ampicillin (200
,uglml). Isolated colonies were screened for loss of
tetracycline resistance, indicative of insertion o~ a
foreign D~A fragment in the BamHI site of pBR322. One such
25 transformant clone was found to contain a plasmid,
pRIT10601, which on digestion with BamHI endonuclease gave
a pBR322 fragment of 4360 bp and HBV DNA fragments of 1600
bp and 1450 bp~ A culture of E. coli K12 strain
C600(pRIT10601) was deposited in accordance with
30 regulations of the E-~ropean Patent Convention (EPC) and the
Budapest Treaty in the American Type Culture Collection,
Rockville, Maryland U.S.A. on June 2, 1982 under accession
number ATCC 39132. A restriction endonuclease cleavage map
of plasmid pRIT10601 is shown in Figure 1.
'7~7
- 12 -
C. The sizes of fragments generated by digestion of
the Dane particle DNA and pRIT10601 with various
restriction enzymes were compared as follows. Dane
particle DNA, that is, HBV DNA, was labelled with 32p by
5 the endogeneous polymerase reaction described above or by
treating purlfied DNA with DNA polymerase I from E. coli
The labelled HBV DNA was mixed with pRIT10601 and the
mixture was treated with a restriction endonuclease and
electrophoresed on an agarose gel. The gel was stained
10 with ethidium bromide and photographed under UV light to
loca~e the DNA fragments and was then dried and
autoradiographed to locate the radioactive HBV DNA
fragments. The following labelled HBV fragments were found
to match exactly the size of pRIT10601 fragments: 1450 and
15 1600 bp BamHI fragments; a 1330 bp HpaI fragment; and a
1130 bp BamHI-XhoI fragment. Labelled Dane particle DNA
also hydridized specifically to both the 1450 and 1600 bp
fragments released by BamHI digestion of pRIT10601
following transfer of these fragments from an agarose gel
20 onto a nitrocellulose filter by the technique of Southern,
J. Mol. Biol., Volume 98, 503 (1975).
These results show that the cloned DNA insert on
pRIT10601 represents the HBV genome and that the relative
orientation of the two BamHI fragments on pRIT10601 is the
25 same as in the virion. pRIT10601 was used to prepare
pRIT10671 in Example 10, below~
Example 2. Preparation of Intermediate Plasmid,
RIT10616 bv Combinina ~BV DNA with ~ACYC184
P ~
Dane particles were isolated from HBsAg positive serum
of adw serotype as described above. Restriction
endonuclease analysis of P-labelled HBV DNA indicated
that the DNA contained one EcoRI site~
HBV D~A, filled in by the endogenous polymerase
3~ reaction using non-labelled nucleotides, was digested with
2~7
- 13 -
EcoRI. The restricted DNA was mixed with plasmid pACYC184
which had been previously digested with EcoRI and treated
with alkaline phosphatase. Plasmid pACYC184 is on deposit,
without restrictions on availability, in the American Type
5 Culture Collection under accession number 37033. The
mixture was liyated with T4 DNA ligase.
The ligated D~A mixture was used to transform
competent cells of E. coli K12 strain C600. Transformants
were selected on tetracycline (15 ug/ml~ agar medium and
10 screened for loss of chloramphenicol resistance which is
indicative of insertion in the EcoRI site of pACYC184. A
transformed colony was found to contain a plasmid,
pRIT10616, which consists of pACYC184 with a 3200 bp
insert, comprising the HBV DNA, at the EcoRI site. A
15 restriction map of pRIT10616 is shown in Figure 2. Eo coli
K12 strain C600 (p~IT10616) was deposited in accordance
with EPC regulations and the Budapest Treaty in the
American Type Culture Collection on June 2, 1982 under
accession number ATCC 39131.
