Language selection

Search

Patent 1332718 Summary

Third-party information liability

Some of the information on this Web page has been provided by external sources. The Government of Canada is not responsible for the accuracy, reliability or currency of the information supplied by external sources. Users wishing to rely upon this information should consult directly with the source of the information. Content provided by external sources is not subject to official languages, privacy and accessibility requirements.

Claims and Abstract availability

Any discrepancies in the text and image of the Claims and Abstract are due to differing posting times. Text of the Claims and Abstract are posted:

  • At the time the application is open to public inspection;
  • At the time of issue of the patent (grant).
(12) Patent: (11) CA 1332718
(21) Application Number: 1332718
(54) English Title: EXPRESSION CASSETTE FOR PLANTS
(54) French Title: CASSETTE D'EXPRESSION POUR PLANTES
Status: Expired and beyond the Period of Reversal
Bibliographic Data
(51) International Patent Classification (IPC):
  • C12N 15/82 (2006.01)
  • C12N 5/10 (2006.01)
(72) Inventors :
  • SLIGHTOM, JERRY L. (United States of America)
(73) Owners :
  • SEMINIS VEGETABLE SEEDS, INC.
(71) Applicants :
  • SEMINIS VEGETABLE SEEDS, INC. (United States of America)
(74) Agent: MACRAE & CO.
(74) Associate agent:
(45) Issued: 1994-10-25
(22) Filed Date: 1989-07-27
Availability of licence: N/A
Dedicated to the Public: N/A
(25) Language of filing: English

Patent Cooperation Treaty (PCT): No

(30) Application Priority Data:
Application No. Country/Territory Date
07/234,412 (United States of America) 1988-08-19
07/323,536 (United States of America) 1989-03-14
07/368,709 (United States of America) 1989-06-19

Abstracts

English Abstract


ABSTRACT
The present invention relates to an expression cassette which
can express a gene at high levels; to transformed bacterial and plant
cells which contain the expression cassette; to transgenic plants
which are produced from plant cells transformed with the expression
cassette; and to a process of producing transgenic plants which
exhibit a desired trait.


Claims

Note: Claims are shown in the official language in which they were submitted.


THE EMBODIMENTS OF THE INVENTION IN WHICH AN EXCLUSIVE PROPERTY OR
PRIVILEGE IS CLAIMED ARE DEFINED AS FOLLOWS:
1. A DNA plant expression cassette comprising:
a) a promoter;
b) an AT rich Cucumber Mosaic Virus (CMV) coat protein
gene 5' untranslated region;
c) an initiation region, said initiation region
comprising the sequence AAXXATGG;
d) a DNA molecule encoding a gene; and
e) a poly(A) addition signal; said poly(A) addition
signal containing untranslated flanking sequences; wherein
said promoter is upstream from said b) AT rich region;
said b) AT rich region is upstream from said initiation
region; said initiation region is upstream and operably
linked to said DNA molecule encoding a gene, and said gene
is upstream and operably linked to said poly(A) addition
signal.
wherein X is a DNA nucleotide selected from A, G, C and T.
2. A DNA plant expression cassette according to Claim 1
wherein said promoter is Cauliflower Mosaic Virus (CaMV) 35S
promoter.
3. A DNA plant expression cassette according to Claim 1
wherein said initiation region is derived from the 5' untranslated
region selected from the group consisting of the 5' untranslated
region of Cucumber Mosaic Virus (CMV) coat protein gene and the 5
untranslated region of SS RUBISCO gene.
32

4. A DNA molecule according to Claim 1 wherein said poly(A)
addition signal is selected from the group consisting of: the
poly(A) signal derived from Cauliflower Mosaic Virus (CaMV) 35S
gene; the poly(A) signal derived from phaseolin storage protein
gene; the poly(A) signal derived from nopalinesynthase gene; the
poly(A) signal derived from octopine synthase gene; the poly(A)
signal derived from bean storage protein gene; and, the poly(A)
signal derived from SS RUBISCO.
5. A DNA plant expression cassette according to Claim 2
wherein said poly(A) addition signal is derived from Cauliflower
Mosaic Virus (CaMV) 35s gene.
6. A DNA plant expression cassette according to Claim 1
wherein said gene is an antipathogenic gene.
7. A DNA plant expression cassette according to Claim 5
wherein said gene is an antipathogenic gene.
8. A DNA plant expression cassette according to Claim 6
wherein said antipathogenic gene is a coat protein gene.
9. A DNA plant expression cassette according to Claim 7
wherein said antipathogenic gene is a coat protein gene.
10. A transformed plant cell containing a DNA plant expression
cassette according to Claim 1.
33

11. A transformed plant cell according to Claim 10 wherein
said DNA plant expression cassette comprises:
a) a Cauliflower Mosaic Virus (CaMV) 35S promoter; and,
b) a poly(A) addition signal derived from Cauliflower
Mosaic Virus (CaMV) 35S gene.
12. A process for introducing a trait in a plant comprising
the steps of:
a) isolating a gene whose expression in a plant confers
said trait;
b) constructing a DNA plant expression cassette
according to Claim 1 comprising said isolated gene;
c) transforming plant cells with said DNA plant
expression cassette; and
d) regenerating plants from said transformed plant
cells.
34

Description

Note: Descriptions are shown in the official language in which they were submitted.


-1- i 3 ~ 2 ~ , 4634.P CNl
EXPRESSION CASSETTE FOR PLANTS
FIELD OF INVENTION
The present invention relates to an i~proved expression cassette
useful for expressing genes at high levels in transformed plants.
BACKGROUND OF THE INVENTION
Application of genetic engineerirlg techniques to improve plant
species can lead to plant species whlch exhibit increased resistance
to pathogens, which display an increased tolerance to severe or
erratic weather conditions and/or which are more nutritious. It ls
well established that the charac~eristics of pathogen tolerance,
weather tolerance and nutritional composition are produced by the
genetic makeup of the plant. Thus, introducing genetic material into
a plant can bring about preferred characteristics and, accordingly,
improved plant species.
The genetic factors which efect these desirable charactistics
include genes for peptide products whose presence confers desired
traits as well as those whose nucleotide sequences impede the
production of undesirable proteins. Plants which have antipathogenic
proteins present in the cells di.splay increased resistance to
pathogen challenge. ~eather tolerance can be conferred by the
production of certain proteins in plants. The nutritional value oE
plants is often related to the presence oi proteins and, in
particular, desirable amino acids which make them up. In addition to
genes which encode peptides that effect the various charActeris~ic~,
traits can be in~luenced by the presenca of RNA molacules which are
not translated, Thus, tha introduction of genatic informfltion can be
used to provide or supplement desirable traits in plants.
Genetic in~ormation may be introduced into plan~s which will
result in an increased rasistanca to pathogenic chnllanga. Specifi-
cally, ~he presence of an;~ipathogenic proteins can increasa resis-
tance against viral inEection as well as act as agents agianst
bacteria and other microrganisms. Furthermore, peptides which act as
pestlcides, fungicides and herbicides may be introduced and ex-
pressed. In addition to introducing genetic sequences which encode
such protein products, resistance to the same pathogenic agents may
coni`erred on a plant by introducing ~enetic information which can be
transcrlbed in the plant cell into RNA that will lnhlbit translation
o~ RNA encoding proteins which are necessary in pathogen challenge.
*

