Note: Descriptions are shown in the official language in which they were submitted.
13~0184
-- 1~--
Improvements in or relating to interferons
The present invention relates to new Type I
interferons as well as to recombinant DNA methods
of producing these polypeptides and products required
in these methods, for example, genetic sequences,
recombinant DNA molecules, expression vehicles
and organisms.
Interferon is a word coined to describe a
variety of proteins endogenous to human cells character-
ised by partly overlapping and partly divergingbiological activities. These proteins modify the
body's immune response and are believed to contribute
substantial protection against viruses. For example,
interferons have been classified into three broad
species, a-, ~, and ~ -Interferon. Furthermore,
interferons are subdivided into two types: Type I
and Type II interferons. Type I interferons are
further divided into o- and ~- interferons. They
seem to have evolved from a common ancestor protein.
The Type II interferon is named y-interferon and
is not related to Type I interferons.
Only one subspecies of ~- and ~-interferon
is known in humans (see, for example, S. Ohno et
al., Proc. Natl. Acad. Sci. 78, 5305-5309 (1981);
Gray et al., Nature 295, 503-508 (1982); Taya,
et al., EMBO Journal ~, 953-958 (1982)). On
the other hand, several subtypes of o-interferon
have been described (See, for example, Phil. Trans.
R. Soc. Lond. 299, 7-28 (1982)). The mature o-
interferons reveal a maximum divergence of 23%among each other and are 166 or 165 amino acids
long. Of note is also a report of an o-interferon
having an unusually high molecular weight (26,000
by SDS polyacrylamide gel electrophoresis, described
,.
~
._" .
13~01~4
-- 2 --
by Goren, P. et al., Virology 130, 273-280 (1983) ).
This interferon is called IFN-~ 26K. It has been
found to have the highest known specific anti-viral
and anti-cellular activities.
The interferons known to date appear to be
effective against various diseases, but demonstrate
little or no efficacy in many others (see, for
example, Powledge, Bio/Technology, March 1984,
215-228, "Interferon On Trial"). Interferons have
also been plagued by side effects. For example,
in trials of the anti-cancer properties of recombinant
o-interferon, doses of around 50 million units,
which had been believed to be safe on the basis
of Phase I trials have been associated with acute
confusional states, disabling arthragia, profound
fatigue and anorexia, disorientation, seizures
and hepatic toxicity. In 1982, the French government
stopped trials with o-interferon after cancer patients
receiving it suffered fatal heart attacks. At
least two cardiac deaths have also been reported
in recent American trials. It has become increasingly
clear that at least some of the side effects, like
fever and malaise, appear to be inherent in o-interferon
itself and are not due to impurities.
Due to the great hopes elicited by the interferons,
and spurred by the wish to discover yet new interferon-
like molecules with decreased side effects, the
present inventors set out to search for and produce
such new substances.
The present invention therefore relates to
new interferons, and active derivatives thereof,
e.g. glycosylated derivatives; to genetic sequences
coding therefor, as well as to recombinant DNA
molecules containing such sequences. Included
within the scope of the present invention are expression
vectors containing a coding sequence for a novel
interferon according to the invention at an appropriate
..... .. ... ....
3 1340184
site for expression and microorganisms and tissue
culture hosts transformed by such vectors which
are capable of producing the encoded interferon.
According to one aspect, the present invention
provides new Type 1 interferon polypeptides of
168 to 174, preferably 172, amino acids,
which have a divergence of 30 to 50%, preferably
40-48%, compared to o-interferons, and a divergence
of at least 70% compared to ~-interferon, optionally
further comprising a leader peptide, and N-glycosylated
or other derivatives thereof with interferon activity.
Such interferons are hereinafter referred to as
omega-interferon or IFN-omega.
According to a further aspect, the present
invention provides polydeoxyribonucleotides comprising
a coding sequence for an omega-interferon or comprising
a pseudo gene sequence capable of hybridizing with
a sequence corresponding to an omega-interferon-
coding sequence under stringent hybridization conditions,
suitable for detecting about 85% or higher homology
with the chosen omega-interferon coding sequence.
To carry out such stringent hybridization
tests, appropriate single-stranded polydeoxyribonucleo-
tides are hybridized in the presence of 6 x SSC
(1 x SSC corresponds to 0.15 M NaCl, 0.015 M trisodium
citrate, pH 7.0), 5 x Denhardt's solution (1 x
Denhardt's solution corresponds to 0.02% polyvinyl-
pyrrolidone, 0.02% ficoll (m.w. 40,000), 0.02%
bovine serum albumin) and 0.1% sodium dodecylsulphate
at 65~C. The degree of stringency is determined
in the washing step. Thus, for selection to DNA
sequences with about 85% homology or more, the
conditions 0.2 x SSC/0.01% SDS/65~C are suitable
and for selection to DNA sequences with about 90%
homology or more, the conditions 0.1 x SSC/0.01%
SDS/65~C are suitable.
~ . . .. . ..
1340184
As preferred embodiments, the present invention
provides an omega-interferon (hereinafter referred
to as omega (Gly)-interferon) having the following
amino acid sequence:
5 10 15
Cys Asp Leu Pro Gln Asn His Gly Leu Leu Ser Arg Asn Thr Leu
TGT GAT CTG CCT CAG AAC CAT GGC CTA CTT AGC AGG AAC ACC TTG
Val Leu Leu His Gln Met Arg Arg Ile Ser Pro Phe Leu Cys Leu
GTG CTT CTG CAC CAA ATG AGG AGA ATC TCC CCT TTC TTG TGT CTC
Lys Asp Arg Arg Asp Phe Arg Phe Pro Gln Glu Met Val Lys Gly
AAG GAC AGA AGA GAC TTC AGG TTC CCC CAG GAG ATG GTA AAA GGG
Ser Gln Leu Gln Lys Ala His Val Met Ser Val Leu His Glu Met
AGC CAG TTG CAG AAG GCC CAT GTC ATG TCT GTC CTC CAT GAG ATG
Leu Gln Gln Ile Phe Ser Leu Phe His Thr Glu Arg Ser Ser Ala
CTG CAG CAG ATC TTC AGC CTC TTC CAC ACA GAG CGC TCC TCT GCT
80 85 90
Ala Trp Asn Met Thr Leu Leu Asp Gln Leu His Thr Gly Leu His
GCC TGG AAC ATG ACC CTC CTA GAC CAA CTC CAC ACT GGA CTT CAT
95 100 105
Gln Gln Leu Gln His Leu Glu Thr Cys Leu Leu Gln Val Val Gly
25 CAG CAA CTG CAA CAC CTG GAG ACC TGC TTG CTG CAG GTA GTG GGA
110 115 120
Glu Gly Glu Ser Ala Gly Ala Ile Ser Ser Pro Ala Leu Thr Leu
GAA GGA GAA TCT GCT GGG GCA ATT AGC AGC CCT GCA CTG ACC TTG
125 130 135
30 Arg Arg Tyr Phe Gln Gly Ile Arg Val Tyr Leu Lys Glu Lys Lys
AGG AGG TAC TTC CAG GGA ATC CGT GTC TAC CTG AAA GAG AAG AAA
140 145 150
Tyr Ser Asp Cys Ala Trp Glu Val Val Arg Met Glu Ile Met Lys
TAC AGC GAC TGT GCC TGG GAA GTT GTC AGA ATG GAA ATC ATG AAA
155 160 165
Ser Leu Phe Leu Ser Thr Asn Met Gln Glu Arg Leu Arg Ser Lys
TCC TTG TTC TTA TCA ACA AAC ATG CAA GAA AGA CTG AGA AGT AAA
170
Asp Arg Asp Leu Gly Ser Ser
GAT AGA GAC CTG GGC TCA TCT
, .. .. .
1340181
a second omega-interferon (hereinafter referred
to as omega (Glu)-interferon), which has the same
amino acid sequence as omega (Gly)-interferon except
that amino acid residue lll is glutamic acid rather
than glycine, and derivatives thereof which are
N-glycosylated at amino acid position 78.
The omega-interferons mentioned above may
be fused with a leader peptide, for example, the
leader peptide having the amino acid sequence:
Met Ala Leu Leu Phe Pro Leu Leu Ala Ala Leu Val
Met Thr Ser Tyr Ser Pro Val Gly Ser Leu Gly.
These omega interferons show similar effective-
ness to ~-interferons without many of the known
therapeutic disadvantages.
As further preferred embodiments, the present
invention provides polydeoxyribonucleotides comprising
the omega (Gly)-interferon coding sequence shown
above, the equivalent sequence coding for omega
(Glu)-interferon which differs only in that codon
lll is GAG (coding for glutamic acid) rather than
GGG (coding for glycine) and degenerate variations
thereof.
The above-mentioned sequences may be fused
with a leader peptide-coding sequence, for example,
the leader peptide-coding sequence shown below:
ATG GCC CTC CTG TTC CCT CTA CTG
GCA GCC CTA GTG ATG ACC AGC TAT AGC CCT GTT GGA TCT CTG GGC
DESCRIPTION OF THE FIGURES
Figure 1: Restriction map for clone E76E69.
Figure 2: Restriction map for clone P9A2.
Figures 3a, 3b: DNA sequence of the cDNA
insert of clone P9A2.
Figures 4a, 4b: DNA sequence of the cDNA
insert of clone E76E9.
Figure 5: Genomic Southern Blot Analysis
13~0181
-- 6 --
using DNA derived from the cDNA insert of clone
P9A2 as a probe.
Figure 6: Construction of the expression
vector pRHW12.
Figure 7: Amino acid and nucleotide differences
between Type I interferons.
Figure 8a: Identification of the unique
nucleotide positions of the IFN-aA gene.
Figure 8b: Identification of the unique
nucleotide positions of the IFN-omega 1 gene.
Figure 8c: Identification of the unique
nucleotide positions of the IFN-~D gene.
Figure 9: Schematic representation of the
synthesis of a specific hybridization probe for
15 ~omega-l-mRNA.
Figure 10: Detection of interferon-subtype
of specific mRNAs.
Figures lla, llb: DNA sequence of the IFN-
omegal gene.
Figures 12a, 12b: DNA sequence of the IFN-
pseudo-omega2 gene.
Figure 13: DNA sequence of the IFN-pseudo-
omega3 gene.
Figures 14a, 14b, 14c: DNA sequence of the
IFN-pseudo-omega4 gene.
Figure 15: Corrected list of the IFN-omega
gene sequences.
Figure 16: Homologies of the signal sequences.
Figure 17: Homologies of the "mature" protein
sequences.
Figure 18: Homologies of the 4 DNA sequences
relative to one another.
Figure 19: Antiproliferative activity of IFN-
omegal on human Burkitt's lymphoma cells.
Figure 20: Antiproliferative activity of IFN-
omegal on human cervical carcinoma cells.
The new omega interferons omega (Gly)-interferon
and omega-(Glu) interferon and polydeoxyribonucleotides
.. _. . . ....
1340184
comprising sequences coding for them may be obtained as
follows:
A human B-cell lymphoid line, for example, Namalwa
cells (see G. Klein et al., Int. J. Cancer 10, 44 (1972)) can
be stimulated for the simultaneous production of ~- and ~-
interferons through treatment with a virus, for example,
Sendai Virus. The mRNA formed is isolated from the stimulated
Namalwa cells, and this can then be used as a template for
cDNA synthesis. In order to increase the yield of interferon-
specific sequences during the cloning process, the mRNApreparation is separated in a sucrose density gradient into
mRNA molecules of different lengths.
Preferably, mRNAs of around 12S (about 800-1,000
bases) are collected. These will include mRNAs which are
specific for ~-interferons and ~-interferons. The mRNA
collected from the gradient is concentrated through
precipitation and dissolution in water and a cDNA library is
then prepared.
The preparation of cDNA library essentially involves
the use of methods known in the literature (see, for example,
E. Dworkin-Rastl, M.B. Dworkin and P. Swetly, Journal of
Interferon Research 2/4, 575-585 (1982)). The mRNA is primed
through the addition of oligo-dT. After that, by adding the
four deoxynucleosidetriphosphates (dATP, dGTP, dCTP, dTTP) and
the enzyme reverse transcriptase in an appropriately buffered
solution, cDNA is synthesized at 45~C for 1 hour. Through
' X
.~ ,. . . .
13~0181
- 7a -
chloroform extraction and chromatography via a gel column, for
example, via Sephadex G50*, the cDNA/mRNA hybrid is purified.
The RNA is hydrolysed by means of alkali treatment (0.3 M NaOH
at 50~C for 1 hour), and the cDNA is precipitated with ethanol
after neutralising with acid sodium acetate solution.
* Trade-mark
-
134018~
-- 8
Double strand synthesis is performed after addition
of the four deoxynucleosidetriphosphates and E.coli
DNA-polymerase I in an appropriately buffered solution.
The cDNA is used both as a template and as a primer
through hairpin structure formation at its 3' end
(6 hours at 15~C) (see also A. Eftratiadis et al.,
Cell 7, 279 (1976)). Following phenol extraction,
Sephadex G50 chromatography and ethanol precipitation,
the DNA is subjected, in a suitable solution, to
treatment with endonuclease Sl, which is specific
for single strands. The hairpin structure as well
as any cDNA that was not converted into double
stranded is degraded. After chloroform extraction
and precipitation with ethanol, the double-stranded
DNA (dsDNA) is separated on the basis of size on
a sucrose density gradient. In the subsequent
steps of cloning, it is preferred to use only dsDNA
of at least 600 bp in length in order to increase
the probability of obtaining clones which contain
the complete coding sequence for omega (Gly) or
omega (Glu)-interferon. dsDNA with a length of
more than 600 bp is concentrated out of the gradient
through precipitation with ethanol and dissolution
in water.
In order to increase the number of dsDNA
molecules that have been obtained, they are first
placed in an appropriate vector, e.g. an E.coli
vector, and then introduced into an appropriate
host, e.g. the bacterium E. coli. The vector used
is preferably the plasmid pBR322 (F. Bolivar et
al., Gene 2, 95 (1977)). This plasmid essentially
consists of a replicon and two selectable marker
genes. The selectable marker genes confer on hosts
resistance against the antibiotics ampicillin and
tetracycline (Ap , Tc ). The gene for ~-lactamase,
which confers resistance to ampicillin (Apr), contains
the recognition sequence for the restriction endonuclease
, ~ .
