Note: Descriptions are shown in the official language in which they were submitted.
1 3~r1 38g
_1_
HUMAN GRANULOCYTE COLONY STIMULATTNG FACTOR
The present invention relates to a human granulocyte
colony stimulating factor. More particularly, the present
invention relates to a gene coding for a polypeptide having
the activity of a colony stimulating factor (hereinafter
abbreviated as CSF) which is a specific stimulating factor
necessary for the principal purpose of forming colonies of
human granulocytic cells. The present invention also
relates to a recombinant vector inserted said gene, a
transformant containing said vector, a polypeptide or glyco-
protein having the CSF activity as produced from said trans-
formant, and a process for producing a polypeptide or glyco-
protein having the CSF activity.
When bone marrow cells as target cells and kidney
cells or fetal cells were cultured by the double-layer soft
agar cultivation method, with the bone marrow cells being in
the upper layer and the kidney or fetal cells in the lower
layer, part of the cells in the upper layer grew and diff er-
entiated to form colonies~~of neutrophilic granulocytes
(hereunder simply referred to as granulocytes) or monocytic
macrophages. This observation has led to the assumption of
the presence in vivo of factors which promote the formation
of colonies [Pluznik and Sach, J. Cell. Comp. Physiol., 66,
319 (1965): and Bradley and Metcalf, Aust. J. Exp. Biol.
Med. Sci., 44, 287 (1966)].
These factors which are collectively referred to as
CSF are known to be produced by cells, such as T-cells,
monocytic macrophages, fibroblasts and endothelial cells,
which normally are distributed extensively in vivo. Among
subclasses of CSF are included: granulocyte-monocytic
macrophage CSF (abbreviated as GM-CSF) which act on the stem'
cells of granulocytes or monocyte macrophages in such a
manner that they stimulate the growth of such stem cells and
induce their differentiation to form colonies of granulo-
cytes or monocytic macrophages monocytic macrophage CSF
(abbreviated as M-CSF) which is principally capable of
1 3 41 38g
-~_
forming colonies of macrocytic macrophages; multipotent CSF
(abbreviated as multi-CSF) which acts on less differentiated
multipotent stem cells; and granulocyte CSF (abbreviated as
G-CSF) of the type contemplated by the present invention
which is principally capable of forming granulocytic colo-
nies. It has recently been held that the stages of differ-
entiation of target cells differ from one subclass of CSF to
another [Asano, Taisha - Metabolism and Disease, 22, 249
(1985); and Yunis et al., "Growth and Maturation Factors",
edited by Guroff, John Wiley & Sons. NY, vol. 1, 209 (1983)].
Therefore, purifying the individual CSF subclasses
and making a closer study of their chemical and biological
properties are very important for the purpose of estimating
the hematopoietic mechanisms and analyzing the patho-
morphological aspects of various hematological diseases.
The biological actions of G-CSF that are drawing increasing
attention of researchers are their capabilities of inducing
the differentiation of bone marrow leukemic cells and
enhancing the functions of mature granulocytes, and much
promise has been held in the potential clinical utility of
G-CSF in the fields of tXeating and preventing leukemia.
The attempts heretof ore made to isolate and purify
G-CSF are based on the method of cell cultivation wherein
G-CSF is isolated from the supernatant of a cell culture,
but homogeneous G-CSF has yet to be produced in large quan-
tities by this method because G-CSF can only be produced in
low concentration and complex purification procedures are
required to obtain a trace amount of G-CSF from a large
volume of culture solution. .Therefore, it has been strongly
desired to achieve mass production of G-CSF by recombinant
DNA technology.
One object of the present invention is to provide a
gene encoding a polypeptide having the human G-CSF activity.
Another object of the present invention is to provide
a recombinant vector incorporating said gene.
Still another object of the present invention is
to provide a transformant which has been produced by
1 ~ ~+1 389
transforming a host with said recombinant vector, and a
polypeptide or glycoprotein which is produced by said
transf ormant .
A further object of the present invention is to
provide a process for producing a polypeptide or
glycoprotein having the human G-CSF activity.
Fig. 1 shows the sequences of three different probes,
IWQ, A and LC;
Fig. 2 shows the nucleotide sequence of a pHCS-1
insert;
Fig. 3(A) shows the nucleotide sequence of a cDNA
insert in pBRG4;
Fig. 3(B) (I) shows the amino acid sequence of a
human G-CSF precursor as deduced from pBRG4 cDNA;
Fig. 3(B) (II) shows the amino acid sequence of human
mature G-CSF as deduced from pBRG4 cDNA;
Fig. 4(A) shows the nucleotide sequence of a cDNA
insert in pBRV2;
Fig. 4(B) (I) shows the amino acid sequence of a
human G-CSF precursor as deduced from pBRV2 cDNA;
Fig. 4(B) (II) shows the amino acid sequence of human
mature G-CSF as deduced from pBRV2 cDNA;
Fig. 5 shows the nucleotide sequence of a human
chromosomal gene coding for human G-CSF;
Fig. 6 shows the restriction enzyme cleavage sites of
pBRG4- or pBRV2-derived human G-CSF cDNA;
Fig. 7 shows the restriction enzyme cleavage sites of
the human chromosomal gene coding far human G-CSF;
Fig. 8 is a partial presentation of the process for
preparing a tac promoter-containing vector (+VSE line):
Fig. 9 is a presentation of the process for preparing
a PL promoter-containing vector (+VSE line);
Fig. 10 is a presentation of the process for prepar-
ing a trp promoter-containing vector (+VSE line);
Fig. 11 is a partial presentation of the process for
preparing a tac promoter-containing vector (-VSE line);
1 3 ~~ 3a9
Fig. 12 is a presentation of the process for prepar-
ing a PL promoter-containing vector (-VSE line);
Fig. 13 is a presentation of the process for prepar-
ing a trp promoter-containing vector (--VSE line);
Fig. 14 shows schematically the structure of pHGA410;
Fig. 15 is a presentation of the processes for con-
structing expression recombinant vectors, pTN-G4, pTN-G4VAa
and pTN-G4VA~;
Figs. 16a and 16b show two processes for constructing
pHGG4-dhfr;
Fig. 16c shows the processes for constructing pG4DR1
and pG4DR2;
Fig. 17 shows schematically the structure of pHGV2;
Fig. 18 is a presentation of the processes for con-
structing expression recombinant vectors, pTN-V2, pTN-VAa
and pTN-VAS;
Figs. 19a and 19b show two processes for constructing
an expression recombinant vector pHGV2-dhfr.
Fig. 19c shows the processes for constructing pV2DRl~
and pV2DR2;
Fig. 20 shows schematically the structure of pMLCE3a;
Fig. 21 shows schematically the structure of pTNCE3a;
and
Fig. 22 shows schematically the structures of
pD26SVCE3a and pDRCE3a.
The gene coding for a polypeptide having the human
G-CSF activity according to the present invention is a DNA
(cDNA) which is complementary to the messenger RNA (mRNA)
that is obtained as 15 - 17S factions by sucrose density
gradient centrifugation and which codes for a polypeptide
having the human G-CSF activity.
The present inventors obtained two lines of this cDNA.
The cDNA of one line has all or part of a gene coding
for the polypeptide I or II shown in Fig. 3(B)» More speci-
fically, this cDNA has the nucleotide sequence delineated by
ATG at 32 - 34 nucleotide positions from 5'-terminus [see
Fig. 3(A)] and ,.CC at 650 - 652 nucleotide positions, or by
1 3 41 389
-5-
ACC at 122 - 124 positions and CCC at 650 - 652 positions.
Alternatively, the cDNA has the nucleotide sequence shown in
Fig. 3(A) or a part thereof. The cDNA of this line is
hereinafter referred to as cDNA (+VSE).
The cDNA of the other line has all or part of a gene
coding for the polypeptide I or II shown in Fig. 4(B). More
specifically, this cDNA has the nucleotide sequence deline-
ated by ATG at 31 - 33 nucleotide positions from 5'-terminus
[see Fig. 4(A)] and CCC at 640 - 642 nucleotide positions,
or by ACC at 121 - 123 positions and CCC at 640 - 642 posi-
tions. Alternatively, this cDNA may have the nucleotide
sequence shown in Fig. 4(A) or a part thereof. The cDNA of
this line is hereinafter referred to as cDNA (-VSE).
The gene described above may be obtained by the
following procesures: a mRNA coded G-CSF is first prepared
from mammalian animal cells or other host cells having the
ability to produce a polypeptide having the G-CSF activity;
the mRNA is then converted to a double-stranded cDNA by any
of the known methods; a set of recombinants containing this
cDNA (the set is hereunder referred to as a cDNA library) is
subsequently subjected to screening by known procedures.
The gene of the present invention also includes a
human chromosomal gene coding for a polypeptide having the
human G-CSF activity. This human chromosomal gene contains
l5 a nucleotide sequence that takes part in transcriptional
control and it also contains all or part of the nucleotide
sequence shown in Fig. 5.
A chromosomal gene may be obtained by first preparing
from human cells a set of recombinants containing a human
chromosomal gene (the set is hereunder referred to as a
human chromosomal gene library), then subjecting said human
chromosomal gene library to screening by known procedures.
The human chromosomal gene may be supplied from any
type of human cells such as cells extracted from the liver
or kidney or cultured cells such as tumor cells. A human
chromosomal gene library may be prepared from human cells by
any of the known methods [see Maniatis et al., Cell, 15, 687
(1978); and Maniatis et al., Molecular Cloning, Cold Spring
~ 3 41 38g
-6-
Harbor Laboratory, p. 269 ff. (1982)], which are illustrated
below:
extract a human chromosomal DNA from such sources as
human fetal liver with phenol or other appropriate chemicals;
digest the extracted DNA partially or completely with an
appropriate restriction enzyme to obtain a DNA fragment of
an appropriate length: insert the DNA fragment into a a-
phage vector DNA fragment with a T4 DNA ligase or other
appropriate ligases, with a linker containing the restric-
tion site for an appropriate enzyme such as EcoRI being
optionally attached; subsequently, obtain a-phage particles
by in vitro packaging method and transform host cells such
as E. coli with the resulting a-phage particles.
Examples of the a-phage usable as the vector in the
above procedures include Charon 4A and EMBL-3 and EMBL-4.
The mammalian cell which may be used as a source of
mRNA supply is a human oral cavity cancer-derived cell
strain, CHU-2 (deposited at Collection Nationale de Cultures
de Microorganismes, or C.N.C.M., under Accession Number
I-483). It should however be understood that in place of
such tumor cell strains, cells that can be separated from
mammals or any other appropriate established cell strains
may be employed. Preparation of mRNA may be achieved by one
of the methods that have already been proposed for cloning
the genes of several other physiologically active proteins:
for example, the whole RNA is first obtained by treatments
with a surfactant and phenol in the presence of a ribo-
nuclease inhibitor such as a vanadyl-ribonucleoside complex
[see Berger and Birkenmeier, Biochemistry, 18, 5143 (1979)]
or by CsCl density gradient centrifugation following
treatment with guanidine thiocyanate [see Chirgwin et al.,
Biochemistry, 18, 5294 (1979)], then poly(A+) RNA (mRNA)
is obtained by subjecting the whole RNA to batch adsorp-
tion or affinity column chromatography on oligo(dT)-
cellulose or poly-U-Sepharose with Sepharose 2B used as a
carrier. The poly(A+) RNA may be further fractionated by an
appropriate method such as sucrose density gradient centrif-
ugation. The ability of thus obtained mRNA to code for a
1 3 41 389
-7-
polypeptide having the G-CSF activity may be confirmed by
several methods; for example, the mRNA is translated into a
protein and its physiological activities are checked; alter-
natively, the identity of that protein is determined with
the aid of an anti-G-CSF antibody. More specifically, mRNA
is injected into oocytes of Xenopus laevis for effecting
translation [see Gurdon et al., Nature, 233, 177 (1972)], or
translational reactions may be performed with rabbit reticu-
locytes or wheat germs [Schleif and wensink, "Practical
Methods in Molecular Biology", Springer-Verlag, NY (1981)].
The G-CSF activity may be assayed by applying the soft agar
cultivation method using bone marrow cells, and techniques
for performing this method have been reviewed [Metcalf,
"Hemopoietic Colonies", Springer-Verlag, Berlin, Heidelberg,
NY (1977)].
A single-stranded cDNA is synthesized with the so
obtained mRNA being used as a template; a double-stranded
cDNA is synthesized from this single-stranded cDNA; and the
double-stranded cDNA is inserted into an appropriate vector
DNA to form a recombinant.~plasmid. This recombinant plasmid
may be used to transforzn~a suitable host, say Escherichia
coli, so as to obtain a group of DNAs in the transformants
(cDNA library).