-2- ~ 3~27~
Tolerance to varying and severe climate conditions can be
conferred in plants by introduction of genetic information. The
presence of various proteins can provide plants with the ability to
adapt to and survive under sub-optimum climatic conditions. Genes
which confer traits that through evolution have developed in plants
that make them more adapted to survive cold, heat, drought or
flooding ior example, can be isolated. These genes can be introduced
into plants which lack them and the plants will exhibit the phenotype
the genes accord.
Similarly, the nutritional value of plants can be changed and
increased through ~the introduction of genetic information. Genes
encoding peptides and proteins comprised of amino acids which are
desirable may be introduced into plants. The genes are expressed and
the plant displays the improved composition accordingly.
The genes which are to be introduced into the plant may be
derived from any source. Many genes which cGnfer desirable traits in
one species of plants may be transferred to confer the trait in a
siecond, different plant. Antipathogenlc genes may be derived from
patho~ens. Genes may be synthesized. Alternatively, the genes may
be identical to those already found in the plant genome where they,
by providing multiple copies of the genes, will be introduced in
order to supplement and enhance the trait. Accordingly, heterologous
as well as endogenous genes may be introduced into plants to confer
~r supplement a desired trait.
Methods to introduce genetic material into plants are wid~ly
known ~o those skilled in the ar~. Extensive work has been done with
vectors of A~robacterium tumerfaciens. Additionally, genetic
material has b~en introduced into the genome of plants by imp~cting
plant cells with mlcropro~ectile~ coated with the ~enetic material.
When the genetlc material is introduced in~o the plant çells it can
be incorporated into the plant's genome and if linked to the proper
genetic regulatory elements, expressed. The expression of the
introduced genes can confer trait.s on the host plant.
In order to achieve expression of introduced genetic material,
the structural genes sought to be expressed must be linked to
regulatory sequences. These regulatory sequences include a promoter,
an initiation codon and a polyadenylation addition signal. Without
these elements operably linked to the gene qought to be expressed,

~3~2711 ~
-3-
expression cflnnot take place. Expression will take place when the
genetic material to be introduced is con.structed such that the gene
to be expressed is downstream of the promoter and initiation codon,
in proper reading frame with the initiation codon and upstream from
the polyadenylation addition signal.
Higher levels of expression are often desirable and can be
acheived with the additlon of genetic sequences in addition to those
minimally required. Untranslated regions flanking the promoter can
oiten lead to a higher level of gene expression. Similarly, un-
translated regions flanking the initiation codon can also result in ahigher level of expression. In addition, the sequences flanking the
poly A addition signal may lead to more efficient processing of the
RNA transcribed and gene expression accordingly.
Expression of the coat protein of tobacco mosaic virus, alfalfa
mosaic virus, cucumber mosaic virus, and potato virus X in transgenic
plants has resulted in plants which are resistant to infection by the
re~pective virus. In order to produce such transgenic plants, the
coat protein gene must be inserted into the genome of the plant.
Furthermore, the co~t protein gene must contain all the genetic
control sequences necessary for the expression of the gene after lt
has been incorporated into the plant genome.
The present invention relates to an improved expression cassette
for introducing desired genes into plants. This cassette comprises a
promoter, an AT rich 5' untranslated region, an initiation region
comprislng the sequence AAXXATGG, a gene and a poly(A) adtli~lon
signal which contains untranslated flanking regions, ~ccording to
the present invention, genes which are introduced into plAnts wlll be
expressed at high levels bacause the genetic regulatory saquences
controlling expres~ion facilitate such high expresslon.
INFORMATION DISCLOSURE
European patent application EP 0 223 452 describes plants that
are re~istant to viral diseases and methods for producing them. The
process described comprises the steps of transforming a plant with a
DNA insert comprising a promoter, a DNA sequence derived from the
vlrus, and a poly(A) addition sequence.
PCT patent application PCT/US86/00514 rafers to a method of
confarring resistance to a parasite to a hGst of the parasite,
An et al, (1985) "New cloning vehlcles for transformation of

- ~ 3 ~
higher plants", EMB0 J. 4:277-285 describe the construction of an
expression plasmid which may be stably replicated in both E. coli and
A. tumerfaciens.
An, G. (1986) "Development of plant promoter expresslon vectors
S and their use for analysis of differential ac~ivity of nopaline
synthase promoter in transformed tobacco cells", Plant Physiol.
81:86-91, reports ~ast differences in promoter activities of
transferred genes within ~he same cells AS well as in independently
derived cell lines.
Koæak, M. (1986) "Point mutations define a sequence flanking the
AU~ initiator codon that modulates translation by sukaryotic ribo-
somes", Cell 44:283-292, discloses the optimal sequence around the
ATG initiator codon of the preproinsulin gane for initiation by
eukaryotic ribosomes.
Loesch-Fries et al. (1987) "Expression of alfalfa mosaic virus
RNA 4 in transgenic plants confers virus resistance", EMBO J
6:1845-1851, dlsclose that expression of the coat protein gene of
alfalfa mosaic virus in transgenic plants confers resistance to
infection by the virus.
Mazur, B. J, and Chui, C.-F. (1985) "Sequence of a genomic DNA
clone for the small subunit of ribulose bis-phosphate
carboxylase-oxygenase from tobacco", Nucleic Acids Research
13:2373-2386, disclose the DNA sequence o the small subunit of
ribulose bis-phosphate carboxylase-oxygenase from tobacco.
Olson, M. K. et al ~1989) "EnhancemenC oE heterologous
polypeptide expression by alterations in the ribosome-binding~site
sequence", J. Biotech. 9 179-190, discloses the increase in gene
expression o~ heterologous genes in E. coli due ~o ~he pre~encQ of an
AT-rich 5' untranslated region.
Pietræak et A~ 8~) "Expression in plants of t~o bacterial
an~iblotic resistant genes after pro~oplast transformation with a new
plant expression vector", Nucleic Acids Research 14:5857-5868, dis-
close expression in plants of foreign genes introduced into the plant
using an expression vector containing a movable expression csssette
consistlng of tha Cauliflower mosaic virus 35S promoter and
transcription terminator sepera~ed by a polylinker containing several
unique restriction sites.
Powell-Abel et al. (1986) ~Delay of disease development in

5 ~3~7:~ 8
transgenic plants that express the tobacco mosaic vims co~t protein
gene", Science 232:738-743, disclose increased resistance toward
infectlo~ by tobacco mosaic virus in transgenic plants containing the
coat protein gene from tobacco mosaic virus.
Tumer et al. (1987) "Expression of alfalfa mosaic virus coat
protein gene confers cross-protection in transgenic tobacco and
tomato plantsn, EMBO J. 6:1181-1188, disclose transgenic tobacco and
tomato plants transformed with the coat protein gene of alfalfa
mosaic virus ~isplay increased resistance to infection by alfalfa
mosaic virus.
SUMMAR~ OF THE INVENTION
The present invention relates to an expression eassette which
can express a desired gene at high levels. The present invention
relates to nn expression vector which comprlses an expression
cassette. The high level expression vector of the present invention
eomprises: a promoter.; a 5' untransl~ted region which is at l~ast
60% A and T; an initiation codon comprising Kozak's element; a
cloning site where a desired gene may be inserted to form a
functional expr~ssion unit; and a 3' untranslated re~ion which
comprises a poly(A) additi~n signal and flanking sequence which
yields hiKh level expression. The present invention relates to
trnnsformed bacterial and plant cells which contain the expression
vector, The present lnvention relates to ~ransgenic plants which ar~
produc~d rom plant cells transformed with the expreasion vector.
2S Th~ presen~ invention relates to a proaess of producin~ transg~nic
plnnts with desirable traits by producing the plant~ from plan~ cells
which havc been transformed with an expression vector which contnins
~ene conierring SUC~I trai~s,
More particularly, the preaent in~ent.ion provide~ a
D~IA plant expre0~ion cu~ette oompri~ing: (a) a promoter;
(b)a Cuoumber Mosaic Virus (CMV) coat protein gene 5'
untranslated region; (c) an initiation region, the
ini-tiation region comprising the sequence AAXXATGG; (d) a
gene; and (e) a poly(A) addition signal, the poly(A)
addition ~ignal containing untranslated flanking
sequences; wherein the promoter is upstream from the (b)
:
. . .

