Note: Descriptions are shown in the official language in which they were submitted.
-
13359 67
PATENT
Case No. 2313
CHARACTERIZATION AND DETECTION OF SEQUENCES
ASSOCIATED WITH INSULIN-DEPENDENT DIABETES
This invention relates to HLA class II beta genes and
proteins associated with insulin-dependent diabetes and methods for
5 their diagnostic detection.
Insulin-dependent diabetes mellitus (IDDM), a chronic
autoimmune disease also known as Type I diabetes, is a familial
disorder of glucose metabolism susceptibility for which is associated
with human leukocyte antigens (HLA). The development of IDDM can be
divided into six stages, beginning with genetic susceptibility and
ending with complete destruction of beta-cells. G. Eisenbarth, N.
Eng. J. Med., 314:1360-1368 (1986). More than 90~ of all IDDMs carry
the DR3 and/or DR4 antigen, and individuals with both DR3 and DR4 are
at greater risk than individuals who have homozygous DR3/3 or DR4/4
15 genotypes. L. Raffel and J. Rotter, Clinical Diabetes, 3.50-54
(1985); L. Ryder et al., Ann. Rev. Genet., 15:169-187 (1981).
The HLA region, located on the short arm of chromosome 6,
encodes many different glycoproteins that have been classified into
two categories. The first category, class I products, encoded by the
2 0 HLA-A, -B, and -C loci, are on the surface of all nucleated cells and
function as targets in T-cell recognition. The second category, class
II products, encoded by the HLA-D/DR region, are on the surface of B
lymphocytes, macrophages and activated T cells. Of all the
immunologically defined polymorphisms, the HLA-DR region has been
25 found to be most strongly associated with IDDM. Therefore,
restriction fragments of the HLA class II-~ DNA have been analyzed for
use as genetic markers of insulin-dependent diabetes mellitus. D.
Owerbach et al., Diabetes, 33:958-964 (1984); O. Cohen-Haguenauer et
al., PNAS (USA), 82:3335-3339 (1985); D. Stetler et al., PNAS (USA),
82:8100-8104 (1985).
Allelic variation in the class II antigens is restricted to
the outer domain encoded by the second exon of the protein. Serologic
2 133596~
methods for detecting HLA class II gene polymorphism are not capable
of detecting much of the variation detectable by DNA methods.
Many HLA DR~ sequences have been published previously. The
sequence AspIleLeuGluAspGluArg was reported by Gregersen et al., PNAS
(USA), 83:2642-2646 (1986) as part of a study of the diversity of DR~
genes from HLA DR-4 haplotypes. No mention was made of association
with diabetes. In addition, J. Gorski and B. Mach, Nature, 322:67-70
(1986) reported on HLA-DR polymorphism within a group including the
haplotypes DR3, DR5 and DRw6. The nucleotide sequences found in the
polymorphic regions at the ~I locus were not discussed regarding
association with diabetes. The first publication on HLA sequences
from diabetics is that by D. Owerbach et al., Immunogenetics, 24:41-46
(1986). This paper bases the study on a HLA-DR~ gene library from one
IDDM patient. The analysis of class II polymorphism and disease
susceptibility requires the comparison of many sequences derived from
patients and HLA-matched controls.
Allelic variations may be detected independently of
restriction site polymorphism by using sequence-specific synthetic
oligonucleotide probes. Conner et al., PNAS (USA), 80:278 (1983).
This technique has been applied to study the polymorphism of HLA DR-
~using Southern blotting. Angelini et al., PNAS (USA), 83:4489-4493
(1986).
A further refinement of the technique using sequence-
specific oligonucleotide probes involves amplifying the nucleic acid
sample being analyzed using selected primers, four nucleotide
triphosphates, and an appropriate enzyme such as DNA polymerase,
followed by detecting the nucleotide variation in sequence using the
probes in a dot blot format, as described in copending Canadian
Application No. 526,476 filed December 30, 1986.
There is a need in the art for subdivision of the serologic
markers HLA DR3 and DR4 to obtain more informative and more precisely
defined markers for susceptibility to IDDM.
Accordingly, the present invention provides a series of four
DNA markers and four protein markers corresponding thereto which are
strongly associated with IDDM.
3 133S9~7
Specifically, in one aspect, the present invention provides
a DNA sequence from the HLA class II beta genes associated with
insulin-dependent diabetes mellitus selected from the group consisting
of:
1) GAGCTGCGTAAGTCTGAG,
2) GAGGAGTTCCTGCGCTTC,
3) CCTGTCGCCGAGTCCTGG, and
4) GACATCCTGGAAGACGAGAGA,
or the DNA strands which are complementary thereto.
In another aspect, the invention provides an amino acid
sequence from the HLA class II beta region of the human genome
associated with insulin-dependent diabetes mellitus selected from the
group consisting of:
1) Glu Leu Arg Lys Ser Glu,
2) Glu Glu Phe Leu Arg Phe,
3) Pro Val Ala Glu Ser Trp, and
4) Asp Ile Leu Glu Asp Glu Arg.
In a third aspect, the invention relates to a process for
detecting the presence or absence of sequences associated with
2 0 Su sceptibility to insulin-dependent diabetes mellitus in a DNA sample
comprislng:
(a) treating the sample to expose the DNA therein to
hybridization;
(b) affixing the treated sample to a membrane;
(c) treating the membrane under hybridization conditions
with a labeled sequence-specific oligonucleotide probe capable of
hybridizing with one or more of the four DNA sequences identified
above or with the DNA strands complementary thereto; and
(d) detecting whether the probe has hybridized to any DNA
in the sample.
In a fourth aspect, the invention provides an antibody that
binds to one or more of the four amino acid sequences identified
above.
4 13~5~67
In a fifth aspect, the invention provides a serological
process for detecting the presence or absence of sequences associated
with susceptibility to insulin-dependent diabetes mellitus in a
protein sample comprising:
(a) incubating the sample in the presence of one or more of
the antibodies described above that are labeled with a detectable
moiety; and
(b) detecting the moiety.
