TELOMERIC DNA PROBE

SONDE D'ADN TELOMERIQUE

English Abstract

ABSTRACT
A DNA probe, designated 29C, comprises a telomeric
deoxynucleotide sequence from near the short arm ends of
the X and Y chromosomes wherein there exists a region of
hypervariability amongst unrelated individual members of
a population. The probe has application in paternity
determination and in the identification of individuals
and provides a useful addition to the range of probes of
this type which are used in forensic science and in
pathology.

Claims

THE EMBODIMENTS OF THE INVENTION IN WHICH AN EXCLUSIVE
PROPERTY OR PRIVILEGE IS CLAIMED ARE DEFINED AS FOLLOWS:
1. An isolated DNA comprising a telomeric
deoxynucleotide region of the short arm ends of X or Y
chromosomes, wherein said region is derived from the
human DNA cloned into cosmid CY29.
2. The DNA of claim 1, comprising a restriction
fragment of CY29 designated 29Cl.
3. The DNA of claim 2 wherein said fragment 29Cl
has a nucleotide sequence comprising:
<IMG>

4. An isolated DNA sufficiently complementary to
hybridize to the human DNA cloned in cosmid CY29.
5. The isolated DNA of claim 4 wherein said cloned DNA
comprises a restriction fragment of CY29 designated 29Cl.
6. The isolated DNA of claim 4 wherein said cloned DNA
comprises a 17-kb HindIII fragment.
7. The isolated DNA of claim 4 wherein said cloned DNA
comprises a 5.7-kb HindIII fragment.
8. The isolated DNA of claim 4 wherein said cloned DNA
comprises a 1.7-kb PstI restriction fragment of a 5.7-kb
HindIII fragment.
9. Cosmid CY29 comprising 3E7 DNA having a telomeric
deoxynucleotide sequence occurring in a polymorphic genetic
region proximate the short arm ends of X or Y chromosomes.
10. A DNA probe prepared from the DNA of claim 1.
11. A DNA probe prepared from the DNA of any one of
claims 2 to 9.
12. A transformed bacterium harboring the DNA of claim
1.
13. A transformed bacterium harboring the DNA of any
one of claims 2 to 9.
14. The bacterium of claim 12, wherein the bacterium
is E. coli.
15. The bacterium of claim 14 comprising
16

Escherichia coli strain HB101 harboring cosmid CY29
wherein said strain is assigned accession number ATCC
67573.
16. A method of identifying individuals comprising,
extracting DNA from a sample of DNA-containing cells of
the individual, digesting said sample with a restriction
endonuclease to produce a mixture of DNA fragments having
a variety of lengths, separating the fragments in
accordance with length, rendering the separated fragments
single stranded, hybridizing the single-stranded
fragments with a DNA probe of claim 10 and locating and
enumerating said hybridized fragments.
17. The method of claim 16, wherein the single-
stranded fragments are probed with at least one
additional DNA probe.
18. The method of claim 16 comprising the further
step of comparing the number and location of the
hybridized fragments derived from samples taken from
first and second individuals and noting similarities and
dissimilarities therebetween in order to establish the
presence or absence of a biological relationship between
the individuals.
19. The method of claim 18, wherein the samples are
taken from a child and a putative parent.
20. The method of claim 17 comprising the further
step of comparing the number and location of the
hybridized fragments derived from samples taken from
first and second individuals and noting similarities and
dissimilarities therebetween in order to establish the
presence or absence of a biological relationship between
the individuals.
17

21. The method of claim 20 wherein the samples are
taken from a child and a putative parent.
22. The method of claim 16, wherein hybridized
fragments derived from a first sample taken from an
individual of known identity and a second or subsequent
sample of unknown biological origin are compared to
establish whether said second or subsequent sample
originated from the known individual.
23. The method of claim 17, wherein hybridized
fragments derived from a first sample taken from an
individual of known identity and a second or subsequent
sample of unknown biological origin are compared to
establish whether said second or subsequent sample
originated from the known individual.
24. A kit of components for the generation of a
genetic profile, comprising a preparation containing at
least one restriction endonuclease and a preparation
containing a DNA probe of claim 10.
25. The kit of claim 24, wherein the preparation
containing said DNA probe contains at least one
additional DNA probe.
18