Example 3. Preparation of Intermediate Plasmid,
pRIT10640,Containing a Nucleotide Sequence Codinq
for HBsAg, by Combininq pRIT10616 with pBR313
pRIT10616 was purified by CsCl-ethidium bromide
25 density gradient centrifugation substantially as described
by Kahn et al, Methods in Enzymology, Volume 68, 268 (1979).
The DNA was digested with BamHI endonuclease, mixed
with BamHI-digested, alkaline phosphatase-treated DNA of
plasmid pBR313, ligated and used to transform competent
30 cells of E. coli K12 strain C600 substantially as described
in Example 1. Plasmid pBR313 is on deposit, without
restrictions on availability, in the American Type Culture
Collection under accession number 37018.
Trans~ormants were selected on ampicillin-containing
35 agar and screened for loss of tetracycline resistance,
14 ~:227~7
indicative of insertion at the BamHI site of pBR313. A
transformed colony was found to contain a plasmid,
pRIT10640, which consists of pBR313 with a 1350 bp insert
at the BamHI site. The insert is a nucleotide sequence
5 which can code for HBsAg. It codes for part of a putative
HBs~g precursor protein and the complete surface antigen
and includes 565 bp of 3' non-coding sequencesO
c Example 4. Preparation of Intermediate Plasmid
pMC200, Containing the arg3 Regulatory Region,
by Combining Yeast arg3 Gene with pBR322
A 3300 bp yeast D~A fragment specifying the arg3 gene
was obtained by diyestion of pYeura3~3 with HindIIIO
Plasmid p~eura3arg3 has been described by Crabeel et al.,
15 Proc. ~atl. Acad. Sci. U.S., Volume 78, 5026 (1981)~ The
3300 bp fragment was cloned into the HindIII site of pBR322
and transformed into _. coli K12 strain MM294,
substantially as described above. Transformants were
selected on ampicillin medium and screened for tetracycline
20 resistance. A transformed colony was found to contain a
plasmid, pMC200, which consists of pBR322 with an insert at
the HindIII site. This plasmid contains the arg3
regulatory region which can effect transcription of a HBs~g
nucleotide sequence in yeast cells as described in
25 following examples~ E. coli K12 strain MM294(pMC200) was
deposited in accordance with EPC regulations and the
Budapest Treaty in the American Type Culture Collection on
June 2, 1982 under accession number ATCC 39130.
The nucleotide sequence of part of the arg3 gene,
30 including part of the ~-terminal coding sequences for
ornithine carbamoyltransferase (OCT) and part of the 5'
non-translated leader region has been determined by Huyghen
et al., ~rch. Intl. Physical. Biochem., Volume 89, B172
- (1981). Figure 4 illustrates a 210 bp fragment of the
35 known sequence The 210 bp fragment contains unique
- 15 ~ 7~7
HincII, BglII and EcoRI sites on the 3300 bp HindIII yeast
DNA insert in pMC200; the initiation codon for the OCT
protein coding sequence is believed to be the boxed ATG
codon. Introduction into the HincII, BglII or EcoP~I sites
S of the yeast D~A of coding sequences for HBsAg alone or
HBsAg precursor plus HBsAg derived from cloned HBV DNA is
- expected to result in a gene fusion and production of a
hybrid protein transcribed and translated from the ~3
regulatory region provided that the gene fusion is in the
10 correct orientation for continued translation beyond the
site of fusion.
Example 5. Preparation of Intermediate Plasmids,
~RIT10671 and pRIT10672, Containing HBsAg and Regulatory
Regions, by Combini~gLpRIT10641 with pMC200
pMC200, 5~g, was digested with 6.4 units of BglII for
2.5 h at 37, diluted with an equal volume of a buffer
(pH 10.5) containing 0.1 M glycine, 0.01 M MgC12 6H2O
and 0.1 m~ ZnC12, and incubated with 0.5 units of calf
20 intestine alkaline phosphatase for 30 minutes at 37 to
remove 5' terminal phosphate residues. The mixture was
ex racted twice with buffer-saturated phenol and three
times with ether. The DNA was precipitated with ethanol
and dissolved in 0.01 M tromethamine buffer (pH 7.5).
pRIT106~0, 25 ~ug, was digested with BamHI to excise
the 1350 bp BamHI fragment of HBV DNA. The 1350 bp
fragment was purified by preparative agarose gel
electrophoresis and electroelution. The eluted D~A was
recovered and concentrated by ethanol precipitation and
30 dissolved in 20 ~1 of 0.01 M tromethamine buffer (pH 7.0).