- 5a - ~ r~ g
region; the (b) region i8 up~tream ~rom the initiation
region; the initiation region is upstream and operably
linked to the DNA molecule encoding a gene, and the gene
is upstream and operably linked to the poly(A) addition
aienal .
DETAILED DESCRIPTION OF THE INVENTION
Certain convention~ are used in Charts 1-9 to
illu~trate plasmids and DNA fragments as follows:
(1) The single line figures represent both circular
and linear double-stranded DNA.
(2) A~terisks (*) indicate that the molecule
represented i3 ¢ircular. Lack of an a~terisk
indicate~ that the molecule is linear.
(~) Junctions between the natural boundaries of
functional component~ are indi¢ated by vertical
lines along the
. " .~
"t

-6- ~3~ 3
horlzontal lines.
(4) Gene.s or functional coMponents are lndicated below the
horizontal lines.
(5) Restriction sites are indicated above the horizontal lines.
(6) Distances between genes and restriction sites are not to
scale. The figures show the relative positions only unless
indicated otherwise.
(7) The following abbreviations are used to denote function and
components:
a) Pc~ ~ CaMV35S promoter;
b) Ic ~ CMV intergenic region, the intergenic region
comprising the initiation codon and AT rich 5'
untranslated region;
c) SCa - CaMV35S poly(A) addition signal; and
d) Nos - Nos nptII gene.
Most of the recombinant DNA methods employed in practicing the
present invention are standard procedures, well known to those
skilled in the art, and described in detail in, for example, European
Patent Application Publication Number 223452 published November 29,
1986, ~nzymes are
obtained from commercial sources and are used according to the
vendor's recommendations or other variations known in the art.
General re~erences containing such standard techniques include the
following: R. Wu, ed. (1979) Methods in En~ymology, Vol~ 68; J. H.
Miller ~1972) Experiments in Molecular Genetlcs; T. Mani~tis e~
~1982) Molecular Cloning: A Laboratory Manual; ~. M. Clover, ad.
~1985) DNA Clonlng Vol, II; H,G. Polites and K.R. Marotcl (19~7) "A
s~op-wise protocol ior cDNA synthesis". Biotechniques 4:514~520,
S.B, Gelvin and R,A, Schilperoort, ed9, In~roduc~ion, Expression,
and Analysis oP Gene Products ln Plant~,
For the purposes of the present disclosure ~he following
definitions Por terms used herein are meant to apply.
"Expression cassette" means fl DNA frflgment which contains a gene
operably linked to regulatory sequences necessary for gene expres-
sion.
"Promoter" means a promoter which is functional in the host
plant.
. .; ~ ,. ~ .

p~
-7-
"Initiation region" includes the initiation codon and
nucleotides flanking the inltiation codon.
"Operably linked" refers to the linking of nucleotide regions
encoding specific genetic information such that the nucleotide
regions are contiguous, the functionality of the region is preserved
and will perform relative to the other regions as part of a
functional unit.
"AT rich 5"' untranslated reglon is a nucleotide sequence is
composed of at least 60~i adenine or thymine nucleotides.
"Untranslated flanking re~ion" refers to nucleotide sequences
which are 3' of the termination codon and end at the poly~A) addition
signal.
'~Vector" is a vehicle by means of which DNA fragments can be
introduced into host organisms.
"Expression vector" is a vehicle by means of which DNA fragments
that contain sufficient genetic information can be introduced into
host organisms and can, therefore, be expressed by the host.
"Antipathogenic gene" is a gene which encodes a DNA sequence
which is either the antisense sequence of a pathogenic gene or the
2Q antipathogenic gene encodes a peptide whose presence ln an organism
confe.rs an increased resistenca to a pathogen.
To practice the present invention, the gene sought to be
introduced into the plant's genetic material must be inserted into a
vector containing the genetic regulatory sequences necessary to
express the inser~ed gene. Accordingly, a vector must be constructod
to provide tho regulatory soquences such that they will be Eunctional
upon inserting a desirod geno, Whon the oxpression vector/insert
construct is assemblod, it is used to transform plant cells which are
then used to regonerate plan~s. Those tran~genic plants carry the
gene in the oxpresslon voctor/insert construct. Tho gene is
expressed in the plant and the trait which the gene influences wlll
be conferred upon the plant.
In order to express the gene, the necessary genetic regulatory
sequences must be provided. Both transcription and translation
signals are necessary for gene expression once the gene is
transferred and integrated into a plant genome. It must, therefore,
be engineered to contain a plant expressible promoter, a translation
initiation codon ~ATG) and a plant functional poly(A) additlon signal

-8- ~33~
(AATAM) 3' of its translation termination codon.
In the present lnvention, additional genetic regulatory
sequences are provided in order to obtain high levels of gene
expression. As described above, an expression vector must contain a
promoter, an intiation codon and a poly(A) addition signal. In order
to get a higher level of expression, untranslated regions 5' and 3'
to the inserted genes are provided. Furthermore, certain sequences
flanking the lnitiation codon optimize express~on. The promoter used
is one that ls chosen for high level expression.
A 5' untranslated region which results in higher level expres-
sion of an in~erted gene is provided downstream from the promoter and
upstream from the initiation codon. This region contains at least
60~ of the sequence as Adenlne and Thymine. l`here is a statistical
bias for expression when such an AT rich region is located between
the promoter and intiation codon. This preference is utilized in the
preferred embodiment of the present invention by inclusion of an AT
rich 5' untranslated region intermediate of the promoter and initi-
ation codon.
The present invention also contains a specific nucleotide
sequence flanking the initiation codon. This preferred sequence,
termed Kozak's element, is AAXXA~GG wherein X represents any of the
four nucleotides. The presence of the ~nitiation codon following
Kozak's rule results in higher level expression when used in an
expression vector. In the preferred embodiment of the present
invention, the small subunit of ribulose bis-phosphate
carbo~ylAse~oxygenase (SS RVBISC0) contains an initiation codon in
which Kozak's elemen~ is used.
Furthermore, the present invention contains n 3' untranslated
region downstream from the clonl.ng ~ite ~er~ th~ co~t protein gene
30 is in~ar~ad and ups~ream rom the poly(A) addition signal. The
sequenca of this 3' untranslated region res~lts in a statistical bias
for protein production. The sequence promotes high level expression.
The poly(A) addition signal is found directly downstream from the 3'
untranslated region and can be derived from the same source. In the
preferred embodiment of the present invention, the 3' untranslated
region and poly(A) addition signal are derived from CaMV 35S gene or
the phaseolin seed storage protein gene.
~ he poly(A) addition signal from CaMV, nopaline synthase,