Description

1~955~`0
-- 1 --
Telomeric DNA Probe
This invention relates to a telomeric DNA probe and
its use in the identification of individuals by means of
their characteristic genetic profile. Although the probe
is of particular interest for the identification of human
individuals, it is applicable, with appropriate selection
of the source materials, to any primate species.
The genetic profile of each individual member of a
species is unique, with the notable exception of
identical twins. It is that uniqueness of the genetic
make-up which defines individuality and is responsible
for the infinite variation in living organisms. In the
same way that examination of the traces left by an
individual's fingerprints may be used to characterise and
so identify that individual from all others, examination
of the genetic profile (the "genetic fingerprint") will
also provide conclusive evidence of the individual's
identity. Genetic fingerprinting, however, uses samples
of body fluids or tissue such as blood, skin or semen
which contain the individual's cells inside which is
located the DNA which encodes the unique genetic
complement. Since the genes are carried by most of the
cells of an organism, there is a wide selection of
genetic material available for use in generating a
genetic fingerprint.
In general, the generation of a DNA fingerprint
requires the extraction of the DNA from the cellular
sample. The DNA is then degraded by treatment with one
or more restriction endonucleases, which are enzymes
which will cleave the double-stranded DNA at specific
sites. For example, the enzyme Smal is known to cleave
3~

lZ955fiO
DNA between the bases cytosine and guanine at loci where
there are adjacent triplets of cystosine (C) and guanine
(G); that is, at the sequence -C-C-C-G-G-G-, cleavage
occurring between the central -C-G-.
The result of the enzymic degradation of the DNA is
a mixture of fragments of DNA of differing length (or,
more accurately, molecular weight), the spectrum of
length distribution being unique to the individual's
genetic profile. The mixture may then be separated in
accordance with the lengths of the fragments by means of
gel electrophoresis, the distance travelled by each band
being related to the size of each fragment. The
electrophoretogram so produced is visualized, using an
analytically detectable reagent which is allowed to bind
(or hybridize) to the bands and which produces a
colorimetric or fluorimetric result or, most commonly, a
radioactively labelled agent, containing, for example,
phosphorus32. Autoradiography is a process in which
the electrophoretogram is laid on an unexposed
photographic plate or film and the radioactive emissions
from the radioactively labelled bands expose the film and
are visualized as dark bands on the developed film. More
usually, the method also involves an intermediate
technique known as Southern blotting where a sheet of
cellulosic film is laid on the gel and the bands are
transferred thereto by adsorption into the cellulosic
material giving a more easily handleable form to the
electrophoretogram.
An electrophoretogram produced in accordance with
the general principle described above is extremely
complex, having a vast number of bands and is extremely

lZ95S~iO
-- 3 --
difficult to interpret, so much so that it is impractical
for routine laboratory use. To render the DNA
fingerprinting technique more useful it is desirable to
analyze only a limited number of DNA fragments. For
example, one may be interested only in examining the
defective gene which is responsible for an inherited
disease, such as haemophilia, and so one would only
examine the bands of the electrophoretogram which contain
the fragments of that gene.
In order to restrict the visualization of the bands
to those of interest, materials known as DNA "probes" may
be used. DNA probes, or, in the context of this
application "gene probes", are relatively short
deoxynucleotide sequences, produced by recombinant DNA
(rDNA) techniques, which are complementary in structure
to a specific nucleotide sequence which is known to occur
only in fragments of the DNA (gene) of interest.
Within the structure of DNA there exist areas which
vary greatly from one individual to another, known as
"polymorphisms" and it is the examination of these
regions which is of interest in the determination of the
identity of individuals as the chance occurrence of two
unrelated individuals having the exactly the same
polymorphisms is remote. Thus, by designing probes which
detect base sequences occurring in the polymorphic
regions the characteristic genetic profile of the
individual may be visualized on the electrophoretogram of
the restricted DNA.
One application of the genetic fingerprinting
technique of the