In a sixth aspect, the invention provides a kit for
detecting the presence or absence of sequences associated with
susceptibility to insulin-dependent diabetes mellitus in a DNA sample,
which kit comprises, in packaged form, a multicontainer unit having
one container for each labeled sequence-specific DNA probe capable of
hybridizing with one or more of the four DNA sequences identified
15 above or with the DNA strands complementary thereto.
In a final aspect, the invention provides a kit for
detecting the presence or absence of sequences associated with
susceptibility to insulin-dependent diabetes mellitus in a protein
sample, which kit comprises, in packaged form, a multicontainer unit
20 having a container for an antibody labeled with a detectable moiety
that binds to one or more of the four amino acid sequences identified
above.
As mentioned above, genetic susceptibility to IDDM has been
correlated in both family and population studies with the presence of
25 the serologic markers HLA DR3 and DR4. The highest risk for IDDM is
associated with HLA DR3,4 heterozygotes, suggesting that the
susceptible alleles associated with these two DR types may be
different and that two doses may be required for high risk to IDDM.
Prev;ous restriction fragment length polymorphism analysis has
subdivided DR3 and DR4 into two subsets each. Molecular analyses of
the HLA genes herein has resulted in further subdivision of the HLA
DR3 and DR4 serological types and in the generation of novel, more
informative, and more precisely defined genetic markers for
susceptibility to IDDM. The molecular techniques herein reveal not
-
1335967
only that the number of class II loci is unexpectedly large, but also
that the allelic variation at these loci is greater than the
polymorphic series defined by serological typing and can be more
precisely localized.
The terms "oligonucleotide" as used herein is defined as a
molecule comprised of two or more deoxyribonucleotides or
ribonucleotides, preferably more than three. Its exact size will
depend on many factors, which in turn depend on the ultimate function
or use of the oligonucleotide. The oligonucleotide may be derived
synthetically or by cloning.
The term "sequence-specific oligonucleotides" refers to
oligonucleotides which will hybridize to one of the four specific DNA
sequences identified herein, which are regions of the locus where
allelic variations may occur. Such oligonucleotides have sequences
spanning one or more of the DNA regions being detected and are
specific for one or more of the regions being detected. One sequence-
specific oligonucleotide is employed for each sequence to be detected,
as described further hereinbelow.
The term "monoclonal antibodies" as used herein refers to an
immunoglobulin composition produced by a clonal population (or clone)
derived through mitosis from a single antibody-producing cell. Unless
otherwise indicated, the term is not intended to be limited to
antibodies of any particular mammalian species or isotype or to
antibodies prepared in any given manner. The term is intended to
include whole antibody molecules as well as antigen-binding fragments
(e.g., Fab, F(ab')2, Fv).
An "antibody-producing cell line" is a clonal population or
clone derived through mitosis of a single antibody-producing cell
capable of stable growth in vitro for many generations. The term
"cell line" refers to individual cells, harvested cells, and cultures
containing cells so long as they are derived from cells of the cell
line referred to. Preferably the cell lines remain viable for at
least about six months and maintain the ability to produce the
specified monoclonal antibody through at least about 50 passages.
6 1335967
As used herein, the term "incubation" means contacting
antibodies and antigens under conditions that allow for the formation
of antigen/antibody complexes (e.g., proper pH, temperature, time,
medium, etc.). Also as used herein, "separating" refers to any
method, usually washing, of separating a composition from a test
support or immobilized antibody, such that any unbound antigen or
antibody in the composition are removed and any antigen/antibody
complexes on the support remain intact. The selection of the
appropriate incubation and separation techniques is within the skill
of the art.
HLA class II beta genes have been isolated from HLA-typed
IDDM patients and HLA-matched controls and have been sequenced,
resulting in four regions of specific nucleotide and amino acid
sequence which occur in various combinations and which are associated
with IDDM. These specific sequences can be used in DNA or protein
diagnostic procedures to determine genetic susceptibility to IDDM.
The four variant sequences A-D found to be associated with
IDDM are shown below. In each case, DNA sequences seen in the
diabetic genomes produce an alteration in one to three amino acid
residues (underlined) of the DR-beta protein. The amino acids
normally found in these positions are shown in parentheses.
A. .... .......GluLeuArgLysSerGlu
.... .......GAGCTGCGTAAGTCTGAG
.... .......CTCGACGCATTCAGACTC
(Val,Ser,Leu,Pro,Asp,Ala)
B. .... GluGluPheLeuArgPhe
... GAGGAGTTCCTGCGCTTC
... CTCCTCAAGGACGCGAAG
(Tyr,Asn,Ser,Asp)
30 C. ..... ProValAlaGluSerTrp
... CCTGTCGCCGAGTCCTGG
... CCGCAGCGGCTCAGGACC
(Asp,Ser) (Tyr)
D. ........... AspIleLeuGluAspGluArg
... GACATCCTGGAAGACGAGAGA
... CTGTAGGACCTTCTGCTCTCT
(Leu,Phe) (Gln,Arg,Glu) (Lys,Arg,Ala)
-
1335967
Table I below shows the IDDI~ susceptibility and variation within the
DR3 and DR4 haplotypes. Table II shows the correlation between the
haplotypes and sequences A-D identified above. Sequences A, B and C
are correlated with B8, DR3 vs. non B8, DR3 haptotypes.
TABLE I
DR3 DR4
DR~1 Not variable Variable (5)
DRR3 Variable (3) Not variable
TABLE II
Sequence
10 Type Gene A B C D
DR4 beta-I - - - +
DR6 beta-I - - - +
DR6 beta-III - + +
DR3 beta-III + + +
15 DR3 beta-III + + - +
DR3 beta-III - +
The above-mentioned DNA sequences may be detected by DNA
hybridization probe technology. In one example, which is not
exclusive, the sample suspected of containing the genetic marker is
20 spotted directly on a series of membranes and each membrane is
hybridized with a different labeled oligonucleotide probe that is
specific for the particular sequence variation. One procedure for
spotting the sample on a membrane is described by Kafotos et al.,
Nucleic Acids Research, 7:1541-1552 (1979).