A 0.3 Jug aliquot of the BamHI fragment, which contains the
HBsAg coding sequence, was mixed with 0.5 ,ug of the
BglII-digested pMC200 ànd the mixture was ligated by
incubation with T~ DNA ligase.
- 16 ~ 7~'7
The ligated DNA was used to transform competent cells
o~ _. coli K12 strain MM294. Transformants were selected
on agar plates containing 200 ~g/ml ampicillin. Twelve
resistant colonies were isolated by serial passage on
5 ampicillin agar and plasmids were isolated by the procedure
described by Birnboim et al., Nucl. Acid Res. Volume 7,
1513 (1979). Analysis by agarose gel electrophoresis
showed that all of the plasmids were restricted by HpaI,
indicative of insertion o~ the BamHI fragment and that both
10 orientations of the inserted fragment were present among
the twelve transformed colonies. The plasmids were
isolated by CsCl-ethidium bromide density gradient
centrifugation. One plasmid, pRIT10671, contained the
BamHI fragment fused at the BglII site in correct
15 orientation for transcription of the HBsAg coding sequence
to generate a 2~6 amino acid fusion protein consisting of
18 N-terminal amino acids of OCT, 42 amino acids of the
putative HBsAg precursor protein and the 226 amino acids of
HBs~g. The fusion protein is HBsAg as shown in Example 8,
20 below. Transformants containing pRIT10671 are designated
_. coli K12 strain MM294(pRIT10671)o pRIT10671 is
illustrated in Figure 5O
Use of pRIT10640 as an intermediate plasmid is not
essential. For example, the BamHI fragment could have been
25 excised from pRIT10616~
Another plasmid, pRIT10672, contained the BamHI
fragment in the incorrect orientation for transcription of
the HBsAg coding sequence. Transformants containing this
plasmid are designated Eo coli K12 strain MM294(pRIT10672)~
Example 6. Preparation of Plasmids, pRIT10673 and
pRIT10674 Shuttle Vectors, by Combining pRIT10671
and pRIT10672_with Shuttle Vector YEpl3
Vector YEpl3, is an E. coli-S. cerevisiae shuttle
vector. It has been described by Broach et al, Gene,
35 Volume 8, 121 (1979). It was supplied b~ J. Hicks, Cold
~ 17 - ~2~27~
Spring Harbor Laboratories, New York, U.S.A. A small
HindIII fragment was excised from the plasmid by digestion
with HindIII and t~e plasmid was religated to prepare a
derivative plasmid, YEpl3 HindIII which contains a single
5 HindIII site. Purified YEpl3 HindIII was digested with
HindIII and treated with alkaline phosphatase to inhibit
religation. The DNA was recovered by phenol extraction and
ethanol precipitation.