A double-stranded cDNA may be obtained from the mRNA
by one of the following two methods: the mRNA is treated
with a reverse transcriptase with oligo(dT) which is comple-
mentary to the poly(A)-chain at 3'-terminus being used as a
primer; or an oligonucleotide that corresponds to part of
the amino acid sequence of G -CSF protein is synthesized, and
a cDNA which is complementary to the mRNA is synthesized by
treatment with a reverse transcriptase with the synthesized
oligonucleotide being used as a primer. A double-stranded
cDNA may also be obtained by the following methods: mRNA
is decomposed and removed by treatment with an alkali and
the resulting single-stranded cDNA is treated first with a
reverse transcriptase or DNA polymerase I (e. g. Klenow
fragment), then with S1 nuclease; alternatively, the mRNA
may be directly treated with RNase H and DNA polymerase
1 3 41 389
_8_
(e. g. E.-coli polymerase I). For more information, see,
Maniatis et al., "Molecular Cloning", Cold Spring Harbor
Laboratory (1982); and Gubler and Hoffman, Gene, 2~, 263
(1983).
The so obtained double-stranded cDNA is inserted into
an appropriate vector such as, for example, one of the EK-
type plasmid vectors typified by pSC101, pDF4l, ColEl, pM89,
pBR322, pBR327 and pACYCl, or one of the phage vectors
typified by agt, ac, agtl0 and agtWES, and thereafter, the
recombinant vector is used to transform a strain of E. coli
(e. g. X1776, HB101, DH1 or C600) so as to obtain a cDNA
library (see, for example, "Molecular cloning", ibid.)
The double-stranded cDNA may be joined to a vector
by the following procedures: a terminus of the cDNA is
Provided with a joinable end by attachment of an appropriate
chemically synthesized DNA fragmentp and a vector DNA which
has been cleaved with a restriction enzyme is joined to said
cDNA by treatment with a T4 phage DNA ligase in the presence
of ATP. Alternatively, dC, dG-chains (or dT, dA-chains) are
attached, respectively, to the double-stranded cDNA and a
vector DNA which has been cleaved with a restriction enzyme,
and a solution containing both DNAs is annealed (see
"Molecular Cloning", ibid.)
A host cell may be transformed by the so obtained
recombinant DNA by any of the known methods. If the host
cell is E. coli, the method detailed by Hanahan [J. Mol.
Biol., 166, 557 (1983)] may be employed, wherein the recom-
binant DNA is added to a competent cell prepared in the
presence of CaCl2, MgCl2 or RbCl.
Screening for the cells harboring the desired gene
may be performed by several methods which include: the
plus-minus method employed in the cloning of interferon
cDNA [Taniguchi et al., Proc. Jpn. Acad., 55, Ser. B., 464
(1979)], the hybridization-translation assay method [Nagata
et al., Nature, 284, 316 (1980)], and the colony or plaque
hybridization method using an oligonucleotide probe which
is chemically synthesized on the basis of the amino acid
sequence of the protein having the human G-CSF activity
1 341 389
_g_
[Wallace et al., Nucleic Acids Res., 9, 879 (1981); and
Benton & Davis, Science. 196, 180 (1977)].
The fragment harboring the thus cloned gene coding
for the polypeptide having the human G-CSF activity may be
re-inserted in an appropriate vector DNA for the purpose of
transforming other prokaryotic or eukaryotic host cells.
By introducing an appropriate promoter and an expression-
associated sequence into the vector, the gene can be
expressed in an individual host cell.
Illustrative prokaryotic host cells include
Escherichia coli, Bacillus subtilis, and Bacillus
thermophilus. The gene of interest may be expressed within
these host cells by transforming them with a replicon (i.e.
a plasmid vector harboring an origin and regulator sequence)
which is derived from a host-compatible species. A desir-
able vector is one having a sequence capable of providing
the transformed cell with selectivity for expressed trait
(phenotype).
To take an example, E. coli may be transformed with
pBR322 which is a vector capable of replication in E. coli
[see Bolivar, Gene, 2, 95 (1975)]. This vector contains
both ampicillin- and tetracycline-resistance genes and
either one of the properties may be used to identify the
transformed cell. Examples of the promoter that is neces-
sary for genetic expression in prokaryotic hosts include the
promoter of the ~-lactamase gene [Chang et al., Nature, 275,
615 (1978)], the lactose promoter [see Goeddel et al.,
Nature, 281, 544 (1979)] and the tryptophan promoter [see
Goeddel et al., Nucleic Acid Res., ~, 4057 (1980)] and so on.
Any of these promoters may be employed in the production of
a polypeptide having the human G-CSf activity according to
the present invention.
A eukaryotic microorganism such as Saccharomyces
cerevisiae may be used as a host cell and transformed by a
vector such as plasmid yRp7 [see Stinchcomb et al., Nature,
282, 39 (1979)]. This plasmid has the TRP1 gene as a
selection marker for yeast strains lacking the ability to
produce tryptophan, so the transformants can be selected by
1 341 389
f
-lo-
performing growth in the absence of tryptophan. Examples
of the promoter that can be utilized for gene expression
include an acidic phosphatase gene promoter [Miyanohara
et al.. Proc. Natl. Acad. Sci., USA, 80, 1 (1983)] and an
alcohol dehydrogenase gene promoter [Valenzuela et al.,
Nature, 2~8, 347 (1982)].
The host cell may also be derived from mammalian
cells such as COS cells, Chinese hamster ovary (CHO) cells,
.:-127 cells and Hela cells. An illustrative vector that may
be used to transform these cells is pSV2-gpt [see Mulligan
and Berg; Proc. Natl. Acad. Sci., USA, 78, 2072 (1981)].
The vectors used to transform these cells contain origin,
selection marker, a promoter preceding in position the gene
to be expressed, RNA splicing site, palyadenylation signal,
etc.
Illustrative promoters that may be used for gene
expression in mammalian cells include the promoters of a
retrovirus, polyoma virus, adenovirus, simian virus 40
(SV40), etc. If the promoter of SV40 is used, the desired
gene expression may be readily achieved in accordance with
the method of Mulligan et al, described in Nature, 277, 108
(1979) .
Illustrative origins that can be used include those
derived from SV40, polyoma virus, adenovirus, bovine papil-
15 loma virus (BPV), etc. Illustrative selection markers that
can be used include the phosphotransferase APH (3') II or I
(neo) gene, thymidine kinase (TK) gene, E. coli xanthine-
guanine phosphoribosyltransferase (Ecogpt) gene, dihydro-
folate reductase (DHFR) gene, etc.
In order to obtain polypeptides having the human
G-CSF activity from the above listed host-vector systems,
the following procedures may be used: the gene coding for
the peptide having the human G-CSF activity is inserted at
a suitable site in one of the vectors mentioned above; the
host cell is transformed with the resulting recombinant DNA;
and the obtained transformants are cultured. The desired
polypeptide may be isolated and purified from the cell or
culture solution by any one of the known techniques,
i 3 41 389
-11-
Eukaryotic genes are generally held to exhibit poly-
morphysm as is known for the case of the human interferon
gene [see Nishi et al., J. Biochem., 97, 153 (1985)] and
this phenomenon may cause substitution of one or more amino
acids or a change in the nucleotide seguence but no change
in the amino acid sequence at all.
The G-CSF activity may also be possessed by a poly-
peptide which is deficient of one or mare of the amino acids
in the amino acid sequence shown in Fig. 3(B) or 4(B) or
which has such amino acids added thereto, or a polypeptide
which has one or more of these amino acids replaced by one
or more amino acids. It is also known that a polypeptide
obtained by converting each of the cysteine colons in the
human interleukin-2 (IL-2) gene to a serine colon has the
activity of interleukin-2 [Wang et al., Science, 224, 1431
(1984)]. Therefore, so long as the polypeptides, either
naturally occurring or chemically synthesized, have the
human G-CSF activity, all of the genes that code for these
polypeptides, recombinant vectors containing these genes,
transformants obtained by such recombinant vectors, and the
polypeptides or glycoproteins that are obtained by cultivat-
ing such transformants are included within the scope of the
present invention.
Hereunder outlined are the processes for producing
the gene of the present invention coding for a polypeptide
having the human G-CSF activity, a recombinant vector having
said gene and a transformant having this recombinant vector,
and a polypeptide or glycoprotein having the human G-CSF
activity expressed in this transformant.
(1) Probe preparation
A homogeneous human CSF protein was purified from the
supernatant of a culture of a tumor cell line, CHU-2, and
its amino acid sequence from the N terminus was determined.
Fragments were obtained by decomposition with bromocyan and
treatment with trypsin and the amino sequences of these
fragments were also determined [Example 3(i), (ii) and
(iii) ] .
1 3 41 389
-12_
From the determined amino acid sequences, three
nucleotide probes, (A), (LC) and (IWQ), having the sequences
shown in Fig. 1 were synthesized (Example 4). Probe (A) was
of the mixed type composed of 14 successive nucleotides.
Probe (IWQ) was composed of 30 successive nucleotides with
deoxyinosine and was a probe of the type used in the cloning
of the human cholecystokinin gene [Takahashi et al., Proc.
Natl. Acid. Sci., USA, 82, 1931 (1985)]. Probe (LC) was a
24-nucleotide probe that was synthesized from the nucle-
otides at 32 - 39 positions from the N terminus of the amino
acid sequence shown in Example 3(i) on the basis of the
nucleotide sequence shown in Fig. 3.
Chemical synthesis of nucleotides can be achieved by
applying the improved phosphotriester method to the solid
Phase method and has been reviewed by Narang [Tetrahedron,
39. 3-22 (1983)].
.Probes based on amino acid sequences at positions
other than those in the above-mentioned probes may also be
used.
(2) Construction of cDNA library
CHU-2 cells were ~iomogenized after addition of a
guanidine thiocyanate solution and the total RNA was
obtained by CsCl density gradient centrifugation.
Poly(A+) RNA was isolated from the total RNA by
column chromatography on oligo(dT)-cellulose. Thereafter,
a single-stranded cDNA was synthesized with a reverse tran-
scriptase, and RNase H and ~, cali DNA polymerise I were
added to obtain a double-stranded cDNA. A dC chain was
attached to the obtained double-stranded cDNA, which was
joined to a vector, pBR322, to which a dG chain had been
attached at the Pst I cleavage site. The resulting recom-
binant DNA was used to transform a strain of E. coli, X1776,
and a pBR322-line cDNA library was constructed (Examples 5
and 6).
In a similar manner, the double-stranded cDNA was
joined to the ~gtl0 vector with the EcoRI linker and ~-phage
line cDNA library was constructed (Example 7).
1 341 3~9
-13-
(3) Screening
Recombinants derived from the pBR322-line cDNA
library were fixed on Whatmann 541 filter paper and a
single clone could be selected by colony hybridization with
32P-labelled probe (IWQ). Further study with the Southern
blotting method [Southern, J. Mol. Biol., 98, 503 (1975)]
showed that this clone also hybridized with probe (A). The
nucleotide sequence of this clone was determined by the
dideoxy method [Sanger, Science, 21~, 1205 (1981)].
The nucleotide sequence of the obtained cDNA insert
is shown in Fig. 2, from which one can see that this insert
consisted of 308 base pairs including probes (TWQ) and (A),
and had an open reading frame cading for 83 amino acids
containing the amino acid sequence sh own in Example 3(iii).
The pBR322 derived plasmid containing these 308 base pairs
is hereunder referred to as pHCS-1 (Example 8).
A DNA fragment containing the 308 base pairs obtained
from pHCS-1 was radialabelled by the nick translation method
(see Molecular Cloning, ibid.) and, with this fragment used
as a probe, the agtl0-derived cDNA library was screened by
plaque hybridization [Benton and Davis, Science, 196, 180
(1977)] to obtain five clones. The nucleotide sequence of a
clone which was believed to contain cDNA was determined by
the same method as described above [Fig. 3(A)].
As shown in Fig. 3(A), this cDNA insert had a single
large open reading frame.
The amino acid sequence encoded by this cDNA can be
deduced as shown in Fig. 3(A).