Briefly, the DNA sample affixed to the membrane may be
pretreated with a prehybridization solution containing sodium dodecyl
sulfate, Ficoll, serum albumin and various salts prior to the probe
being added. Then, a labeled oligonucleotide probe that is specific
to each sequence to be detected is added to a hybridization solution
similar to the prehybridization solution. The hybridization solution
is applied to the membrane and the membrane is subjected to
hybridization conditions that will depend on the probe type and
length, type and concentration of ingredients, etc. Generally,
133G967
hybridization is carried out at about 25-75C, preferably 35 to 65C,
for 0.25-50 hours, preferably less than three hours. The greater the
stringency of conditions, the greater the required complementarity for
hybridization between the probe and sample. If the background level
is high, stringency may be increased accordingly. The stringency can
also be incorporated in the wash.
After the hybridization the sample is washed of unhybridized
probe using any suitable means such as by washing one or more times
with varying concentrations of standard saline phosphate EDTA (SSPE)
(180 mM NaCl, 10 mM Na2HP04 and 1 M EDTA, pH 7.4) solutions at 25-75C
for about 10 minutes to one hour, depending on the temperature. The
label is then detected by using any appropriate detection techniques.
The sequence-specific oligonucleotide that may be employed
herein is an oligonucleotide that may be prepared using any suitable
method, such as, for example, the organic synthesis of a nucleic acid
from nucleoside derivatives. This synthesis may be performed in
solution or on a solid support. One type of organic synthesis is the
phosphotriester method, which has been utilized to prepare gene
fragments or short genes. In the phosphotriester method,
oligonucleotides are prepared that can then be joined together to form
longer nucleic acids. For a description of this method, see Narang,
S. A., et al., Meth. Enzymol., 68, 90 (1979) and U.S. Patent No.
4,356,270. The patent describes the synthesis and cloning of the
somatostatin gene.
A second type of organic synthesis is the phosphodiester
method, which has been utilized to prepare tRNA gene. See Brown, E.
L., et al., Meth. Enzymol., 68, 109 (1979) for a description of this
method. As in the phosphotriester method, the phosphodiester method
involves synthesis of oligonucleotides that are subsequently joined
together to form the desired nucleic acid.
Automated embodiments of these methods may also be
employed. In one such automated embodiment diethylphosphoramidites
are used as starting materials and may be synthesized as described by
Beaucage et al., Tetrahedron Letters, 22:1859-1862 (1981). One method
for synthesizing oligonucleotides on a modified solid support is
9 1335967
described in U.S. Patent No. 4,458,066. It is also possible to use a
primer which has been isolated from a biological source (such as a
restriction endonuclease digest).
The sequence-specific oligonucleotide must encompass the
5 region of the sequence which spans the nucleotide variation being
detected and must be specific for the nucleotide variation being
detected. For example, four oligonucleotides may be prepared, each of
which contains the nucleotide sequence site characteristic of each of
the four DNA sequences herein. Each oligonucleotide would be
hybridized to duplicates of the same sample to determine whether the
sample contains one or more of the four regions of the locus where
allelic variations may occur which are characteristic of IDDM.
The length of the sequence-specific oligonucleotide will
depend on many factors, including the source of oligonucleotide and
15 the nucleotide composition. For purposes herein, the oligonucleotide
typically contains 15-25 nucleotides, although it may contain more or
fewer nucleotides. While oligonucleotides which are at least 19-mers
in length may enhance specificity and/or sensitivity, probes which are
less than 19-mers, e.g., 16-mers, show more sequence-specific
20 discrimination, presumably because a single mismatch is more
destabilizing. If amplification of the sample is carried out as
described below prior to detection with the probe, amplification
increases specificity so that a longer probe length is less critical,
and hybridization and washing temperatures can be lowered for the same
25 salt concentration. Therefore, in such as case it is preferred to use
probes which are less than 19-mers.
Where the sample is first placed on the membrane and then
detected with the oligonucleotide, the oligonucleotide must be labeled
with a suitable label moiety, which may be detected by spectroscopic,
30 photochemical, biochemical, immunochemical or chemical means.
Immunochemical means include antibodies which are capable of forming a
complex with the oligonucleotide under suitable conditions, and
hiochemical means include polypeptides or lectins capable of forming a
complex with the oligonucleotide under the appropriate conditions.
35 Examples include fluorescent dyes, electron-dense reagents, enzymes
-
1335967
capable of depositing insoluble reaction products or being detected
chronogenically, such as alkaline phosphatase, a radioactive label
such as 32p, or biotin. If biotin is employed, a spacer arm may be
utilized to attach it to the oligonucleotide.
In a "reverse" dot blot format, a labeled sequence-specific
oligonucleotide probe capable of hybridizing with one of the four DNA
sequences is spotted on (affixed to) the membrane under
prehybridization conditions as described above. The sample is then
added to the pretreated membrane under hybridization conditions as
described above. Then the labeled oligonucleotide or a fragment
thereof is released from the membrane in such a way that a detection
means can be used to determine if a sequence in the sample hybridized
to the labeled oligonucleotide. The release may take place, for
example, by adding a restriction enzyme to the membrane which
recognizes a restriction site in the probe. This procedure, known as
oligomer restriction, is described more fully in EP Patent Publication
164,054 published December 11, 1985.
In an alternative method for detecting the DNA sequences
herein, the sample to be analyzed is first amplified using DNA
20 polymerase, four nucleotide triphosphates and two primers, as
described more completely in copending Canadian Application Serial No.