Purified pRIT10671 and pRIT10672 were digested with
10 BamHI and treated with alkaline phosphatase to inhibit
reformation of the pBR322 moiety. The treated DNA was
further digested with ~indIII to liberate a 4650 bp HindIII
fragment, which contains the regulatory region-HBsAg gene
fusion, and the samples were extracted with phenol and
15 precipitated with ethanol. The DNA preparations derived
from pRIT10671 and pRIT10672~ 0.4 ~g of each, were
separately mixed with 0.4 ~ug of the HindIII-digested YEpl3
LIindIII and the mixtures were incubated with T4 DNA ligase
A portion of each of the ligated mixtures was used to
20 transform competent cells of E. coli K12 strain MM2940
_
Transformants were selected on ampicillin agarO
Transformant colonies were isolated and examined for their
plasmid content by the procedure described by ~irnboim et
al., Nucl. Acid. Re_., Volume 7, 1513 (1979). One
25 transformant colony, Eo coli K12 strain MM294(pRIT10673),
contained a plasmid, pRIT10673, which contains the HindIII
fragment from pRIT10671 inserted on YEp 13HindIII, in the
correct orientation, as illustrated in Figure 6. Another
transformant colony, E. coli K12 strain MM294(pRIT10674),
_._
30 contained a plasmid, pRIT10674, which contains the HindIII
fragment from pRIT10672 inserted on YEpl3 HindIII in the
incorrect orientation.
~~
~ v a
Example 7. Transformation of Yeast with pRIT10673
and pRIT10674
Plasmids pRIT10673 and pRIT10674 were isolated from
cleared lysates of E. coli K12 strains MM294(pRIT10673) and
5 MM294(pRIT10674) by CsCl-ethidium bromide density gradient
centrifugation.
A S cerevisiae strain DC5
The S. cerevisiae strain DC5 (leu 2-3, leu 2-112, his
3, can 1-11) described by Broach et al., Gene, Volume 8,
10 121 (1979), was obtained from J. HicXs, Cold Spring Harbor
Laboratories, New York, U.S.A. and was deposited in
accordance with EPC regulations and the Budapest Treaty in
the American Type Culture Collection in Rockville,
Maryland, U.S.A., on June 2, 1982 under accession number
15 ATCC 20630. Cells of strain DC5 were grown and prepared
for transformation by the procedures described by Hinnen et
al., Proc. Natl. Acad. Sci. U.S.A., Volume 75, 1929 (1978)
except that protoplasting was done in 008 M sorbitol, 0.03
M ~-mercaptoethanol, and 0.1 M potassium phosphate buffer
20 (pH 7.5) using a mixture of ~-glucouronidase (0.24 units/ml
final concentration) and arylsulphatase (1.2 units/ml final
concentration)O ~east protoplasts were separately
incubated with 10 lug of pRIT10673 and 10 ug of pRIT10674
and transformants were selected in regeneration agar
25 lacking leucineO Colonies which grew in the regeneration
agar were recovered and streaked on solid medium containing
0.675% Yeast Nitrogen Base medium lacking amino acids, 2~
glucose, 2% agar and 80 jug/ml histidine and were grown at
30 . One colony of strain DC5 had been transformed with
30 pRIT10673 and is designated S. cerevisiae strain
DC5(pRIT10673). Another colony had been transformed with
pRIT10674 and is designated S. cerevisiae strain
DC5(pRIT1067~)o
Cultures of strains DC5(pRIT10673) and DC5 (pRIT10674)
35 were grown in Yeast Nitrogen Base medium plus 80 ~g/ml
- 19- :~2~ 7
histidine to optical densities of 0.33 to 1.0 at 620 ~m.
The latter strain is useful as a negative control because
it contains the HBsAg coding sequence fused in incorrect
orientation to the regulatory region. Cells were recovered
5 by centrifugation, washed with phosphate buffered saline
(PBS) and resuspended in 5 ml PBS plus 1 mM phenyl methyl
sulphonyl fluoride (PMSF) at 20 to 160-fold
concentrations. Cells were broken by two passages through
a French Press~re Cell at 12,000 psi (83 MPa) and the
10 lysate was centrifuged at 7700 x G for 15 minutes and then
for 30 minutes at 30,000 x G. The supernatants were
recovered and filtered over a Millex GV membrane.