134018~
g
PstI. pBR322 can thus be cut with PstI. The overlapp-
ing 3'-ends are extended with terminal deoxynucleotide
transferase (TdT) along with a premixed quantity
of dGTP in an appropriately buffered solution.
At the same time, the selected dsDNA is likewise
extended with the enzyme TdT, using dCTP at the
3'-ends. The homopolymer ends of the plasmid and
dsDNA are complementary and will hybridize if plasmid
DNA and dsDNA are mixed in the appropriate concentra-
tion ratio and under suitable salt, buffer, and
temperature conditions tT. Nelson et al., Methods
in Enzymology 68, 41-50 (1980)).
E. coli HB101 strain ~genotype F-, hsdS20
(r - B, m - B) recA13, ara-14, proA2, lacYl, galK2,
rpsL20 (Smr), xyl-5, mtl-l, supE44, lambda-] is
prepared for transformation by the recombinant
vector-dsDNA molecules by washing with a CaC12
solution. Competent E. coli HB101 are mixed with
the previously ligated DNA and, after incubation
at 0~C, transformation is achieved by heat shock
at 42~C for 2 minutes (M. Dagert et al., Gene 6,
23-28 (1979)). The transformed bacteria are then
spread on tetracycline-containing agar plates (10 ~ug
per ml). Only E. coli HB101 cells which have received
a vector or recombinant carrier molecule are resistant
to tetracycline (Tcr) and can thus grow on this
agar. Recombinant vector-dsDNA molecules give
a host the genotype ApSTcr because the introduction
of the dsDNA into the ~-lactamase gene destroys
the information for ~-lactamase. Clones are then
transferred to agar plates, containing 50 ug/ml
ampicillin. Only about 3% grow, meaning that 97%
of the clones contain the insertion of a dsDNA
molecule. By the above process and starting with
0.5 jUg dsDNA, we obtained more than 30,000 clones;
28,600 clones thereof were individually transferred
into the cups of microtiter plates which contained
, . .. . . .. .. .
13~0184
-- 10 --
nutrient medium, 10 ~g/ml tetracycline and glycerine.
After the clones had grown, the plates were kept
at -70~C for storage (cDNA library).
In order to search the cDNA library for the
new interferon gene-containing clones, the clones
are transferred after thawing to nitrocellulose
filters. These filters rest on tetracycline containing
nutrient agar. The bacterial colonies are allowed
to grow and then the DNA of the bacteria is fixed
on the filter.
As a probe, one can advantageously use the
insert of the clone pER33 (E. Rastl et al., Gene
21, 237-248 (1983) - see also European Patent applica-
tion No. 0.115.613) which contains the gene for
IFN-o2-Arg. By means of nick translation using
DNA-polymerase I, dATP, dGTP, dTTP and a-3 P-dCTP,
this portion of DNA is radioactively labelled.
The nitrocellulose filters are first pretreated
under relaxed hybridisation conditions, without
the addition of the radioactive probe, and subsequently
they are hybridised for about 16 hours with the
addition of the radioactive probe. The filters
are then washed under relaxed conditions. Due
to the low stringency of hybridisation and washing,
not only are clones obtained that contain the interferon
o2-Arg gene, but also other clones containing interferon
coding sequences which may differ considerably
from that of the interferon o2-Arg gene. After
drying, the filters are exposed on an x-ray film.
A blackening effect, which is substantially above
the level of background, shows the presence of
clones with interferon-specific sequences.
Because the radioactivity signals are of
differing quality, the positive clones or the clones
that react in a manner leading to a suspicion of
positive results are then cultured on a small scale.
The plasmid DNA molecules are isolated, digested
134018~
-- 11 --
with the restriction endonuclease PstI, and separated
electrophoretically on an agarose gel according
to size (Birnboim et al., Nucl. Acid. Res. 7, 1513
(1979)). The DNA in the agarose gel is transferred
S to a nitrocellulose filter according to the method
of Southern (E. M. Southern, J. Mol. Biol. 98,
503-517 (1975)). The DNA in this filter is hybridised
with the radioactive, IFN o2-Arg gene-containing,
denatured probe. As a positive control, the plasmid
lF7 (deposited at the DSM under the DSM no. 2362)
may be used, which also contains the gene for interferon
o2- Arg.
By the above procedure, we obtained an autoradio-
gram which clearly showed that two clones, E76E9
and P9A2, contain a sequence that hybridises with
the interferon ~2-Arg gene under nonstringent,
relaxed conditions. In order to be able to characterise
more fully the dsDNA inserts of the clones E76E9
and P9A2, the plasmids of these clones were prepared
on a larger scale. The DNA was digested with various
restriction endonucleases, for example, with AluI,
Sau3A, BglII, HinfI, PstI, and HaeIII and the resulting
fragments were separated on an agarose gel. Through
comparison with size markers, for example the fragments
which result from digestion of pBR322 with the
restriction endonuclease HinfI or HaeIII, the sizes
of the restriction fragments derived from the plasmids
E76E9 and P9A2 were determined. By means of mapping
according to Smith and Birnsteil (H. O. Smith et
al., Nucl. Acid. Res. 3, 2387-2398 (1967)), the
arrangement of these fragments within E76E9 and
P9A2 was determined. From the restriction enzyme
maps thus obtained (see Figures 1 and 2), the surpri-
sing finding was made that the inserts of the clones
E76E9 and P9A2 involve a hitherto unknown interferon
gene, that is, the omega-interferon gene.
This information was used in order to digest
the cDNA inserts of E76E9 and P9A2 with suitable
_. . . ~ , . .
13~018~
- 12 -
restriction endonucleases. The fragments were
ligated into the dsDNA form (replicative form)
of the bacteriophage M13 mp9 (J. Messing et al.,
Gene 19, 269-276 (1982)) and were sequenced with
the help of Sanger's dideoxy method (F. Sanger
et al., Proc. Natl. Acad. Sci. USA 74, 5463-5467
(1977)). This sequencing method, which is well
known to those skilled in the art of recombinant
DNA technology, may be summarized as follow: The
single-strand DNA of recombinant M13 phages is
isolated. After the binding of a synthetic oligomer,
second-strand syntheses are performed in four separate
preparations, using the large fragment of E. coli
DNA-polymerase I (Klenow fragment). For each of
the four partial reactions, one of the four didexoy-
nucleosidetriphosphates (ddATP, ddGTP, ddCTP, ddTTP)
are added. This leads to statistically distributed
chain breaks at those places where a base that
is complementary to the particular dideoxynucleosidetri-
phosphate in the reaction mixture happens to bein the template-DNA. Radioactively labelled dATP
is also used. After termination of the synthesis
reactions, the products are denatured and the single-
strand DNA fragments are separated according to
size in a denaturing polyacrylamide gel (F. Sanger
et al., FEBS Letters 87, 107-111 (1978)). The
gel is then exposed to x-ray film. From the autoradio-
gram one can read off the DNA sequence of the recombi-
nant M13 phage. The sequences of the inserts of
the various recombinant phages are processed by
means of suitable computer programs (R. Staden,
Nucl. Acid. Res. _ , 4731-4751 (1982)).
Figures 1 and 2 reveal the strategy of sequen-
cing. Figure 3 shows the DNA sequence of the insert
of the clone P9A2; Figure 4 shows that of the clone
E76E9. The noncoding DNA strand is shown in the
5' 3' direction, together with the amino acid
sequence derived therefrom.
1340184
- 13 -
A comparison of the cDNA inserts of the clones
E76E9 and P9A2 shows one important difference.
The triplet in clone E76E9 which codes for amino
acid 111 is GAG and codes for glutamic acid. This
triplet in clone P9A2 is GGG and codes for glycine.
DNA sequences that code for mature omega
tGlu)-interferon and mature omega (Gly)-interferon
are completely contained in the clones E76E9 and
P9A2 respectively. Both mature omega (Glu) interferon
and mature omega (Gly) interferon start at the
N-terminal end with the amino acids cysteine-aspartic
acid-leucine. Quite surprisingly, these two mature
omega-interferons are 172 amino acids long this
clearly deviates from the hitherto known length
of other known interferons, that is, 166 (or 165)
amino acids for ~-interferons. Also somewhat surpri-
singly, the two omega-interferons have a potential
N-glycosylation site at amino acid position 78,
an asparagine residue.
The isolated cDNA of the clone E76E9 which
codes for omega(Glu)-interferon is 858 base pairs
long and has a 3' nontranslated region. The region
which codes for mature omega(Glu)-interferon extends
from nucleotide 9 to nucleotide 524. The isolated
cDNA of the clone P9A2 is 877 base pairs long,
the sequence which codes for mature omega (Gly)
interferon extending from nucleotide 8 to nucleotide
523. The 3' nontranslated region in the case of
P9A2 extends to the poly-A segment.
A comparison of the two specific omega-interferons
mentioned above with the hitherto known human ~-
interferon subtypes gives the following picture:
... . , ,.. . .. . , . ~.. . .....
134018~
- 14 -
omega alpha
Length of protein in amino acids 172 166*
5 Potential N-glycosylation site
at position 78 - **
* Interferon alpha A has only 165 amino acids.
** Interferon alpha H has a potential N-glycosylation
site at position 75 (D. Goeddel et al., Nature
2 , 20-26 (1981)).
E. coli HB 101 with the plasmid E76E9 and
E. coli 101 with the plasmid P9A2 were deposited
at the German Collection for Microorganisms (DSM
Gottigen) under the numbers DSM 3003 and 3004,
respectively on 3 July 1984.
To prove that the newly discovered clones
produce an activity resembling interferon, a 100 ml
culture of clone E76E9 was further cultured in
L-broth at 37~C up to an optical density of A600 = 0.8,
the bacteria were lysed and the resulting supernatant
was then tested in a plaque reduction test. As
expected, the supernatant tested was found to have
interferon-like activity (see Example 3).
To prove that omega (Gly)- and omega (Glu)-
interferon are members of a new interferon family,
all the DNA was isolated from Namalwa cells and
digested with various restriction endonucleases.
In this way, it was possible to assess the
number of genes which correspond to the cDNAs of
the clones P9A2 and E76E9. For this purpose, the
DNA fragments obtained were separated on agarose
gel using the method of Southern (E.M. Southern
et al., J. Mol. Biol. 98, 503-517 (1975)), placed
on nitrocellulose filters and hybridised under
13~018~
- 15 -
relatively stringent conditions with radioactively
labelled specific DNA of the clone P9A2.
Figure 5b illustrates the cDNA of the clone
P9A2 and the fragment used for hybridisation.
The points of recognition sites of some restriction
enzymes are shown (P=PstI, S=Sau3A, A=AluI). The
probe employed included only two of the three possible
PstI fragments (see Example 4(d)).
In addition to the omega interferon gene
probe, an interferon o2-Arg gene probe was used
derived from the plasmid PER33. The results which
were obtained are shown in Figure 5a.
The individual lanes are marked with letters
to indicate the various restriction enzymes used
to diqest the Namalwa cell DNA samples (E=EcoRI,
H=HindIII, B=BamHI, S=SphI, P=PstI, C=ClaI). The
left-hand half of the filter was hybridised with
the o-interferon gene probe ("A") and the right-
hand half was hybridised with the omega interferon
gene probe derived from the clone P9A2 ("O").
The DNA bands which hybridised with the o-interferon
gene probe were different than those which hybridized
with the new interferon gene probe. No cross-
hybridisation could be detected with the two different
probes by assessing the corresponding lanes.
The hybridisation pattern obtained with the
probe derived from the cDNA insert of clone P9A2
shows only one hybridising fragment with approximately
1300 base pairs (bp), which belongs to the homologous
gene. The shorter fragment, 120 bp long, had run
out of the gel. The band belonging to the 5' part
of the gene cannot be observed since the probe
does not contain this region. At least 6 different
bands can be seen in the PstI lane. This indicates
that some other genes which are related to the
sequences for omega (Gly)-interferon and omega
(Glu)-interferon must be present in the human genome.
134018~
- 16 -
From these results, one can deduce that if one
or more PstI recognition sites are present in these
genes, one can expect to be able to isolate at
least three more additional genes. These genes
may preferably be isolated by hybridisation from
a human gene library contained in a plasmid vector,
phage vector or cosmid vector (see Example 4e).
Thus, it will be understood in view of the
foregoing that the present invention provides the
omega-interferon polypeptides of Type 1 coded for
by the cDNA inserts of plasmids P9A2 and E76E9,
further interferon polypeptides coded for by sequences
which will hybridise with the sequences corresponding
to the interferon-coding sequences of plasmids
P9A2 and E76E9 or degenerate variations thereof
under stringent hybridisation conditions suitable
for detecting about 85% or higher homology, and
N-glycosylated or other derivatives thereof with
interferon activity.
The omega-interferons according to the invention
do not only encompass the mature interferons which
are specifically described but also any modifications
of these polypeptides which leave IFN-omega activity.
These modifications comprise shortening of the
molecules at the N- or C-termini thereof, exchanging
amino acid residues for other residues without
substantially affecting activity, or chemically
or biochemically attaching the molecules to other
molecules, which may be inert or otherwise. Among
the latter can be mentioned hybrid molecules made
from one or more omega interferons and/or known
o- or ~-interferons.
In order to be able to compare the differences
between the amino acid and nucleotide sequences
of the new interferons, particularly of the omega(Gly)
and omega(Glu)-interferon, with the amino acid
and nucleotide sequences which have already been
134018'1
- 17 -
published for o-interferons and ~-interferon (C.
Weissmann et al., Philo Trans. R. Soc. London 299,
7-28 (1982); A. Ullrich et al., J. Molec. Biol.
156, 467-486 (1982);, T.Taniguchi et al., Proc.
Nat. Acad. Sci. 77, 4003-4006 (1980); K. Tokodoro
et al., EMBO J. 3, 669-670 (1984)), the corresponding
sequences are arranged in pairs and the differences
at individual positions are counted.
The results shown in Figure 7 demonstrate
that the interferon coding nucleotide sequences
of the clones P9A2 and E76E9 are related to the
sequences of the Type I interferons (o and ~-interferons).
It is also shown that the differences in the amino
acid sequences between the individual o-interferons
and the new sequences are between 41.6% and 47.0%.
The differences between both the new sequences
and those of the individual o-interferons to the
one of ~-interferon are about 70%. Taking into
account the results of Example 4 in which the existence
of a whole set of related genes is demonstrated,
and also taking into account the proposed nomenclature
for interferons (J. Vilceck et al., J. Gen. Virol.