_ 9 ~ o ! ~
octopine synthase, bean storage protein, and SS RUBISC0 genes are
also suitable for this construction. Several promoters which
function in plants are available, but the best promoters are the
constitutive promoter from cauliflower mosaic virus (CaMV, a plant
DNA virus) and the SS RUBISC0 gene.
Using methods well known to those having ordinary skill in the
art, plant cells are transformed with the vector construct and the
plant cells are induced to regenerate. The resulting plants contain
the coat protein genes and produce the coat protein. The production
of the protein confers upon the plant an increased resistance to
infection by the virus from which the coat protein gene was derived.
In addition, the expression vector of the present invention
comprises a DNA molecule comprising a promoter, an AT rich 5'
untranslated region, an initiation region, a gene and a
polyadenylation signal with untranslated flanking regions wherein the
promoter is upstream and operably linked to the AT rich 5' untrans-
lated region, the AT rich 5' untranslated region is upstream and
operably linked to the initiation region which is upstream and
operably linked to the antipathogenic gene which is upstream and
operably linked to the poly(A) addition signal.
The DNA molecule described above may comprise a promoter derived
from the Cauliflower mosaic virus CaMV 35S gene. The DNA molecule
comprising the expression vector described above may contain an AT-
rich 5' untranslated region is derived from the 5' untranslated
region of Cucumber mosaic virus CMV coat protein gene or SS RU~ISC0
gene, Similarly, the initiation region in the ~NA mol~cule described
above mAy be derived from the 5' ~mtranslated reglon of Cucumber
mo3alc vlrus C~V CoAt protein gene or SS RUBISCO gene. The initia-
tion region oE the DNA molecule described above comprlses the DNA
a~quence AAXXATGG. Furthermore, the DNA molecule describqd above mAy
compri~e n poly(A) adclitlon slgnal derived from either the Cauli-
flower mosaic virus CaMV 35S gsne; the phaselin storage protein gene,
the nopalinesynthase gene, the octopine synthase gene, the bean
storage protein gene or the SS RUBISC0 gene.
The expression vector described above may comprise a DNA
molecule in which the antipathogen gene is a viral pathogen coat
protein gene, a viral enzyme gene, a gene derived from a host gene or
an unrelated gene. Furthermore, the introduced gene may be for a

~3~7 ~ ~,
-10-
peptide which acts as a pesticide, a fungicide or a herbicide when
expressed in a plant. The gene may encode a peptide whose presence
confers tolerance to severe or eradic cllmatlc conditlons. The gene,
alternatively, may encode a proteln whose presPnce in a plant
enhances the nutritional value of the plant. The present invention
provides a recombinant DNA molecule which comprises any desired gene
operably linked to genetic regulatory elements necessary for high
expression in transformed plants. Moreover, the gene ~ay not be
required to be transcribed into a peptide. The gene may encode an
antisense strand to a nucleotide sequence forwhich inhibition of
translation is desirable.
The expression vector may be an Agrobacterium derived binary
vector. The expression vector may be used to transformed cells and
transgenic plants may be produced comprising the transformed cells.
DESCRIPTION OF THE PREFERRED F~BODIMENTS
Example 1 Isolation of WMVII RNA.
Watermelon mosaic virus II tWMV II) was propagated in zucchini
squash (Cucurbita pepo L) plants and RNA was isolated by the method
described by Yeh and Gonsalves (Virology 143:260, 1985).
Example 2 Isolation of PRV-p RNA.
Papayn ringspot virus strain prv (PRV-p) was propagated in ~elly
melon, Cucumis metuliferus tNand.) Mey. Acc. 2549 plants and RNA was
isolated by the method described by Yeh and Gonsalves (Virology
143:260, 1985).
Example 3 Isolation of ZYMV RNA.
Zucchini yellow mosaic viru~ (ZYMV) was propagated in zucchini
squash ~Cucurbita pepo L) plants and RNA was isolated by ~he method
described by Yeh and Gonsalves (Virology 143:260, 1985).
Example 4 Syn~hesls of Doublo~strandad cDNA.
'rha procedure ~Ised to make double stranded oDNA from lsolated
viral ~NA i9 the same for all viral RNA isolated above. The purified
RNA was sub~ected to the cDNA synthesis protocol described by Polites
and Marotti (Biotechniques 4:514, 1986) and because this RNA contains
an A-rich region at its 3'-end (similar to that found for many
eukaryotic mRNAs) the procedure was straight-forward. The synthesis
of double stranded cDNA was also done as described by Polites and
Marotti. APt~r double-stranded cDNA was synthesized, it was purified
by passage through a G-100 Sephadex* column, precipitated with
-trade mark
,

11 ~ 3 ~
ethanol, and suspended in 20 ~1 of lOX EcoRI methylase buffer (100 mM
NaCl, 100 mM Tris-HCl, pH 8.0, 1 mM EDTA, 80 ~M S-adenosyl methio-
nine, and 100 ~g/ml bovine serum albumin). An additional amount of
S-adenosyl methionine (1 ~1 of a 32 mM solution) was added to the
reaction mixture, followed by the addition of 1 ~1 (20 units) EcoRI
methylase. The reaction was incubated at 37C for 30 minutes and
stopped by incubation at 70C for 10 minutes Then 1 ~1 (5 units) of
E. coli DNA polymerase I Klenow fragment was added and incubated at
37~C for 10 minutes, followed by phenol/chloroform extraction and
ethanol precipitatLon. The pelle~ was washed in 70~ ethanol, then
70% ethanol/0 3 M sodium acetate. The pellet was dri~d and re-
suspended ln 8 ~1 of 0.5 ~g/~l phosphoryla~ed EcoRI llnkers (Col-
laborative Research, Inc., 128 Spring St., ~exington, MA 02173). One
~1 of lOX lLgase buffer (800 mM Tris-HCl ph 8.0, 200 mM MgC12. 150 mM
DTT, 10 mM ATP) and 1 ~1 of T4 DNA ligase (4 units) were added, and
the reaation was incubated overnight at 15C. The ligation reaction
was stopped by incubation at 65C ~or 10 minutes. Sixty ~1 of H20,
10 ~1 of lOX EcoRI salts (900 mM Tris-HCl pH 8.0, 100 mM MgC12, 100
mM NaCl), and 10 ~1 of EcoRI (10 units/~l) were added, and the
reaction was incubated at 37C for 1 hour. The reaction was stopped
by phenol/chloroform and chloroform extractions. The reaction
mixture was then size fractionated by passage through a Sephadex*G-
100 column and the fractions containing the largest double strande~
cDNA molecules were concentrated by butanol extraations, pr~aipita~ed
with ethanol, and resuspended in 10 ~1 of H20 Five ~1 of the double
~tranded cDNAs was added eo 0.5 ~g oi~ pUCl~ DNA (which h~ b~en
pr~vlously treated with phosphAtase to remove the 5' phosphates), 1
~1 o~ lOX ligase buer, and 1 ~1 of T4 llgase, and the r~action was
incubated a~ 15~ for 16 hours. The resulting liga~ed pUC19~coa~
pro~oin ~ene double stranded cDN~ moleculea were trans~ormed into
~,coli hoa~ cells aa described by the manui`acturer (Bethesda Reaearch
Lnboratories, Inc., Gaithersburg, MD 20877) and plated on medium
containing 50 ~g/ml ampicillin, 0.04 mM IPTG, and 0.004~ X-Gal.
Bacterial colonies showing no blue color were selected for further
analysis, Glones containing the 3'-region and posslbly the coat
protein gene were identified by hybridi~ation against a 32P-labeled
oligo-dT. Bacterial colonies showing hybridization to this probe
should contain at lea~t the poly(A) re~ion of the p~rticular po~y-
*Trade-mark