Comparison with the N-terminal amino acid sequence of
G-CSF protein shown in Example 3(i) revealed that this cDNA
contained a nucleotide sequence which corresponded to both a
signal peptide encoded by 90 base pairs starting with the
ATG sequence at 32 - 34 nucleotide positions from 5'-
terminus and ending with the GCC sequence at 119 - 121
positions, and a mature G-CSF polypeptide encoded by 531
base pairs starting with the ACC sequence at 122 - 124
positions and ending with the CCC sequence at 650 - 652
positions. Therefore, the polypeptide of the amino acid
- 1 3 41 389
-14-
sequence I shown in Fig. 3(B) was composed of 207 amino
acids and its molecular weight was calculated as 22292.6?
daltons. The polypeptide of the amino acid sequence II was
composed of 177 amino acids and its molecular weight was
calculated as 18986.74 daltons (Example 9).
It should be noted that the ATG at 32 - 34 positions
or at 68 - 70 positions can also be considered to be the
protein initiation site. Escherichia coli strain X1776
harboring pBR322 which had this cDNA (+VSE) at the EcoRI
cleavage site has been deposited with the Fermentation
Research Institute, the Agency of Industrial Science and
Technology (FERM BP-954).
Fig. 6 shows the restriction enzyme cleavage sites of
the gene .
This cDNA was joined to pBR327 CSoberon et al., Gene,
9, 287 (1980)] at the EcoRI site and the resulting plasmid
is hereunder referred to as pBRG4.
The thus obtained pBRG4 was treated with a restric-
tion enzyme, EcoRI, to obtain a DNA fragment containing cDNA
of about 1500 base pairs. This fragment was radiolabelled
by the nick translation method (see Molecular Cloning,
ibid.) and, with this radiolabelled DNA fragment being used
as a probe, the agtl0-derived cDNA library was screened once
again by plaque hybridization (see Benton and Davis, ibid.)
In this plaque hybridization, two sheets of a-phage DNA
fixed nitrocellulose filter paper were prepared; one of
these sheets was used for the above-mentioned plaque hybrid-
ization and another one was subjected to plaque hybridiza-
tion with the already described probe (LC). The phages
which turned positive for both probes were selected. A
clone which has a "full-length" cDNA was selected and the
nucleotide sequence of the cDNA insert as determined by the
dideoxy method is shown in Fig. 4(A).
This cDNA had a single large open reading frame and
the amino acid sequence that would be encoded by this cDNA
was deduced as shown in Fig. 4(A).
Comparison with the N-terminal amino acid sequence
of G-CSF protein shown in Example 3(i) revealed that this
a ~ 4~ ~e9
-15-
cDNA contained a nucleotide sequence which corresponded to
both a signal peptide encoded by 90 base pairs starting
with the ATG sequence at 31 - 33 nucleotide positions from
5'-terminus and ending with the GCC sequence at 118 - 120
positions, and a mature G-CSF polypeptide encoded by 522
base pairs starting with the ACC sequence at 121 - 123
positions and ending with the CCC sequence at 640 - 642
positions. Therefore, the polypeptide of the amino acid
sequence I shown in Fig. 4(B) was composed of 204 amino
acids and its molecular weight was calculated as 21977.35
daltons. The polypeptide of the amino acid sequence II was
composed of 174 amino acids and its molecular weight was
calculated as 18671.42 daltons (Example 10).
It should be noted that the ATG at 58 - 60 positions
or at 67 - 69 positions can also be considered to be the
protein initiation site.
Escherichia coli strain X1776 harboring pBR322 which
had this cDNA (-VSE) at the EcoRI cleavage site has been
deposited with the Fermentation Research Institute, the
Agency of Industrial Science and Technology (FERM BP-955).
Fig. 6 shows the restriction enzyme cleavage sites of
the gene. This cDNA was joined to pBR327 at the EcoRI site
to form a plasmid which is hereunder referred to as pBRV2.
(4) Screening a human chromosomal gene library
A human chromosomal gene library that was prepared in
accordance with the procedures described by Maniatis et al.
(Molecular Cloning, ibid.) was subjected to screening with
the pHCS-1 shown above. Probes that may be employed in
screening include: a pHCS-1-derived 308-by DNA fragment,
a pBRG4-derived ca. 1500-by DNA fragment, a pBRV2-derived
ca. 1500-by DNA fragment, a DNA fragment of an appropriate
length containing part of one or more of these DNA frag-
ments, as well as the aforementioned oligonucleotide probes
[i.e., (IWQ), (A) and (IC)]. The case of using the pHCS-1
DNA fragment is hereunder described.
This DNA fragment was radiolabelled with 32P in
accordance with the nicl~ translation method [see Roop et al.,
Cell, 15, 431 (1978)]. With the resulting 32P-labelled
1 341 389
-16-
fragment used as a probe, the human chromosomal gene library
was subjected to screening by plaque hydridization (see
Benton and Davis, ibid.) so as to obtain ten-odd clones.
After recovering DNA from the clones, a restriction
enzyme map was prepared by known procedures [Fritsch et al.,
Cell, 19, 959 (1980)].
With the same DNA probe being used, Southern blotting
(see Southern, ibid.) was conducted and it was found that a
DNA fragment of about 4 kb that was cut out with EcoRI and
XhoI could potentially contain a region for encoding the
human G-CSF polypeptide. Therefore, the ca. 4-kb DNA frag-
ment was inserted into pBR327 at the EcoRI site using an
EcoRI linker so as to obtain pBRCE3a. With this plasmid
being used as a base sequencing DNA, the nucleotide sequence
of the ca. 3-kb portion of that ca. 4-kb DNA fragment was
determined by the dideoxy method. As a result, said DNA
fragment was found to be a gene coding for the human G-CSF
polypeptide (Fig. 5).
E. coli strain X1776 harboring pBRCE3s (i.e. the
plasmid pBR327 having said ca. 4-kb DNA fragment inserted
into the EcoRI site) has been deposited with the Fermenta-
tion Research Institute, the Agency of Industrial Science
and Technology (FERM BP-956).
Comparison between the pBRG4 cDNA insert shown in
Fig. 3 and the pBRV2 cDNA insert shown in Fig. 4 revealed
that the DNA fragment under discussion contained five exon
portions and that it coded for the amino acid sequences
deduced from pBRG4 and pBRV2.
Fig. 7 shows the restriction enzyme cleavage sites of
the obtained gene.
This DNA fragment contained the chromosomal gene of
human G-CSF, or the preceding region to be transcribed to
human G-CSF mRNA, plus a nucleotide sequence taking part in
transcriptional control [Benoist and Chambon, Nature, 290,
304 (1981): and Breathnack and Chambon, Ann. Rev. Biochem.,
50, 349 (1981)].
(5) Construction of recombinant vector for expression
in E. coli
1 341 X89
-17-
(A) +VSE line recombinant vector
From the pBRG4 plasmid obtained in (3) (Example 9),
a cDNA fragment of the G-CSF polypeptide was cut out
with a restriction enzyme arid a recombinant vector was
constructed by one of the following methods:
(i) using an annealed synthetic linker, the fragment was
ligated with a fragment prepared from a tac promoter-
containing pKK223-3 (Pharmacia Fine Chemicals) (Example
12 and Fig. 8);
(ii) three fragments prepared from PL promoter containing
pPL-lambda (Pharmacia Fine Chemicals) were ligated with
an annealed synthetic linker and, the ligation product
and the cDNA fragment were subjected to re-preparation
procedures to construct a recombinant vector (Example
13, Fig. 9); or
(iii) using an annealed synthetic linker, the fragment
was ligated with a fragment prepared from a trp
promoter-containing pOYI plasmid (Example 14 and Fig.
10) .
(B) -VSE line recombinant vector
In the same manner as described above, three recom-
binant vectors were constructed using the plasmid pBRV2
(Example 10) as shown in Example 19 and Figs. 11, 12 and
13.
(6) Preparation of E. coli transformants, and cultivation
and expression thereof
Using three recombinant vectors of each of the +VSE
and -VSE lines, E, coli strain DH1, N4830 or 3M105 was
transformed by the calcium chloride or rubidium chloride
procedure described in Molecular Cloning, ibid. (Examples
12, 13, 14 and 19). Each of the transformants obtained was
cultivated in ampicillin-containing Luria medium, with
induction being subsequently conducted as required to
achieve expression (Examples 15 and 20).
'35 (7) Recovery and purification of G-CSF polypeptide from
E. coli and amino acid analysis thereof
A culture solution of the transformants was centri-
f uged to obtain a cell pellet. The collected cells were
1 3 41 389
-ls-
treated with a lysozyme and, after lysis by cyclic freezing
and thawing, the supernatant was obtained. Alternatively,
the cells were treated with guanidium chloride, centrifuged
and the supernatant was recovered.
The supernatant was subjected to gel filtration on an
Ultrogel ACA54 column (LKB) and the active fractions were
concentrated with an ultrafiltration apparatus.
Subsequently, an aqueous solution of trifluoroacetic
acid containing n-propanol was added to the concentrate and,
after being left in ice, the mixture was centrifuged and
adsorbed on a reverse-phase C18 column. After elution, the
fractions were checked for their activity. The active frac-
tions were collected and subjected to the same procedures of
purification as described above. The purified fractions
were freeze-dried and the powder was dissolved and subjected
to high performance liquid chromatography based on molecular
size. The obtained polypeptides were subjected to SDS-
polyacrylamide gel electrophoresis and a single band for
the desired G-CSF polypeptide was confirmed (Examples 16
and 20). The so obtained polypeptide showed human G-CSF
activity (Examples 17 and 20). The G-CSF polypeptide was
analyzed by an amino acid analyzing method with a Hitachi
835 Automatic Amino Acid Analyzer (Hitachi, Ltd.) For
analysis of the N-terminal amino acids, a gas-phase
sequencer (for Edman decomposition), high-pressure liquid
chromatographic apparatus and Ultrasphere-ODS column were
used (Examples 18 and 21).
(8) Construction of recombinant vectors for animal cells
Recombinant vectors (derived from BPV) for use with
C127 and NIH3T3 cells as host cells were constructed for
each of the +VSE and -VSE line cDNAs and for the chromosomal
gene. Recombinant vectors (with dhfr) for use with CHO
cells were also constructed for each of th +VSE and -VSE
line cDNAs and for the chromosomal gene. Recombinant
vectors for use with COS cells were also constructed. In
the following, representative examples are described and,
for further details, reference should be made to the
relevant working examples.
~ 3 41 389
-19-
(A) Construction of recombinant vectors of the +VSE line
The cDNA (+VSE) fragment obtained in (3) was inserted
into a vector pdKCR to make a plasmid pHGA410 (Example 22
and Fig. 14), which was partially digested with EcoRI
followed by treatment with DNA polymerase I (Klenow frag-
ment) to create blunt ends. A linker HindIII was attached
to the DNA, which was subsequently treated with HindIII
and T4DNA lipase. The treated DNA was used to transform
E, coli strain DH1 by the rubidium chloride procedure (see
Molecular Cloning, ibid.) The resulting plasmid was named
pHGA410(H) (Fig. 15).
The pHGA410(H) was treated with Sall and, after blunt
ends were created, it was treated with HindIII once again
and a HindIII-SalI fragment was recovered. A plasmid
pdBPV-1 having a transformed fragment of bovine papilloma
virus was treated with HindIII and PvuII and the larger
DNA fragment was separated and joined to the separately
prepared HindIII-SaII fragment. The joined fragments were
used to transform E. coli strain DH1 to obtain a plasmid,
pTN-G4, which had the pHGA410-derived CSF-cDNA (Fig. 15
and Example 23).
Either plasmid, pHGA410 or pHGA410(H), in combination
with the plasmid pAdD26SVpA was used to construct pHGG4-
dhfr which was a recombinant vector (+VSE) for use with
CHO cells (Figs. 16a and b, and Example 25).
A 2-kb DNA fragment containing the dhfr gene was
recovered from pAdD26SVpA by treatment with EcoRI and
BamHI and the recovered fragment was inserted into pHGA410
(H) at the HindIII site so as to construct pG4DR1 and
pG4DR2 (Fig. 16c and Example 25).
(B) Construction of -VSE line recombinant vectors
The cDNA (-VSE) fragment obtained in (3) was inserted
into a vector pdKCR to make a plasmid pHGV2 (Example 28),
which was partially digested with EcoRI followed by treat-
ment with DNA polymerase I (Klenow fragment) to create
blunt ends. A linker HindIII was attached to the DNA,
which was subsequently treated with HindIII and T4DNA
lipase. The treated DNA was used to transform E, coli
1 3 ~~ 389
-20-
strain DH1 by the rubidium chloride procedure (see
Molecular Cloning, ibid.) The resulting plasmid was named
pHGV2(H) (Fig. 18).