65, 669-670 (1984)), it is assumed that the cDNA
inserts of the clones P9A2 and E76E9 code for a
new class of Type I interferon, interferon-omega.
It has also been shown that omega-interferon
gene expression occurs analogously to that of a
Type I interferon gene. Transcription of the individual
members of the multi gene families coding for the
o- and omega-interferons may be investigated using
the Sl mapping method (A.J. Berk et al., Cell 12,
721 (1977)). By means of this technique, it has
been demonstrated that the expression of mRNA
corresponding to the omega (Glu)- and omega (Gly)-
interferon genes (hereinafter referred to as omega-
l-mRNA) is virus-inducible. Since the transcripts
of a gene family of this kind differ by only a
1340184
- 18 -
few bases out of approximately 1000, hybridisation
alone is not a sufficiently sensitive criterion
to distinguish between the various IFN mRNAs.
To overcome this problem, the mRNA sequences
of 9 o-interferons, omega (Gly)-interferon/omega
(Glu)-interferon (hereinafter referred to as interferon-
omega 1) and ~-interferon were aligned and capital
letters were used to designate those bases which
are specific to the top sequence (see Figures 8(a),
(b) and (c)). Such specific sites can easily be
found using a simple computer programme. A hybridi-
sation probe complementary to the top sequence
which starts from such a specific site can only
hybridise perfectly with the mRNA of the selected
subtype. All other mRNAs are unable to hybridise
at the specific site of the subtype. If the hybridi-
sation probe is radioactively labelled at its specific
5'-end, only those radioactive labels which are
protected from digestion with a single strand-specific
nuclease (preferably Sl nuclease) are those which
have hybridised with the interferon subtype mRNA
for which the probe was designed.
This principle is not restricted to interferon-
coding mRNAs but may be applied to any group of
known sequences which have the specific sites described
in Figure 8.
The above-mentioned specific sites of the
subtypes are not restriction sites, in most cases,
which means that the cutting of the corresponding
cDNAs with restriction endonucleases is not capable
of producing subtype-specific hybridisation probes.
A specific probe for omega-l-mRNA was therefore
produced by extending an oligonucleotide radioactively
labelled at the 5' end which is complementary to
the mRNA of interferon-omegal above its specific
site (see Example 7(a) and Figure 9).
Figure 10 shows that, as expected, omega-
l-mRNA can be induced in Namalwa and NC37 cells
13~018i
-- 19
(see Example 7(c)).
It should be understood that the present
invention encompasses not only the genetic sequences
specifically coding for the omega interferons mentioned,
but also modifications obtained readily and routineLy
by mutation, deletion, transposition or addition.
Any sequence which codes for an omega-interferon
(i.e. a polypeptide having a spectrum of biological
activities as indicated herein) and which is degenerate
to those actually shown is included. Means for
preparing such a sequence are well known to those
skilled in the art of recombinant DNA technology.
Also, any sequence coding for a polypeptide having
the spectrum of activities shown herein for IFN-
omega, and which hybridises with the sequences
(or portions thereof) shown herein under stringent
hybridisation conditions (i.e., selecting for better
than about 85%, preferably better than about 90
homology) is also covered.
By screening a cosmid human DNA library using
an IFN omegal gene probe and stringent hybridization
conditions suitable for detecting about 85% or
higher homology, one will find a number of cosmids
which hybridise. Sequence analysis of restriction
enzyme fragments isolated therefrom will give theauthentic IFN-omegal gene (see Figure 11) and three
other related genes which have been designated
the IFN-pseudo-omega2 gene, the IFN-pseudo-omega3
gene and the IFN-pseudo-omega4 gene (see Figures
12-14). The invention also relates to these and
to the encoded peptides.
DNA comparisons give an approximately 85~
homology of the pseudo genes with the IFN-omegal
gene.
Moreover, the IFN-omegal gene shows that
upon transcription the mRNA contains the information
for a functional interferon protein. A signal
134018 1
- 20
peptide 23 amino acids long, of the formula
Met Ala Leu Leu Phe Pro Leu Leu Ala Ala Leu
Val Met Thr Ser Tyr Ser Pro Val Gly Ser Leu Gly
is coded, fused to the mature IFN-omega which is 172 amino acids
long.
Interferon-omega genes may be introduced into any
organism under conditions which result in high yields. Suitable
hosts and vectors are well known to anyone skilled in the art; by
way of example, reference is made to EP-A-0.093.619, published on
November 9, 1983, inventors D.V.N. Goeddel et al.
In particular, prokaryotes are preferred for expression.
For example, E.coli K12 strain 294 (ATCC No. 31446) is
particularly useful. Other microbial strains which may b~ used
include E.coli X1776 ~ATCC No. 31.537). The aforementioned
strains, as well as E. coli W3110 (F , lamba , prototrophlc, ATCC
No. 27325), bacilli such as Bacillus subtilis, and other
enterobacteria such as Salmonella typhimurium or Serratia
marcesens, and various pseudomonad species may be used.
In general, plasmid vectors containing replicon and
control sequences which are derived from species compatible with
the host cell are used in connection with these hosts. The vector
ordinarily carries a replication site, as well as marking
sequences which are capable of providing phenotypic selection in
transformed cells. For example, E. coli is typlcally transformed
using pBR322, a plasmid derived from an E. coli strain (Bolivar,
et al., Gene 2 95 (1977)). pBR322 contains genes for ampicillin
and tetracycline resistance and thus provides easy means for
r ''
~'1
. ., ~
1340184
20a
identifying transformed cells. The pBR322 plasmid or other
plasmids must also contain, or be modified to contain, prc~oters
~¢~
134Q18~
,~
which can be used by the microbial organism for
expression. Those promoters most commonly used
in recombinant DNA construction include the beta-
lactamase (penicillinase) and lactose promoter
systems (Chang et al., Nature 275, 615 (1978);
Itakura et al., Science 198. 1056 (1977); Goeddel
et al., Nature 281, 544 (1979)) and tryptophan
(trp) promoter system (Goeddel et al., Nucleic
Acids Res. 8, 4057 (1980); EP-A-0.036.776). While
these are the most commonly used, other microbial
promoters have been discovered and utilized. For
example, the genetic sequence for IFN-omega can
be placed under the control of the leftward promoter
of bacteriophage Lambda (PL). This promoter is
one of the strongest known promoters which can
be controlled. Control is exerted by the lambda
repressor, and adjacent restriction sites are known.
A temperature sensitive allele of this repressor
gene can be placed on the vector that contains
the complete IFN-omega sequence. When the temperature
is raised to 42~C, the repressor is inactivated,
and the promoter will be expressed at its maximum
level. The amount of mRNA produced under these
conditions should be sufficient to result in a
cell which contains about 10% newly synthesised
RNA originating from the PL promoter. In this
way, it is possible to establish a bank of clones
in which a functional IFN-omega sequence is placed
adjacent to a ribosome binding sequence, and at
varying distances from the lambda PL promoter.
These clones can then be screened and the one giving
the highest yield selected.
The expression and translation of an IFN-
omega sequence can also be placed under control
of other regulons which may be "homologous" to
the organism in its untransformed state. For example,
lactose dependent E. coli chromosomal DNA comprises
1340184
- 22 -
a lactose or lac operon which permits lactose digestion
by expressing the enzyme beta-galactosidase.
The lac control elements may be obtained
from bacteriophage lambda placS, which is infective
for E. coli. The phage's lac operon can be derived
by transduction from the same bacterial species.
Regulons suitable for use in the process of the
invention can be derived from plasmid DNA native
to the organism. The lac promoter-operator system
can be induced by isopropyl-~-D-thiogalacto-pyranoside
(IPTG).
Other promoter-operator systems or portions
thereof can be employed as well: for example, the
arabinose-operator, Colicine El-operator, galactose-
15 -operator, alkaline phosphatase-operator, trp-operator,
xylose A-operator and tac-promoter/operator.
In addition to prokaryotes, eukaryotic microbes,
such as yeast cultures may also be used. Saccharomyces
cerevisiae is the most commonly used among eukaryotic
microorganisms, although a number of other species
are commonly available. For expression in Saccharomyces,
plasmid YRp7 (Stinchcomb, et al., Nature 282, 39
(1979); Kingsman et al., Gene 7, 141 (1979); Tschumper,
et al., Gene _ , 157 (1980)) and plasmid YEpl3
(Bwach et al., Gene 8, 121-133 (1979)) are, for
example, commonly used. The plasmid YRp7 contains
the TRPl gene which provides a selection marker
for a mutant strain of yeast lacking the ability
to grow in tryptophan, for example ATCC No. 44076.
The presence of the TRPl lesion as a characteri-
stic of the yeast host cell genome then provides
an effective environment for detecting transformation
by growth in the absence of tryptophan. Similarly,
the plasmid YEpl3 contains the yeast LEU2 gene
which can be used to complement a LEU2 minus mutant
strain.
- ~ 13401~4
- 23 -
Suitable promoting sequences for yeast vectors
include the 5'-flanking regions of the genes for ADH I
(Ammerer, G., Methods of Enzymology 101, 192-201 (19B3)),
3-phosphoglycerate kinase (Hitzeman, et al., J.
Biol. Chem. 255, 2073 (1980)) and other glycolytic
enzymes (Kawasaki and Fraenkel, BBRC 108, 1107-
1112 (1982)), such as enolase, glyceraldehyde-3-
phosphate dehydrogenase, hexokinase, pyruvate,
decarboxylase, phosphofructokinase, glucose-6-phosphate
isomerase, phosphoglucose isomerase, and glucokinase.
In constructing suitable expression plasmids, the
termination sequences associated with these genes
are also ligated into the expression vector at
the 3' end of the sequences to be expressed, to
provide polyadenylation of the mRNA and termination.
Other suitable promoters, which like the
aforementioned promoter region of the glyceraldehyde--
3-phosphate gene have the additional advantage
of enabling transcription control by growth conditions,
are the promoter regions of the genes for alcohol
dehydrogenase-2, isocytochrome C, acid phosphatase,
degradative enzymes associated with nitrogen metabolism
and enzymes responsible for maltose and galactose
utilisation. Promoters which are regulated by
the yeast mating type locus, such as the promoters
of the genes BARI, MFol, STE2, STE3, STE5 can be
used for temperature regulated systems by using
temperature dependent siv mutations (Rhine, Ph.D.
Thesis, University of Oregon, Eugene, Oregon (1979),
Herskowitz and Oshima, The Molecular Biology of
the Yeast Saccharomyces, part I, 181-209 (1981),
Cold Spring Harbor Laboratory). These mutations
directly influence the expressions of the silent
mating type cassettes of yeast, and therefore indirec-
tly the mating type dependent promoters. Generally,however, any plasmid vector containing a yeast-
compatible promoter, originating replication and
termination sequences is suitable.
.
13~0181
In addition to microorganisms, cultures of
cells derived from multicellular organisms may
also be used as hosts. In principle, any such
cell culture may be employed, whether from vertebrate
or invertebrate culture. However, interest has
been greatest in vertebrate cells, and propagation
of vertebrate cells in culture (tissue culture)
has become a routine procedure in recent years
(Tissue Culture, Academic Press, Kruse and Patterson,
Editors (1973)). Examples of such useful host
cell lines are VERO and HeLa cells, Chinese hamster
ovary (CHO) cell lines, and W138, BHK, COS-7 and
MDCK cell lines. Expression vectors for such cells
ordinarily include (if necessary) an origin of
replication, a promoter located in front of the
gene to be expressed, along with any necessary
ribosome binding sites, RNA splice sites, polyadeny-
lation site, and transcriptional terminator sequences.
For use in mammalian cells, the control functions
on the expression vectors are often provided by
viral material. For example, commonly used promoters
are derived from polyoma, Adenovirus 2, and most
frequently Simian Virus 40 (SV40). The early and
late end promoters of SV40 are particularly useful
because both are obtained easily from the virus
as a fragment which also contains the SV40 viral
origin of replication (Fiers et al., Nature 273,
1123 (1978)). Smaller or larger SV40 fragments
may also be used, provided there is included the
approximately 250 bp sequence extending from the
Hind III site toward the Bgl I site location in
the viral origin of replication. Further, it is
also possible, and often desirable, to utilise
promoter or control sequences normally associated
with the desired gene sequence, provided such control
sequences are compatible with the host cell systems.
. , , . ~, .
134018~
- 25 -
An origin of replication may be provided
either by construction of the vector to include
an exogenous origin, such as may be derived from
SV40 or another viral source (e.g., Polyoma, Adeno,
VSV, BPV, etc.) or may be provided by the host
cell chromosomal replication mechanism. If the
vector is integrated into the host cell chromosome,
the latter is often sufficient.
The genes may, however, preferably be expressed
in the expression plasmid pER103 (E. Rastl-Dworkin
et al., Gene 21, 237-248 (1983) and EP-A-0.115-
613 - deposited at the DSM under the number DSM
2773 on 20th December 1983), since this vector
contains all the regulons necessary for a high
expression rate of the cloned genes in E. coli.
According to a preferred embodiment of the present
invention, therefore, we provide an expression
vector derived from plasmid PBR322 wherein the
shorter EcoRI/BamHI fragment belonging to plasmid
pBR322 is replaced by a polydeoxyribonucleotide
comprising the sequence:
EcoRI Sau3A
gaattcacgctGATCGCTAAAACATTGTGCAAAAAGAGGGTTGACTTTGCCTTCGCGA 59~5
mRNA-Start Met
ACCAGTTAACTAGTACACAAGTTCACGGCAACGGTAAGGAGGTTTAAGCTTAAAG ATG 116
RBS HindIII
Cys Asp
TGT GAT C IFN-omega-coding sequence~
Sau3A
In order to construct an expression vector
of this type, the following procedure may, for
example, be used, which is illustrated in Figure
6.
. . . . .... . .. .....