Supernatants were tested for the presence 3f protein
reacting with specific anti-HBsAg antibodies by the
15 Ausria~ radioimmunoassay procedures. Clarified cell
extracts of S. cerevisiae strain DC5(pRIT10673) prepared in
this manner gave positive reactions in this
radioimmunoassay even when tested at 16 to 256-fold
dilutions in PBS. In contrast, extracts of strain
20 DC5(pRIT10674) were negative in this assay for the presence
of proteins reacting with anti-HBsAg antibodies~
B. S. cerevisiae strain lc1697d
_. cerevisiae strain lc1697d was deposited in
accordance with EPC regulations and the Budapest Treaty in
25 the American Type Culture Collection, on June 2, 1982 under
accession number ATCC 20631. Using the procedure described
above, the arginine bradytrophe strain lc1697d 5argJ -,
leu 2-1) was transformed with pRIT10673 and pRITl0674. One
leucine-independent colony of the bradytrophe strain had
30 been transformed with pRIT10673 and is designated SO
cerevisiae strain lc1697d(pRIT10673). Another
leucine-independent colony, which had been transformed with
pRIT10674, is designated S. cerevisiae strain
lc1697d(pRIT10674).
* Trademark
' ,,~
- 20 ~ 7~7
Cultures of strains lc1697d(pRIT10673) and lc1697d
(pRIT10674) were grown in Yeast Nitrogen Base medium
supplemented with 20 ~g/ml arginine. The cells were
recovered and cell extracts were prepared as described
5 above. Claxified cell extracts of strain lc1697d
(pRIT10673) gave positive results in the Ausria~
radioimmunoassay at dilutions of up to 1/2048 whereas
extracts of strain lc1697d(pRIT10674) were uniformly
negative in this assay.
From these results, it is concluded that yeast cells
of strains DC5 and lc1697d transformed with pRIT10673
specifically synthesize HBsAg in the form of a fusion
protein having HBsAg determinants.
Exam~le 8. Immunization of Rabbits with ~BsAg from
S. cerevisiae strain lc1697d(pRIT10673)
S. cerevisiae strain lc1697d(pRIT10673) was grown to
an optical density at 620 um of 0.60 and collected by
centrifugation. The cells were resuspended at a 40-fold
20 concentration in PBS plus 1 mM PMSF. A clarified cell
extract was prepared as described in Example 7. A
clarified cell extract of strain lc1697d~pRIT10674) was
similarly prepared. These extracts were used to immunize
rabbits. A first group of six rabbits received parenteral
25 injections of 1 ml of extract of strain lc1697d(pRIT10673)
mixed with 1 ml of Freund's complete adjuvant on days 0, 9,
15, 30 and 37. A second group of three rabbits received
parenteral injections of 1 ml of extract of strain
lc1697d(pRIT10674) mixed with 1 ml of Freund's complete
30 adjuvant on the same days. Sera was obtained from both
groups on days 0 (pre-immune) 23, 51 and 65 and, from the
first group, on day ~4, and tested for the presence of
anti-~BsAg antibodies using the Ausab radioimmunoassay.