The pHGV2(H) was treated with SalI and, after blunt
ends were created, it was treated with HindIII once again
and a HindIII-SalI fragment was recovered. A plasmid
pdBPV-1 having a transformed fragment of vobine papilloma
virus was treated with HindIII and PvuII and the larger
DNA fragment was separated and joined to the separately
prepared HindIII-Sall fragment. The joined fragments were
used to transform E. coli strain DHl to obtain a plasmid,
pTN-V2, which had the pHGV2-derived CSF-cDNA (Fig. 18 and
Example 29).
By similar procedures, either plasmid, pHGV2 or
pHGV2(H), in combination with the plasmid pAcID26SVpA was
used to construct pHGV2-dhfr which was a recombinant
vector (-VSE) for use with CHO cells (Figs. 19a and b,
and Example 31).
A DNA fragment of ca. 2 kb containing the dhfr gene
2p was recovered from pAdD,26SVpA by treatment with EcoRI and
BamHI and the recover~cl~fragment was inserted into pHGV2
(H) at the HindIII site so as to construct pV2DR1 and
pV2DR2 (Fig. 19c and Example 31).
(C) Construction of recombinant vectors containing the
chromosomal gene
The plasmid gBRCE3~ that was obtained in (4) and
which contained the chromosomal gene shown in Fig. 5 was
treated with EcoRI.
The pSVH+R+ plasmid described by Banerji et al. in
Cell, 27, 299 (1981) was treated with KpnI to remove the
globin gene. The plasmid was further subjected to partial
digestion with HindIII so as to remove part of the late
gene of SV40. The fragments were re-joined to prepare an
expression vector pML-E+.
This vector was treated with the restriction enzyme,
EcoRI, and dephosphorylated with an alkaline phosphatase
(Takara Shuzo Co., Ltd.) to obtain a vector DNA, which was
linked to the aforementioned chromosomal DNA fragment with
- 1 3 41 389
-21-
the aid of a T4DNA ligase (Takara Shuzo Co., Ltd.) to
obtain pMLCE3a which was a recombinant vector for COS
cells (Example 34). As shown in Fig. 20, this plasmid
contained the enhancer of SV40 gene) the replication
origin of SV40, the replication origin of pBR322 and the
pBR322-derived S-l.ac~.ama:~c~ gene (,~pr ) , and had the human
G-CSF chromosomal gene joined downstream from the enhancer
of SV4 0 gene .
An expression vector for 0127 cells was constructed
by the following procedures. A DNA fragment containing
the chromosomal CSF gene was cut out with an appropriate
restriction enzyme from pMLCE3a which was the expression
vector for COS cells. This fragment was joined, with a
T4DNA ligase, to a DNA fragment containing the origin of
bovine papilloma virus (BPV) and a DNA fragment containing
the early promoter of SV40. The resulting pTNCE3a was an
expression vector that had a chromosomal CSF gene linked
downstream from the early promoter of SV40 and which
contained a 65$ portion of BPV.
The expression vector for CHO cells had two DNA
fragments linked together by a T4DNA ligase; one fragment
contained the chromosomal CSF gene and the early promoter
of SV40 as in the case of the expression vector for C127
cells, and the other fragment contained a pAdD26SVpA-
derived dhfr gene. The resulting pD26SVCE3~ was an
expression vector that had the chromosomal CSF gene down-
stream of the SV40 promoter and, the dhfr gene downstream
of the principal late promoter of adenovirus.
(9) Expression in animal cells
Two representative examples are hereunder described
and, for further details, see the relevant working examples.
(A) Expression in mouse C127 cells
Plasmid pTN-G4 or pTN-V2 was treated with BamHI.
The treated plasmid was used to transform C127 cells
(previously grown by cultivation) by the calcium phos-
phate procedure. The transformed cells were cultured
and clones having high CSF production rate were
selected. Glycaproteins containing the expressed G-CSF
1 .341 3gg
_22_
were recovered and purified from the culture solution of
the transformed cells and were found to have human G-CSF
activity. The presence of the desired glycoprotein was
also confirmed by amino acid and sugar content analyses
of the sample.
For sugar content analysis, the CSF sample used in
amino acid analysis was subjected to determination of
amino sugar by the Elson-Margan method, determination of
neutral sugar by the orcinol sulfate procedure, or deter-
urination of sialic acid by the thiobarbiturate procedure.
The procedures of each determination are shown in
"Tohshitsu no Kagaku "Chemistry of Saccharides" (Part 2 of
two parts)", Chapter 13, Vol. 4 of A Course in Biochemical
Experiments, published by Tokyo Kagaku Dojin. Conversion
1S of the measured values into weight percent revealed that
the sugar content of the G-CSF obtained was distributed
within the range of 1 - 20 wt$ depending upon the type of
host cells, expression vectars and the cultivation
conditions.
(B) Expression in COS cells
COS cells, which were derived from a monkey CV-1
cells and which had been transformed by SV40-origin
deficient mutant to express the large-size T antigen of
SV40 [see Gluzman et al., Cell, 32, 175 (1981)], were
transformed by the vector pMLCE3a which was obtained in
(5)(C) and which contained the human chromosomal G-CSF
gene. The supernatant of the culture of the COS cells
showed the human G-CSF activity (Example 35).
The COS cells were recovered and subjected to mRNA
analysis, which showed the existence of two mRNAs that
corresponded to the amino acid sequences depicted in Fig.
3(A) and Fig. 4(A), respectively.
Exampl es
Before the present invention is described in greater
detail with reference to working examples, the following
referential examgle is provided for the gurpose of illus-
trating the methods of assaying the CSF activity.
~ 3 41 X89
-23-
Referential Example: Assaying CSF Activity
The following methods were used to determine the CSF
activity (hereunder abbreviated as CSA) in the present
invention.
CSA assay
(a) With human bone marrow cells: '
Single-layer soft agar cultivation was conducted in
accordance with the method of Bradley, T.R. and Metcalf, D.
(Aust. J. Exp. Biol. Med. Sci», 44, 287-300, 1966). More
specifically, 0.2 ml of a bovine fetal serum, 0.1 ml of the
sample, 0.1 ml of a human bone marrow nonadherent cell sus-
pension (1 - 2 x 105 nuclear cells), 0.2 ml of a modified
McCoy's 5A culture solutiom, and 0.4 ml of a modified
McCoy's 5A culture solution containing 0.?5% of agar were
mixed, poured into a plastic dish for tissue culture (35
mm~), coagulated, and cultured at 37°C in 5% C02/95% air and
at 100 humidity. Ten days later. the number of colonies
formed was counted (one colony consisting of at least 50
cells) and CSA was determined with one unit being the
activity required for forming one colony.
(b) With mouse bone marrow cells:
A horse serum (0.4 ml), 0.1 m1 of the sample, 0.1 ml
of a C3H/He (female) mouse bone marrow cell suspension (0.5
- 1 x 105 nuclear cells), and 0.4 ml of a modified McCoy's
5A culture solution containing 0.75% of agar were mixed,
poured into a plastic dish for tissue culture (35 mm~),
coagulated, and cultured fob 5 days at 37°C in 5% C02/95%
air and at 100% humidity. The number of colonies formed was
counted (one colony consisting of at least 50 cells) and CSA
was determined with one unit~being the activity fox forming
one colony.
The modified McCoy's 5A culture solution used in each
of the methods (a) and (b) and the human bone marrow non-
adherent cell suspension used in (a) were prepared by the
following procedures. '
Modified McCoy's 5A culture solution (double concentration)
Twelve grams of McCoy's 5A culture solution (Gibco),
2.55 g of MEM amino acid-vitamin medium (Nissui Seiyaku Co.,
1 3 41 389
-24-
Ltd.), 2.18 g of sodium bicarbonate and 50,000 units of
potassium penicillin G were dissolved twice in 500 ml of
distilled water and the solution was aseptically filtered
through a Millipore filter (0..22 um).
Human bone marrow nonadherent cell suspension
A bone marrow fluid obtained from a healthy person
by sternal puncture was diluted 5-fold with an RPMI 1640
culture solution, plated over a Ficoll-Paque solution
(Pharmacia Fine Chemicals) and centrifuged at 400 x g for
30 minutes at 25°C. The interfacial cell layer (specific
gravity <1.077) was recovered. The cells were washed,
adjusted to a concentration of 5 x 106 cells/ml with an RPMI
1640 culture solution containing 20$ of bovine fetal serum,
poured into a 25-cm2 plastic flask for tissue culture, and
incubated for 30 minutes in a C02 incubator. Nonadherent
cells were recovered in the supernatant, poured into a
plastic flask (25 cm2) and incubated for 2 hours and a half.
Nonadherent cells in the supernatant were collected and used
in an assay.
Example 1: Establishment of CHU-2
A tumor of a patient with oral cancer wherein pro-
nounced increase was observed in the number of neutrophiles
was transplanted into nu/nu mice. About 10 days after the
transplantation, the increase in the weight of the tumor and
in the number of neutrophiles was pronounced. Twelve days
after the transplantation, the tumor was extracted asepti-
cally, shredded into cubes of 1 - 2 mm3 and cultured in the
following manner.
Ten to fifteen cubes of the tumor were put into a
50-ml plastic centrifugal tube. After addition of 5 ml of
a trypsin solution (containing 0.25 of trypsin and 0.02$
of EDTA), the tube was shaken for 10 minutes in a warm bath
at 37°C and the supernatant was discarded. Another 5 ml of
the same trypsin solution was added and trypsin digestion
was conducted under agitation far 15 minutes at 37°C. The
supernatant cell suspension was recovered and stored in ice
after the trypsin had been inactivated by addition of 1 ml
of a bovine fetal serum.
a
1 341 389
-2 5-
After repeating these procedures once again, the
cell suspension was recovered, combined with the previously
obtained suspension, and centrifuged at 15,000 rpm for 10
minutes to obtain a cell pellet. The pellet was washed
twice with F-10 containing 10~ of a bovine fetal serum and
was thereafter loaded in a plastic culture flask (25 cm2)
to give a cell concentration of 5 x 106 cells/flask. After
incubation overnight in a C02 incubator (5~ C02 and 100$
humidity) with an F-10 culture solution containing 10$ of a
bovine fetal serum, the supernatant was removed together
with the nonadherent cells, and culture was continued with
a fresh supply of culture solution. Six days after the
start of culture, the flask became full of the cells and
the culture solution was replaced by a fresh one. On the
next day, the culture solution was discarded and the flask
was charged with 2 ml of an anti-mouse erythrocyte antibody
(Cappel) diluted 5-fold with RPMI 1640 and 2 ml of a guinea
pig complement (Kyokuto Seiyaku Co., Ltd.) diluted 2.5-fold
with RPMI 1640. After incubation for 20 minutes at 37°C,
the culture was washed twice with F-10 containing 10~ of a
bovine fetal serum and the nu~'nu mouse derived fibroblasts
were removed. Subsequently, an F-10 culture solution con-
taining 10$ of a bovine fetal serum was added and cultiva-
tion was conducted for 2 more days. Thereafter, same of
the cells were recovered and subjected to cloning by the
limiting dilution method.
The resulting 11 clones were checked for their CSF
activity and one clone (CHU-2) exhibited activity about 10
times as high as that of the other clones.
Example 2: Isolation of CSF
The cells established in Example 1 were grown in a
completely dense population in two culture flasks (150 cm2).
The cells were recovered, suspended in 500 ml of an F-10
culture solution containing 10$ of a bovine fetal serum,
transferred into a glass roller bottle of 1580 cm2 (Belco),
and whirl-cultured at 0.5 rpm. When the cells were found to
have grown in a completely dense population on the inner
wall of the roller bottle, the culture solution was replaced
1 3 ~1 38~
-26-
by a serum-free RPMI 1640. After 4-day culture, the super-
natant of the culture was recovered and cultivation was
continued with F-10 containing 10$ of.a bovine fetal serum
being added. After 3-day culture, the culture solution was
again replaced by a serum -free RPMI 1640 and the supernatant
of the culture was recovered 4 days later. By repeating
these procedures, 500 ml of the serum-free supernatant of
culture per bottle was obtained each week. In addition,
this method enabled the supernatant of culture to be
recovered, with the cells maintained over a significantly
prolonged period.
A batch consisting of 5,000 ml of the supernatant of
the culture obtained was mixed with 0.01 of TWEEN* 20 and
concentrated about 1000 times by ultrafiltration with Hollow
Fiber DC-4 and Amicon PM-10 (Amicon). The concentrate was
purified by the following steps.