526,476 filed December 30, 1986. Briefly, this amplification process
involves the steps of:
(a) treating a DNA sample suspected of containing one or
25 more of the four IDDM genetic marker sequences, together or
sequentially, with four different nucleotide triphosphates, an agent
for polymerization of the nucleotide triphosphates, and one
deoxyribonucleotide primer for each strand of each DNA suspected of
containing the IDDM genetic markers under hybridizing conditions, such
30 that for each DNA strand containing each different genetic marker to
be detected, an extension product of each primer is synthesized which
is complementary to each DNA strand, wherein said primer(s) are
selected so as to be substantially complementary to each DNA strand
containing each different genetic marker, such that the extension
35 product synthesized from one primer, when it is separated from its
1335g~7
complement, can serve as a template for synthesis of the extension
product of the other primer;
(b) treating the sample under denaturing conditions to
separate the primer extension products from their templates if the
5 sequence(s) to be detected are present; and
(c) treating the sample, together or sequentially, with
said four nucleotide triphosphates, an agent for polymerization of the
nucleotide triphosphates, and oligonucleotide primers such that a
primer extension product is synthesized using each of the single
strands produced in step (b) as a template, wherein steps (b) and (c)
are repeated a sufficient number of times to result in detectable
amplification of the nucleic acid containing the sequence(s) if
present.
The sample is then affixed to a membrane and detected with a
15 sequence-specific probe as described above. Preferably, steps (b) and
(c) are repeated at least five times, and more preferably 15-30 times
if the sample contains human genomic DNA. If the sample comprises
cells, preferably they are heated before step (a) to expose the DNA
therein to the reagents. This step avoids extraction of the DNA prior
20 to reagent addition.
In a "reverse" dot blot format, at least one of the primers
and/or at least one of the four nucleotide triphosphates used in the
amplification chain reaction is labeled with a detectable label, so
that the resulting amplified sequence is labeled. These labeled
25 moieties may be present initially in the reaction mixture or added
during a later cycle. Then an unlabeled sequence-specific
oligonucleotide capable of hybridizing with the amplified sequence(s),
if the sequence(s) is/are present, is spotted on (affixed to) the
membrane under prehybridization conditions as described above. The
amplified sample is then added to the pretreated membrane under
hybridization conditions as described above. Finally, detection means
are used to determine if an amplified sequence in the DNA sample has
hybridized to the oligonucleotide affixed to the membrane.
Hybridization will occur only if the membrane-bound sequence
35 containing the variation is present in the amplification product.
13~5967
12
The amplification method provides for improved specificity
and sensitivity of the probe; an interpretable signal can be obtained
with a 0.04 ~9 sample in six hours. Also, if the amount of sample
spotted on a membrane is increased to 0.1-0.5 ~9, non-isotopically
labeled oligonucleotides may be utilized in the amplification process
rather than the radioactive probes used in previous methods. Finally,
as mentioned above, the amplification process is applicable to use of
sequence-specific oligonucleotides less than 19-mers in size, thus
allowing use of more discriminatory sequence-specific
oligonucleotides.
In a variation of the amplification procedure, a
thermostable enzyme, such as one purified from Thermus aquaticus, may
be utilized as the DNA polymerase in a temperature-cycled chain
reaction. The thermostable enzyme refers to an enzyme which is stable
to heat and is heat resistant and catalyzes (facilitates) combination
of the nucleotides in the proper manner to form the primer extension
products that are complementary to each DNA strand.
In this latter variation of the technique, the primers and
nucleotide triphosphates are added to the sample, the mixture is
heated and then cooled, and then the enzyme is added, the mixture is
then heated to about 90-100C to denature the DNA and then cooled to
about 35-40C, and the cycles are repeated until the desired amount of
amplification takes place. This process may also be automated.
The invention herein also contemplates a kit format which
comprises a packaged multicontainer unit having containers for each
labeled sequence-specific DNA probe. The kit may optionally contain a
means to detect the label (such as an avidin-enzyme conjugate and
enzyme substrate and chromogen if the label is biotin). In addition,
the kit may include a container that has a positive control for the
probe containing one or more DNA strands with the sequence to be
detected and a negative control for the probe that does not contain
the DNA strands having any of the sequences to be detected.
One method for detecting the amino acid sequences in a
protein sample that are associated with IDDM involves the use of an
immunoassay employing one or more antibodies that bind to one or more
1335967
13
of the four amino acid sequences. While the antibodies may be
polyclonal or monoclonal, monoclonal antibodies are preferred in view
of their specificity and affinity for the antigen.
Polyclonal antibodies may be prepared by well-known methods
which involve synthesizing a peptide containing one or more of the
amino acid sequences associated with IDDM, purifying the peptide,
attaching a carrier protein to the peptide by standard techniques, and
injecting a host such as a rabbit, rat, goat, mouse, etc. with the
peptide. The sera are extracted from the host by known methods and
screened to obtain polyclonal antibodies which are specific to the
peptide immunogen. The peptide may be synthesized by the solid phase
synthesis method described by Merrifield, R. B., Adv. Enzymol. Relat.
Areas Mol. Biol., 32:221-296 (1969) and in "The Chemistry of
Polypeptides" tP. G. Katsoyannis, ed.), pp. 336-361, Plenum, New York
(1973). The peptide is then purified and may be conjugated to keyhold
limpet hemocyanin (KLH) or bovine serum albumin (BSA). This may be
accomplished via a sulfhydryl group, if the peptide contains a
cysteine residue, using a heterobifunctional crosslinking reagent such
as N-maleimido-6-amino caproyl ester of 1-hydroxy-2-nitrobenzene-4-
sulfonic acid sodium salt.
The monoclonal antibody will normally be of rodent or humanorigin because of the availability of murine, rat, and human tumor
cell lines that may be used to produce immortal hybrid cell lines that
secrete monoclonal antibody. The antibody may be of any isotype, but
is preferably an IgG, IgM or IgA, most preferably an IgG2a.
The murine monoclonal antibodies may be produced by
immunizing the host with the peptide mentioned above. The host may be
inoculated intraperitoneally with an immunogenic amount of the peptide
and then boosted with similar amounts of the immunogenic peptide.
Spleens or lymphoid tissue is collected from the immunized mice a few
days after the final boost and a cell suspension is prepared therefrom
for use in the fusion.