The results of these assays, which are given in Table 1,
35 show that four of six rabbits receiving injectio~s of
-- 21 ~ 7~7
extract from strain lc1697d(pRIT10673) produced antibodies
direeted against HBsAg. None of the three control rabbits
reeeiving injections of extract from strain
le1697d(pRIT10674) showed evidenee of produetion of
S anti HBsAg antibodies. From these results, it is eoneluded
that extracts of strain lc1697d(pRIT10673) eontain H~sAg,
which ean be used in a vaecine to stimulate protection
against HBV infection in humans without serious side
effectsO
TABLE I
PROD~CTION OF HBsAg A~'TIBODIES BY RABBITS I~ IZED ~'ITH CELL-FREE EXTP~hCTS
()F S. CERE~1ISIAE STRAI~S lc1697d(pRIT10673) and lc1697d(pRIT10674)
SOVRCE OF EXTRACT R~BBIT ANTI-HBsAg SERUI~ TITRE ~Y Ausa~) ASSAY
NU~5:BER DAY DAY DAY DAY DAY
0 23 44 51 65
Strain lc1697d 1 neg Deg 1/16 1/16 1/64
-(pRIT10673)
2 neg 1/1024 1/8192 1/8192 1/40g6-
1/8192
neg 1/64 1/16 1/16 1/16
4 neg 1/64 1/2048 1/1024 1/2048
r.eg /~. 024 1/2~6 1/1024 i'2048
6 neg 1/16 1/256 1/1024 112048
S;rain lc1697d
-(p~IT10674) 7 neg neg --- neg ---
8 neg 1/1 --- neg neg
9 ne~ neg --- neg neg
~'ighest dilution of serum gi~in~ a positive result in the Ausab~)~s Y
~2~7~3~
- 22 -
Example 9. Preparation of Plasmid, pRIq'10749, Containinq
the arg3 Regulatory Reqion, from pMC200
Purified pMC200 was digested with ~incII and
electrophoresed on a 10% acrylamide gel. A 1940 bp
5 fragment containing the ary3 regulatory region was
recovered from the gel by electroelution and ethanol
precipitation. About ~ ~g of the fragment was incubated
with 0.2 units of Bal31 exonuclease, for 1 to 3 seconds at
in 100 ~1 of buffer (pH 8.0) containing 12.5 mM
10 MgC12, 12.5 mM CaC12, 200 mM NaCl, 1 mM EDTA and 200 mM
tromethamine-HCl. The treated DNA was extracted with
phenol and precipitated with ethanol. A 1 jug aliquot was
incubated with T4 DN~ polymerase in the presence of
deoxynucleotide triphosphates to repair any single strand
15 extremities and was then digested with EcoRI endonucleaseO
This procedure produced DNA fragments of varying lengths
due to the resection with Bal31. Each fragment had a fixed
EcoRI extension at one end with the othe~ extremity being
blunt ended and located at some distance from the original
20 HincII site and the OCT protein initiation codon.
Fragments of about 1480 bp containing the arg3 regulatory
region were isolated by electrophoresis on a 7.5~
acrylamide gel followed by electroelution and ethanol
precipitation. This cut-back reyulatory region is
25 preferred because it can promote transcription leading to
synthesis of a protein devoid o~ OCT amino acid sequences,
as described in Example 10, below.
In a second series of reactions, pMC200 was digested
with XbaI and the 5' single strand extremities were filled
30 in or rendered blunt-ended, by incubation with T4 DNA
polymerase and deoxynucleotide triphosphates. This DNA was
digested with EcoRI and a large EcoRI-T4/Xbal fragment of
about 5700 bp, containing yeast D~A sequences located 3' to
the XbaI site, plus pBR32~ sequences, was purified by
35 electrophoresis, electroelution and ethanol precipitation.
- 23 ~ lZ ~ 2 ~ ~ ~
This fragment was mixed with and ligated to the 1480 bp
promotor-containing fragments.
The ligation mixture was used to transform competent
cells of E. coli K12 strain MM294. Transformants were
5 selected on ampicillin agar~ Plasmid DNA was isolated from
transformant colonies by the procedure described by
Birnboim et al., Nucl. Acid. Res., ~olume 7, 1513, (1979)
and were screened for presence of an XbaI site by digestion
with XbaIO An XbaI site was present only in those plasmids
10 in which the filled-in XbaI site on a fragment from the
second series of reactions was ligated to another fragment
from the first series which terminated in a 3' T residue so
as to restore an XbaI recognition sequence, TCTAGA, in a
new location. A plasmid possessing an XbaI site was
15 identifed as pRIT10749. A flow sheet illustrating these
manipulations is provided in Figure 6. E. coli K12 strain
MM294 (pRIT10749) was deposited in accordance with EPC
regulations and the Budapest Treaty in the American Type
Culture Collection, Rockville, Maryland, U.S.A~ on June 2,
20 1982 under accession number ATCC 39133.