-12- ~ 3 `~
vlrus ~enome Several of the hybridizing bacterial clones were
selected and plasmid DNAs were isolated accordlng to methods known to
those skilled ln the art.
Example 5 Identification of the PRV-p Coat Protein Gene.
Several of the cloned cDNAs of PVP-p RNA were sequenced by the
chemical DNA sequencing method described by Maxam and Gilbert
(Methods of Enzymology 65:499, 1980). Based on this information and
comparative analysis with other potyviruses clone number pPRV-117 was
found to contain a complete copy of the PRV-p co~t protein gene. The
N-terminus of the co~t protein w~s identiiied by the locatlon of th~
dipeptide sequence Gln-Ser. The length of the PRV-p coat prot~in
gene coding region is consistent with a gene encoding a protein of
about 33 kDal.
Example 6 Construction of a Plant-Expressible PRV-p Coat Protein
Gene Cassette with CaMV 35S Promoter and Polyadenylation Signal and
CMV 5' ~ntranslated Region and Translation Initiator ATG.
Attachment of the necessary plant regulatory signals to the PRV-
p coat protein gene was accomplished by constructing a translational
fusion with a clone originally designed for ~he expression of the CMV
20 coat protein gene, using clone pUC1813/CPl9. Plasmid p~C1813/CPl9 is
a vector suitable for agrobacterium mediated gene transfer. An
~coRI-EcoRI fragment was removed from pDH51/CPl9 and placed into the
EcoR~ site of the plAsmid, pUC1813 ~available from Robert K.,
Department of Chemistry, Washington State University, Pullman,
25 Washington), creating plasmid pUC1813/CPl9. Th:l.s trans-
lational fusion clone w~s conatructed by flrst identiPying two
restriction enzyme s:ltes within clone pUC1813/CP19. One site ~Tthlll
I) is located between amino acids 13 to 17 while the other si~e (~stX
I~ ia located near ~he ond of the 3'-untranslated regiorl of the CMV
aoa~ pro~ein gen~.
Addition oE ~hese specific resitriction enzyme sites to the PRV-p
CoAt protein gene was accomplished by the polymerase chain reaction
technique, using an instrument and Taq polymerase purchased from
Perkin Elmer-Cetus, Emeryville, Ca. Specifically, two respective 5'
and 3' oligomers (CGACGTCGTCAGTCCMGAATGAAGCTGTG, contaLning a Tthlll
I site and (CCCACGAAAGTGGGGTGAAACAGGGTCGAGTCAG, containine ~ BstX I
.; ,
;

~ ~ ?~
-13-
site), sharing at least 20 nucleotides with the PRV-p coat protein
gene were used to prime synthesis and gene amplification of the coat
protein gene. After synthesis, the amplified fragments were digested
with Tthlll I and BstX I to expose the sites.
As shown in Chart 1, pUC1813/CPl9 is the expression vector which
contains the CMV coat protein gene. Plasmld pUC1813/CP19 contains
Tthlll I nnd BstX I sites.
The digested, amplified fragments are ligated into the respec-
tive exposed sites of pUC1813/CPl9 and the expected new constructlon
1~ was identified using methods known to those skilled ln the art.
Poly~erase chain reaction techniques were ~sed to amplify PRV-P coat
protein gene containing the TthlllI and BstXI sites. ~he plasmid
pUC1813/CP19 and PRV-P coat protein gene fragments were digested with
TthlllI and BstXI and ligated to each other. The resulting clone,
15 designated pUC1813/CP19-PRVexp, was subJected to nucleotide sequenc-
ing to ensure tha~ the cloning and gene amplification diA not
introduce any detrimental artifacts. The sequence showed no arti-
facts, suggesting that this plant expression cassette should be
capable of expressing a PRV-p coat protein gene which contains an
additional 16 amino acids of CMV coat protein at its N-terminus.
Example 7 Construction of a Micro T DNA Plasmid Containing the
Plant-expressible PRV-p Coat Protein Gene Construction.
As depicted in Chart 2, the plant expression cassette Eor the
PRV-p coat protein gene was transferred into a ~uitable micro T-DNA
vector which contains the necessary Agrobacterlum T-DNA tran~Eer
aignals for transfer Erom an Agrobacterium and integration into a
plant genome, and a wide host-range origin o~ replication (for
replication in Agrobacterium). Plasmid pUC1813/CPlg-PRVexp was
digested with Hind III and ttle resulting 2.2 kb inaert Eragment
contalning ~he plant axpressible cassette was removed and ligated
into the Hind III site ~f the modified Agrobacterium-derived micro-
vector pGA482 (modification included the addi~ion of the ~-glucuroni-
da~e gene). The micro T-DNA vector, pGA482, is available from G. An,
Institute of Biological Chemistry, Washington State University,
Pullman, WA. The resulting plasmid was deslgnated, pGA482/G/CPl9-
PRVexp and i9 shown in Chart 2. This plasmid (or derivatives
thereof) waa ~ransferred into virulent or avirulent strains of
Agrobacterium tumei`aciens or rhizogenes, such as A208, C58, LBA4404,
;~:' ~ ' ' . ' ~; ;''`,';'`` '.'," ''" '"';' ''' '"'';';' ' ' " " ' '

~ .
~3~2~3 ~3
-14-
C58Z707, A4RS, A4RS(pRiB278b), and others. Strnins A208 C5~,
LBA4404, and A4RS nre available from American Type Culture Collection
(ATCC), 12301 Parklawn Drive, Rockville, MD. Bacterla A4RS (pRiB-
278b)is ~vailable from Dr. F. Casse-Delbart, C.N.~.A., Routede Saint
Cyr. F78000, Versailles, France. Strain C58Z707 is available from
Dr, A.G.Hepburn, Dept. of Agronomy, University of Illinols, Urbana,
IL.
After transfer of the engineered plasmld pGA482/G/CP19-PRVexp
into any of the above listed Agrobacterium strains, these Agro-
bacterium strains can be used to transfer and integrate within a
plant genome the plant-e.xp~essible PRV-p coat protein gene contained
wlthin lts T-DNA region. This transfer can be accompliQhed using the
standard methods for T-DNA transfers whlch are known to those skllled
ln the art, or this transfer can be accompllshed using the methods
described in WO 89/5858, published June 29, 1989,
entltled "Agrobacterlum Mediated Trans-
formation of Germinating Plnnt Seedsn.
Example 8 Construction of a Plant-expresslon Cassette for
Expreasion of Varlous Genes ln Transgenlc Plants.
In the preferred embodiment of the present invention, the
followlng expression cassette was constructed to provide the neces-
sary plant regulatory slgnals (which include the addition o~ a
pro~oter, 5' untranslated region, translation initintion codon,
and polyndenyl~tion 3ignnl) to the gene inser~s in order to ~chleve
~5 high l~vel expression of ~he lnserts. The exprs.sslon cassette may be
used to expreas any genes inserted ~herein. ~ccordingly, the
~pplicability oE the expression aassetta goes beyond lts use in
expr~saine co~ protein genes. Rather, the expression cassette may
be used to exprass ,any desired protein in transgenlc pl~ants. ! The
expression cassette is the preferred expresslon system for expresslng
vlr~l co~t protein genes ln plants.
The expresslon cassette of the preferred embodiment contalns: a
constltutive promoter; a 5' untranslated reglon whlch enhances gene
expression; an lnitiation codon which comprlse Kozak's element; a
cloning site where the gene to be expressed may be inserted ~o
produce a func~ional expression unlt; and a 3' untranslated reglon
whlch comprises a poly(A) additlon signal and untranslated ~lanking
,
. ' ''~ . ` ' '.1
., . ~ ~.
I