~ 134013~
- 26 -
(I). Preparation of the individual DNA fragments
required:
Fragment (a)
In order to produce fragment (a) a plasmid
which contains an IFN-omega coding sequence, e.g.
the plasmid P9A2, is digested with the restriction
endonuclease AvaII. After chromatography and purifi-
cation of the resulting cDNA insert, the latter
is twice redigested with the restriction endonucleases
NcoI and AluI and then isolated by chromatography
and electroelution. This fragment contains the
majority of the corresponding omega-interferon
gene. Thus, for example, the omega(Gly) interferon
gene fragment derived from the clone P9A2 has the
following sequence:
His Gly Leu Leu Ser Arg Asn Thr Leu
c¦CAT GGC CTA CTT AGC AGG AAC ACC TTG 28
NcoI
25 30
Val Leu Leu His Gln Met Arg Arg Ile Ser Pro Phe Leu Cys Leu
GTG CTT CTG CAC CAA ATG AGG AGA ATC TCC CCT TTC TTG TGT CTC 73
Lys Asp Arg Arg Asp Phe Arg Phe Pro Gln Glu Met Val Lys Gly
25 AAG GAC AGA AGA GAC TTC AGG TTC CCC CAG GAG ATG GTA A~A GGG 118
Ser Gln Leu Gln Lys Ala His Val Met Ser Val Leu His Glu Met
AGC CAG TTG CAG AAG GCC CAT GTC ATG TCT GTC CTC CAT GAG ATG 163
30Leu Gln Gln Ile Phe Ser Leu Phe His Thr Glu Arg Ser Ser Ala
CTG CAG CAG ATC TTC AGC CTC TTC CAC ACA GAG CGC TCC TC'T GCT 208
Ala Trp Asn Met Thr Leu Leu Asp Gln Leu His Thr Gly Leu His
GCC TGG AAC ATG ACC CTC CTA GAC CAA CTC CAC ACT GGA CTT CAT 253
3'
100 105
Gln Gln Leu Gln His Leu Glu Thr Cys Leu Leu Gln Val Val Gly
CAG CAA CTG CAA CAC CTG GAG ACC TGC TTG CTG CAG GTA GTG GGA 298
, . . . ...... .. ~ . . . .
- 13~0181
- 27 -
110 115 120
Glu Gly Glu Ser Ala Gly Ala Ile Ser Ser Pro Ala Leu Thr Leu
GAA GGA GAA TCT GCT GGG GCA ATT AGC AGC CCT GCA CTG ACC TTG 343
125 130 135
Arg Arg Tyr Phe Gln Gly Ile Arg Val Tyr Leu Lys Glu Lys Lys
AGG AGG TAC TTC CAG GGA ATC CGT GTC TAC CTG AAA GAG AAG AAA 388
140 145 150
Tyr Ser Asp Cys Ala Trp Glu Val Val Arg Met Glu Ile Met Lys
TAC AGC GAC TGT GCC TGG GAA GTT GTC AGA ATG GAA ATC ATG AAA 433
155 160 165
Ser Leu Phe Leu Ser Thr Asn Met Gln Glu Arg Leu Arg Ser Lys
TCC TTG TTC TTA TCA ACA AAC ATG CAA GAA AGA CTG AGA AGT AAA 478
..
170
1 Asp Arg Asp Leu Gly Ser Ser
GAT AGA GAC CTG GGC TCA TCT TGAAATGATTCTCATTGATTAATTTGCCATA 530
TAACACTTGCACATGTGACTCTGGTCAATTCAAAAGACTCTTATTTCGGCTTTAATCAC 589
AGAATTGACTGAATTAGTTCTGCAAATACTTTGTCGGTATATTAAGCCAGTATATGTTA 648
2(AAAAGAcTTAGGTTcAGGGGcATcAGTcccTAAGATGTTATTTATTTTTAcTcArTTAT 707
TTATTCTTACATTTTATCATATTTATACTATTTATATTCTTATATAACAAATGTTTGCC 766
TTTACATTGTATTAAGATAACAAAACATGTTCAG~t 802
AluI
Fragment (b)
In order to isolate fragment (b) from the
plasmid P9A2 or plasmid E76E9, the chosen plasmid
is digested with the restriction endonuclease AvaII.
After chromatography and purification of the resulting
cDNA insert, the latter is redigested with the
restriction endonuclease Sau3A and the desired
fragment of 189bp is isolated by chromatography
and electroelution. It has the following sequence:
. .
- 28 1 3 1 0 1 8 i
Asp Leu Pro Gln Asn His Gly Leu Leu Ser Arg Asn Thr Leu
¦GAT CTG CCT CAG AAC CAT GGC CTA CTT AGC AGG AAC ACC TTG 42
Sau3Al NcoI
Val Leu Leu His Gln Met Arg Arg Ile Ser Pro Phe Leu Cys Leu
GTG CTT CTG CAC CAA ATG AGG AGA ATC TCC CCT TTC TTG TGT CTC 87
Lys Asp Arg Arg Asp Phe Arg Phe Pro Gln Glu Met Val Lys Gly
AAG GAC AGA AGA GAC TTC AGG TTC CC~ CAG GAG ATG GTA AAA GGG 132
50 55 60
Ser Gln Leu Gln Lys Ala His Val Met Ser Val Leu His Glu Met
ACG CAG TTG CAG AAG GGC CAT GTC ATG TCT GTC CTC CAT GAG ATG 177
Leu Gln Gln Ile
20CTG CAG C~ atc 189
Sau3A¦
Fragment (c)
In order to prepare fragment (c), the plasmid
pER33 (see E. Rastl-Dworkin et al., Gene 21, 237-24&
(1983) and EP-A-0.115.613) is digested twice with
30 the restriction enzymes EcoRI and PvuII. The 389bp
fragment which is obtained after agarose gel fractic,nation
and purification and which contains the Trp promotor,
the ribosomal binding site and the starting codon,
is subsequently digested with Sau3A. The desired
35 fragment of 108bp is obtained by agarose gel electro-
., phoresis, electroelution and elutip column purificat:ion
C (carried out with an Elutip~column available from
f,~a6le ,~ a r lC
1340184
- 29 -
Messrs. Schleicher and Schuell). It has the following
sequence:
EcoRI ¦Sau3A
gaattcacgct~ATCGCTAAAACATTGTGCAAAAAGAGGGTTGACTTTGCC~'TCGCGA 59
~mRNA-Start Met
ACCAGTTAACTAGTACACAAGTTCACGGCAACGGTAAGGAGGTTTAAGCTTAAAG ATG 116
RBS HindII}
10 Cys Asp
TGTIgat c 123
Sau3A
Ligation of fragments (b) and (c):
The fragments (b) and (c) are ligated with
T4 ligase and, after destruction of the enzyme,
cut with HindIII. This ligated fragment has the
following structure:
20 HindIII Sau3A NcoI
a~GCTTAAAG ATGTGTGATC TGCCTCAGAA CCATGGCCTA CTTAGCAGGA 50
ACACCTTGGT GCTTCTGCAC CAAATGAGGA GAATCTCCCC TTTCTTGTGT 100
25 CTCAAGGACA GAAGAGACTT CAGGTTCCCC CAGGAGATGG TAAAAGGGAG 150
CCAGTTGCAG AAGGCCCATG TCATGTCTGT CCTCCATGAG ATGCTGCAGC 200
AGATCACACA TCTTTA~gct t
Sau3A HindIIII
Alternatively, this DNA fragment necessary
for the production of the plasmid pRHW10 may also
be produced by using two synthetically produced
oligonucleotides:
The oligonucleotide of formula
5'-AGCTTAAAGATGTGT-3'
,.
1340 184
- 30 -
remains dephosphorylated at its 5' end.
The oligonucleotide of formula
5'-GATCACACATCTTTA-3'
is phosphorylated at the 5' end by using T4 polynucleotide
kinase and ATP.
When the two oligonucleotides are hybridised,
the following short DNA fragment is obtained:
5'-AGCTTAAAGATGTGT 3'
3'- ATTTCTACACACTAGp 5'
This produces at one end the 5' overlap typical
of HindIII and at the other end the 5' overlap
typical of Sau3A.
Fragment (b) is dephosphorylated using calves'
intestine phosphatase. Fragment (b) and the fragment
described above are combined and joined together
by means of T4 ligase.
Since the ligase requires at least one end
containing 5'-phosphate, only the synthetic piece
of DNA can be joined to fragment (b) or 2 synthetic
fragments may be connected at their Sau3A ends.
Since the two resulting fragments are of different
lengths, they may be separated by selective isopropanol
precipitation. The desired fragment thus purified
is phosphorylated using T4 polynucleotide kinase
and ATP.
(II). Preparation of the expression plasmids
a) Preparation of plasmid pRHW10:
The expression plasmid pER103 (E. Rastl-Dworkin
et al., Gene 21, 237-284 (1983) and EP-A-0.115.613,
filed at the DSM under DSM Number 2773) is linearised
with HindIII and then treated with calves' intestine
,
13~0181
- 31 -
phosphatase. After isolation and purification
of the DNA thus obtained, it is dephosphorylated
and then ligated with the fragment obtainable by
ligating fragments (b) and (c), followed by digestion
with HindIII as described above. Then, E.coli
HB 101 is transformed with the resulting ligation
mixture and cultivated on LB agar plus 50 jug/ml
of ampicillin. The resulting plasmid designated
pRHW 10, (see Figure 6), after replication is used
as an intermediate for preparing the desired expression
plasmids.
b) Preparation of the expression plasmid pRHW12:
The Klenow fragment of DNA polymerase I and
the 4 deoxynucleoside triphosphates are added to
the plasmid pRHW10 cut with BamHI. The linearised
blunt-ended plasmid obtained after incubation is
purified and then cut with NcoI. The larger fragment,
which is obtained using agarose gel electrophoresis,
electroelution and elutip purification (carried
out with an Elutip column available from Messrs.
Schleicher and Schuell), is ligated with fragment
(a). E. coli HB 101 is then transformed with the
ligation mixture and cultivated on LB agar plus
50 ,ug/ml of ampicillin. The resulting plasmid
which expresses omega(Gly)-interferon has been
designated pRHW12 (see Figure 6).
For example, 1 litre of the bacterial culture
thus obtained (optical density: 0.6 at 600 nm)
contains 1 x 10 International Units of interferon.
c) Preparation of the expression plasmid pRHWll:
The Klenow fragment of DNA polymerase I and
the 4 deoxynucleoside triphosphates are added to
the plasmid pRHW10 cut with BamHI. The linearised
blunt-ended plasmid obtained after incubation is
purified and then cut with NcoI. The larger fragment,
which is obtained using agarose gel electrophoresis,
~ .. ...... . . . . .
1340181
- 32 -
electroelution and elutip purification, is ligated
with fragment (a) obtained analogously as in (I)
above from the plasmid E76E9, the IFN-coding sequence
of which differs from that of plasmid P9A2 only
in that the GGG codon coding for the amino acid
Gly is replaced by the GAG codon coding for the
amino acid Glu at codon position 111. Subsequently
the resulting ligation mixture is used to transform
E. coli HB101 which is then cultivated on LB agar
plus 50 lug/ml of ampicillin. The resulting plasmid
which expresses omega(Glu)-interferon has been designated
pRHWll.
Transformation of cells with vectors can
be effected by a number of procedures. For example,
the transformation procedure may comprise either
washing cells in magnesium and adding DNA to the
cells suspended in calcium or exposing the cells
to a coprecipitate of DNA and calcium phosphate.
Following gene expression, the cells are plated
on media which select for transformants.
After appropriate transformation of the host,
expression of the gene therein and fermentation
or cell culture under conditions where IFN-omega
is expressed, the product can normally be extracted
by means of well known chromatographic separation
procedures to yield a material comprising IFN-omega
with or without leading and trailing sequences.
The IFN-omega may be expressed with a leading sequence
at the N-terminus thereof (to yield pre-IFN-omega),
which may be removed in some of the host cells.
If not removed, it may be necessary to cleave the
leading polypeptide (if any is present) to yield
the mature IFN-omega. Alternatively, the IFN-omega
clone can be modified in such a way that the mature
protein will be directly produced in the microorganism
instead of pre-IFN-omega. In this respect, the
precursor sequence of the yeast mating pheromone
MF-alpha-l can be used for precise maturation of
.. . . ..
13401~'~
- 33 -
the fused protein, and for secretion of the products
into the growth medium or periplasmic space. The
DNA sequence corresponding to functional or mature
IFN-omega can be connected to a portion of the
leader sequence of the MF-alpha-l gene at the sequence
coding for the cathepsin-like cleavage site (after
lys-arg) at position 256 from the initiation codon
ATG (Kurjan, Herskowitz, Cell 30, 933-943 (1982)).
On the basis of their biological actions,
the new interferons according to the invention
are suitable for the treatment of any condition
for which the known interferons have been used.
These include conditions such as herpes, rhinovirus,
AIDS infections and certain cancers. The new interferons
of the present invention can be used by themselves c,r in
combination with other known interferons or other
biologically active products, such as IFN-alpha, IFN-gamma
(see Example 12D), IL-2 and other immune modulators.
According to yet another aspect of the present
invention, we therefore provide a pharmaceutical
composition comprising at least one interferon
polypeptide according to the present invention
and/or at least one derivative of such an interferon
polypeptide with interferon activity in association
with a pharmaceutically acceptable carrier or excipient.
Suitable carriers and their formulation are
described in Remington's Pharmaceutical Sciences
by E. W. Martin, to which reference is expressly
made. The chosen active ingredient comprising
at least one IFN-omega and/or at least one IFN-
omega derivative is mixed together with a suitable
amount of vehicle in order to prepare pharmaceutically
acceptable compositions suitable for effective
administration to the patient. The preferred mode
of administration is parenteral.
IFN-omega may be parenterally administered
to subjects requiring antitumour or antiviral treat-
ment, and to those exhibiting immunosuppressive
134018~
- 34 -
conditions. Dosage and dose rate may parallel
those currently in use in clinical investigations
of o-IFN materials, e.g. about (1-10) x 106 units
daily, and in the case of materials of purity greater
than 1%, up to e.g. 5 x 107 units daily.
As one example of an appropriate dosage form
for essentially homogenous bacterial IFN-omega
in parenteral form, 3 mg IFN-omega may be dissolved
in 25 ml of 5 N human serum albumin, the solution
is passed through a bacteriological filter and
the filtered solution aseptically subdivided into
100 vials, each containing 6 x 106 units pure IFN-
omega suitable for parenteral administration.
The vials are preferably stored in the cold (-20~C)
prior to use.
The following Examples, which are not exhaustive,
illustrate the present invention in greater detail.
134018~
Example 1
Finding IFN-sequence-specific clones
a) Preparation of a cDNA Library
mRNA from Sendai-virus-stimulated cells was
used as starting material for the establishment
of a cDNA library according to methods known in
the literature (E. Dworkin-Rastl et al., Journal
of Interferon Research Vol. 2/4, 575-585 (1982)).