(i) A portion (5 ml) of the concentrated supernatant of
culture was subjected to gel filtration on an ULT1~AGEL* AcA54
column (4.6 cm~ x 90 cmL~ LKB) at a flow rate of ca. 50
ml/hr with 0.01 M Tris-HC1 buffer (pH 7.4) containing 0.15 M
NaCl and 0.01$ TWEEN 20 (Nakai Kagaku Co., Ltd.) The column
had been calibrated with bovine serum albumin (Mw; 67,000),
ovoalbumin (Mw: 45,000) and cytochrome C (Mw; 12,400).
After completion of the gel filtration, 0.1 ml of each of
the fractions was diluted 10-fold and screened for the
active fractions by the above-described method of CSA assay
(b). The fractions for Ve = 400 - 700 ml were found to
exhibit macrophage-dominant CSA while the fractions for
Ve = 800 - 1200 ml showed granulocyte-dominant CSA. There-
f ore, the latter fractions were collected and concentrated
to a volume of ca. 5 ml on an ultrafiltration apparatus with
PM-10 (Amico) .
(ii) To the cocentrated fractions was added an aqueous
solution of 0.1~ trifluoroacetic acid coma-fining 30~ of n-
. propanol (for determination of amino acid sequence; avail-
able from Tokyo Kasei K.K.) After the mixture had been left
to stand in ice for about 15 minutes, the precipitate was
removed by centrifugation for 10 minutes at 15,000 rpm. The
* Trade mark
1 ~ 41 389
-27-
supernatant was adsorbed on a u-Bondapak C18 column (8 mm x
30 cm for semipreparatory use; Waters) equilibrated with the
aqueous solution containing n-propanol and trifluoroacetic
acid; the column was continuously eluted with an aqueous
solution of 0.1% trifluoroacetic acid which contained n-
propanol having a linear concentration gradient of 30 - 60%.
A high-pressure liquid chromatographic apparatus, Hitachi
Model 685-50 (Hitachi, Ltd.), and a detector, Hitachi Model
638-41 (Hitachi, Ltd.) were employed to determine the
absprptions at 220 nm and 280 nm simultaneously. After
elution, 10 u1 of each of the fractions was diluted 100-fold
and screened for the active fractions by the above-described
method of CSA assay (b). The peaks eluted with 40% n-
propanol were found to have CSA activity, so they were col-
lected, re-chromatographed under the same conditions, and
assayed for CSA by the same method. Again, CSA activity was
observed in the peaks at 40% n-propanol. Therefore, these
peaks were collected (4 fractions = 4 ml) and freeze-dried.
(iii) The freeze-dried powder was dissolved in 200 u1 of
an aqueous solution of 0.1% trifluoroacetic acid containing
40% of n-propanol, and the solution was subjected to high-
pressure liquid chromotography on TSK-G 3000SW column (Toyo
Soda Manufacturing Co., Ltd.; 7.5 mm x 60 cm). Elution was
conducted with the same aqueous solution at a flow rate of
0.4 ml/min and the fractions were taken in 0.4-ml portions
with a fraction collector, FRAC-100 (Pharmacia Fine
Chemicals). Each of the fractions taken was checked for
its CSA by the same method as described above and activity
was observed in the fractions for retention times of 37 - 38
minutes (corresponding to MW of ca. 2 x 104). The active
fractions were recovered and purified on an analytical u-
Bondapak C18 column (4.6 mm x 30 cm). The main peaks were
recovered and freeze-dried. The sample obtained was assayed
by the method of CSA assay (a); it was found to have human
G-CSF activity.
Examtale 3: Determination of Amino Acid Sequence
(i) Determination of N-terminal amino acid sequence
The sample was subjected to Edman decomposition with
1 3 41 389
a gas-phase sequencer (Applied Bios;ystems) and the resulting
PTH amino acid was analyxed by routine procedures with a
high-pressure liquid chromatographic apparatus (Beckman
Instruments) and Ultrasphere-ODS column (Beckman Instru-
ments). The column {5 um; 4.6 mm~ x 250 mmL) was equi-
librated with a starting buffer [aq. sol. containing 15 mM
sodium acetate buffer (pH 4.5 and 40$ acetonitrile] and
injected with the sample {as dissolved in 20 u1 of the start-
ing buffer). Separation was effected by isocratic elution
with the starting buffer. The flow rate was 1.4 ml/min and
the column temperature was held at 40°C. Detection of the
PTH amino acid was achieved utilizing the absorptions in the
UV range at 269 nm and 320 nm. Standard samples of PTH
amino acid (Sigma) in 2-nmol portions were separated on the
same line to determine their retention times, which were
compare with those of the sample to be tested. As a result,
the sample was found to have the following amino acid
sequence of the 40 residues from N-terminus:
H2N - Thr - Pro - Leu - Gly - Pro - Ala - Ser - Ser -
(10) , ;
Leu - Pro - Gln -~ Ser - Phe - Leu - Leu - Lys - Cys -
(20)
Leu - Glu - Gln - Val - Arg -- Lys - Ile - Gln - Gly -
(30)
Asp - Gly - Ala - Ala - Leu - Gln - Glu - Lys - Leu -
(40)
Cys - Ala - Thr - Tyr - Lys --
(ii) Decomposition with bromocyan
The sample was dissolved in 70$ formic acid. To the
solution, 200 equivalent amounts of bromocyan that had been
purified by sublimation was ,added. The mixture was left
overnight at 37oC for reaction. The reaction product was
freeze-dried and fractionated by HPLC on a TSK G3000SW
column (Toyo Soda Manufacturing Co., Ltd.) to obtain four
peaks. The peaks were named CN-1, C:N-2, CN-3 and CN-4 in
the decreasing order of the molecular weight. The first two
peaks (CN-1 and CN-2) had better yields and their amino acid
sequences were analyzed with an automatic gas-phase
sequencer (Applied Biosystems) under the same conditions as
used in (i).
~ 3 41 389
-29_
As a result, CN-1 was found to be a peptide from the
N-terminus of G-CSF protein, and CN-2 had the following
amino acid sequence:
Pro - Ala - Phe - Ala - Ser - Ala - Phe
Gln - Arg - Arg - Ala - Gly - Gly - Val
Leu - Val - Ala - Ser - His - Leu - Gln
(iii) Decomposition with trypsin
The sample was dissolved in 0.1 M Tris-HC1 buffer (pH
7.4) containing 8 M urea and the solution was mixed with 0.1
M Tris-HC1 buffer (pH 7.4) containing 0.1$ 2-mercaptoethanol
to provide a final urea concentration of 2 M. A TPCK
treated trypsin (Sigma) was added such that the sample-to-
enzyme ratio was 50:1. The mixture was held for 4 hours at
25oC and, after addition of an equal amount of TPCK-treated
trypsin, the mixture was held for an additional 16 hours at
25°C. Thereafter, the reaction product was subjected to
high-speed reverse-phased column chromatography on C8 column
(Yamamura Kagaku K.K.), with elution conducted with 0.1~ TFA
containing n-propanol having a linear density gradient of 5
l0 - 60$. While several peaks were obtained by measuring the
absorption at 280 nm, the main peak was analyzed for its
amino acid sequence with an automatic gas-phase sequences
(Applied Biosystems) under the same conditions as used in
(i). As a result, the main peak was found to be a peptide
having the following sequence which contained part of the
CN-2 fragment shown in ( i i )
Gln - Leu - Asp - Val - Ala -- Asp - Phe - Ala - Thr -
Thr - Ile - Trp - Gln - Gln - Met - Glu - Glu - Leu -
Gly - Met - Ala - Pro - Ala - Leu - Gln - Pro - Thr -
Gln - Gly - Ala ~- Met - Pro - Ala - Phe - Ala - Ser -
Example 4: Preparation of DNA Probe
(i) Synthesis of probe (IWQ)
Thirty successive nucleotides (see Fig. 1) were
prepared on the basis of the sequence of 10 amino acids
(Ile-Trp-Gln-Gln-Met-Glu-G1u-Leu-Gly-Met) included within
the amino acid sequence obtained in Example 3(iii). It
will be necessary to make one comment about the notation of
nucleotides shown in Fig. 1; for example, the nucleotide at
1 3 41 389
-30-
9-position from 5'-terminus is an equimolar mixture of dA
and dG. The starting nucleotides were mostly dimers but
mononucleotides were also used as required. A glass filter
equipped column was charged with 20 mg of the starting
nucleotide resin, Ap-d (G) (Yamasa ~r~oyu Co., Ltd. ) After
repeated washing with methylene chloride, the 4,4'-
dimethoxytrityl group was eliminated by treatment with a
solution of methylene chloride containing 3$ trichloroacetic
acid. Subsequently, the column was washed several times
with 1 ml of methylene chloride. After the column was
washed with anhydrous pyridine to displace the solvent, 20
mg of a nucleotide dimer, (DMTr)ApTp(NHR3), (Nippon Zeon;
NHR3 = triethylammonium; DMTr - dimethoxytrityl) and 0.2 ml
of pyridine were added, and the interior of the column was
vacuum-dried with a vacuum pump. Subsequently, 20 mg of
2,4,6-trimethylbenzenesulfonyl-3-nitrotriazolide (MSNT of
Wako Pure Chemical Industries, Ltd.) and 0.2 ml of anhydrous
pyridine were added, and the interior of the column was
displaced with a nitrogen gas» The nucleotide resin was
condensed with the dimer by reaction for 45 minutes at room
temperature, with occasional shaking. After completion of
the reaction, the column was washed with pyridine and the
unreacted OH groups were acetylated with a pyridine solution
containing excess acetic anhydride and 4-dimethylamino-
pyridine. After washing the column with pyridine, the
following dimers or monomers were condensed, in the order
written, by repeating the above-described procedures:
(DMTr)Ip(NHR3), (DMTr)GpGp(NHR3), (DMTr)Ip(NHR3), an
equimolar mixture of (DMTr)CpTp(NHR3) and (DMTr)TpTp(NHR3),
an equimolar mixture of (DMTr)ApAp(NHR3) and
(DMTr)ApGp(NHR3), an equimolar mixture of (DMTr)ApGp(NHR~)
and (DMTr)GpGp(NHR3), (DMTr)GpAp(NHR3), (DMTr)TpGp(NHR3), an
equimolar mixture of (DMTr ) ApAp (NHR3 ) and (DMTr ) GpAp (NHR3 ) ,
(DMTr)CpAp(NHR3), an equimolar mixture of (DMTr)ApAp(NHR3)
and (DMTr)ApGp(NHR3), (DMTr)GpCp(NHR3), (DMTr)TpGp(NHR3),
(DMTr)Ip(NHR3) and (DMTr)ApTp(NHR3), with all of these
nucleotides being available from Nippon Zeon except for
(DMTr)Ip(NHR3) which was available from Yamasa Shoyu Co.,
1 3 41 389
-31-
Ltd. After completion of the reaction in the final stage,
the resin was washed successively with pyridine, methylene
chloride and ether without acetylation, and thereafter dried.
The dried resin was suspended in 1.7 ml of a mixture of pyri-
dine (0.5 ml), water (0.2 ml) and dioxane (1 ml) containing
1 M tetramethylguanidine and 1 M a-picolinaldoxime. The
suspension was left to stand overnight at room temperature
and concentrated to 100 - 200 v1 under vacuum. The concen-
trate was mixed with a small amount (2 - 3 drops) of pyri-
dine and 2 - 3 ml of concentrated aqueous ammonia, and the
mixture was heated at 55°G for 6 hours. Following extrac-
tion with ethyl aetate, the aqueous layer was separated and
concentrated under vacuum. The concentrate was dissolved in
a solution of 50 mM triethyl ammonium acetate (pH 7.0) and
the solution was subjected to chromato-graphy on C-18 column
(1.0 x 15 cm; Waters), with elution conducted with aceto-
nitrile (linear density gradient of 10 - 30'x) in a solution
of 50 mM triethyl ammonium acetate (pH 7.0). The peak
fraction eluted at an acetonitrile concentration of about
25~ was concentrated under vacuum.
To the concentrate, 80~ acetic acid was added and the
mixture was left to stand for 30 minutes at room temperature.
Following extraction with ethyl acetate, the aqueous layer
was separated and concentrated under vacuum. The resulting
concentrate was further purified by high-pressure liquid
chromatography on C-18 column (from Senshu Kagaku K.K.;
SSC-ODS-272; 6~ x 200 mm). Elution was conducted with aceto-
nitrile (10 - 20~! linear density gradient) in a solution of
50 mM triethyl ammonium acetate (pH 7.0). A synthetic DNA
was obtained in a yield no lower than 10A260 units.