Hybridomas may be prepared from the splenocytes or lymphoid
tissue and a tumor (myeloma) partner using the general somatic cell
hybridization technique of Koehler, B. and Milstein, C., Nature,
14 1335967
256:495-497 (1975) and of Koehler, B. et al., Eur. J. Immunol., 6:511-
519 (1976). Preferred myeloma cells for this purpose are those which
fuse efficiently, support stable, high-level expression of antibody by
the selected antibody-producing cells, and are sensitive to a medium
such as HAT medium. Among these, preferred myeloma cell lines are
murine myeloma lines, such as those derived from MOPC-21 and MOPC-11
mouse tumors available from the Salk Institute, Cell Distribution
Center, San Diego, California, USA, or P3X63-Ag8.653 (653) and Sp2/0-
Ag14 (SP2/0) myeloma lines available from the American Type Culture
Collection, Rockville, MD, USA, under ATCC CRL Nos. 1580 and 1581,
respectively.
Basically, the technique involves fusing the appropriate
tumor cells and splenocytes or lymphoid tissue using a fusogen such as
polyethylene glycol. After the fusion the cells are separated from
the fusion medium and grown on a selective growth medium, such as HAT
medium, to eliminate unhybridized parent cells and to select only
those hybridomas that are resistant to the medium and immortal. The
hybridomas may be expanded, if desired, and supernatants may be
assayed by conventional immunoassay procedures (e.g.,
radioimmunoassay, enzyme immunoassay, or fluorescence immunoassay)
using the immunizing agent as antigen. Positive clones may be
characterized further to determine whether they meet the criteria of
the antibodies of the invention. For example, the antigen-binding
ability of the antibodies may be evaluated in vitro by immunoblots,
ELISAs and antigen neutralizing tests.
A preferred procedure for making a hybric cell line that
secretes human antibodies against the amino acid genetic markers is
somatic cell hybridization using a mouse x human parent hybrid cell
line and a human cell line producing sufficiently high levels of such
antibodies. The human cell line may be obtained from volunteers
immunized with the peptide(s) described above. The human cell line
may be transformed with Epstein-Barr virus (EBV) as described, for
example, by Foung, et al., J. Immunol. Methods, 70:83-90 (1984).
When EBV transformation is employed, the most successful
approaches have been either to pre-select the population of B cells to
1335967
be transformed or to post-select the antigen-specific transformed
populations by panning or rosetting techniques, as described by
Kozbar, et al., Scan. J. Immunol., 10:187-194 (1979) and Steinitz, et
al., J. Clin. Lab. Immun., 2.1-7 (1979). Recently EBY transformation
has been combined with cell fusion to generate human monoclonal
antibodies (see, e.g., Foung et al., J. I~mun. Meth., 70:83-90
(1984)), due to instability of immunoglobulin secretion by hybridomas
when compared to EBY lymphoblastoid cell lines, and higher frequencies
of rescue of the antigen-specific populations. EBY most frequently
infects and transforms IgM-bearing B cells, but B cells secreting
other classes of Ig can also be made into long-term lines using the
EBY fusion technique, as described by Brown and Miller, J. Immunol.,
1 :24-29 (1982).
The cell lines which produce the monoclonal antibodies may
be grown ln vitro in suitable culture medium such as Iscove's medium,
Dulbecco's Modified Eagle's Medium, or RPMI-1640 medium from Gibco,
Grand Island, NY, or in vivo in syngeneic or immunodeficient
laboratory animals. If desired, the antibody may be separated from
the culture medium or body fluid, as the case may be, by conventional
20 techniques such as ammonium sulfate precipitation, hydroxyapatite
chromatography, ion exchange chromatography, affinity chromatography,
electrophoresis, microfiltration, and ultracentrifugation.
The antibodies herein may be used to detect the presence or
absence of one or more of the four amino acid sequences associated
25 with IDDM in white blood cells expressing the HLA class II antigens.
The cells may be incubated in the presence of the antibody, and the
presence or absence and/or degree of reaction (antibody-peptide
binding) can be determined by any of a variety of methods used to
determine or quantitate antibody/antigen interactions (e.g.,
fluorescence, enzyme-linked immunoassay (ELISA), and cell killing
using antibody and complement by standard methods). The antibody
employed is preferably a monoclonal antibody.
For use in solid phase immunoassays, the antibodies employed
in the present invention can be immobilized on any appropriate solid
test support by any appropriate technique. The solid test support can
1335967
16
be any suitable insoluble carrier material for the binding of
antibodies in immunoassays. Many such materials are known in the art,
including, but not limited to, nitrocellulose sheets or filters;
agarose, resin, plastic (e.g., PVC or polystyrene) latex, or metal
beads; plastic vessels; and the like. Many methods of immobilizing
antibodies are also known in the art. See, e.g., Silman et al., Ann.
Rev. Biochem., 35:873 (1966); Melrose, Rev. Pure & App. Chem., 21:83
(1971); Cuatrecafas, et al., Meth. Enzym., Vol. 22 (1971). Such
methods include covalent coupling, direct adsorption, physical
entrapment, and attachment to a protein-coated surface. In the latter
method, the surface is first coated with a water-insoluble protein
such as zein, collagen, fibrinogen, keratin, glutelin, etc. The
antibody is attached by simply contacting the protein-coated surface
with an aqueous solution of the antibody and allowing it to dry.
Any combination of support and binding technique which
leaves the antibody immunoreactive, yet sufficiently immobilizes the
antibody so that it can be retained with any bound antigen during a
washing, can be employed in the present invention. A preferred solid
test support is a plastic bead.
In the sandwich immunoassay, a labeled antibody is employed
to measure the amount of antigen bound by the immobilized monoclonal
antibody. The label can be any type that allows for the detection of
the antibody when bound to a support. Generally, the label directly
or indirectly results in a signal which is measurable and related to
the amount of label present in the sample. For example, directly
measurable labels can include radiolabels (e.g., 125I, 35S, 14C,
etc.). A preferred directly measurable label is an enzyme, conjugated
to the antibody, which produces a color reaction in the presence of
the appropriate substrate (e.g., horseradish peroxidase/o-
phenylenediamine). An example of an indirectly measurable label wouldbe antibody that has been biotinylated. The presence of this label is
measured by contacting it with a solution containing a labeled avidin
complex, whereby the avidin becomes bound to the biotinylated
antibody. The label associated with the avidin is then measured. A
preferred example of an indirect label is the avidin/biotin system
- 1335967
17
employing an enzyme conjugated to the avidin, the enzyme producing a
color reaction as described above. It is to be understood, however,
that the term "label" is used in its broadest sense and can include,
for example, employing "labeled" antibodies where the label is a
xenotypic or isotypic difference from the immobilized antibody, so
that the presence of "labeled" antibodies is detectable by incubation
with an anti-xenotypic or anti-isotypic antibody carrying a directly
detectable label.