1295560
type to which the present invention relates is in forensic
science where DNA fingerprinting may provide strong evidence for
presentation to a court in criminal cases. The DNA fingerprint
may be generated from semen deposited by a rapist or from
bloodstains and tissue traces left at the scene of violent
crimes. When compared with a fingerprint prepared in parallel
from a DNA sample taken from a suspect, the fingerprint will
indicate the involvement or otherwise of the suspect.
It is characteristic of sexually reproducing species that
offspring inherit one half of their genetic complement from each
parent. Examination of the genetic fingerprint of a child will
reveal DNA banding which also occurs in the genetic fingerprint
of each parent and thus the technique may be used to determine
with a high degree of certainty the presence or absence of a
blood relationship between individuals in addition to its more
general application in the identification of individuals. This
ability to determine blood relationship between individuals is of
interest in the production of evidence for paternity suits,
immigration disputes where establishment of a blood relationship
between a would-be immigrant and an already existing resident of
the country concerned is necessary before immigration is
permissible, identification of hitherto unidentifiable bodies,
and the reuniting of runaway children with their biological
parents.
United Kingdom Patent Application Number 2,135,774,
describes a method for the identification of individual
members of a species of organism by analysis of
DNA fragment length polymorphisms generated by the
action of restriction endonucleases on the DNA of
individuals. The sized, single-stranded DNA molecules
produced are hybridised with probe DNA and the
;

12~SS60
-- 5 --
number and the location of the hybridized fragments is
identified. The method may be used in paternity tests. The
said application contains full experimental details of the
procedures employed in the production of genetic fingerprints
and in the analysis of the results obtained.
on object of the present invention is to provide a DNA probe
for use in the generation of genetic fingerprints.
In accordance with an embodiment of the present invention
there is provided an isolated DNA comprising a telomeric
deoxynucleotide region of the short arm ends of X or Y
chromosomes, wherein the region is derived from the human DNA
cloned into cosmid CY29.
Other particular aspects of the present invention provide a
probe prepared from the above DNA and a transformed bacterium
harboring said DNA.
It is preferred that the above noted DNA comprises a
restriction fragment of CY29 designated 29Cl; it being
particularly preferred that the fragment 29Cl has a nucleotide
sequence comprising:
~ 70
GAGGGTclGGAGAT~GccccGAGG~GGTcccGATAG~c~ b~y7D~7G7c~cToclD~AGGGAA 140
GAAGCCGTCTGGTGTGGTCrGG~AAAnaGG~GCPGGGGGTClGGGGTGGTCCCGAG3GGPGGAGOGGG3G 210
_______________________ ______ ____________________ ___________
TCTGGGGTGGTCCCGAGGC~YX~Y3~3GGGGTCnGGGG'rGGTCCCGPGGGGAGG~iCGlGGGTCTGGGGT 280
_______________:,__________________________~ ______________
GGTCCCGAGGGGAGGAGC~GGGGGTTCT~GGTGTGGTCCCGTGGGIAGGPEGGGGGGTCTGGGGTGGTCC 350
___________ ___________ ______________~_______________~______
TAAGAGGAGGAGC ~GGG'~DG3GGrGGTCCCAGAGGX~Y~4~133GGG~CqGGGGIGGTCCCAGAGGGG 420
AGGA ~ TCTGGGGT&GTCCCGPG3GGAGGA ~ T ~ TGGICCC ~ 490
DG~bGDGDl~CGA ~ TICIGGGTGTGGTCCCGTGGGTAGGAGaGaG3GT 560
CT~ZGGATGGICCTAAGAGJ;iX~YX13GG3GTCTGCATGIGG~ T'n~hGGGGTGGAGCAlGGGGnCDCCC 630
TGTGGTICGGAGGGTGGAGCAGGGGGT~IGGGGTlGGTACITrlCGCCGGGACACCGCTAq ~ Tl'r 700
TGGT~cGGTTcccATclxcTGATcTGGGGGTccTTGTGATccl~AcGGcGoGccAGATGGG~GGGTcAAG 770
GT~AGGGAAGGAAGGAGT&GcAGcTTGGncccAGGGAGchG-~AAhGGGlTTGTGGTTcAGTrcTGATm~m 840
TGACCCATCCATAGGAGAAT&GACACCTCAGACTCTCTCAATCIIGGCCAG~G~CPaGICCCAGTAGCTG 9lO
CC3q~X~r~3GClGTCCTTGAGGCTCA~rGGAGGATA~ ATICIGGCAAATTTrAAAAAATTC 980
TTCTATAGATCTCAGTGAGTTCAAAGCTGCCTGTGTGCAGGCATAGATCCGTTCTTTGCIGAGCTICCAC l050
TCTAGTCGGCIGAAAGGAAAGGGTAATATA&CIGXZUUUY~GrAT~CTGGGGTGAT~AGAGGAT~CTACAT 1l20
TTcATcTTpyAAAGGGATATTGAcAGGAGAccAGAAcITccAGAq~ rGAATl~rcAAGAAcTAcTTc 1190
CAA~CCTGGACAATAn~xx~YXiYTCATCTCTACAAAATAAAAATTA~UATTX~ACGT~CG~TGG 1260
~ i~ CACACn~CD~rAGTCCCACCTWC~=n~AC~D=~r~b~ U~DOO~nC~C~rC~D~,X~G~ 1330
~.~