The 30,000 clones obtained were individually transfer-
red into the wells of microtiter plates. The following
medium was used for growing and freezing the colonies:
10 9 trypton
5 9 Yeast Extract
5 9 NaCl
0.51 9 Na-Citrate x 2 H2O
7.5 9 K2HPO4 x 2 H2O
1.8 9 KH2PO4
0.09 9 MgSO4 x 7 H2O
0.9 9 (NH4)2SO4
44 9 glycerine
0.01 9 tetracycline x HCl
ad 1 1 H2O
The microtiter plates with the individual
clones were incubated overnight at 37~C and were
then stored at -70~C.
b) Hybridisation test
As the starting material for the hybridisation
test was used the recombinant plasmid pER33 (E.
Dworkin-Rastl et. al., Gene 21, 237-248 (1983)).
This plasmid contains the coding region for the
mature interferon IFN-o2 arg plus 190 bases of
the 3' nontranslated region. 20 ug pER33 were
incubated with 30 units of Hind III restriction
endonuclease in 200 ul reaction solution (10 mM
Tris-HC1, pH-7.5, 10 mM MgC12, 1 mM Dithiothreitol
. .
134018'1
- 36 -
(DTT), 50 mM NaCl) for 1 hour at 37~C. The reaction
was terminated by the addition of 1/25 vol 0.5
M ethylenedinitrilotetraacetic acid (EDTA) and
heating to a temperature of 70~C for 10 minutes.
After the addition of 1/4 vol 5 x buffer (80% glycerine,
40 mM Tris acetate, pH 7.8, 50 mM EDTA, 0.05% Sodium
dodecylsulphate (SDS), 0.1% bromophenol blue),
the resulting fragments were separated electrophoreti-
cally according to size in a 1% agarose gel. [Gel
and electrophoresis buffer (TBE): 10.8 9/1 trishydroxy-
methylaminomethane (Tris-Base), 5.5 9/1 boric acid,
0.93 9/1 EDTA]. After the incubation of the gel
in a 0.5 ~ug/ml ethidium bromide solution, the DNA
strips were made visible in W-light and the gel
area, which contained the IFN-gene-containing DNA
piece (about 800 bp long), was cut. The DNA was
electroeluted into 1/10 x TBE buffer. The DNA
solution was extracted once with phenol and four
times with ether, and the DNA was precipitated
by adding 1/10 vol 3 M sodium acetate (NaAc) pH
5.8 and 2.5 vol EtOH from the aqueous solution
at -20~C. After centrifuging, the DNA was washed
with 70% ethanol and was dried in a vacuum for
5 minutes. The DNA was dissolved in 50 ul of water
(about 50 ,ug/ul). The DNA was marked radioactively
by means of nick translation (modified according
to T. Maniatis et al., Molecular Cloning, Ed. CSH).
Furthermore, 50 ul incubation solution contained
the following:
50 mM Tris pH 7.8, 5 mM MgC12, 10 mM mercaptoethanol,
100 ng DNA insert from pER33, 16 pg DNaseI, 25 luM
dATP, 25 ~uM dGTP, 25 ~uM dTTP, 20 uCi o -32P-dCTP
(~ 3,000 Ci/mMol), as well as 3 units of DNA polymerase
I (E.coli). Incubation was performed at 14~C for
45 minutes. The reaction was terminated through
the addition of 1 vol 50 mM EDTA, 2% SDS, 10 mM
Tris pH=7.6 solution and heating to 70~C for 10
-
134018~
minutes. The DNA was separated by means of chromatography
using Sephadex G-100* into TE buffer (10 mM Tris pH=8.0, 1 mM
EDTA) from non-incorporated radioactivity. The radioactively
labelled sample had a specific radioactivity of about 4 x 107
cpm/~g-
c) Screeninq the clones for IFN qene-containinq inserts
The bacterial cultures, which were kept frozen in
the wells of the microtiter plates, were thawed (a). A piece
of nitrocellulose filter of corresponding size (Schleicher and
Schull, BA 85, 0.45 ~m pore size) was placed on LB-agar (LB-
agar: 10 g/l Trypton, 5 g/l yeast extract, 5 g/l NaCl, 15 g/l
Bacto Agar, 20 mg/l tetracycline-HCl). By means of a plunger
adapted to the microtiter plates, the individual clones were
transferred to the nitrocellulose filter. The bacteria grew
overnight at 37~C to form colonies with a diameter of about 5
mm. To destroy the bacteria and to denature the DNA, the
nitrocellulose filters were, one after the other, placed on a
stack of Whatman* 3MM Filter which had been soaked with the
following solutions: (1) 8 minutes at 0.5 M NaOH, (2) 2
minutes at 1 M Tris pH=7.4, (3) 2 minutes at 1 M Tris pH=7.4
and (4) 4 minutes at 1.5 M NaCl, 0.5 M Tris pH=7.4. The
filters were dried in air and were then kept at 80~C for 2
hours. The filters were pretreated for 4 hours at 65~C in the
hybridisation solution, consisting of 6 x SSC (1 x SSC
corresponds to 0.15 M NaCl; 0.015 M trisodium citrate; pH =
7.0), 5 x Denhardt's solution (1 x Denhardt's solution
* Trade-mark
X
134018~
- 37a -
corresponds to 0.02% PVP (polyvinylpyrrolidone); 0.02% ficoll*
(MW: 40,000D); 0.02% BSM (bovine serum albumin)) and 0.1% SDS
(sodium dodecylsulphate). About 1 x 106 cpm per filter of the
sample made in (b) were denatured by boiling and added to the
hybridisation solution. Hybridisation was performed at 65~C
for a period of 16 hours. The filters were washed four times
* Trade-mark
~,
13~018~
- 38 -
1 hour at 65~C with 3 x SSC/0.1% SDS. The filters
were dried in air, were covered with Saran Wra ~,
and exposed on Kodak X-OmatS~ film.
Example 2
Southern Transfer to confirm IFN gene-containing
recombinant plasmids
5 ml cultures of the positively reacting
colonies or those colonies that were suspected
of reacting positively, were grown in L-broth (10 9/1
trypton, 5 9/1 yeast extract, 5 9/1 NaCl, 20 mg/l
tetracycline x HCl) at 37~C overnight. The plasmid-
DNA was isolated using a modified protocol according
to Birnboim and Doly (Nucl. Acid. Res. 7, 1513
(1979)). The cells in 1.5 ml suspension were centri-
fuged (Eppendorf Centrifuge) and resuspended at
0~C in 100 ,ul lysozyme solution consisting of 50 mM
glucose, 10 mM EDTA, 25 mM Tris-HCl pH=8.0 and
4 mg/ml of lysozyme. After 5 minutes of incubation
at room temperature, 2 vol of ice-cold 0.2 M NaOH,
1% SDS solution were added, and incubation continued
for another 5 minutes. Then 150 ~1 of ice-cold
sodium acetate solution pH=4.8 was added and incubated
for 5 minutes. The precipitated cell components
were centrifuged. The DNA solution was extracted
with 1 vol phenol/CHC13 (1:1), and the ~NA was
precipitated by the addition of 2 vol ethanol.
After centrifuging, the pellet was washed once
with 70% ethanol, and dried in a vacuum for 5 minutes.
The DNA was dissolved in 50 ul (TE)-buffer. Of
that amount, 10 ,ul were digested in 50 ul reaction
solution (10 mM Tris-HCl pH=7.5, 10 mM MgC12, 50 mM
NaCl, 1 mM DTT) with 10 units PstI-restriction
endonuclease for 1 hour at 37~C. After the addition
of 1/25 vol 0.5 M EDTA as well as 1/4 vol 5 x buffer
(see Example lb)), it was heated for 10 minutes
and the DNA was then separated electrophoretically
in a 1~ agarose gel (TBE-buffer). The DNA in the
1340184
- 39 -
agarose gel was transferred to a nitrocellulose
filter according to the method of Southern (E.
M. Southern, J. Mol. Biol. 98, 503-517 (1975)).
The DNA in the gel was denatured for 1 hour by
incubating the gel in a 1.5 M NaCl/0.5 M NaOH solution.
This was followed by neutralisation for 1 hour
with a 1 M Tris x HCl pH=8/1.5 M NaCl solution.
The DNA was transferred to the nitrocellulose filter
with 10 x SSC (1.5 M NaCl, 0.15 M sodium citrate,
pH=7.0). After completion of transfer (about 16
hours), the filter was briefly rinsed in 6 x SSC
buffer and then dried in air; it was finally baked
at 80~C for 2 hours. The filter was pretreated
for 4 hours with a 6 x SSC/5 x Denhardt's solution.
0.1% SDS (see Example lc) at 65~C. About 2 x 106 cpm
of the hybridisation probe (see Example lb) were
denatured by means of heating to a temperature
of 100~C and were then added to the hybridisation
solution. The duration of hybridisation was 16
hours at 65~C. Then the filter was washed 4 x 1
hours at 65~C with a 3 x SSC/0.1% SDS solution.
After air-drying, the filter was covered with Saran
Wrap~ and was exposed on Kodak X-OmatS~ film.
Example 3
Detection of interferon activity in the clone E76E9
A 100-ml culture of clone E76E9 was cultured
in L-broth (10 9/1 trypton, 5 9/1 yeast extract,
5 9/1 NaCl, 5 9/1 glucose, 20 mg tetracycline x
HCl per 1) at 37~C up to an optical density of
A6oo=0.8. The bacteria were centrifuged for 10
minutes at 7,000 rpm, they were washed once with
a 50 mM Tris x HCl pH=8.0, 30 mM NaCl solution
and then were resuspended in 1.5 ml washing solution.
After incubation with 1 mg/ml of lysozyme at 0~C for
half an hour, the bacterial suspension was frozen
and thawed five times. The cells were pelleted
by means of centrifugation at 40,000 rpm for 1
.. . .... . .. ~ . ~, .
134018~
- 40 -
hour. The supernatant was sterile filtered and
was tested for interferon activity. The test used
was the Plaque Reduction Test with V3 cells and
Vesicular Stomatitis Virus (G. R. Adolf et al.,
Arch. Virol. 72, 169-178 (1982)). Surprisingly,
the clone produced up to 9,000 IU of interferon
per litre of initial culture.
Example 4
Genomic Southern Blot for determining the number
of genes associated with the new sequences
a) Isolating the DNA from Namalwa cells
400 ml of a Namalwa cell culture are centrifuged
at 1000 rpm in a JA21 centrifuge in order to pellet
the cells. The resulting pellets are carefully
washed by resuspending them in NP40 buffer (NP40
buffer: 140 mM NaCl, 1.5 mM MgC12, 10 mM Tris/Cl
pH=7.4) and pelleting them again at 1000 rpm.
The pellets obtained are again suspended in 20 ml
of NP40 buffer and mixed with 1 ml of a 10% NP40
solution in order to destroy the cell walls. After
standing for 5 minutes in an ice bath the intact
cell nuclei are pelleted by centrifuging at 1000 rpm
and the supernatant is discarded. The cell nuclei
are resuspended in a 10 ml of a solution consisting
of 50 mM Tris/Cl pH=8.0, 10 mM EDTA and 200 mM
NaCl, and then 1 ml of 20% SDS are added to eliminate
the proteins. The resulting viscous solution is
extracted twice with the same quantity of phenol
(saturated with 10 mM Tris/Cl pH=8.0) and twice
with chloroform. The DNA is precipitated by the
addition of ethanol and by centrifuging. Then
the resulting DNA pellet is washed once with 70%
ethanol, dried for 5 minutes in vacuo and dissolved
in 6 ml of TE buffer (TE buffer: 10 mM Tris/Cl
pH=8.0, 1 mM EDTA). The concentration of the DNA
is 0.8 mg/ml.
13~018~
- 41 -
b) Restriction endonuclease digestion of the DNA
from Namalwa cells
The restriction endonuclease digestion was
carried out in accordance with the conditions specified
by the manufacturer (New England Biolabs). 1 ,ug
of DNA is digested with 2 units of the suitable
restriction endonuclease in a volume of 10 ul at
37~C for 2 hours or longer. The restriction endonucleases
EcoRI, HindIII, BamHI, SphI, PstI and ClaI were
used. 20 lug of DNA are used for each digestion.
In order to monitor the completeness of the digestion,
10 ~1 (aliquot parts) are taken out at the start
of the reaction and mixed with 0.4 ~9 of lambda
phage-DNA. After 2 hours incubation, these aliquot
portions are monitored by agarose gel electrophoresis
and the completeness of digestion is assessed with
the aid of a sample of the stained lambda phage
DNA fragments.
After these checks have been carried out
the reactions are stopped by adding EDTA to a final
concentration of 20 mM and heating the solution
to 70~C for 10 minutes. The DNA is precipitated
by the addition of 0.3 M NaAc, pH=5.6 and 2.5 vols
of ethanol. After 30 minutes incubation at -70~C
the DNA is pelleted in an Eppendorf centrifuge,
washed once with 70% ethanol and dried. The resulting
DNA is taken up in 30 ,ul of TE buffer.
c) Gel electrophoresis and Southern Transfer
The digested DNA samples are fractionated
according to their size in a 0.8% agar gel in TBE
buffer (10.8 9/1 Tris base, 5.5 9/1 boric acid,
0.93 9/1 EDTA). For this purpose, 15 ~ul of the
DNA sample are mixed with 4 ~1 of loading buffer
(0.02% SDS, 5 x TBE buffer, 50 mM EDTA, 50% glycerine,
0.1% bromophenol blue), heated briefly to 70~C
and loaded onto the troughs provided in the gel.
Lambda-DNA which has been cut with EcoRI and HindIII
- 42 - 134018~
is loaded separately and serves as a marker for
the size of the DNA. Gel electrophoresis is carried
out for 24 hours at about 1 V/cm. Then the DNA
is transferred to a nitrocellulose filter using
the method of Southern (Schleicher and Schuell,
BA85), using 10 x SSC (1 x SSC: 150 mM trisodium
citrate, 15 mM NaCl, pH=7.0). After the filter
has been dried at ambient temperature it is heated
for 2 hours to 80~C in order to bind the DNA to
it.
d) Hybridisation probe
20 ug of the plasmid P9A2 are cut with AvaII,
thereby generating a fragment approximately 1100 bp
long which contains the entire cDNA insert. This
DNA fragment is again cut with Sau3A and AluI and
the largest DNA fragment is isolated after agarose
gel electrophoresis (see Figure 5b) by electroelution
and elutip column chromatography. The resulting
DNA (1.5 ~ug) is dissolved in 15 ul of water.