A sample of pRIT10749 was digested with a combination
of BstEII and XbaI~ The size of the deleted arg3
regulatory region was estimated to be about 210 bp by
comparison with pMC200 which had been similarly digested
25 W7 th BstEII and XbaI and by reference to the known
molecular weights of fragments of phage ~ x17~ D~A
described by Fuchs et al. Gene, Volume 4, 1, (1978).
To determine the DNA sequence of the BstEII-XbaI
fragment of pRIT10749, plasmid D~A was digested with
30 BstEII, labelled with ~- P-ATP by exchange kination and
digested with BamHI endonuclease to liberate a 2000 bp
fragment which was purified by electroelution and ethanol
precipitation. D~A sequencing of the labelled fragment was
performed according to the chemical modification method
35 described by Maxam et al., Methods in_En~ymology, Volume
- 2~ 7
65, 499 (19~0). A part of this sequence was determined to
be CCCATCAACTTGTACACTCGT _AGA. The underscored nucleotides
were derived from the 5700 bp EcoRI-T4/Xbal fragment,
Comparison to the appropriate region of the D~A sequence
5 shown in Figure 4 indicates that the restored XbaI site is
located in the 5' untranslated leader region nine
nucleotides upstream of the original HincII site in the
pMC200 yeast DNA insert.
Example 10. Preparation of Plasmids, pRIT10759
and pRIT10761, Containing HBsAg and Regulatory Regions,
by Combining pRIT10749_with pRIT10601
pRIT10601 was digested with HhaI endonuclease, and
electorphoresed on a 7.5% acrylamide gel. A 1100 bp
15 fragment was recovered by electroelution and ethanol
precipitation~ The DNA sequence of part of this fragment
contains sequences corresponding to the known N-terminal
amino acid sequence of HBsAg of ayw serotype as described
by Peterson et al., Viral Hepatitis, G. No Vyas, S. N.
20 Cohen and R. Schmid, Eds., Franklin Institute Press,
Philadelphia, UoS~A~ ~ 1978, p.569. The fragment contains 6
nucleotides located 5' to the HBsAg initiation codon, the
complete HBsAg coding sequence and about 390 3'
non-translated nucleotidesO
DNA of plasmid pRIT10749 was digested with XbaI and
about 400 ng of this DNA was mixed with about 280 ng of the
purified HhaI fragment. The mixture was incubated with 0.5
units of T4 DNA polymerase for 30 minutes at 37 in 20 ~1
buffer (pH 7.5) containing 20 mM tromethamine-HCl, 10 mM
30 M~C12, 1 mM dithiothreitol, and 33 mM each of dATP, dCTP,
dGTP and dTTP. To this reaction mixture was added 2.5 Jul
of 1 mM ATP, 2.5 ~1 of 10 mM EDTA and 2 ~ul (2 units) of T4
DNA ligase and the mixture was incubated for 16 h at 15 .