-15-
regions which result in a hi~her level of expression.
More specifically, the expression cassette which is the prefer-
red embodiment of the present invention consists of the cauliflower
mosaic vlrus (CaMV) 35S transcript promoter, the 5'-untranslated
region of cucumber mosaic virus (CMV), the CMV translation inltiation
codon, and the CaMV polyadenylation signal. The construction of this
expression cassette utilized the Polymerase Chain Reaction (PCR)
technique to obtain correct position of the plant regulatory signals
and the addition of convenient restriction enzyme sites which allow
for the easy addition of a coat protein gene and the excision of the
completed cassette so it can be transferred to other plasmids.
To accomplish the construction of this expression essse~te the
following oligomers were synthesi~ed:
1. 5'-G MGCTTCCGGAAACCTCCTCGGATTCC-3', contains a HindIII site
at its 5'-end and contains 21 bases which are identical eo 21 bases
in the 5'-flanking region of CaMV.
2. 5'-GCCATGGTTGACTCGACTCAATTCTACGAC-3', contains a NcoI site
at its 5'-end which contains a tr~nslation initiation codon which
eonforms to Kozak's rules and has 21 bases which are identical to 21
bases in the antisense strand of the CMV S'-untranslated region.
3. 5'-GCCATGGTTGCGCTGAAATCACCAGTCTC-3', contains a NcoI site at
lts 5'-end (which contains the same translstion initiation codon as
oligomer 2) and has 20 bases which are identical to 20 bases in the
3'-untransla~ed region of CaMV.
4. 5'-GAAGCTTGGTACCACTGGATTTTGGTT-3', contains a HindIII ~ite
at its 3'-end and has a 20 base match with the flanking ~A region 3'
of the CaMV polyadenylation si~e (on the antisense strand),
These ollgomers were used to amplify sequene~ eontained within
the CMV expres~ion clone refarred to as pUC1813/CPl9, shown in Chart
1, and rei'erred ~o above. As depieted in Chart 3, the PCR teehni~ue
was used to ampli~y Ithe gene regulatory regions in p~C1813jCP19.
Amplifieation of the 5'-flanking, CMV 5'~untranslated region, and CMV
initiation eodon (which was modified to eonform to Kozak's rul~
AAXXATGG) resulted in a fragment oi` about 400 base pairs in length
and amplifieation of the CaMV 3-untranslated and flanking regions
resulted in a fragment of about 200 base pairs in length. These
fragments were digested with NeoI and HindIII, isolated from a
polyaerylamide gel, and then ligated into HindIII digested and

-16~ J i ~
phosphatase treated pUC18. The resulting clone is referred to as
pl8CaMV/CMV-exp and is shown in Chart 3.
Example 9 Identification of the WMVII Coat Protein Gene
The cloned l~ffVII cDNA insert from clone pWMVII-41-3.2 which was
produced as described above, was sequenced by using both the chemical
(Maxam and Gilbert, Methods of Enzymology 65:499, 1980) and enzymatic
(Sanger e. al., Proc. Natl. Acad. Sci. U.S.A. 74:5463, 1977) meth~ds.
Based on this information and comparative analysis with other
potyviruses, the nucleotide sequence of clone pWMVII-41-3.2 was found
to contain a complete copy of the WMVII coat proteln gene. The N-
terminus of the coat protein was suggested by the location of the
dipeptide sequence Gln-Ser. The length of tha WMVII coat proteln
gene coding region (281 amino acids) i9 consistent with a gene
encoding a protein of about 33 kD.
Example 10 Construction of a Plant-expressible WMVII Coat Protein
Gene Cassette with CaMV 35S Promoter and Polyadenylatlon Signal and
CMV Intergenic Region and Translation Initiator ATG.
As depicted in Chart 4, attachment of the necessary plant
regulatory signals to the WMVII coat protein gene was accomplished by
using the PCR technique to amplify the ~MVII coat protein gene using
oligomers which would add the necessary sites to its 5' and 3'
se~uences, Followlng this amplification tha resulting fragment is
digested with the appropriate restriction enzyme and cloned into the
NcoI site of the abo~e described expression cassette containing
plasmid, pl8CaMV/CMV-exp. Clones containing the WMVII coat protein
gena insert need only be checked to determine correct orientation
wlth respact with tha CaMV promotar. Howevor, to ensure that no
artifacts have been lncorporatsd during the PCR ampli~ication the
entire c04t protein gena region is checked by nucleotide sequence
analysis.
To obtnin the amplified WMVII coat protein gene with NcoI
restriction enzyme sites on both ends the follo~iDg two oligomars
were syntheqized:
1. 5'-ACCATGGTGTCTTTACAATCAGGAAAAG-3', which adds a NcoI site
to the 5'-end oi the WMVII coat protain gene and retains the same ATG
translation start codon which i9 present in the expression cassette,
pl8CaMV/CMV-exp.
2. 5'-ACCATGGCGACCCGAAATGCT MCTGTG-3', which adds a NcoI site

~L 3 ~
-17-
to the 3'-end of the WMVII coat protein gene, this site can be
ligated into the expression cassette, pl8CaMV/CMV-exp.
The cloning of this PCR WMVII coat protein gene, using these two
oligomers, into pl8CaMV/CMV-exp yields A plant expressible WMVII gene
(referred to as pl8WMVII-exp) which, following transcription and
translation, will generate a WMVII coat protein which is ~dentical to
that derived from the WMVII coat protein gene nucleotide sequence.
However, this coat protein will differ, because of necessary genetic
engineering to add the ATG initiation codon and by including the last
four amino acids of the 54 kD nuclear lnclusion protein (which is
adJacent to the Glu-Ser protease cleavage site); the amino acids
added are Val-Ser Leu-Glu-N-ter WMVII. The addition oE these four
amino acid residues should not aEfect the ability of this coat
prote~n to yield plants which are resistant to WMVII infections,
because the N-terminal region of potyvlrus coat proteins appear not
to be well conserved for eithsr length or amino acid identity.
However, if this is found to be a problem its replacement would
involve the use of a different oligomer to obtain N-terminal varia-
tions of the WMVII coat protein gene. The cloned construction of the
plant expressible WMVII coat protein gene is referred to as pl8WMV-
II-exp, and is shown in Chart 4.
Example 11 Construction of a Micro T-DNA Plasmid Containing the
Plant-expressible WMVII Coat Protein Gene Construction.
As depicted in Chart 5, the plant expression cas~ette for the
WMVII coat protein gene was transi`srred in~o a suitnble micro-T-DNA
vector which contains tho necessary Agrobacterium T-DNA transfer
3i~nals (to mediated transfer from an Agrobacteri~n and intRgration
into A plant ~enome) and wide-hos~ range origin o~ replication (~or
replic~ion in Agrob~cterium) to form plasmid pGA482/G/CPWMVII-exp.
To construct this plasmid, plasrnid pl8WMVII-exp was digested with
Hlnd III (which cuts within the polycloning sites of pUC18, well
outside of the expression cassette), and an 1.8 kb fragment contain-
inB the plant-expressible cassette was removed and ligated into the
Hind III site of the modified Agrobacterium-derived micro-vector
3S pGA482 (modification included the addition of the ~-glucuronidase
gene), The micro T-DNA vector, pGA482, is shown ln Chart 2 and
available from G. An, Institute of Biological Chemistry, Washington
StAte University, Pullman, WA. The resulting plasmid was designa~ed,

~ 3 ~
-18-
pGA482/G/CPWMVII-exp is shown in Chart 5. This plasmid (or deriva-
tives thereof) was transferred into virulent or avirulent strains of
Agrobacterium tumefaciens or rhi~ogenes, such as A208, C58, LBA4404,
C58Z707, A4RS, A4RS(pRiB278b), and others. Strains A208 C58,
S LBA4404, and A4RS are available from American Type Culture Collection
(ATCC), 12301 Parklawn Drive, Rockville, MD. Bacteria A4RS(pRiB-
27Bb)is available from Dr. F. Casse-Delbart, C.N.R.A., Routede Saint
Cyr. F78000, Versailles, France. Bacterin C58Z707 is avnilable from
Dr. A.G.Hepburn, Dept. of Agronomy, Unlversity of Illinois, Urbana,
IL.
After transfer of the engineered plasmid pGA482/G/CPWMVII-exp
into any of the above listed Agrobacterium strains, these Agrobac-
terium strains can be used to transfer nnd integrate within a plant
genome the plant-expressible WMVII coat protein gene contained wlthin
its T-DNA region. This transfer can be accomplished using the
standard methods for T-DNA transfers which are known to those skilled
in the art, or this transfer can be accomplished using the methods
described in WO 89/5858, published June 29, 1989,
~ n~itled "Agrobacterium Mediated Transformation of Germinating
Plant Seedsn. In addition, it has recently been shown that such
Agrobacteria are capabla of transferring and integrating their T-DNA
regions into the genome of soybean plants. Thus these strains could
be used to transfer the plant expressible WMVII coat protein Bene
in~o ~he genome of soybean to develop a soybean plant llne which is
ra~ ant to inf~ction from soybean mosaic vlrus ~trains~
Exnmple 12 MicroproJectile TransEer of p~MVII exp into Plant
Tias~es.
Recently an alternative approach for the trans~e~ and integra-
~ion o~ DNA into n plant genome has been daveloped. This technique
relies on the use of micropro~ectiles on which the DNA tplasmid form)
is attached. These micropro~ectiles are accelerated to high velocit-
ies and their momentum is used to penetrate plant call walls and
membranes. After penetration into a plant cell the attached DNA
leaches off the microproJectile and i8 transferred to the nucleus
where DNA repair enzymes integrate the "free" DNA into the plant
genome. In its present form the process is entlrely random, but
plant tissues which have been successfully transformed by the plasmid
DNA (or part of it) can be identii`ied and cultured to homogeneity by
; :