20 ~ug of the plasmid pER33 are cut with HindIII,
and this expression plasmid for IFN-~2-Arg (E.
Rastl.-Dworkin et al. Gene 21, 237-248 (1983))
is cut twice. The smaller DNA fragment contains
the gene for interferon-~2-Arg and is isolated
in the same way as the desired fragment from the
cDNA insert of plasmid P9A2.
Both DNA's are nick-translated using the
method proposed by P.W.J. Rigby et al. (J. Mol.
Biol. 113, 237-251 (1977)). The nick translation
is carried out with 0.2 ug of DNA in a solution
of 50 ~1, consisting of 1 x nick buffer (1 x nick
buffer: 50 mM Tris/Cl pH=7.2, 10 mM MgSO4, 0.1 mM
DTT, 50 ,ug/ml BSA), 100 ~umol each of dATP, dGTP
and dTTP, 150 uCi ~-32P-dCTP (Amersham, 3000 Ci/mMol)
and 5 units of DNA polymerase I (Boehringer-Mannheim,
nick translation quality). After 2 hours at 14~C
the reaction is stopped by adding the same amount
13~lol8~
of an EDTA solution (40 mMol) and the unreacted
radioactive material is separated off by means
of G50 column chromatography in TE buffer. The
remaining specific radioactivity is approximately
100 x 106 cpm/,ug DNA.
e) Hybridisation and autoradiography
The nitrocellulose filter is cut into two
halves. Each half contains an identical set of
lanes with Namalwa DNA which have has treated with
one of the restriction enzymes mentioned in Example
4a. The filters are pre-hybridised in a solution
containing 6 x SSC, 5 x Denhardt's (1 x Denhardt's:
0.02% bovine serum albumin (BSA), 0.02% polyvinyl-
pyrrolidone (PVP), 0.02% Ficoll 400), 0.5% SDS,0.1 mg/ml of denatured calf thymus DNA and 10 mM
EDTA for 2 hours at 65~C. Hybridisation is carried
out in a solution containing 6 x SSC, 5 x Denhardt's,
10 mM EDTA, 0.5% SDS and approximately 10 x 106 cpm
of nick translated DNA for 16 hours at 65~C. One
half of the filter is hybridised with interferon-
o2-Arg-DNA and the other half with interferon-DNA
which has been isolated from the plasmid P9A2.
After hybridisation, both filters are washed at
ambient temperature, four times with a solution
consisting of 2 x SSC and 0.1% SDS and twice at
65~C for 45 minutes with a solution consisting
of 0.2 x SSC and 0.01% SDS. The filters are then
dried and exposed to a Kodak X-Omat S film.
Example 5
Preparation of the expression plasmids pRHW 12
and pRHW 11
Preliminary comment:
The preparation of the expression plasmids
is illustrated in Figure 6 (not to scale), and
also all the restriction enzyme digestions are
carried out in accordance with the instructions
of the enzyme manufacturers.
44 1340184
a) Preparation of the plasmid pRHW 10
100 lug of the plasmid P9A2 are digested with
100 units of the restriction endonuclease AvaII
(New England Biolabs). After digestion, the enzyme
is deactivated by heating to 70~C and the fragments
obtained are fractionated on a 1.4% agarose gel
with TBE buffer (TBE buffer: 10.8 9/1 Tris base,
5.5 9/1 boric acid, 0.93 9/1 EDTA) according to
their size. The band which contains the entire
cDNA insert is electroeluted and purified using
an elutip column (Schleicher & Schuell). Of the
20 ~9 obtained, 6 ~9 are further digested with
the restriction endonuclease Sau3a (20 units in
a total of 100 ~1 of solution). The fragments
15 -are separated using 2% agarose gel in TBE buffer.
After staining with ethidium bromide (EtBr) the
DNA fragment 189 bp long is electroeluted and purified
as described above (= fragment b in Figure 6).
In order to link the interferon gene with
a promoter, a ribosomal binding site and a starting
codon, the corresponding DNA fragment is isolated
from the expression plasmid pER 33 (E. Rastl-Dworkin
et al., Gene 21, 237-248 (1983)). For this purpose
50 ug of pER 33 are digested twice with the restriction
enzymes EcoRI and PvuII and the resulting fragments
are fractionated according to their size on a 1.4%
agarose gel in TBE buffer. The DNA fragment which
is 389 bp long and contains the trp promotor, the
ribosomal binding site and the starting codon,
is electroeluted and purified using an elutip column.
The fragment thus obtained is then digested with
Sau3A and the desired fragment 108 bp is obtained
by agarose gel electrophoresis, electroelution
and elutip column purification in a yield of approx-
imately 100 ng (= fragment c in Figure 6).
20 ng of fragment (b) are ligated with 20 ngof fragment c in a volume of 40 lul using 10 units
of T4 ligase in a solution containing 50 mM Tris/Cl
_ 45 _ 1 3~ 01 8
pH=7.5, 10 mM MgC12, 1 mM DTT and 1 mM ATP, at
14~C for 18 hours. The enzyme is then destroyed
by heating to 70~C and the resulting DNA is cut
with HindIII in a total volume of 50 lul.
S 10 ~9 of the expression plasmid pER 103 (E.
Rastl-Dworkin et al., Gene 21, 237-248 (1983))
is linearised with HindIII in a total volume of
100 ~1. After 2 hours at 37~C 1 volume of 2 x phos-
phatase buffer (20 mM Tris/Cl pH=9.2, 0.2 mM EDTA)
together with one unit of calves intestine phosphatase
~CIP) are added. After 30 minutes at 45~C, a further
unit of CIP is added and the incubation is continued
for 30 minutes. The DNA thus obtained is purified
by extracting twice with phenol, once with chloroform
and precipitating by the addition of 0.3 M sodium
acetate (pH=5.5) and 2.5 vol ethanol. It is then
dephosphorylated in order to prevent religation
of the vector during the next ligation step.
100 ng of the linearised pER 103 and the
ligated fragment (b) and (c) (after HindIII digestion)
are added to a solution of 100 ,ul which contains
ligase buffer and ligated using T4-DNA ligase for
18 hours at 14~C.
200 ~1 of competent E. coli HB 101 (E. Dworkin
et al., Dev. Biol. 76, 435-448 (1980)) are mixed
with 20 ~1 of the ligation mixture and incubated
for 45 minutes on ice. Then the uptake of DNA
is brought about by a heat shock for 2 minutes
at 40~C. The cell suspension is incubated for
a further 10 minutes on ice and finally applied
to LB agar (10 9/1 trypton, 5 9/1 yeast extract,
5 9/l NaCl, 1.5% agar), containing 50 mg/l ampicillin.
The plasmids from the 24 resulting colonies obtained
are isolated using the method of Birnboim and Doly
(see Nucl. Acid. Res. 7, 1513-1523 (1979)). After
diqestion with various restriction enzymes one
plasmid has the desired structure. This is designated
pRHW 10 (see Figure 6).
1~0184
- 46 -
b) Preparation of the plasmid pRHW 12
About 10 ~ug of the plasmid pRHW 10 are cut
with BamHI. Then the Klenow fragment of DNA polymerase
I and the 4 deoxynucleoside triphosphates are added
and incubated for 20 minutes at ambient temperature.
The linear blunt-ended plasmid fragment obtained
is purified by phenol extraction and precipitation
and then cut with the restriction endonuclease
NcoI in a volume of 100 ,ul. The larger fragment
is obtained by agarose gel electrophoresis, electro-
elution and elutip purification. Fragment (a)
(see Figure 6) is obtained by digestion of 4 ~ug
of AvaII fragment which contains the P9A2-cDNA
insert (see above) with NcoI and AluI, thereby
obtaining about 2 ,ug of fragment (a).
In the final ligation step, fragment (a)
and the pRHW 10 added thereto, which has twice
been digested with BamHI/NcoI, is ligated in a
volume of 10 lul, using 10 ng of each DNA. Ligation
of a filled in BamHI site to a DNA cut by AluI
restores a BamHI recognition site. Competent E.
coli HB 101
are transformed with the resulting ligation mixture
as described above. Of the 40 colonies obtained,
one is selected; this is designated pRHW 12.
The plasmid is isolated and the EcoRI/BamHI
insert is sequenced using the method of Sanger
(F. Sanger et al., Proc. Nat. Acad. Sci 74, 5463-
5467 (1979)). This has the expected sequence.
c) Preparation of the plasmid pRHW 11
This is carried out analogously to Example
5b. 1 ug of the plasmid pRHW 10 is digested with
BamHI. The sticky ends of the resulting DNA are
converted to blunt ends using the Klenow fragment
of DNA polymerase I and the 4 deoxynucleoside triphos-
phates and then the linearised DNA is cut with
NcoI. The larger fragment is obtained by agarose
_ . . . ~ . .
13~018~
gel electrophoresis, electroelution and elutip
column chromatography.
The NcoI-AluI fragment is isolated from the
clone E76E9 analogously to Example 5b. Then 10 ng
of the vector part is ligated with 10 ng of the
cDNA part in a volume of 10 ~1 under suitable conditions
using 1 unit of T4 ligase. After transformation
of the resulting DNA mixture in E. coli HB 101
and selection of the 45 resulting colonies on LB
plates containing ampicillin, a clone is selected,
which is designated pRHW 11. After the corresponding
clone has been cultivated, the plasmid DNA is isolated.
Its structure is proved by the presence of several
specific restriction endonuclease cutting sites
(AluI, EcoRI, HindIII, NcoI, PstI).
d) Expression of interferon activity by E. coli
HB 101 containing the plasmid pRHW 12
100 ml of the bacterial culture are incubated
up to an optical density of 0.6 at 600 nm in M9
minimal medium which contains all the amino acids
with the exception of tryptophan (20 ~g/ml per
amino acid), 1 ~ug/ml of thiamine, 0.2% glucose
and 20 lug/ml of indol-(3)-acrylic acid (IAA), the
inductor of the tryphtophan operon. Then the bacteria
are pelleted by centrifuging (10 minutes at 7000 rpm),
washed once with 50 mM Tris/Cl pH=8, 30 mM NaCl
and finally suspended in 1.5 ml of the same buffer.
After 30 minutes incubation with 1 mg/ml of lysozyme
on ice the bacteria are frozen and thawed five
times. The cell debris are eliminated by centrifuging
for 1 hour at 40,000 rpm. The supernatant is filtered
sterile and tested for interferon activity in a
plaque reduction assay using human A549 cells and
encephalo-myocarditis virus.
Result: 1 litre of the bacterial culture produced
contains 1 x 106 international units of interferon
(A. Billiau, Antiviral Res. 4, 75-98 (1984)).
~ , . .. _ . . .. .. ,, ~,
- 48 - 134018~
Example 6
Summary of the differences between the amino acid
and nucleotide sequences of Type I interferons
a) Comparison of the amino acid sequences
A pairwise comparison of amino acid sequences
is obtained by aligning the first cysteine residue
of mature o-interferon with the first cysteine
residue of the amino acid sequences which are coded
for by the cDNA inserts of the plasmids P9A2 and
E76E9. The two sequences are shown in Figure 7
as IFN-omega, since no differences could be detected
between the specific sequences of the P9A2 or E76E9
clones in the values obtained. The only correction
made was the insertion of a gap at position 45
of the interferon-oA, which was counted as mismatch.
If the sequence of the omega-interferon is a partner,
the comparison is carried out taking into account
the usual 166 amino acids. This value is shown
in Figure 7 together with the additional 6 amino
acids coded for by the clones P9A2 and E76E9.
The percentage differences are obtained by dividing
the differences by the number 1.66. An additional
amino acid thus represents a percentage of 0.6.
This gives 3.6% for the 6 additional amino acids
of IFN-omega which are already contained in the
percentage.
The comparisons with ~-interferon are carried
out by aligning the 3rd amino acid of the mature
~-interferon with the first amino acid of the mature
a-interferon or the first cysteine which is coded
for by the plasmids P9A2 and E76E9. The longest
comparison structure of an o-interferon with ~-
interferon is thus over 162 amino acids, which
gives 2 additional amino acids each for the o-interferon
and ~-interferon. These are counted as errors
and are shown separately in Figure 7 but they are
included in the percentage. The listing of ~-interferon
with the amino acid sequences of the clones P9A2
.. ~ . .. . . . ......
1340184
- 49 -
or E76E9 is carried out in the same way. However,
this gives a total of 10 additional amino acids.
b) Comparison of the nucleotide sequences
The sequences which are to be compared are
listed analogously to Example 6a. The first nucleotide
of the DNA of the mature o-interferon is the first
nucleotide of the triplet of mature o-interferon
coding for cysteine. The first nucleotide from
the DNA of the plasmids P9A2 or E76E9 is also the
first nucleotide of the codon for cysteine-l.
The first nucleotide from the DNA of ~-interferon
is the first nucleotide of the third triplet.
The comparison is made over a total of 498 nucleotides
if the individual DNAs of the o-interferons are
compared with the DNA of ~-interferon, and over
516 nucleotides if the DNA sequences of the individual
o-interferons or of the ~-interferon are compared
with those of the plasmids P9A2 and E76E9. The
absolute number of gaps is given in the left-hand
part of the Table in Figure 7 and then the correspon-
ding percentages are given in brackets.
Example 7
Virus-inducible expression of omega-l-mRNA in Namalwa
cells and NC37 cells
a) Synthesis of a specific hybridisation probe
for omega-l mRNA
10 pMol of the oligonucleotide d(TGCAGGGCTGCTAA)
are mixed with 12 pMol of gamma-32P-ATP (specific
activity: ~ 5000 Ci/mMol) and 10 units of polynucleotide
kinase in a total volume of 10 ~ul (70 mM Tris/Cl
pH = 7.6, 10 mM MgC12, 50 mM DTT) and left to stand
for one hour at 37~C. The reaction is then stopped
by heating to 70~C for 10 minutes. The resulting
radioactively labelled oligonucleotide is hybridised
with 5 pMol of M13pRHW 12 ssDNA (see Figure 9)
in a total volume of 35 ~ul (100 mM NaCl) by standing
for one hour at 50~C.
. ~ .
1340184
After cooling to ambient temperature, nick
translation buffer, the 4 deoxynucleoside triphosphates
and 10 units of Klenow polymerase are added to
give a total volume of 50 ~1 (50 mM Tris/Cl pH
= 7.2, 10 mM MgC12, 50 ~g/ml BSA, 1 mM per nucleotide).