Analysis by the Maxam-Gilbert sequencing method
[Meth. Enzym., 65, 499 (1980)) revealed that the oligonucle-
otide obtained had the nucleotide sequence shown in Fig. 1.
(ii) Synthesis of probe (A)
Fourteen successive nucleotide (see Fig. 1) were
obtained on the basis of the sequence of 5 amino acids (Met-
Pro-Ala-Phe-Ala) included within the amino acid sequence
obtained in Example 3(iii)»
'I 3 4~ 389
-32-
Synthesis procedures were similar to those employed
in the preparation of probe (IWQ), and the following
nucleotides were condensed to a nucleotide resin, Ap-d(T)
(Yamasa Shoyu Co., Ltd.) in the order written:
S (DMTr)CpAp(NHR3), (DMTr)GpGp(NHR3), an equimolar mixture of
(DMTr)CpAp(NHR3), (DMTr)CpTp(NHR3), (DMTr)CpGp(NHR3) arid
(DMTr)CpCp(NHR3), an equimolar mixture of (DMTr)ApGp(NHR3),
(DMTr)TpGp(NHR3), (DMTr)GpGp(NHR3) and (DMTr)CpGp(NHR3),
(DMTr)ApAp(NHR3), an equimolar mixture of (DMTr)CpAp(NHR3)
and (DMTr)CpGp(NHR3), and (DMTr)Gp(NHR3), with all nucle-
otides being available from Nippon Zeon. A synthetic DNA
was obtained in a yield of ca, 10A260 units. Analysis by
the Maxam-Gilbert sequencing method revealed that the oligo-
nucleotide obtained had the nucleotide sequence shown in
Fig. 1.
(iii) Synthesis of probe (LC)
Automatic DNA synthesis was accomplished with a DNA
synthesizer, Model 380A of Applied Biosystems. This tech-
nique, based on the principles described by Caruthers et al.
[J. Am. Chem. Soc., 103, 3185 (1981)], is generally referred
to as the ghosphoramidite procedure.
A phosphoramidite form of (DMTr)-dT preliminarily
activated with tetrazole was condensed to dG-S (S: support)
wherein 5'-dimethoxytrityl group (DMTr) was deblocked.
Thereafter, the unreacted hydroxyl groups were acetylated
and oxidated with iodine in the presence of water to make a
phosphoryl group. After deblocking the DMTr group, conden-
sation was repeated in the same manner until 24 nucleotides
having the sequence shown in Fig. 1 were synthesized. These
nucleotides were cleaved from the support, deblocked, and
purified by reverse-phased high-pressure liquid chromato
graphy on C-18 column (Senshu Kagaku Co., Ltd.; SSC-ODS-272).
Example 5: Cultivation of CHU-2 Cells and Preparation
of mRNA
1) Cultivation and recovery of CHU-2 cells
Established CHU-2 cells were grown in a completely
dense population in two culture flasks (150 cm2), recovered,
suspended in 500 ml of an RPMI 1640 culture solution
~ 341 3~9
-33-
containing 10% of a bovine fetal serum, transferred into a
glass roller bottle of 1580 cm2 (Belco), and whirl-cultured
for 4 days at 0,5 rpm. When the cells were found to have
grown in a completely dense population on the inner wall of
the roller bottle, the culture solution was removed from the
roller bottle, which was charged with 100 ml of a preheated
(37°C) physiological saline solution containing 0.02% of
EDTA. After heating at 37°C for 2 minutes, the cells were
separated from the inner wall of the flask by pipetting.
The resulting cell suspensian was centrifuged at 1500 rpm
for 10 minutes to obtain a cell pellet. The cells were
resuspended in 5 ml of an EDTA-free physiological saline.
solution. The suspension was centrifuged at 1500 rpm for
10 minutes to obtain a cell pellet (wet weight, ca. 0.8 g).
The so obtained cells were stared frozen at -80oC until they
were subjected to procedures for extraction of RNA.
2) Purification of mRNA
Isolation of mRNA from the CHU-2 cells obtained in 1)
was accomplished by procedures which were essentially the
same as those described in "Malecular cloning", Maniatis et
al., Cold Spring Harbor, page 196, 1982. The frozen CHU-2
cells (wet weight, 3.8 g) were suspended in 20 ml of a solu-
tion of 6 M guanidine [6 M guanidinium isothiocyanate, 5 mM
sodium citrate (gH 7,0), 0.1 M ~-mercaptoethanol, and 0.5%
sodium sarcosyl sulfate] and the suspension was well mixed
by vortexing for 2 - 3 minutes. The mixture was subjected
to 10 cyclic suction and ejection with a syringe (capacity,
20 ml) equipped with a 18G needle. About 6 ml of the
viscous guanidinium solution containing the disrupted cells
was layered onto a 6-ml cushion of 5.7 M CsCl in 0.1 M EDTA
(pH 7.5) in a Beckman SW40 Ti polyallomer centrifuge tube
in such a manner that the tube became full of the contents.
Four centrifuge tubes were prepared by the procedures
described above and centrifuged at 30,000 rpm for 15 hours
at 20°C. The resulting pellets were washed three times
with a small amount of 70% ethanol.
The pellets obtained from the respective tubes were
combined, dissolved in 550 u1 of water and worked up to
f 1 3 41 389
-34-
provide a NaCl concentration of 0.2 M. After treatment with
a 1:1 mixture of phenol and chloroform and with chloroform
alone, 2.5 volumes of ethanol were added to precipitate the
total RNA (ca. 10.1 mg of the total RNA was obtained from
3.8 g of wet cells).
Poly(A+) RNA was purified from the total RNA by the
following procedures of affinity chromatography taking
advantage of the attachment of a poly(A) chain at 3' termi-
nus of the mRNA. Adsorption on oligo(dT)-cellulose (Type 7
of P-L Biochemicals) was achieved by passage through an
oligo(dT)-cellulose column of the total RNA in a loading
buffer [containing 10 mM Tris-HC1 (pH 7.5), 0.5 M NaCl, 1 mM
EDTA, and 0.1% SDS solution] after the solution had been
heated at 65°C for 5 minutes. The column had been equi-
librated with the same loading buffer. Elution of poly(A+)
RNA was accomplished with a TE solution [containing 10 mM
Tris-HC1 (pH 7.5) and 1 mM EDTA]. The unadsorbed effluent
was re-charged through the column and the eluate obtained by
repeating the same procedures was mixed with the first run
of eluate. As a result, 400 ug of the poly(A+) RNA was
obtained.
The so prepared mRNA was fractionated for size by
sucrose density gradient centrifugation in accordance with
the procedures described in the laboratory manual of Schleif
and Wensink, "Practical Methods in Molecular Biology",
Springer-Verlag, New York, Heidelberg, Berlin (1981).
Stated more specifically, a 5 - 25% sucrose density
gradient was created in a Backman SW40 Ti centrifuge tube.
Two sucrose solutions were prepared by dissolving 5% and 25%
of RNase-free sucrose (Schwarz/Mann) in a solution contain-
ing 0.1 M NaCl, 10 mM Tris-HCl (pH 7.5), 1 mM EDTA, and 0.5%
SDS.
Eight hundred micrograms of the mRNA [poly(A+)-RNA]
prepared by the method already described was dissolved in
200 - 500 u1 of a TE solution. The solution was heated at
65°C for 5 minutes and, after being quenched, it was placed
on the sucrose density gradient solutions, which were
centrifuged at 30,000 rpm for 20 hours. Fractions each
X34'389
-35-
weighing 0.5 ml were collected and their absorption at 260
nm was measured. The sizes of the fractionated RNAs were
determined on the basis of the positions of standard RNAs
(ribosome RNAs 285, 18S and 5S). At the same time, the G-
CSF activity of each fraction was examined with oocytes of
Xenopus laevis by the following procedures, First, the mRNA
of each fraction was worked up into an aqueous solution
having a concentration of 1 ~g/ul; oocytes were taken from
Xenopus (about one year old) and the mRNA solution was
injected in such a manner that a 50-~ng of mRNA was injected
into one oocyte; ten such oacytes were placed in each of 96
wells in a microtiter plate; the oocytes were cultured for
48 hours at room temperature in 100 u1 of a Barth medium j88
mM NaCl; 1 mM KC1; 2.4 mM NaHC03; 0.82 mM MgS04; 0.33 mM
Ca(N03)2; 0.41 mM CaCl2; 7.5 mM Tris-HCl (pH 7.6); penicil-
lin, 10 mg/L; and streptomycin sulfate, 10 mg/L]; the super-
natant of the culture was recovered, concentrated and puri-
fied to a grade suitable for assay of G-CSF activity.
The G-CSF activity was found to be present in 15 -
17S fractions.
Example 6: Synthesis of cDNA (Construction of pBR-line
cDNA Library)
From the poly(At) RNA obtained in Example 5 was
synthesized cDNA by the method of Land et al. [Nucleic Acids
Res., 9, 2251 (1981) ] as modified by the method of Gubler
and Hoffman [Gene, 25, 263 (1983)].
1) Synthesis of single-stranded cDNA
An Eppendorf tube (capacity, 1.5 ml) was charged with
reagents in the following order: 80 u1 of a reaction buffer
(500 mM RC1, 50 mM MgCl2, 250 mM Tris-HC1, pH 8.3); 20 u1 of
200 mM dithiothreitol, 32 u1 of 12.5 mM dNTP (containing
12.5 mM each of dATP, dGTE, dCTP and dTTP), 10 u1 of a-32P-
dCTP (PB 10205 of Amerscham) , 32 u1 of oligo (dT) 12-18 (f rom
P-L Biochemicals; 500 ug/ml), 20 u1 of poly(A+) RNA (2.1
ug/ul), and 206 u1 of distilled water. A total of 400 u1 of
the reaction solution was heated at 65°C for 5 minutes, and
thereafter heated at 42°C for 5 minutes. To the heated
solution, 120 units of a reverse transcriptase (Takara Shuzo
3 41 389
Co., Ltd.) was added. Following reaction for 2 more hours
at 42°C, 2 u1 of an RNase inhibitor (Bethesda Research
Laboratories), 20 u1 of a TE solution, 16 u1 of 100 mM
sodium pyrophosphate and 48 units (4 ~1) of a reverse tran-
scriptase were added, and reaction was carried out at 46°C
f or 2 hours. The reaction was quenched by addition of 0.5 M
EDTA (8 u1) and 10~ SDS (8 ~1). By subsequent treatment
with phenol/chloroform and precipitation with ethanol
(twice), a single-stranded cDNA was obtained.
2) Attachment of dC-chain to the single-stranded cDNA
The single-stranded cDNA obtained in 1) was dissolved
in distilled water. To the solution was added 60 u1 of a
dC-chain adding buffer (400 mM potassium cacodylate, 50 mM
Tris-HC1 (pH 6.9), 4 mM dithiothreitol, 1 mM CoCl2, and 1 mM
dCTP], and the mixture was heated at 37°C for 5 minutes. To
the reaction solution, 3 p1 of a terminal transferase (27
units/ul; P-L Biochemicals) was added and the mixture was
heated at 37oC for 2.5 minutes. Following treatment with
phenol/chloroform (once) and precipitation with ethanol
(twice), the dC-tailed cDNA was dissolved in 40 u1 of a TE
r
solution containing 100 ~n'M NaCI.
3) Synthesis of double-stranded cDNA
To 40 u1 of the DNA solution prepared in 2), 4 u1 of
oligo(dG)12-18 (200 ug/ml; P-L Biochemicals) was added and
the mixture was heated first at 65oC for 5 minutes, then at
42°C for 30 minutes. While the reaction solution was held
at 0°C, 80 u1 of a buffer [100 mM Tris-HCl (pH 7.5), 20 mM
MgCl2, 50 mM (NH4) 2504, and 500 mM TCC1 ] , 4 u1 of 4 mM dNTP
(containing 4 mM each of dATP, dCTP, dGTP and dTTP), 60 u1
of 1 mM S-NAD, 210 u1 of distilled water, 20 u1 of ~ coli
DNA polymerase I (Takara Shuzo C:o., Ltd.), 15 u1 of E. coli
DNA ligase (Takara Shuzo Co., Ltd.) and 15 u1 of E. coli
RNase H (Takara Shuzo Co., Ltd.) were added, and the mixture
was subjected to reaction at 12°C for 1 hour. Following
addition of 4 mM dNTP (4 u1), reaction was carried out at
25°C for 1 hour. By subsequent treatment with phenol-
chloroform and precipitation with ethanol (once), about 8 ~g
1 341 3~9
-37-
of a double-stranded cDNA was obtained. This double-
stranded cDNA was dissolved in a TE solution and subjected
to 1.2~ agarose gel electrophoresis. Fragments correspond-
ing to the size of ca. 560 by to 2 kbp were adsorbed on
Whatman DE81 and about 0.2 ug of the double-stranded cDNA
could be recovered by elution.