12~5~0
- 5a -
In accordance with another embodiment of the present
invention there is provided an isolated DNA sufficiently
complementary to hybridize to the human DNA cloned in cosmid
CY29.
It is preferred that the cloned DNA comprises a 17-kb
HindIII fragment, and particularly preferred that the cloned
DNA comprises a 5.7-kb HindIII fragment. In another
particularly preferred embodiment, the cloned DNA has a 1.7-kb
PstI restriction fragment of a 5.7-kb HindIII fragment.
In accordance with a further embodiment of the present
invention there is provided cosmid CY29 comprising 3E7 DNA
having a telomeric deoxynucleotide sequence occurring in a
polymorphic genetic region proximate the short arm end of X or
Y chromosomes.
The invention also provides the bacterium Escherichia coli
strain HB101 harboring the cosmid CY29 which expresses the
deoxynucleotide sequence of this invention and which was
deposited, pursuant to the Budapest Treaty, with the American
Type Culture Collection, 12301 Parklawn Drive, Rockville,
Maryland on December 8, 1987. The accession number, ATCC
67573, was assigned and the requisite fees were paid. The
strain will be made available if a patent office signatory to
the Budapest Treaty certifies one's rights to receive a
sample. The strain will be maintained for a period of at
least five years after the most recent request for a sample
and, in any event, for a period of at least 30 years after the
date of deposit. Should the culture die or be destroyed
during the effective term of the deposit, it will be replaced
with a viable culture of the same taxonomic description.
The invention also provides a method of identifying
individuals comprising, extracting DNA from a sample of DNA-
containing cells of the individual, digesting the said sample
with a restriction endonuclease to produce a mixture of DNA
fragments having a variety of lengths, separating the
fragments in accordance with length, rendering the separated

lZ95560
-- 6 --
fragments single stranded, hybridizing the single stranded
fragments with the DNA probe of this invention and locating
and enumerating the hybridized fragments.
Preferably the single-stranded fragments are
probedadditionally with other DNA probes hybridizing with
different DNA sequences, said additional probing being
effected simultaneously or separately from the probing with
the probe of this invention.
The method may also include the further step of comparing
the number and location of the hybridized fragments derived
from samples taken from individuals to be compared and noting
similarities and dissimilarities therebetween in order to
establish the presence or absence of a biological relationship
between the individuals.
The two samples may be taken from a child and putative
parent. As a matter of practice, however, the child's
fingerprint would be compared with those of both parents.
Should it be determined that the sizes of the DNA fragments of
the child are different from those of the putative father than
it may be concluded that he is not the biological father. The
statistical probability of paternity may be ascertained by
reference to the probability of the DNA of two random
unrelated individual members of a population having identical
restriction fragment sizes. It will be appreciated that the
rarer the recurrence of a fragment in the population at large
is the more conclusive will be the test. Reference is
directed to "Inclusion Probabilities in Parentage Testing"
(1983) ed. R.H. Walker, American Association of Blood Banks,
where the so-called "paternity index" is fully described. The
probe of this invention detects variable numbers of restricted
DNA fragments in different individuals. Where families are
involved the fragments can be assigned to one of two alleles
present on both XX chromosomes or on the X and the Y. The
number of different alleles in the population is thought to be
in excess of fifty.