The ligated mixture was used to transform competent
35 cells of Eo coli K12 strain MM294 with selection being made
- 25 - ~222~7
for ampicillin resistant transformants. Plasmid
preparations were made from several of these transformants
and analyzed by restriction endonuclease digestion and gel
electrophoresis. The results showed that the blunt-ended
5 HBV fr~gment had been inserted in both possible
orientations into the XbaI-digested pRIT10749. One such
plasmid, pRIT10761 contained the 1100 bp insert in the
correct orientation for transcription of the HBsAg sequence
from the ~3 promotor and gave a 271 bp fragment after
10 sequential digestion with BstEII and XbaI. It is
illustrated in Figure 7. A second plasmid, pRIT10759
contained the insert in the incorrect orientation and gave
rise to an estimated 1175 bp fragment on digestion with a
combination of BstEII and XbaI endcnucleases. The
15 nucleotide sequence at the arg3 regulatory region-HBsAg
insert junction was determined for pRIT10761, by sequencing
the 271 bp BstEII-XbaI fragment using the chemical
modification methods of Maxam et al., Methods in
Enzymologx, Volume 65, 499 (1980), after exchange kination
20 labelling of the XbaI terminus with y - P-ATPo The
sequence determined for the ar~3 regulatory region - HBsAg
junction is TACACTCGTCTACTGAACATGo It can be seen that the
XbaI restriction site was not completely repaired by the T4
DNA polymerase and that one guanine residue was lost. The
25 ar~3 non-translated leader region is immediately followed
by 6 nucleotides of HBV origin, CTGAAC, followed by the
HBsAg initiation codon, ATG, and the coding sequence of the
HBsAg structural geneO The HBsAg initiation codon is the
first initiation codon encountered downstream of the ~3
30 promotor. Therefore, translation of the mRNA transcribed
from the DNA will initiate at that codon and HBsAg
synthesized will be devoid of extraneous amino acid
residues. The HBsAg synthesized is not a fusion protein;
it is substantially structurally identical to authentic
35 HBsAg.
- 26 - ~2~2~7
Example 11. Preparation of Pl3~ IT10764 and
pRIT10765 by Combinin~l~RIT10761 with YEpl3 HindIII~
pRIT10761 and pRIT10759 were separately digested with
PstI and BamHI to destroy the pB~322 replicon moiety and
S then with HindIII to release the DNA fragment carrying the
inserted HBV DNA and the regulatory region. The DNA's were
extracted with phenol, precipitated with ethanol and
dissolved in bu~fer (pH 7.5) containing 0.01 M
tromethamine-HCl and 0.001 M EDTA. A 0.6 ~g portion of each
10 DNA preparation was se~arately mixed with 0.3 ~ug
HindIII-digested, alkaline phosphatase treated DN~ of
YEpl3 HindIII prepared as described above and the mixture
was ligated.
The ligated mixture was used to transform competent
15 cells of E. coli K12 strain MM294 with selection being made
for ampicillin resistant transformants~ One transformant
was shown to contain a plasmid, pRIT10764, consisting of
the HindIII fragment from pRIT10761 inserted on YEp
13HindIII. A further transformant was shown to contain a
20 plasmid, pRIT10765, consisting of the ~indIII fragment from
pRIT10759 inserted on YEp 13HindIII~ A flow sheet
illustrating the preparation of pRIT10761 and pRIT10764 is
provided in Figure 7.
.
Exam le 12 - Transformation of Yeast with
P
pRIT10764 and pRIT10765
pRIT10764 and pRIT10765 were isolated from cultures of
the transformants prepared in Example 11 by CsCl-ethidium
bromide density gradient centrifugation and 10Jug of each
30 was used to transform cells of yeast strain lc1697d as
described in Example 7 with selection being made for
leucine-independent transformants on regeneration agar.
One leucine-independent colony axising from these
transformations is designated strain lc1697d(pRITl0764)o
35 Another transformant is designated S. cerevisiae strain
- 27 - ~2~X7~
lc1697d(pRIT10765). Cultures of these strains were grown
at 30 in Yeast Nitrogen Base medium supplemented with 2%
glucose and 20 jug/ml arginine to an optical density at 620
~m of 0.80 to 0088. Cells were harvested and cell-free
5 extracts were prepared and assayed for HBsAg by the
Ausria ~ radioimmunoassay as described in Example 7.
Extracts of lc1697d(pRIT10764) gave positive results in
this assay at dilutions in PBS of up to 1/1024 whereas
undiluted extracts of strain lc1697d(pRIT10765) were
10 uniformly negative in this assay. From the genetic and
radiomimmunoassay evidence, it is concluded that cells of
S, cerevisiae strain lc1697d(pRIT10764) synthesize HBsAg
which can be used in a vaccine for stimulating protection
against HBV infection in humans without serious side
15 effectsO