Polymerisation is carried out at ambient temperature
for one hour and stopped by heating to 70~C for
5 minutes.
During the reaction, a partially double-stranded
circular DNA is obtained. This is then cut in
a total volume of 500 ~1 with 25 units of AvaII,
using the buffer described by the manufacturer.
The double stranded regions are cut to uniform
sizes. The reaction is then stopped by heating
to 70~C for 5 minutes.
b) Preparation of RNA from virus-infected cells
100 x 106 cells (0.5 x 106/ml) are treated
with 100 uMol of dexamethasone for 48 to 72 hours
- the control contains no dexamethasone. To induce
interferon, the cells are suspended in serum-free
medium in a concentration of 5 x 106/ml and infected
with 21~ units/ml of Sendai virus. Aliquot parts
of the cell culture supernatants are tested for
IFN activity in a plaque reduction assay (Example
5d). The cells are harvested 6 hours after the
virus infection by centrifuging (1000 9, 10 minutes),
washed in 50 ml of NP40 buffer (Example 4a), resuspended
in 9.5 ml of ice cold NP40 buffer and lysed by
the addition of 0.5 ml of 10% NP40 for 5 minutes
on ice. After the nuclei have been removed by
centrifuging (1000 x 9, 10 minutes) the supernatant
is adjusted to pH=8 with 50 mM Tris/Cl, 0.5% sarcosine
and 5 mM EDTA and then stored at -20~C. In order
to isolate the total RNA from the supernatant,
it is extracted once with phenol, once with phenol/chloro-
form/isoamyl alcohol and once with chloroform/isoamyl
alcohol. The aqueous phase is layered on top of
134~181 - -
- 51 -
a 4 ml 5.7 molar CsCl cushion and centrifuged in
an SW40 rotor (35 krpm, 20 hours) in order to free
the extract from DNA and remaining proteins. The
resulting RNA pellet is resuspended in 2 ml of
TE, pH=8.0, and precipitated with ethanol. The
RNA precipitated is then dissolved in water at
a concentration of 5 mg/ml.
c) Detection of interferon-omega mRNA
0.2 ,ul of the hybridisation probe prepared
in Example 7(a) are precipitated together with
20-50 ,ug of the RNA prepared according to Example
7(b) by the addition of ethanol. As a control,
transfer RNA (tRNA) or RNA originating from
E. coli transformed with the plasmid pRHW 12
(Example 5) is added instead of cellular RNA.
The resulting pellets are washed free from salt with
70% ethanol, dried and dissolved in 25 ul of 80%
formamide (100 mM PIPES pH=6.8, 400 mM NaCl, 10 mM
EDTA). Then the samples are heated to 100~C for
5 minutes in order to denature the hybridisation
sample, adjusted directly to 52~C and incubated
for 24 hours at this temperature. After hybridisation,
the samples are placed on ice and 475 ~ul of Sl
reaction mixture (4 mM Zn(Ac)2, 30 mM NaAc, 250 mM
NaCl, 5% glycerine, 20 ug ss calf thymus DNA,
100 units Sl nuclease) are added. After digestion
at 37~C for 1 hour the reaction is stopped by ethanol
precipitation.
The pellets are dissolved in 6 ,ul formamide
buffer and separated essentially like samples from
DNA sequencing reactions on a 6% acrylamide gel
containing 8 M urea (F. Sanger et al., Proc. Nat.
Acad. Sci. 74, 5463-5467 (1979)).
For autoradiography, the dried gel is exposed
to a DuPont Cronex~X-ray film using the Kodak Lanex~
regular intensifying screen at -70~C.
?~ ~r~G~e ~k
1340184
- 52 -
Legend relating to Figure 10
Lanes A to C represent the controls.
Lane A: 20 ~ug tRNA
Lane B: 10 ~9 RNA from pER33 (E. coli - expression
strain for interferon-o2-Arg)
Lane C: 1 ng RNA from pRHW12 (E. coli expression
strain for interferon-omega 1)
Lane D: 50 ~ug RNA from untreated Namalwa cells
Lane E: 50 ,ug RNA from virus-infected Namalwa
cells
Lane F: 50 ~9 RNA from Namalwa cells pretreated
with dexamethasone and infected with
virus
Lane G: 20 ,ug of RNA from untreated NC 37 cells.
Lane H: 20 ~9 RNA from virus-infected NC 37 cells
Lane I: 20 ug RNA from NC 37 cells pretreated
with dexamethasone and infected with
virus
Lane M: Size marking (pBR322 cut with HinfI).
Lanes B and C show that the expected signal can
only be detected when an omegal-specific RNA is
among the RNA molecules. They also show that even
a large excess of the wrong RNA does not cause
a background signal (see lane B). Furthermore,
the tRNA used as a hybridisation partner does not
produce a signal either (see lane A).
Lanes G to I show the induction of the omegal-
specific RNA in virus-infected NC 37 cells. The
pretreatment with dexamethasone enhances this effect:.
Lanes D to F show that fundamentally the
same result is obtained with Namalwa cells as with
NC37 cells. However, the induction of omegal-specific
RNA is not as great as in NC 37 cells. This result
is parallel to the interferon titres which were
measured in the corresponding cell supernatants.
This behaviour of interferon-omegal gene
expression is thus as would be expected from an
interferon Type I gene.
134018~L
- 53 -
Example 8
Isolation of the gene coding for IFN-omegal or
genes related thereto:
a) Cosmid screening
A human cosmid bank (human DNA (male) cloned
in the cosmid vector pcos2 EMBL (A. Ponstka, H.-R.
Rockwitz, A.-M. Frischauf, B. Hohn, H. Lehrach
Proc. Natl. Acad. Sci. 81, 4129-4133 (1984)) with
a complexity of 2 x 106) was screened for the IFN-
omega gene or related genes. E. coli DHl (rK-,
mK+, rec.A; gyrA96, sup.E) was used as the host.
First of all, Mg + cells ("plating bacteria") were
prepared. E. coli DHl grows overnight in L broth
(10 9/1 trypton, 5 9/1 yeast extract, 5 9/1 NaCl)
supplemented with 0.2% maltose. The bacteria are
removed by centrifuging and taken up in a 10 mm
MgS04 solution to give an optical density600 =
2. 5 ml of this cell suspension are incubated
with 12.5 x 106 colony forming units of packed
cosmids for 20 minutes at 37~C. Then 10 vol of
LB are added and the suspension is kept at 37~C
for one hour for the purpose of expression of the
kanamycin resistance coded for by the cosmid.
The bacteria are then removed by centrifuging,
resuspended in 5 ml of LB and spread over nitrocellu-
lose filter in 200 ul aliquots (BA85, Schleicher
and SchUll, 132 mm diameter) placed on LB agar
(1.5% agar in L broth) plus 30 ug/ml kanamycin.
About 10,000 to 20,000 colonies grow on each filter.
The colonies are replica-plated on further nitro-
cellulose filters which are kept at 4~C.
A set of the colony filters is processed
as described in Example lc), i.e. the bacteria
are denatured, and the single strand DNA is fixed
to the nitrocellulose. The filters are washed
for 4 hours at 65~C in a 50 mM Tris/HCl, pH=8.0,
1 M NaCl, 1 mM EDTA, 0.1% SDS solution. The filters
are then incubated at 65~C for 2 hours in a 5 x Denhardt's
.. .... .. ...
13~018~
- 54 -
(see Example lc), 6 x SSC, 0.1% SDS solution and
hybridised with about 50 x 106 cpm of nick-translated
denatured IFN-omegal DNA (HindIII-BamHI insert
of the clone pRHW12, see Figure 6) for 24 hours
at 65~C in the same solution. After hybridisation,
the filters are washed first 3 x 10 minutes at
ambient temperature in a 2 x SSC, 0.01% SDS solution
and then 3 x 45 minutes at 65~C in a 0.2 x SSC,
0.01% SDS solution. The filters are dried and
exposed to Kodak X-Omat S film using an intensifier
film at -70~C. Positively reacting colonies are
localised on the replica filters, scratched off
and resuspended in L broth + kanamycin (30 ,ug/ml).
Of this suspension, a few ul are spread out on
LB agar + 30 ~ug/ml kanamycin. The resulting colonies
are replica-plated on nitrocellulose filters.
These filters are hybridised with 32P-labelled
IFN-omegal-DNA as described above. From each hybridi-
sing colony, the cosmid is isolated using the method
described by Birnboim & Doly (Nucl. Acids Res.
7, 1513 (1979)). With this cosmid DNA preparation,
E. coli DHl was transformed and the transformants
were selected on LB agar + 30 ,ug/ml kanamycin.
The transformants were again tested with 32P-radio-
actively labelled IFN-omegal DNA for positively
reacting clones. One clone in each case starting
from the original material isolated is selected
and the cosmid thereof is produced on a larger
scale (Clewell, D.B. and Helinski, D.R., Biochemistry
9, 4428 (1970)). Three of the isolated cosmids
are designated cos9, coslO and cosB.
b) Sub-cloning of hybridising fragments in PUC8
1 ~9 of cosmids cos9, coslO and cosB were
cut with HindIII under the conditions recommended
by the manufacturer (New England Biolabs). The
fragments are separated on 1% agarose gels in TBE
buffer by electrophoresis and transferred to nitro-
134018'i
- 55 -
cellulose filters according to Southern (Example
4c). The two filters are hybridised with nick-
translated IFN-omegal DNA as described in Example
4d, and washed and exposed. About 20 ~ug of each
cosmid are cut with HindIII and the fragments formecl
are separated by gel electrophoresis. The fragments
hybridising with IFN-omegal-DNA in the preliminary
tests are electroeluted and purified via elutip
columns (Schleicher & Schuell). These fragments
are ligated with HindIII-linearised dephosphorylated
pUC8 (Messing, J., Vieira, J., Gene 19, 269-276
(1982)) and E. coli JM101 (supE, thi, (lac-proAB),
[F', traD36, pro AB, lac q Z M15] (e.g. P.L. Biochemicals)
is transformed with the ligase reaction solution.
The bacteria are spread on LB agar containing 50 ugJml
of ampicillin, 250 ug/ml of 5-bromo-4-chloro-3-
indolyl-~-D-galactopyranoside (BCIG, Sigma) and
250 ug/ml of isopropyl-~-D-thiogalacto-pyranoside
(IPTG, Sigma). A blue colour of the resulting
colonies indicates the absence of an insert in
pUC8. The plasmid DNAs were isolated on a small
scale from some white clones, then cut with HindIII
and separated on 1% agarose gels. The DNA fragments
were transferred to nitrocellulose filters and
hybridised with 32P-IFN-omegal-DNA as above. Starting
from cos9 and coslO, a subclone was selected in
each case. These clones have been designated pRHW22
and pRH57. From cosB, two DNA fragments which
hybridise well with the IFN-omegal DNA probe were
subcloned. The resulting clones have been designated
pRH51 and pRH52.
c) Sequence analysis
The DNA inserted in pUC8 is separated from
the vector part by cutting with HindIII and subsequent
gel electrophoresis. This DNA, about 10 ug, is
ligated in 50 yl of reaction solution using T4
DNA ligase, the volume is adjusted to 350 ~ul with
. .
1340184
- 56 -
nick translation buffer (Example 4d) and then decom-
posed using ultrasound, whilst cooling with ice
(MSE 100 Watt ultrasonic disintegrator, maximum
output at 20 kHz, five times 30 seconds). Then
the ends of the fragments are repaired by adding
1/100 vol of 0.5 mM dATP, dGTP, dCTP and dTTP and
10 units of Klenow fragment of the DNA polymerase
I for 2 hours at 14~C. The resulting DNA fragments
having blunt ends are separated according to their
size on a 1% agarose gel. Fragments of sizes between
500 and 1000 bp were isolated and subcloned in
the dephosphorylated phage vector M13 mp8 cut with
SmaI. The single strand DNA of recombinant phages
is isolated and sequenced using the method developed
by Sanger (Sanger, F. et al., Proc. Natl. Acad.
Sci 74, 5463-5467 (1976)). The individual sequences
are put together to form the total sequence by
means of computers (Staden, R., Nucl. Acids Res.
10, 4731-4751 (1982)).
d) Sequence of the subclone pRH57 (IFN-omegal)
The sequence is shown in Figure 11. This
fragment which is 1933 bp long contains the gene
for interferon-omegal. The region coding for protein
comprises the nucleotides 576 to 1163. The sequence
is totally identical to that of the cDNA insert
of clone P9A2. The nucleotide portion 576 to 674
codes for a signal peptide of 23 amino acids.
The TATA box is at a distance characteristic of
interferon Type I genes in front of the starting
codon ATG (positions 476-482). The gene has a
number of signal sequences for polyadenylation
during transcription (ATTAAA at positions 1497-
1502, or 1764-1796; AATAAA at positions 1729-1734
or 1798-1803), the first of which is present in
the clone P9A2.
134018~
- 57 -
e) Sequence of the subclone pRHW22 (IFN-pseudo-
omega2)
Figure 12 shows the sequence, 2132 bp long,
of the HindIII fragment from the cosmid cos9 which
hybridises with the IFN-omegal-DNA probe. An open
reading frame exists from nucleotide 905 to nucleotide
1366. The amino acid sequence derived therefrom
is shown. The first 23 amino acids are similar
to those of the signal peptide of a typical Type
I interferon. The following 131 amino acids show
a similarity to interferon omegal, up to amino
acid 65, whilst tyrosine is notable as the first
amino acid of the mature protein.
Following amino acid position 66 is the sequence
of a potential N-glycosylation site (Asn-Phe-Ser).
From this point onwards the amino acid sequence
is different from that of a Type I interferon.
However, it can be demonstrated that similarity
to IFN-omegal can be established by suitable insertions
and the resulting displacement of the protein reading
frame (see Example 9). Thus, from the standpoint
of Type I interferons, the isolated gene is a pseudogene:
IFN-pseudo-omega2.
f) Sequence of the subclone pRH51 (IFN-pseudo-omega3)
The HindIII fragment originating from cosmid
B and about 3500 bp long which hybridises with
the IFN-omegal DNA probe is partially sequenced
(Figure 13). An open reading frame is obtained
from nucleotide position 92 to 394. The first
23 amino acids display the features of a signal
peptide. The subsequent sequence starts with tryptophan
and shows similarity to IFN-omegal up to amino
acid 42. Thereafter, the derived sequence is different
from IFN-omegal and ends after amino acid 78.