4) Attachment of dC-chain to the double-stranded cDNA
The double-stranded cDNA prepared in 3) was dissolved
in 40 u1 of a TE solution. After 8 u1 of a dC-tail adding
buffer of the type identified in 2) had been added, the
mixture was heated at 37°C for 2 minutes. Following addi-
tion of 1 u1 of a terminal transferase (27 units/ul), the
mixture was subjected to reaction at 37oC for 3 minutes.
Thereafter, the reaction solution was immediately cooled to
0°C, and the reaction was quenched by addition of 1 u1 of
0.5 M EDTA. Following treatment with phenol/chloroform and
precipitation with ethanol, the precipitate obtained was
suspended in 10 u1 of a TE solution.
5) Construction of pBR-line cDNA library
Four microliters of a commercial oligo(dG)-tailed
pBR322 vector (Bethesda Research Laboratories; 10 ng/u1) and
2 u1 of the dC-tailed double-stranded cDNA obtained in 4)
were annealed in a TE solution containing 75 u1 of 0.1 M
NaCl. The annealing consisted of three stages: heating at
65°C for 5 minutes, subsequent heating at 40°C for 2 hours,
followed by cooling to room temperature.
In accordance with the method described in the
laboratory manual of Maniatis et al. [Molecular cloning,
Cold Spring Harbor, p 249 ff. (1982)] (other routine tech-
niques could also be used here), competent cells were
prepared from E. coli strain X1776, and transformed with
the annealed plasmid to produce transformants.
Example 7: Synthesis of cDNA (Construction of aphage
Library)
1) Synthesis of single-stranded cDNA
In accordance with the procedures described in
Example 5, 3.8 g of frozen CHt7-2 cells were purified twice
~1 3 41 389
-38-
on an oligo(dT)-cellulose column and subsequently worked up
to obtain 400 ug of poly(A+) RNA.
A TE sol ution (10 u1 ) having 12 ug of the poly (A+)
RNA dissolved therein was placed in a reaction tube contain-
s ing 10 ug of actinomycin D (Sigma). Thereafter, the tube
was charged with reagents in the following order: 20 u1 of
a reverse transcription buffer [250 mM Tris-HC1 (pH 8.3); 40
mM MgCl2; 250 mM KC1]; 20 u1 of 5 mM dNTP (containing 5 mM
each of dATP, dGTP, dCTP and dTTP); 20 u1 of oligo(dT)12-18
(0.2 ug/ml; P-L Biochemicals); 1 u1 of 1 M dithiothreitol;
2 u1 of RNasin (30 units/ul; Promega Biotech); 10 u1 of a
reverse transcriptase (10 units/ul; Seikagaku Rogyo Co.,
Ltd.); 1 u1 of a-32P-dATP (10 uCi; Amerscham); and 16 u1 of
water. The reaction solution totalling a volume of 100 u1
was held at 42°C for 2 hours and the reaction was quenched
by addition of 0.5 M EDTA (5 u1) and 20$ SDS (1 u1). By
subsequent treatment with phenoi/chlorof orm (100 u1) and
precipitation with ethanol (twice), about 4 ug of a single-
stranded cDNA was obtained.
2) Synthesis of double-stranded cDNA
The cDNA obtained in 1) was dissolved in 29 u1 of a
TE solution and a reaction solution was prepared by adding
the following reagents in the order written: 25 u1 of a
polymerase buffer [400 mM Hepes (pH 7.6); 16 mM MgCl2, 63 mM
~-mercaptoethanol, and 270 mM KC1]; 10 u1 of 5 mM dNTP; 1.0
u1 Of 15 mM ~-NAD; 1. 0 u1 of a-32-P-dATP (10 uCi/ul ) ; 0. 2 u1
of ~ coli DNA ligase (60 units/ul; Takara Shuzo Co., Ltd.);
5.0 u1 of E. co i DNA polymerase I (New England Biolabs; 10
units/ul); 0.1 u1 of RNase H (60 units/ul; Takara Shuzo Co.,
Ltd.); and 28.7 u1 of distilled water.
The reaction solution was incubated at 14°C for 1
hour, allowed to return to room temperature, and incubated
for an additional hour. Then, the reaction was quenched by
addition of 0.5 M EDTA (5 u1) and 20$ SDS (1 u1), and treat-
ment with phenol/chloroform and precipitation with ethanol
were performed. The DNA obtained was dissolved in 20 u1 of
0.5 mM EDTA and a reaction solution was prepared by addition
of 3 u1 of a Rlenow buffer [500 mM Tris-HCl (pH 8.0) and 50
~ 3 41 389
-39-
mM MgCl2], 3 u1 of 5 mM dNTP, and 4 u1 of water. After
addition of 1 u1 of a DNA polymerase (Rlenow fragment;
Takara Shuzo Co., Ltd.), the reaction solution was incubated
at 30oC for 15 minutes.
The incubated reaction solution was diluted with 70
u1 of a TE solution and the reaction was quenched by addi-
tion of 0.5 M EDTA (5 u1) and 20% SDS (1 u1). By subsequent
treatment with phenol/chloroform and precipitation with
ethanol, about 8 up of a double-stranded cDNA was obtained.
3) Methylation of double-stranded cDNA
An aqueous solution (30 u1) of the double-stranded
cDNA synthesized in 2) was mixed with 40 u1 of a methylation
buffer [500 mM Tris-HC1 (pH 8.0); 50 mM EDTA], 20 u1 of a
SAM solution [800 uM S-adenosyl-L-methylmethionine (SAM); 50
mM ~-mercaptoethanol], and 100 u1 of water. To the mixture,
15 j~l of an EcoRI methylase (New England Biolabs; 20
units/ul) was added to make a reaction solution totalling
200 u1 in volume. Following incubation at 37°C for 2 hours,
treatments with phenol and ether and precipitation with
ethanol were conducted to recover the DNA.
4) Addition of EcoRI linker
To about 1.2 up of the methylated double-stranded
DNA, 1.5 u1 of a lipase buffer [250 mM Tris-HC1 (pH 7.5) and
100 mM MgCl2], 0.5 u1 of a preliminarily phosphorylated
EcoRI linker (lOmer; Takara Shuzo Co., Ltd.), 1.5 u1 of 10
mM ATP, 1.5 u1 of 100 mM dithiothreitol, and 2 u1 of H20
were added to make a reaction solution totalling 15 u1 in
volume. After 0.7 u1 of T4 DNA lipase (3.4 units/ul; Takara
Shuzo Co., Ltd.) had been added, reaction was carried out
overnight at 4°C. Thereafter, the l.igase was inactivated by
heating at 65°C for 10 minutes. The reaction solution was
worked up to a total volume of 50 ~.~1 by addition of 100 mM
Tris-HC1 (pH 7.5), 5 mM MgCl2, 50 mM NaCl and 100 ug/ml of
gelatin. Following addition of EcoRI (3.5 u1: 10 units/ul),
reaction was carried out at 37°C for 2 hours. Subsequently,
2.5 u1 of 0.5 M EDTA and 0.5 u1 of 20% SDS were added,
followed by treatment with phenol/chloroform and precipita-
tion with ethanol so as to recover the DNA. Thereafter, the
1 34~ 389
-40-
unreacted EcoRI linker was removed by gel filtration on
Ultrogel AcA34 (LKB) or agarose-gel electrophoresis, so as
to recover about 0.5 - 0.7 1~g of the linker-added double-
stranded cDNA.
5) Joining double-stranded cDNA to agtl0 vector
The linker-added double-stranded cDNA was mixed with
2.4 up of preliminarily EcoRI-treated ~,gtl0 vector (Vector
Cloning system), 1.4 u1 of a lipase buffer (250 mM Tris-HC1
and 100 mM MgCl2), and 6.5 u1 of distilled water, and the
mixture was heated at 42°G for 15 minutes. Thereafter, 1 u1
of 10 mM ATP, 1 u1 of 0.1 M dithiothreitol and 0.5 u1 of T4
DNA lipase were added to make a total volume of 15 u1 and
reaction was carried out overnight at 12°C.
6) In vitro packaging
About a third of the recombinant DNAs prepared in 5)
was packed with an in vitro packaging kit (Promega Biotech)
to obtain phage plaques.
Example 8: Screening of pBR-Line Library with Probe (IWQ)
Whatman 541 paper was placed on a colony-growing agar
.medium and left to stand at 37oC for 2 hours. The filter
paper was subsequently tfeated by the following method of
Taub and Thompson [Anal. Biochem., x26, 222 (1982)].
The colonies transferred onto the 541 paper was
further grown onto an agar medium containing chloramphenicol
(250 ug/ul) overnight at 37°C.
The 541 paper was recovered and left at room tempera-
ture for 3 minutes on another sheet of filter paper that had
been impregnated with a 0.5 N NaOH solution. This procedure
was repeated twice. Two similar runs were conducted for 3
minutes using a solution of D.5 M Tris-HCl (pH 8). At 4°C,
treatments were conducted with a solution of 0.05 M Tris-HC1
(pH 8) for 3 minutes, and with 1.5 mg/ml of a lysozyme
solution (containing 0.05 M Tris-HC1 (pH 8) and 25$ sucrose]
for 10 minutes; then, at 37°C, treatments were conducted
with a solution of 1 x SSC (0.15 M NaCl and 0.015 M sodium
citrate) for 2 minutes, and with a 1 x SSC solution contain-
ing 200 ug/ml of proteinase K for 30 minutes; finally, at
room temperature, treatments were conducted with a 1 x SSC
1 3 41 389
-41-
solution for 2 minutes, and with 95% ethanol solution for 2
minutes. The final step was repeated twice. Thereafter,
the 541 paper was dried. The dried 541 paper was immersed
in a 25:24:1 mixture of phenol/chlaroform/isoamylalcohol
[equilibrated with 100 mM Tris-HC1 (pH 8.5), 100 mM NaCl
and 10 mM EDTA] for 30 minutes at room temperature. Subse-
quently, similar procedures were repeated three times with
a 5 x SSC solution for 3 minutes, then twice with a 95%
ethanol solution for 3 minutes. Thereafter, the filter
paper was dried.
The probe (IWQ) was labelled with 32P in accordance
with routine procedures (see Molecular Cloning) and colony
hybridization was performed in accordance with the method of
Wallace et al. [Nucleic Acids Res., 9, 879 (1981)].
Prehybridization was conducted at 65°C for 4 hours in a
hybridization buffer containing 6 x NET [0.9 M NaCl; 0.09 M
Tris-HC1 (pH 7.5): and 6 mM EDTA], 5 x Denhardt's solution,
0.1% SDS and 0.1 mg/ml of denatured DNA (calf thymus).
Thereafter, hybridization was conducted overnight at 56°C in
a hybridization buffer (f or its formulation, see above)
containing 1 x 106 cpm/ml of the radiolabelled probe (IWQ).
After completion of the reaction, the 541 paper was washed
twice with a 6 x SSC solution (containing 0.1% SDS) f or 30
minutes at room temperature, then washed at 56°C for 1.5
minutes. The washed 541 paper was then subjected to
autoradiography.
The plasmid was separated from positive clones and
subjected to Southern blotting with the probe (IWQ).
Hybridization and autoradiography were conducted under the
same conditions as described above.
Similarly, Southern blotting was conducted with the
probe (A). Using a hybridization buffer having the formula-
tion shown above, hybridization was conducted first at 49°C
for 1 hour. After leaving it to 39°C, hybridization was
further continued at the same temperature for 1 hour. After
completion of the reaction, a nitrocellulose filter was
washed twice With 6 x CSC cont:aini.n~ 0.1~ SDS for 30 minutes
a
1 34~ 3~9
-42-
at room temperature, then washed at 39°C for 3 minutes. The
washed paper was subjected to autoradiography.
As a result, a single clone was found to be positive,.
Nucleotide sequencing by the dideoxy method revealed that
this clone had a DNA composed of 308 base pairs containing
the portions of both probe (IWQ) and probe (A). The pBR322-
derived plasmid containing this insert was named pHCS-1.
Example 9: Screening of lPhage Line Library with pHCS-1
Derived DNA Probe
Plaque hybridization was conducted in accordance with
the method of Benton and Davis [Science, 196, 180 (1977)].