Whatever label is selected, it results in a signal which can
be measured and is related to the amount of label in a sample. Common
signals are radiation levels (when radioisotopes are used), optical
density (e.g., when enzyme color reactions are used), and fluorescence
(when fluorescent compounds are used). It is preferred to employ a
nonradioactive signal, such as optical density (or color intensity)
produced by an enzyme reaction. Numerous enzyme/substrate
combinations are known in the immunoassay art which can produce a
suitable signal. See, e.g., U.S. Patent Nos. 4,323,647 and 4,190,496.
For diagnostic use, the antibodies will typically be
distributed in multicontainer kit form. These kits will typically
contain the antibody(ies) in labeled or unlabeled form in suitable
containers, any detectable ligand reactive with unlabeled antibody if
it is used, reagents for the incubations and washings if necessary,
reagents for detecting the label moiety to be detected, such as
substrates or derivatizing agents depending on the nature of the
label, product inserts and instructions, and a positive control
associated with IDDM, such as a cell containing the HLA class II
antigens associated with IDDM. The antibodies in the kit may be
affinity purified if they are polyclonal.
The following examples illustrate various embodiments of the
invention and are not intended to be limiting in any respect. In the
examples all parts and percentages are by weight if solid and by
volume if liquid, and all temperatures are in degrees Centigrade,
unless otherwise indicated.
18
EXAMPLE I
This example illustrates how the four sequences associated
with IDDM were identified.
I. Analysis of HLA-DR-.beta. Sequences
Several HLA class II beta genes were isolated from clinical
blood samples of diverse HLA-typed IDDM individuals (from University
of Pittsburgh clinic and from cell lines from IDDM patients available
from the Human Genetic Mutant Cell Repository, Camden, NJ) and non-
diabetic controls (homozygous typing cells) using cloning methods.
In one such method, which is a standard method, human genomic DNA was
Maniatis et al., Molecular Cloning: A Laboratory Manual (1982), 280-
281 or prepared from the buffy coat fraction, which is composed
primarily of perpheral blood lymphocytes, as described by Saiki et
al., Biotechnology, 3:1008-1012 (1985). This DNA was then cloned as
full genomic libraries into bacteriphage vectors, as described in
Maniatis, supra, pp. 269-294. Individual clones for the HLA-DR.beta. genes
were selected by hybridization to radioactive cDNA probes (Maniatis et
al., pp. 309-328) and characterized by restriction mapping. See U.S.
Patent No. 4,582,788 issued April 15, 1986. Individual clones from
IDDM patients were assigned to DR-typed haplotypes by comparing the
clone restriction map with the RFLP segregation pattern within the
patients' family. Finally, small fragments of these clones
representing the variable second exon were subcloned (Maniatis et al.,
supra, pp. 390-402) into the M13mp10 cloning vector, which is publicly
available from Boehringer-Mannheim.
In an alternative procedure for cloning the genes,
amplification of the relevant portion (the second exon) of the gene
was carried out as described below.
A total of 1 microgram of each isolated human genomic DNA
was amplified in an initial 100 µl reaction volume containing 10 µl of
a solution containing 100 mM Tris.HCl buffer (pH 7.5), 500 mM NaCl,
and 100 mM MgCl2, 10 µl of 10 µM of primer GH46, 10 µl of 10 µM of
primer GH50, 15 µl of 40 mM dNTP (contains 10 mM each of dATP,dCTP,
-
1335967
19
dGTP and TTP), and 45 ~l of water. Primers GH46 and GH50 have the
following sequences:
5'-CCGGATCCTTCGTGTCCCCACAGCACG-3' (GH46)
5'-CTCCCCAACCCCGTAGTTGTGTCTGCA-3' (GH50)
These primers, having non-homologous sequences to - act as
linker/primers, were prepared as follows:
A. Automated Synthesis Procedures: The
diethylphosphoramidites, synthesized according to Beaucage and
Caruthers (Tetrahedron Letters (1981) 22:1859-1862) were sequentially
condensed to a nucleosi~e derivatized controlled pore glass support
using a Biosearch SAM-1. The procedure included detritylation with
trichloroacetic acid in dichloromethane, condensation using
benzotriazole as activating proton donor, and capping with acetic
anhydride and dimethylaminopyridine in tetrahydrofuran and pyridine.
Cycle time was approximately 30 minutes. Yields at each step were
essentially quantitative and were determined by collection and
spectroscopic examination of the dimethoxytrityl alcohol released
during detritylation.
B. Oligodeoxyribonucleotide Deprotection and Purification
Procedures: The solid support was removed from the column and exposed
to 1 ml concentrated ammonium hydroxide at room temperature for four
hours in a closed tube. The support was then removed by filtration
and the solution containing the partially protected
oligodeoxynucleotide was brought to 55C for five hours. Ammonia was
removed and the residue was applied to a preparative polyacrylamide
gel. Electrophoresis was carried out at 30 volts/cm for 90 minutes
after which the band containing the product was identified by UV
shadowing of a fluorescent plate. The band was excised and eluted
with 1 ml distilled water overnight at 4C. This solution was applied
to an Altech RP18 column and eluted with a 7-13% gradient of
acetonitrile in 1% ammonium acetate buffer at pH 6Ø The elution was
monitored by UV absorbance at 260 nm and the appropriate fraction
collected, quantitated by UV absorbance in a fixed volume and
evaporated to dryness at room temperature in a vacuum centrifuge.