12955~0
- 7 -
In a second type of analysis, hybridized fragments derived
from a first sample taken from an individual of known identity
and second or subsequent samples of unknown biological origin
may be compared to establish whether said second or subsequent
sample originated from the known individual.
The invention further provides a kit of components usable in
accordance with a set of procedural instructions, for the
generation of a genetic profile, comprising a preparation
containing one or more than one restriction endonucleases and
a preparation containing the DNA probe aforesaid either alone
or in combination with one or more additional DNA probes.
A further application of the probe of the present invention
is in the medical monitoring of bone marrow transplantation.
At intervals after transplantation, genetic profiles are
generated using the probe in the manner herein described from
samples of the DNA of the recipient of the transplant. These
profiles are compared with the profiles obtained from donor
DNA and the recipient's pre-transplant profile. Successful
engraftment is indicated by progressive change of the
recipient's profile to that of the donor and failure shown by
the recipient's profile remaining in, or reverting to, its
pre-transplantation condition.
The probe of this invention visualizes only a limited number
of restriction fragments, normally about four to six. This is
a desirable number since, on the one hand a small number of
DNA fragments may easily be separated electrophoretically, yet
the pattern of sequences (referred to as haplotypes) detected
by the probe are sufficiently variable within unrelated
individual members of a population to give that degree of
uniqueness which satisfies the criteria for utility in
determining individuality.
The probe of this invention is derived from the telomeric
regions of the sex chromosomes. Telomeres are base sequences
in DNA whose action is to preserve the integrity of linear
chromosomes during the meiotic and mitotic phases of cell

12~SStiO
division. Telomeric DNA is specialized to ensure complete
replication of the 3' ends of linear chromosomal DNA.
Human X and Y chromosomes display a pairing behaviour
distinct from that of the autosomes during meiosis but there
is evidence that they undergo an obligatory recombination
event which results in transposition of the telomeric
sequences from one chromosome to the other with the result
that sequences distal to the site of recombination are
inherited as though autosomal. The term "pseudoautosomal" has
been coined to describe such a region.
Despite intensive efforts to provide DNA probes for the
human X and Y chromosomes, no human X or Y-derived sequences
which are inherited in an autosomal manner have hitherto been
reported in the literature. Several sequences which are
highly homologous on both sex chromosomes have been found.
These sequences have arisen as a result of transposition of X
chromosome sequences on to the Y chromosome in primate
evolution but to positions which are non-homologous. For
example, in humans the STS locus which maps close to the tip
of Xp is clearly X-linked, implying that it must be more
proximal than a site of obligatory recombination. Also, MIC2,
a human locus which controls expression of a cell-surface
antigen 12E7, and which has alleles on Xp and Yp, shows a sex-
linked expression of a polymorphism in the levels of 12E7,
suggesting that MIC2 is also proximal to any obligatory
recombination site. However, the probe sequence 29Cl has been
found to be inherited pseudoautosomally following
transposition from one chromosome to a homologous position in
the telomeric region of the other. Similar behaviour has been
observed with the sex reversion factor (Sxr) and the STS locus
in the normal mouse.
The inheritance of human Xp and Yp telomeric sequences
provides a stringent test for the existence of a
pseudoautosomal region of the sex chromosomes since unless two
obligate recombinations events occur, these regions of the X
and Y chromosomes would have to show an autosomal pattern of
inheritance. It has been confirmed by the present inventors
that the telomeric regions of the X and Y chromosomes