-19-
the use of selectable marker genes (such as the bacterial neomycin
phosphotransferase II gene, NPTII), or reporter genes (such as the
bacterial beta-glucuronidase gene, Gus). Successful use of particle
acceleration to transform plants has recently been shown for soybean
and the transfer of pl8WMVII-exp into the genome could result in
obtaining soybean plants which are resistant to infections from
soybean mosaic virus strains.
The use of this process for the transfer of pl8WMVII-exp can be
accomplished after the nddition of either plant expressible genes
NPTII or Gus genes or both. Plasmids that have the nptII and Gus
genes to pl8WMVII-exp are shown in Chart 6, and referred to as
pl8GWMVII-exp and pl8NGWMVII-exp. In addit~on, the construction
described in Example 11 can also be used for micropro~ectile transfer
as it already has both the np~II and Gus genes attached to the
pWMVII-exp cassette (see Chart 5). The only difficulty which ~he use
of pGA482GG/cpWMVII-exp may encounter during transfer by the micro-
projectile process is due to its large size, about 18~b, which may
have a lower efficiency transfer and such larger plasmid generally
yield less DNA during propagation.
To construct plasmid pl8GWMVii-exp, plasmid pl8WMVii-exp is
digested with BamHI and ligated with a 3.0 kilobase BamHI isolated
~ragment containing the Gus gene. To construct plasmid pl8NGWMVii-
exp, the plasmid pl8GWMVii-exp is digested with SmaI and ligated with
a 2.4 kb isolated fragment containing the Nos-nptII gene ~enernt~d by
digestion with Dral and Stul.
Example 13 IdentiPication of the ZYMV Coat Protein Gene.
The cloned ZYMV cDNA insert from clone pZYMV~15, which was
cloned using the method described above, wa9 sequonced by using both
the chcmical ~MAxam and Gilbert, Methods of Enzymology 65:499, 1980)
3~ flnd enzymatic ~Sanger et nl., Proc. Natl. Acad. Sci. ~.S.A. 74:5463,
1977) methods. Based on this information and comparative analysis
with other potyviruses the nucleotide sequence of clone pZYNV-15 was
found to contain a complete copy of the ZYMV coat protein gene. The
N-terminus of the coat protein was suggested by the location of the
dipeptide sequence Gln-Ser which is characteristic of cleavage sites
in potyviruses (see Dougherty et al. EMB0 J. 7:1281, 1988). The
length oi' the Z~MV coat protein gene coding region (280 amino acids)
i9 aonsl9tent with fl gene encoding a protein of about 31.3 kD.

-20-
Example 14 Construction of a Plant-expressible ZYMV Coat Pro~ein
Gene Cassette wlth CaMV 35S Promoter and Polyadenylation Signal and
CMV Intergenic Region and Translation Initiator ATG.
As depicted in Ch~rt 7, attachment of the necessary plant
regulatory signals to the ZYMV coat prote~n gene was accomplished by
using the PCR technlque to amplify the ZYMV coat protein gene using
oligomers which would add the necessary sites to its 5' and 3'
sequences. Following this amplification the re~ulting fragment is
digested with the appropriate restriction enzyme and cloned into the
NcoI site of the above expression cassette containlng plasmid,
pUC18CP-exp. Clones containing the ZYMV coat protein gene insert
need only be checked to determine correct orientation with respect
with the CaMV promoter. However, to ensure that no artiiacts have
been incorporated during the PCR amplification the entire coat
protein gene region is checked by nucleotide sequence analysis.
To obtain the amplifled ZYMV coat protein gene with NcoI
restriction enzyme sites on both ends the following two oligomers
were synthesized:
1. 5'-ATCATTCCATGGGCACTCM CCM CTGTGGC-3', which adds a NcoI
site to the 5'-end of th0 ZYMV coat protein gene and retains the same
ATG translation start codon which is present in the expression
cassette, pUC18cpexp.
2. 5'-AGCTM CCATGGCTAAAGATATCAAATA MGCTG-3', which adds a NcoI
site to the 3'-end of the ZYMV coat proteln g~ne, this ~lte can be
ligated into the expression cassette, pUCl8cpexp.
The cloning of this PCR ZYMV coat protein gene, using these two
oligo~rs, into pUC18cpexp yields a plant expressible ~YMV gene
~r~fRrr~d to as pUC18cpZY~) which following eran~cription and
translation will generat~ a ZYMV coat protein which i~ identical to
that derived from the ZYMV coat protein Benfl nucleotide sequance.
However, this coat protein will differ, because of necessary genetic
enginearing to add the ATG initiation codon followed by Gly, which is
the amino acid 3' ad~acent to the Ser of the polyprotein cleavage
site. The Gly amino acid residue was selected for the potentlal N-
terminal amino acld because many potyvirus coat proteins have eitheran Ser, Gly, or Ala at their N-terminal. However, if this is found
to be a problem its replacement would involve the use of a different
oligornar to obtain a different N-terminal amino acid for the ZYMV

~e~
-21-
coat protein. The cloned construction of the plant expressible ZYMV
coat protein gene is referred to pUC18cpZYMV, and is shown in Chart
7.
Example 15 Construction of a Micro T-DNA Plasmid Containing the
Plant-expressible ZYMV Coat Protein Gene Construction.
Following the teachings of Example 11 with appropriate modifica-
tions, the construction of a micro T-DNA plasmid containing a plant-
expressible ZYMV coat protein was constructed. Plasmid pUC18cpZYMV
(Chart 7) was digested with Hind III (which cuts within the poly-
cloning sites of pUC18, well outside of the expression cassette), anda 1.6 kb fragment containing the plant-expressible cassetta was
removed and ligated into the Hind III site of the micro-vector pGA482
(Chart 2). The resulting plasmid was designnted, pGA482GG/cpZYMV is
shown in Chart 8.
15After transfer of the engineered plasmid pGA482GG/cpZYMV into
Agrobacterium strains, the Agrobacteriu~ utrains can be used to
transfer and integrate within a plant genome the plant-expressible
ZYMV coat protein gene contained within $t9 T-DNA region.
Example 16 Micropro~ectile Transfer of pUC18cpZYMV into Plant
Tissues,
Following the teachings of Example 12, the micropro,~ectile
transfer technique can be used to introduce the ZYMV coat protein
gene with appropriate genetic regulatory sequences into plant
tissues.
25The use of this process for the transPer of pUC18cpZ~MV can be
accompllshed sPter the nddition oP either plant expres~ible genes
NPTII or Gus genes or both, Plasmids thnt have the nptII and Gus
genes to pUC18cpZYMV are shown in Chart 9 and referred to ns pUC18Gc-
pZYMV and pUC18NGcpZYMV. In addition, the construction described in
30Examplu 15 can ~190 be used fnr microproJectile trans~er a3 it
nlready ~as both the np~II and Gus genas attached to the pUC18cpZYMV
cassette (see Chart 8). The only difficulty which the use of pGA4-
82GG/cpZYMV may encoun~er during transfer by the micropro~ectile
process i5 due to its large size, about 18kb, which may have a lower
efficiency transfer and such larger plasmid generally yield less DNA
during propagation.
To construct plasmid pUC18GCPZYMV, plasmid pUC18CPZYMV ls
digested with BamHI and ligated to a 3.0 BamHI isolated fragment
~,,,,",,,"~ ",~ ,"~ "..,",~"~,:','`,:"~