.
r~aJe ~ar~
133~967
C. Characterization of Oligodeoxyribonucleotides: Test
aliquots of the purified oligonucleotides were 32p labeled with
polynucleotide kinase and y-32P-ATP. The labeled compounds were
examined by autoradiography of 14-20% polyacrylamide gels after
5 electrophoresis for 45 minutes at SO volts/cm. This procedure
verifies the molecular weight. Base composition was determined by
digestion of the oligodeoxyribonucleotide to nucleosides by use of
venom diesterase and bacterial alkaline phosphatase and subsequent
separation and quantitation of the derived nucleosides using a reverse
10 phase HPLC column and a 10% acetonitrile, 1% ammonium acetate mobile
phase.
The above reaction mixtu res were hel d in a heat bl ock set at
95C for 10 minutes to denature the DNA. Then each DNA sample
undenrent 28 cycles of amplification, where each cycle was composed of
15 four steps:
(1) spin briefly (10-20 seconds) in microcentrifuge to
pellet condensation and transfer the denatured material immediately to
a heat bl ock set at 30C for two mi nutes to all ow primers and genomic
DNA to anneal,
(2) add 2 lll of a solution prepared by mixing 39 ~,l of the
Klenow fragment of E. coli DNA Polymerase I (New England Biolabs, 5
units/~,l), 39 ~l of a salt mixture of 100 mM Tris buffer (pH 7.5), 500
mM NaCl and 100 mM MgC12, and 312 l~l of water,
(3) all owing the reaction to proceed for two minutes at
30C, and
(4) transferring the samples to the 95C heat block for two
minutes to denature the newly synthesized DNA, except this reaction
was not carried out at the last cycle.
Then the mixtures were stored at -20C. The following
cloning procedure was used for the amplified products.
The reaction mixture was sub-cloned into M13mplO by first
digesting in 50 ~ll of a buffer containing 50 mM l~aCl, 10 mM Tris HCl,
pH 7.8, 10 mM MgCl2, 20 units PstI, and 26 units HindIII at 37C for
90 mi nutes. The reacti on was stopped by freezi ng. The volume was
21 1335967
adjusted to llo ~1 with a buffer containing Tris HCl and EDTA and
loaded onto a 1 ml BioGel P-4 spin dialysis column. One fraction was
collected and ethanol precipitated.
The ethanol pellet was resuspended in 15 ~l water and
adjusted to 20 ~l volume containing 50 mM Tris HCl, pH 7.8, 10 mM
MgCl2, 0.5 mM ATP, 10 mM dithiothreitol, 0.5 ~g of M13mplO vector
digested with PstI and H dIII and 400 units ligase. This mixture was
incubated for three hours at 16C.
Ten microliters of ligation reaction mixture containing Molt
4 DNA was transformed into E. coli strain JM103 competent cells, which
are publicly available from BRL in Bethesda, MD. The procedure
followed for preparing the transformed strain is described in Messing,
J. (1981) Third Cleveland Symposium on Macromolecules:Recombinant DNA,
ed. A. Walton, Elsevier, Amsterdam, 143-153.
About 40 different alleles from these two cloning procedures
were sequenced. In some of the sequences determined four areas of
specific DNA and protein sequence were found to occur in various
combinations and to be associated with IDDM. The DNA sequences seen
in each of these segments in the genomes of IDDM patients produced an
20 alteration in one to three amino acid residues of the DR~ protein.
These four variable segments of the DR~ second exon, found in
sequences obtained from many diabetic sources, and labeled A-D, are
identified above. The regions which can be used for devising probes
used for detecting such sequences are identified in Table III, where
25 the amino acid abbreviations are shown in Table IY.
22 1335967
TABLE III
: Alllin~nt ot HL~-DRf Pro~-in S ~iU-nc-c
EYO--1: 20 ~ ~ li
DRB ~ RFI ~ LL~ ~ Ll F~ T~ . 8~ S ~' ~4)~1
d ~
Il d~-- ~6 )
L 'C- ~ 'i-
D~9 !i ,~ V d-- ~ ' O --
r ~1-- V ~-- ~ I~_
0
o l ~ L~
D~.: V
R~ V
D~ d- ~'S~-~
_IJ': --............. A 1~ cl ' d
~ '9: .. - : ^ A Ri I ' V 1~
P~ : . . : ~ A R L7 ~ V IR~; --- I
5: . .- - A R ~ ~ V IC ~ --- I
~-1: ---- : 1 r ~ ~ ~ J _ I
' V - Q ~ V ~ *~,~;-.11 -
1~ ,, , : V C~; ; L ~ _ 1 1 -
~" , Y -, V C~ I ~ 6'- 11 -
DRel': _ Y . V r., ' ~C )(DR )-111
AVL~ Y V r
LD': --. Y '. V G~ i ~ d 6 ~- 11 -
~P~.: --~ Y '. V ~ ' I~ 1'-. Il -
H~ 1 __ y ~ V ,~ ' ~
: -- y ~ 4~-~11 -
c'~: --Y tY~ _ 7 7 ~ ~ d ~J_-
--Y~ E H ~ ~ r A l;R
Y : r A C~
--Y--: Y ~ n ~ ~
~1~:--7~~ :? Y ~ ~ 6'-1
D~l.: --Y~ DE V ~ ~)-.