1;~95560
are inherited as if autosomally located, as predicted by the
hypothesis that the X and Y chromosomes undergo an obligate
crossover between one pair of chromatids during meiosis.
With respect to the accompanying drawings, Figures lA, B
and C are restriction maps of, respectively,
- Xp and Yg chromosome termini;
- cosmid CY29; and
- expanded map of distal EcoRI fragments 29C;
Figures 2A, B and C are graphs of DNA from unrelated blood
cells digested with three different enzymes, respectively,
- EcoRI;
- HindIII; and
- PstI;
and Figures 3A, B and C are a genetic profile produced using
the probe of this invention with two different features.
The probe of the invention may be prepared as follows. A
cosmid CY29 was isolated from a cosmid library constructed
from DNA of 3E7 [Markus, M. et. al., Nature, 262, 63-65,
(1976)], a mouse-human hybrid with multiple Y-chromosome,
during a screen for OpG-rich sequences on the human Y-
chromosomes. Such sequences are frequently associated with
genes. The restriction map of 29C (Fig. 1), a subclone of
CY29, shows sites for HpaII and HhaI are clustered in the
region of the SstII sites and this is consistent with a OpG-
rich domain.
In greater detail, Fig. 1 shows restriction maps of:A. Xp and Yg chromosome termini;
B. Cosmid CY29 and,
C. Expanded map of distal EcoRI fragments 29C.
Maps in B and C were generated by end-labelling and
partial digestion. CY29 was selected from a cosmid library,
Bl

l;~95S~O
- 9a -
constructed from a partial MboI digest of 3E7 DNA by standard tech-
niques on the basis of hybridization to total human DNA, CY29 is
free from detectable mouse repeated sequences. CY29 was linearised
at the PvuI site, partially digested with the enzymes, indicated
and transferred to nitrocellulose by bidirectional transfer. One
filter was probed with the large PvuI-EcoRI fragment from the
cosmid vector pJB8 and the other with the smaller EcoRI-PvuI vector
fragment. Fragment sizes were measured and calculated according to
the method of Southern and Elder ~Elder, J. ~ Southern, E.M.;
Analyt. Biochem. 128 227-321 (1981)]. The map for 29C, a subclone
in pUC9, was generated by cleavage with BamHI, end-labelling with
DNA polymerase I Klenow fragment followed by re-cleavage with
HindIII (these sites occur in the vector polylinker) and partial
digestion with the enzymes shown. Enzyme sites are marked
~1

1295560
-- 10 --
as follows: B, BamHI; H, HindIII; Hh, HhaI: Hp, HpaII;
M, MboI; P, PstI; Pv, PvuI; R, EcoRI: S, SstII: and V,
EcoRV.
A panel of somatic cell hybrid DNA's was used to
confirm the chromosomal origin of this cosmid.
Reference is directed to Nature, Vol. 317, No. 6039,
pp. 687-692 where full details of this confirmation
are given. As well as confirming that the cosmid
contains Y-chromosome sequences, these experiments
also confirmed that this sequence is also present on
the X-chromosome. As would be predicted, both male
and female DNA's also contain sequences homologous to
this probe. Further testing, also reported in the
Nature paper referred to, confirmed that the probe
sequence occurs only on the X and Y and not on any of
the other chromosomes.
Further investigation has been carried out to
establish that telomeric location of the probe
sequence. The evidence from this investigation
strongly supports the argument that the probe is
indeed a chromosome end and details of the
investigation are to be found in the Nature paper
referred to above.
Reference is now directed to Fig. 2 which shows
the results of an investigation of the extent of the
polymorphisms in the probe region.
Fig. 2 shows DNA from nucleated blood cells of 22
unrelated randomly selected donors digested with three
different enzymes, namely:
A EcoRI;
B HindIII; and,
C PstI
Digestions were carried out under standard
conditions and the digests were reprobed with
29Cl. Transfer, hybridization, and washing were
as follows:

12~55~0
-- 11 --
DNA was digested with an excess of restriction
endonuclease (EcoRI in Fig. 2A; HindIII in Fig.
2B; and PstI in Fig. 2C) and the resulting
fragments were separated by electrophoresis in
0.8% agarose and transferred to a nylon filter.
The filter was hybridized with approximately 0.1
microgram of the probe 29Cl in 5% SSC, 5%
Denhardt's solution, 10% dextran sulphate at 68C
for 18 hours then washed at 68C in 0.1% SSC,
0.05% SDS and autoradiographed with
intensification. The size indicators in Fig. 2
are in kilobases.
It is clear from Fig. 2 that no two individuals
have identical patterns. Because the polymorphisms
are detected with different enzymes they cannot be due
to point mutations in restriction sites it also seems
to be unlikely that they represent variations in the
number of mini-satellite repeats in a block because
29Cl does not hybridize in conditions of reduced
stringency with two mini-satellite core sequences.
Since all the Pst fragments (Fig. 2C) detected by this
probe (which is itself a Pst fragment) are polymorphic
this probe cannot be flanking a polymorphic region but
must itself be polymorphic. Measurement of the copy
number of this sequence by titration gives an estimate
of between three and ten copies per haploid genome.
There is uncertainty about this estimate because the
nature of the sequence variability is unknown and
could affect the estimate of the copy number. It
would be necessary to clone this region from a number
of individuals to establish the basis of this extreme
polymorphism.
Sequences 29C4 and 29C2 which are immediately 5'
to the probe 29Cl, detect polymorphic HindIII and
EcoRI fragments as expected from the restriction map
of the
i
;~