-22- ~ 3 ~
which contalns the Gus gene. To construct plasmid pVC18GCPZYMV,
plasmid pVC18GCPZYMV is digested with SmaI and ligated with a 2.4 kb
isolated fragment containing the Nos nptII gene isolated by digestion
with DraI and StuI.
: .;

r- .
-23~ 7. i~
CHARTS
CHART 1
pPRV117
*, I I *
IPRV-p Coat Protein Gene
pUC1813/Cpl9
HindIII NcoI TthlllIBstXI NcoI HindIII
* _l I I I I I - I ~ . I , I I I - ~ * , .
I PCa I Ic ¦ ¦CMV Coat Protein Gene¦ I Sca
2~
pUC1813/Cpl9-PRVexp
HlndIII NcoI TthlllI BstXI NcoI HindIII
cn I Ic ~ CMV ¦ PRV p Coat--~t- - I *
Coat Protein
(16AA) gene
j ~ I ' ' ` j ! '

~ e~ 7.~ Ji ,~ ~)
-24-
CHART 2
5 pGA482
HindIII
I Br I I NOS I I CaMV I I BL
Gus
Gene
pGA482/G/CPl9-PRVexp
NindIII TthlllI BstXI HindIII
¦Br¦ ¦ Nos ~ ¦PCalIcl CMV I PRV-p Coat ~ ¦sC81 ¦CaNV¦ IBLI
Coat Protein Gus
30Protein Gene Gene
(16AA)

~3~7~
-25-
CHART 3
HindIII NcoI NcoI HindIII
1¦ Pca ¦ Ic l lSca
pl8CaMV/CMV-exp
HindIII NcoIHindIII
* ~ I --I ---. *
I Pca ¦ Ic ¦ I Sca

~ 3 ~
-26-
CHART 4
p~ 41-3.2
* I I *
¦WMVII Coat Protein¦
Gene
PCR Generated Gene
NcoI NcoI
¦ WMVII Coat Protein Gene¦
pl8~MVII-exp
HindIII NcoI NcoI HindIII B~mHI SmaI
* I ~ I - ............... ~ 1 1 1 1 1 * .
I PCa I Ic ¦WMV Coat Protein I I Sc~ ¦
Gene

~` ~ 3~
CHART 5
pGA482/G/CPWMVII-exp
HindIII NcoI NcoI HindIII
* I I I 11 1 1 11 ~I ~ I I *
rl I Nos ll Pca I Ic I WMVII Coat ¦¦ SCa ¦ ¦ CaMV ¦ IBL¦
Protein Gus
Gene Gene
: I I ' ~ ! '

-28-
CHART 6
pl8GWMVII-exp
HindIII NcoI NcoI HindIII BamMI BamHI SmaI
PCa I Ic ¦ WMV Coat II Sca I¦ CaMV
Prote$n Gus
Gene Gene
pl8NGWMVII-exp
HindIII NcoI NcoI HindIII Ba~HI Bam~lI
IPCal IC I~VII coatl I Sca I I CaMV ¦ ¦ No~ ¦
Protein Gu~
Gene Gen~
::~

:L3~27~ ~
-29-
CHART 7
pZYMV-15
* I l *
¦ZYMV Coat Protein¦
Gene
ZYMV Coat Protein Gene
Ncol NcoI
IZYMV Coat Protein Gene¦
pUC18CpZYMV
HindlII NcoI NcoI HindIII Ban~lI SmaI
35 * . ~ I *
PCa I Ic ¦ZYMV Co~t Protein¦¦ Sca ¦
Gene

~ 3 ~
-30-
CHART 8
5 pGA482/GG/cpZYMV
HindIII NcoI NcoI HindIII
Br I I Nos I Pca I Ic I ZYMV Coat ¦ ¦ SCa ¦ ~ CEIMV ¦ IBL~
Protein Gus
Gene G~ne
. , I ,; ~
,: '

-31- ` ~3~2~
CHART 9
pUC18GCpZYMV
HindIII NcoI NcoI HindIII BamHI BamHI SmaI
¦PcpIICIZYMV co~tlIScaI ¦ CaMN ¦
Protein Gus
Gene Gene
pUC18NGCpZYMV
~5
HindlII NcoI NcoI HindIII BamHI Ban~lI
* 11 1 -~ L 11 1 1 1 1 *
IPCal Ic ¦ZYMV Co~t 1I Sca I¦ CaMV I 1 No5 ¦
30 Proteln Gu~
Gene Gene
" , , i I , .

Representative Drawing

Sorry, the representative drawing for patent document number 1332718 was not found.

Administrative Status

2024-08-01:As part of the Next Generation Patents (NGP) transition, the Canadian Patents Database (CPD) now contains a more detailed Event History, which replicates the Event Log of our new back-office solution.

Please note that "Inactive:" events refers to events no longer in use in our new back-office solution.

For a clearer understanding of the status of the application/patent presented on this page, the site Disclaimer , as well as the definitions for Patent , Event History , Maintenance Fee  and Payment History  should be consulted.

Event History

Description Date
Inactive: IPC expired 2018-01-01
Time Limit for Reversal Expired 2002-10-25
Letter Sent 2001-10-25
Grant by Issuance 1994-10-25

Abandonment History

There is no abandonment history.

Fee History

Fee Type Anniversary Year Due Date Paid Date
MF (category 1, 3rd anniv.) - standard 1997-10-27 1997-10-24
Registration of a document 1997-11-18
MF (category 1, 4th anniv.) - standard 1998-10-26 1998-10-26
MF (category 1, 5th anniv.) - standard 1999-10-25 1999-09-16
MF (category 1, 6th anniv.) - standard 2000-10-25 2000-10-16
Owners on Record

Note: Records showing the ownership history in alphabetical order.

Current Owners on Record
SEMINIS VEGETABLE SEEDS, INC.
Past Owners on Record
JERRY L. SLIGHTOM
Past Owners that do not appear in the "Owners on Record" listing will appear in other documentation within the application.
Documents

To view selected files, please enter reCAPTCHA code :



To view images, click a link in the Document Description column. To download the documents, select one or more checkboxes in the first column and then click the "Download Selected in PDF format (Zip Archive)" or the "Download Selected as Single PDF" button.

List of published and non-published patent-specific documents on the CPD .

If you have any difficulty accessing content, you can call the Client Service Centre at 1-866-997-1936 or send them an e-mail at CIPO Client Service Centre.


Document
Description 
Date
(yyyy-mm-dd) 
Number of pages   Size of Image (KB) 
Cover Page 1995-08-30 1 54
Claims 1995-08-30 3 140
Abstract 1995-08-30 1 62
Drawings 1995-08-30 1 11
Descriptions 1995-08-30 32 1,836
Maintenance Fee Notice 2001-11-22 1 178
Fees 1996-10-03 1 52
Examiner Requisition 1991-04-29 2 68
Prosecution correspondence 1991-07-08 5 112
Examiner Requisition 1993-09-15 2 100
Prosecution correspondence 1993-12-14 3 35
PCT Correspondence 1994-08-10 1 21