The sequence can be altered by insertions so that
it is then greatly homologous to IFN-omegal (Example
9). The gene is designated IFN-pseudo-omega3.
134018~
- 58 -
g) Sequence of the insert of pRH52 (IFN-pseudo-
omega4)
The sequence of the HindIII fragment which
is 3659 bp long, is isolated from cosmid B and
which hybridises with IFN-omegal-DNA, is shown
in Figure 14. An open reading frame, the translation
product of which is partially homologous to IFN-
omegal, is located between nucleotide positions
2951 and 3250. After a signal peptide of 23 amino
acids, the further amino acid sequence begins with
phenylalanine. Homology to IFN-omegal is interrupted
only after the 16th amino acid, continues at the
22nd amino acid and ends at the 41st amino acid.
Translation would be possible up to amino acid
77. Analogously to Example 8e) and 8f), good homology
can be established with IFN-omegal by the introduction
of insertions (Example 9). The pseudo gene isolated
here is designated IFN-pseudo-omega4.
Example 9
Evaluation of the genes for 4 members of the IFN-
omega family
Figure 15 is a listing of the genes for IFN-
omegal to IFN-pseudo-omega4 together with the amino
acid translation. To establish better analogy,
gaps are inserted in the individual genes which
are indicated by dots. No bases are omitted.
The numbering of the bases includes the gaps.
The amino acid translation of IFN-omegal is retained
(e.g. at positions 352-355: "C.AC" codes for His).
In the case of the pseudo genes, translation into
an amino acid is given only where this is unambigiously
possible. This list immediately shows that the
4 isolated genes are related to one another. Thus,
for example, the potential N-glycosylation site
(nucleotide positions 301 to 309) is obtained in
all 4 genes.
,.. ~ . . _ . . .
1340184
- 59 -
Similarly, apart from the case of IFN-pseudo-
omega4, at nucleotide positions 611 to 614, there
is a triplet which represents a stop codon and which,
in the case of IFN-omegal, terminates a mature protein
with a length of 172 amino acids. There are premature
stop codons in IFN-pseudo-omega2 (nucleotide positions
497 to 499) and in IFN-pseudo-omega4 (nucleotide
positions 512 to 514) using this arrangement.
The degree of relationship between the genes
or the amino acid translations can be calculated
from the arrangement shown in Figure 15. Figure
16 shows the DNA homologies between the members
of the IFN-omega gene family. In the comparison
in pairs, those positions where one of the two
15 -partners or both partners have a gap are not included
in the counting. The comparison gives a homology
of about 85% between IFN-omegal-DNA and the sequences
of the pseudo genes. IFN-pseudo-omega2-DNA is
about 82% homologous to the DNAs of IFN-pseudo-
omega3 and IFN-pseudo-omega4. Figure 17 shows
the results of comparisons of the signal sequences
and Figure 18 shows the results of the comparisons
of the "mature" proteins. The latter vary between
72 and 88%. However, this homology is substantially
greater than that between IFN-omegal and the o-IFNs
and ~-IFN (Example 6). The fact that the individual
members of the IFN-omega family are more distant
from one another than the members of the o-IFN
family can be explained by the fact that three
of the four isolated IFN-omega-genes are pseudo
genes and are not subject to the same selection
pressure as functional genes.
,
- 60 - 13 g0 184
Example 10
Fermentation
Strain storage:
A single colony of the strain E. coli HB101/pRHW12
on LB-agar (25 mg/l ampicillin) is inoculated into
trypton-soya-broth (OXOID CM129) containing 25 mg/l
ampicillin and incubated at 37~C by shaking at
250 RPM until an optical density at 546 nm of about
5 is reached (log-phase). 10% (W/V) of sterile
glycerol are added to the culture, which is then
placed in sterile ampoules in 1.5 ml portions and
frozen at -70~C.
Inoculum stage:
The medium contains 15 g/l Na2HPO4. 12H2O;
0.5 g/l NaCl; 1.0 g/l NH4Cl; 3.0 g/l KH2PO4; 0.25 g/l
MgSO4. 7H2O; 0.011 g/l CaC12; 5 g/l casamino acid
(Merck 2238); 6.6 g/l glucose-monohydrate; 0.1 g/l
ampicillin; 20 mg/l cysteine and 1 mg/l thiamine-
hydrochloride. Each of 4 1000 ml Erlenmeyer flasks
containing 200 ml of this medium is inoculated
with 1 ml of a thawed culture of HB101/pRHW12 and
incubated by shaking at 250 RPM at 37~C for 16
to 18 hours.
Production stage:
The medium consists of 10 g/l (NH4)2HPO4;
4.6 g/l K2HPO4.3H2O; 0.5 g/l NaCl; 0.25 g/l MgSO4.7H2O;
0.011 g/l CaC12; 11 g/l glucose-monohydrate; 21 g/l
casamino acids (Merck 2238); 20 mg/l cysteine,
1 mg/l thiamine-hydrochloride and 20 mg/l 3-~-indoleacrylic
acid. 8 litres of a sterile medium in a 14 1 fermentor
(height:radius = 3:1) are inoculated with 800 ml
of said cultures. The fermentation runs at 28~C,
1000 RPM of agitation (effigas-turbine), an aeration
rate of 1 vvm (volume/volume/minute) and an initial
pH of 6.9. During fermentation, the pH decreases
to 6.0 and is then regulated automatically at this
134018~
- 61 -
level by 3N NaOH. After the optical density at 546 nm has
reached 18 to 20 (usually after 8.5 to 9.5 hours of
fermentation) the culture is cooled to 20~C under aeration and
agitation and then brought to pH = 2.2 by addition of 6N H2SO4
without aeration. After one hour of agitation at 800 rpm and
20~C, the resulting biomass is centrifuged in a CEPA
laboratory centrifuge type GLE at 30,000 rpm. The cell paste
is frozen and stored at -20~C.
Example 11
Purification of omeqa (Gly)-interferon
a) Partial purification
All steps are performed at 4~C.
140 g of biomass (E. coli HB101 transformed with the
expression plasmid pRHW12) are resuspended in 1150 ml of
precooled 1~ acetic acid and stirred for 30 minutes. The pH
of the suspension is shifted to 10.0 by the addition of 5 M
NaOH. The suspension is stirred for another two hours. The
pH is then readjusted to 7.5 using 5 M HCl and the stirring
continued for a further 15 minutes. The suspension is
centrifuged at 4~C for 1 hour at 10,000 rpm (J21 centrifuge
(Beckman*) JA10-rotor).
The clear supernatant is applied to a 150 ml CPG
controlled pore glass-column (CPG 10-350, mesh size 120/200)
at a flow rate of 50 ml/hour. The column is washed using 1 1
25 mM Tris pH = 7.5/lM NaCl and the bound material is eluted
* Trade-mark
.X
.. . ... .. ..... ..
13~018~
- 61a - ~
with a solution containing 25 mM Tris pH = 7.5/lM KCNS/50
ethyleneglycol at a flow rate of 50 ml/hour.
The interferon activity containing fractions are
pooled and dialysed over night against about 100 vol. of 0.1 M
Na-phosphate/10% polyethyleneglycol 40,000. The resulting
precipitate is removed by centrifugation at 4~C for 1 hour at
10,000 rpm (J21 centrifuge, ~A20 rotor) [See Table 1 below].
,~
~. ~
,. ~
, ... .~____
13~018~
- 62 -
b) Further purification
The dialysed and concentrated CPG-eluate is diluted
with 5 vol of buffer A (O.lM Na-phosphate pH = 6.25/25% 1,2-
propyleneglycol). The solution is applied to a MonoS* 5/5
(Pharmacia, cation exchange) column equilibrated with buffer A
using a "superloop" (Pharmacia). Elution is carried out using
a linear gradient from 0 to lM NaCl in buffer A in a total of
20 ml at a flow rate of 0.5 ml/hour. The flow through and the
1 ml fractions are collected and tested for interferon
activity by means of a plaque reduction assay using human A549
cells and EMC-virus. The active fractions are pooled.
Table 1
volume Biological test protein total u/mg yield
(ml) (u/ml *) U total (mg/ml) (mg)
start 1150 15000 17.3x106 3.6 4140 4180 100%
ft 2200 <600 <1.3x106 0.74 1628 <600 < 5%
eluate 124.3 170000 21.0x105 16.8 2088 10000 121%
after
dia- 41 300000 12.3x106 12.6 516.6 23800 71%
lysis
* Plaque-reduction assay: A549 cells, EMC-virus
ft flow through
U: units using interferon-~2 as a standard
* Trade-mark
; _
-63 - 134018~
Example 12
Characterisation of HuIFN-omegal
A. Antiviral activity on human cells
B. Antiviral activity on monkey cells
C. Antiproliferative activity on human Burkitt's
lymphoma cells (Cell line: Daudi)
D. Antiproliferative activity on human cervical
carcinoma cells (cell line: Hela) and synergism
with HuIFN-gamma and human tumour necrosis factor
E. Stability at low pH
F. Serological characterisation.
A. Antiviral activity on human cells
Assay cell line: Human lung carcinoma cells
- A549 (ATCC CCL 185)
Challenge virus: Murine encephalomyocarditis
virus (EMCV)
Assay method: Inhibition of cytopathic
effect
A partially purified preparation of HuIFN-
omegal with a protein content of 9.4 mg/ml was
diluted in cell culture medium and applied to the
assay plates. The preparation showed an antiviral
effect with a specific activity of 8300 Iu/mg relative
to the reference standard preparation Go-23-901-527
(National Institutes of Health, Bethesda, Maryland,
USA).
B. Antiviral activity on monkey cells
30 Assay cell line: GL-V3 vervet monkey kidney
cells (Christofinis G.J.,
J. Med. Microbiol. 3, 351-258;
1970)-
Challenge virus: vesicular stomatitis virus
(VSV)
Assay method: Plaque reduction
A partially purified preparation of HuIFN-
omegal (see Example 12A) was diluted in culture
134018~
64
medium and applied to the assay cells. The preparation
showed a specific activity of 580 units/mg.
C. Antiproliferative activity on human Burkitt's
lympnoma cells (Cell line: Daudi)
The human Burkitt's lymphoma cell line Daudi
was grown in the presence of various concentrations
of HuIFN-omegal (see Example 12A). Cultures were
started at 100,000 cells/ml; cell densities were
determined after 2, 4 and 6 days in culture (37~C).
Untreated cultures served as controls. All cultures
were run in triplicate. Figure 19 shows the results
of the experiment. Cell proliferation was partially
and transiently inhibited at 10 lU/ml, and was
~strongly inhibited at 100 lU/ml.
The following symobols are used in Figure 19:
O control, ~ lIu/ml, ~ 10 Iu/ml, ~ 100 IU/ml.
D. Antiproliferative activity on human cervical
carcinoma cells (cell line: Hela)
The human cervical carcinoma cell line HeLa
was grown in the presence of one of the following
proteins or a mixture of two of the following proteins:
HuIFN-omegal (see Example 12A) at 100 IU/ml.
HuIFN-gamma (see Example 12A) at 100 IU/ml.
Human tumour necrosis factor (HuTNF),
98% pure, prepared by Genentech Inc., San Francisco,
USA (see Pennica D. et al., Nature 312, 712-729,
1984) at 100 ng/ml.
All binary combinations of the mentioned
proteins had the same concentrations as above.
In each case, 2 cultures were started at
50,000 cells/3 cm petri dish and incubated for
6 days at 37~C; thereafter cell densities were
determined.
HuIFN-omegal and HuTNF had only a weak influence
on the growth of the cells, whereas HuIFN-gamma
... ~ ~ .. .
- 65 - 1 34 ~1 8
showed a clear cytostatic activity. A combination
of IFN-gamma with IFN-omegal showed a synergistic
cytostatic/cytotoxic activity. The results of
this experiment are shown in Figure 20.
In this figure, the following symbols are used:
C untreated control, T HuTNF, O HuIFN-omegal,
G HuIFN-gamma.
E. Stability at low pH
A preparation of HuIFN-omegal (see Example
12A) was diluted in cell culture medium RPMI 1640
medium containing 10% fetal calf serum) and adjusted
to pH 2 with hydrochloric acid. Following incubation
at 4~C for 24 hours, the preparation was neutralized
using sodium hydroxide and its antiviral activity
titrated as in Example 12A. The preparation showed
75% of the activity of a control incubated at neutral
pH; HuIFN-omegal therefore can be regarded as stable
at low pH.
F. Serological characterisation
To compare the serological properties of
HuIFN-omegal and Hu-lFN-~2, samples of both proteins
(see Example 12A) were diluted to contain 100 iu/ml,
mixed with equal volumes of solutions of various
antisera or monoclonal antibodies and incubated
for 90 minutes at 37~C. The antiviral activity
of these samples was then compared with those of
untreated controls. Table 2 shows the results
of the experiment. The antiviral activity of HuIFN-
omegal was neutralized only by an antiserum to
human leukocyte-derived IFN at relatively high
concentration, but not by a polyclonal antiserum
to HuIFN-~, HuIFN-~2 or various monoclonal antibodies
that neutralise HuIFN-~2. HuIFN-omegal is thus
serologically unrelated to HuIFN-~2 as well as
to HuIFN-~. Symbols used in Table 2: - not tested,
0, no neutralization, + partial neutralization,
+++ complete neutralization.
1340184
- 66 -
Table 2
AntiserumDilution Neutralization of
monoclonal~g/ml
antibody HuIFN-~2 HuIFN-omegal
EBI_ll) 1 +
1 0 +++
1 0 0 +++
1000 - O
EBI_31) 1 +++
1 0 +++
100 +++
1000 +++ ~
L3B7 ) 100 +++ 0
1000 +++ ~
sheep anti3)
leukocyte IFN 1: 50 000 +++
1:5 000 +++ 0
1:500 +++ +
1:50 - +++
rabbit anti
HuIFN-~2 1:1 000 +++
1:100 +++ O
1:10 - O
sheep anti4)
HuIFN-~ 1:50 - 0
1) EP-A 0.119.476
2) Drug Research 35 364-369 (1985)
3) Research reference reagent catalog no. G-026-502-568
4) Research reference reagent catalog no. G-028-501-568
Research Resources Branch, National Institute of
Allergy and Infectious Diseases, Bethesda, Maryland,
USA.