1295560
- 12 -
cosmid (Fig. lB). These probes detect Pst fragments
which are not polymorphic and which are identical in
size in DNA's from both sexes. 29C3, in contrast,
detects polymorphic fragments (data not shown). This
suggests that 29Cl defines a boundary between
hypervariable and non-variable regions of the X and Y
chromosomes.
Analysis of five families has revealed no
examples of Y linkage of informative fragments in 25
meioses. In three families, however, one
uninformative fragment was present in both father and
mother. Fig. 3 presents the data of two of these
fully informative families.
In Fig. 3 there is presented the genetic profile
produced using the probe of this invention to show the
inheritance of 29Cl in two families. DNA from blood
samples were analyzed in the manner described in
respect of Fig. 2.
A Family 1, Pst (individuals are shown in the
same order as in Fig. 3B);
B Family l, EcoRI; and
C Family 2, EcORI.
The results are presented schematically above the
hybridization data with fragments assigned to
halotypes. Fragments detected by this sequence are
sufficiently polymorphic to provide a good check for
paternity. In further experiments, the number of
individuals analyzed with EcoRI was extended to 83 and
it has been found that no two individuals had
identical patterns. Family 2 is affected by X-linked
retinitis pigmentosa (XLRP). 29Cl shows either one or
three recombination in four meioses with this locus
(the family is uninformative for RFLP's tightly linked
to XLRP and so it is not possible to determine phase).
In Family I (Fig. 3A and B), X-linkage can be
excluded for all paternal fragments and it can be

1295560
.
- 13 -
demonstrated that two out of three daughters inherit a
paternal Y-chromosome fragment. The only assumption
can be that at least one copy of a sequence homologous
to 29Cl is always present on both the X and the Y
chromosomes, as is suggested by the cell hybridization
data. Considering only the second two generations in
the Pst digest (Fig. 3A) of these DNA's, the largest
fragment in the paternal sample is inherited by
daughters 1 and 3 but not by daughter 2 and is
therefore not X-linked. The next largest fragment is
inherited only by daughter 2 and is therefore not X-
linked and the smallest paternal fragment is not
inherited by the first daughter and so is also not X-
linked. Thus, although at least one of these
fragments must be located on the X-chromosome, non
behave genetically as if they were X-linked. In the
EcoRI digest (Fig. 3B), although one fragment is
uninformative in the second and third generations, one
fragment can be assigned to the paternal Y-chromosome.
The second largest fragment (fragment b in Fig. 3B) in
the grandfather is the only fragment inherited by the
father and therefore must be on the father's Y-
chromosome. Daughters 1 and 3 have inherited this
fragment presumably as a consequence of an X/Y
recombination in the father.
In Family 2 (Fig. 3C), it cannot be determined
which fragments are derived from the paternal Y
chromosome but no fragment is inherited by all the
sons. In both families there are two independently
segregating set of fragments in each individual which
show a mendelian pattern of inheritance (shown
schematically above the blots in Fig. 3). Fragments
in both the Pst and the EcoRI digests for Family 1 can
be fitted into the same sets which behave as
haplotypes. Although the family sizes are small this
supports the localization of these
,

lZ9~560
- 14 -
sequences to two loci, one on the X-chromosome and one
on the Y. Thus two out of three daughters carry a
paternal X-chromosome which is a product of an X/Y
recombination in the father of the Family l and three
out of six sons in Family 2 carry a Y-chromosome which
is an X/Y recombination product. This is consistent
with there being an obligate recombination event.