~: Y ~ OE ~ ~; 8~-1
~Y y ~ I r~ c~ dl " ~
D~P: _Y~~ y ~ V ' le _
~: Y~~ Y ~ V ~ _
A .1: --Y~~ y - ~ _
c~ _r- Y - ~ V ~ ~c 6~- -
o~-: --Y~~ Y
~ r- ~ ~ c r ~
~: --Y~~~Y ~ 7 ' r G; L ~ ~.5
D~ ~ r~- , A DD ~ E V ~ ~G~-
_ L--E--C I ' S ~ ~ I d ~_
-~ 11 .7 L-E-CI ' r ~ 8-I
~: --S~.-- 7 L--ELFI-- ~ d~';
~: 11 " 7 ~ ~ ~
n s r I A V ,
~-i: ~r M Cl N DL rDP d~
- r L r D , ~:
r L; l~ y
L~ 6C~7r~ILr E n~ V N CI~K ~ d' )- 11
~ ~71--?I~Y ~R~i r E~ v N Cl t dli,3 1
L~Y 1~ '~ ?77E--Fr~L V 11 Cl--Vv~ ~ .-''~- 11 -
: --I~?lt~ ~ . P E r V N Cl ;i~ P ~ dS,I~,-- 11 -
A C . ~ r~L ~ ~ y v l p~
J5 ~ A ~n~ L- '` 7 ~` ~ d ~, ~,' _- I I -
A r~L
A Yi L ~ : ~'.~)~ 11 -
PCR--> ~ PCR
A ~ C D ( ~ IDDU)
23 1335967
TABLE IV
Amino Acid Abbreviation Codes
Alanine Ala A
Arginine Arg R
Asparagine Asn N
Aspartic Acid Asp D
Cysteine Cys C
Glutamine Gln Q
Glutamic Acid Glu E
Glycine Gly G
Histidine His H
Isoleucine Ile
Leucine Leu L
Lysine Lys K
Methionine Met M
Phenylalanine Phe F
Proline Pro P
Serine Ser S
Threonine Thr T
2 0 Tryptophan Trp W
Tyrosine Tyr Y
Valine Val V
II. Preparation of Primers for Detection
Oligonucleotides designated GH46 and GH50 complementary to
25 opposite strands of the conserved 5' and 3' ends of the DR-~ second
exon were used as primers. The primers, having the following
sequences, are identified in the section above.
III. Expected Amplification Reaction
One microgram of DNA from each DNA sample to be tested (10
~l of 100 ~g/ml DNA) may be amplified in an initial 100 ~l reaction
volume containing 10 ~l of a solution containing 100 mM Tris buffer
133~967
24
(pH 7.5), 500 mM NaCl, and 100 mM MgCl2. 10 ~l of 10 ~M of primer
GH46, 10 ~l of 10 ~M of primer GH50, 15 ~l of 40 mM dNTP (contains 10
mM each of dATP, dCTP, dGTP and TTP), 10 ~l DMS0, and 45 ~l of water.
Each reaction mixture is held in a heat block set at 95C
for 10 minutes to denature the DNA. Then each DNA sample undergoes 30
cycles of amplification where each cycle is composed of four steps:
(1) spin briefly (10-20 seconds) in microcentrifuge to
pellet condensation and transfer the denatured material immediately to
a heat block set at 37C for two minutes to allow primers and genomic
DNA to anneal,
(2) add 2 ~l of a solution prepared by mixing 39 ~l of the
Klenow fragment of E. coli DNA Polymerase I (New England Biolabs, 5
units/~l), 39 ~l of a salt mixture of 100 mM Tris buffer (pH 7.5), 500
mM NaCl and 100 mM MgC12, and 312 ~l of water,
(3) allowing the reaction to proceed for two minutes at
37C, and
(4) transferring the samples to the 95C heat block for two
minutes to denature the newly synthesized DNA, except this reaction
was not carried out at the last cycle.
The final reaction volume is 150 ~l, and the reaction
mixture is stored at -20C.
IV. Expected Synthesis and Phosphorylation of Oligodeoxyribonucleo-
tide Probes
Two of four labeled DNA probes, designated GH54 (V--S) and
GH78 (I--DE), from Regions C and D, respectively, are employed.
These two probes are synthesized according to the procedures
described above for preparing primers for cloning. The probes are
labeled by contacting 10 pmole thereof with 4 units of T4
polynucleotide kinase (New England Biolabs) and about 40 pmole y~32p_
ATP (New England Nuclear, about 7000 Ci/mmole) in a 40 ~l reaction
volume containing 70 mM Tris buffer (pH 7.6), 10 mM MgCl2, 1.5 mM
spermine, 100 mM dithiothreitol and water for 60 minutes at 37C. The
total volume is then adjusted to 100 ul with 25 mM EDTA and purified
133596~
according to the procedure of Ma~atis et al., Molecular Cloning
(1982), 466-467 over a 1 ml Bio Gel P-4 (BioRad) spin dialysis column
equilibrated with Tris-EDTA (TE) buffer (10 mM Tris buffer, 0.1 mM
EDTA, pH 8.0).
V. Expected Dot Blot Hybridizations
Five microliters of each of the 150 ~l amplified samples
from Section III was diluted with 195 ~1 0.4 N NaOH, 25 mM EDTA and
spotted onto three replicate nylon filters by first wetting the filter
with water, placing it in an apparatus for preparing dot blots which
holds the filter in place, applying the samples, and rinsing each well
with 0.4 ml of 20 x SSPE (3.6 M NaCl, 200 mM NaH2P04, 20 mM EDTA), as
disclosed by Reed and Mann, Nucleic Acids Research, 13, 7202-7221
(1985). The filters are then removed, rinsed in 20 x SSPE, and baked
for 30 minutes at 80C in a vacuum oven.
After baking, each filter is then contacted with 6 ml of a
hybridization solution consisting of 5 x SSPE, 5 x Denhardt's solution
(1 x = 0.02% polyvinylpyrrolidone, 0.02% Ficoll~ 0.02% bovine serum
albumin, 0.2 mM Tris HCl, 0.2 mM EDTA, pH 8.0) and 0.5% SDS and
incubated for 60 minutes at 55C. Then 5 ~l each of the probes is
added to the hybridization solution and the filters are incubated for
60 minutes at 55C.
Finally, each hybridized filter is washed under stringent
conditions. The genotypes are expected to be readily apparent after
minutes of autoradiography. The probes are expected to have
reasonable specificity for the portions of the allele being detected
in genomic DNA samples.
EXAMPLE II
The dot blot procedure of Example I can be carried out
without using the amplification procedure.
- ir~d~ k
-
26 1335967
EXAMPLE III
Peptides to the four amino acid sequences disclosed may be
prepared as described above and used as immunogens to generate
antibodies thereto, useful in immunoassays for detecting the amino
-5 acid sequence(s) in protein samples.
In summary, the present invention is seen to provide four
DNA sequences and four amino acid sequences associated therewith which
are conserved among many diabetic genomes. These sequences may be
used to develop probes and antibodies for detecting IDDM
susceptibility in a patient sample.