The pHCS-1 obtained in Example 8 was treated with Sau3A and
EcoRI to obtain a DNA fragment of ca. 600 bp. This DNA
fragment was radiolabelled by nick translation in accordance
with routine procedures. A nitrocellulose filter (S & S)
was placed on the phage plaque-growing agar medium to trans-
fer the phages onto the filter. After denaturing the phage
DNA with 0.5 M NaOH, the filter paper was treated by the
following procedures: treatment with 0.1 M NaOH and 1.5 M
NaCl for 20 seconds; two treatments with 0.5 M Tris-HC1 (pH
7.5) and 1.5 M NaCl for 20 seconds; finally, treatment with
120 mM NaCl, 15 mM sodium citrate, 13 mM KH2P04 and 1 mM
EDTA (pH 7.2) for 20 seconds.
The filter was subsequently dried and heated at 80°C
for 2 hours to immobilize the DNA. Prehybridization was
conducted overnight at 42oC in a prehybridization buffer
containing 5 x SSC, 5 x Denhardt's solution, 50 mM phosphate
buffer, 50% formamide, 0.25 mg/ml of denatured DNA (salmon
sperm DNA) and 0.1% SDS. Thereafter, hybridization was
conducted at 42°C for 20 hours in a hybridization buffer
containing 4 x 105 cpm/ml of pHCS-1 probe that had been
radiolabelled by nick translation. This hybridization
buffer was a mixture of 5 x SSC, 5 x Denhardt's solution,
20 mM phosphate buffer (pH 6.0), 50% formamide, 0.1% SDS,
10% dextran sulfate and 0.1 mg/ml of denatured DNA (salmon
sperm DNA).
'i ~ 41 389
-43-
The hybridized nitrocellulose filter was washed for
20 minutes with 2 x SSC containing 0,1% SDS at room tempera-
ture, then for 30 minutes with 0.1 x SSC containing 0.1% SDS
at 44oC, and finally for 10 minutes with 0.1 x SSC at room
temperature. Detection by autoradiography was then
conducted.
As a result, five positive clones (G1 - G5) were
obtained. The clone contained a "full-length" cDNA was
checked for its DNA nucleotide sequence by the dideoxy
method and the nucleotide sequence shown in Fig. 3(A) was
identified. This cDNA was cut out of the ~gtl0 vector and
joined to pBR327 [Soberon et al., Gene, _9, 287 (1980)] at
the EcoRI site to form a plasmid which could be prepared on
a large scale. This plasmid i.s named pBRG4.
Example 10: Screening of ~Phage Line Library with
pBRG4-Derived DNA Probe and Probe (LC)
Plaque hybridization was performed in accordance with
the method of Benton and Davis (see Science, ibid.) employed
in Example 9. A nitrocellulose filter (S & S) was placed on
the phage plaque-growing agar medium to transfer the phages
onto the filter. After denaturing the phage DNA with 0.5 M
NaOH, the filter was treated by the following procedures:
treatment with 0.1 M NaOH and 1.5 M NaCl for 20 seconds;
then two treatments with 0.5 M Tris--HC1 (pH 7.5) and 1.5 M
NaCl for 20 seconds; finally, treatment with 120 mM NaCl, 15
mM sodium citrate, 13 mM KH2P04 and 1 mM EDTA (pH 7.2) for
20 seconds. The filter was subsequently dried, and heated
at 80oC for 2 hours to immobilize tree DNA. Two sheets of
the same filter were prepared in the manner described above
and subjected to screening with the pBRG4-derived DNA probe
and the probe (LC).
Screening with the pBRG4-derived DNA probe was
carried out by the following pracedures. The pBRG4 was
treated with EcoRI to obtain a DNA fragment of ca. 1500 bp.
This DNA fragment was radiolabelled by nick translation in
accordance with routine procedures. One of the two nitro-
cellulose filters was subjected to prehybridization over-
night at 42°C in a prehybridization buffer containing 5 x
SSC, 5 x Denhardt's solution, 50 mM phosphate buffer, 50%
~ 3 41 389
_44_
formamide, 0.25 mg/ml of denatured DNA (salmon sperm DNA)
and 0.1% SDS. Thereafter, the filter was subjected to
hybridization at 42°C for 20 hours in a hybridization buffer
containing the radiolabelled DNA probe (ca. 1 x 106 cpm/ml)
of ca. 1500 bp. This hybridization buffer was a mixture of
5 x SSC, 5 x Denhardt's solution, 20 mM phosphate buffer (pH
6.0), 50% formamide, 0.1% SDS, 10% dextran sulfate and 0.1
mg/ml of denatured DNA (salmon sperm DNA). The hybridized
nitrocellulose filter was washed for 20 minutes with 2 x SSC
containing 0.1% SDS at room temperature, then for 30 minutes
with 0.1 x SSC containing 0.1% SDS at 44oC, and finally for
10 minutes with O.lx SSC at room temperature. Detection by
auto.radiography was then conducted.
Screening with the probe (LC) was carried out by the
following procedures. The other filter was preliminarily
treated with 3 x SSC containing 0.1% SDS at 65°C for 2 hours.
Then, prehybridization was conducted at 65°C for 2 hours in
a solution containing 6 x NET, 1 x Denhardt's solution, and
100 ug/ml of denatured DNA (salmon sperm DNA). Hybridiza-
tion was subsequently conducted overnight at 63°C in a
hybridization buffer containing the radiolabelled probe (LC)
(2 x 106 cpm/ml). This hybridization buffer was also a
mixture of 6 x NET, 1 x Denhardt's solution and 100 ug/ml of
denatured DNA (salmon sperm DNA). The hybridized nitro-
cellulose filter was washed three times (20 minutes each)
with 6 x SSC containing 0.1% SDS at room temperature, then
washed with 6 x SSC containing 0.1% SDS at 63°C for 2
minutes.
The filter was dried and detection was conducted by
autoradiography.
In the screening described above, clones which were
positive to both probes we-re selected and the clone con-
tained a "full-length" cDNA was checked for its nucleotide
sequence by the dideoxy method. It was found to have the
nucleotide sequence shown in Fig. 4(A). This cDNA was cut
out of the ~gtl0 vector and joined to pBR327 at the EcoRI
site to prepare a plasmid pBRV2.
Example 11: Screening of Human Chromosomal Gene Library
1 34~ 389
_45-
1) Construction of human chromosomal gene library
The human chromosomal gene library which was provided
by courtesy of Dr. Maniatis of Harvard University had been
prepared by the following procedures: the whole chromosomal
DNA was extracted from the human fetal liver with phenol or
other appropriate chemicals and partially digested with
restriction enzymes, HaeITI and Alul; the resulting DNA
fragments were treated by sucrose density gradient centrif-
ugation to concentrate the fragments having chain lengths of
about 18 - 25 kb; the concentrated fragments were joined to
the arm DNA of E. coli phage ~ Charon 4A, with short-chained
synthetic nucleotides having the cleavage sites of the
restriction enzyme EcoRI being inserted, so as to prepare
infectious phage DNA recombinants; with a view to providing
enhanced infectiousness, more refined phage a particles were
created by packaging. The so prepared human gene library is
theoretically considered to be a set of recombinants con-
taining human DNAs with chain lengths of 18 - 25 kb which
contained practically all human genes.
2) Screening of human chromosomal gene library with the
pH CS-1 derived DNA pX'obe
Plaque hybridization was conducted in accordance with
the method of Benton and Davis [Science, 196, 180 (1977)].
The pHCS-1 obtained in Example 8 was treated with Sau3A and
EcoRI to obtain a DNA fragment of ca. 600 bp. This DNA
fragment was radiolabelled by nick translation in accordance
with routine procedures. A'nitrocellulose filter (S & S)
was placed on the phage plaque-growing agar medium to trans-
fer the phages onto the filter. After denaturing the phage
DNA with 0.5 M NaOH, the filter paper was treated by the
following procedures: treatment with 0.1 M NaOH and 1.5 M
NaCl for 20 seconds; two treatments with 0.5 M Tris-HC1 (pH
7.5) and 1.5 M Nac:l for 20 seconds; finally, treatment with
120 mM NaCl, 15 mM sodium citrate, 13 mM KH2P04 and 1 mM
EDTA (pH 7.2) for 20 seconds.
The filter was subsequently dried and heated at 80°C
for 2 hours to immobilize the DNA. Prehybridization was
conducted overnight at 42°C in a prehybridization buffer
1 341 389
-46-
containing 5 x SSG, 5 x Denhardt's solution, 50 mM phosphate
buffer, 50% formamide, 0.25 mg/ml of denatured DNA (salmon
sperm DNA) and 0.1% SDS. Thereafter, hybridization was
conducted at 42°C for 20 hours in a hybridization buffer
containing 4 x 105 cpm/ml of pHCS-1 probe that had been
radiolabelled by nick translation. This hybridization
buffer was a mixture of 5 x SSC, 5 x Denhardt's solution, 20
mM phosphate buffer (pH 6.0), 50% formamide, 0.1% SDS, 10%
dextran sulfate and 0.1 mg/ml of denatured DNA (salmon sperm
DNA).
The hybridized nitrocellulose filter was washed for
minutes with 2 x SSC containing 0.1~ SDS at room tempera-
ture, then for 30 minutes with 0.1 x SSC containing 0.1% SDS
at 44°C, and finally for 10 minutes with 0.1 x SSC at room
15 temperature. Detection by autoradiography was then
conducted.
As a result, ten-odd positive clones were obtained.
Recombinant DNAs were prepared from these clones by the
method of Maniatis [Cell, 15, 687 (1978)]. The obtained
20 DNAs were treated with restriction enzymes such as EcoRI,
BamHI and BglI2, analyzed by agarose gel electrophoresis,
and their restriction enzyme map was prepared in accordance
with the method of Fritsch et al. (see cell, ibid.)
Southern hybridization was conducted with the probe
being the radiolabelled pHCS-1 derived DNA fragment that was
the same as what was used in the above-described screening
procedures. A DNA fragment of ca. 8 kbp that was cut with
EcoRI was selected from the clones that hybridized with the
probe. This fragment was subcloned to the EcoRI site of
pBR327. The subcloned DNA was subjected to another treat-
ment with restriction enzymes and Southern hybridization was
conducted repeatedly. A DNA fragment of ca. 4 kbp that was
cut out with EcoRI and XhoI was found to contain a gene
coding for the human G-CSF polypeptide. This DNA fragment
was checked for the sequence of its ca. 3-kbp portion by the
dideoxy method and the nucleotide sequence shown in Fig. 5
was identified» This DNA fragment had the restriction
enzyme cleavage sites shown in Fig. 7.
1 3 41 X89
-47-
Screening of human chromosomal genes was also
conducted using pBRG4-derived DNA and pBRV2-derived DNA as
probes. In either case, a DNA fragment of 1500 by that had
been treated with EcoRI was directly radiolabelled by nick
translation in the manner described above or, alternatively,
a DNA fragment of ca. 700 by that was obtained by successive
treatments with EcoRI and Drar was radiolabell.ed by nick
translation. The so prepared probe was used in plaque
hybridization that was conducted under the same conditions
as described above. Selected clones were analyzed by
Southern hybridization so as to obtain a DNA fragment having
the nucleotide sequence shown in Fig. 5. The plasmid thus
obtained was named pBRCE3,,~:.
Example 12: Construction of E. coli Recombinant Vector
(+VSE) and Transformation (Using tac Promoter-
Containing Vector)
1) Construction of recombinant vector
(i) Vector preparation
Five micrograms of a tac promoter-containing vector
pKK223-3 (Pharmacia) was treated with 8 units of EcoRI
(Takara Shuzo Co., Ltd.) for 2 hours at 37°C in 30 u1 of
a reaction solution (40 mM Tris-HC1, 7 mM MgCl2, 100 mM
NaCl, and 7 mM 2-mercaptoethanol).
Subsequently, 3 u1 of an alkali phosphatase (Takara
Shuzo Co., Ltd.) was added and treatment was conducted
at 60°C for 30 minutes. A DNA fragment was recovered by
three treatments with phenol, one treatment with ether
and precipitation with ethanol, all being conducted in
accordance with routine procedures.
The recovered DNA fragment was dissolved in a 50-ul
mixture composed of 50 mM Tris-HC1, 5 mM MgCl2, 10 mM
DTT, and 1 mM each of dATP, dCTP, dGTP and dTTP. After
addition of 3 u1 of an E. co i DNA polymerase I - Klenow
fragment (Takara Shuzo Co., Ltd.), reaction was carried
out at 14°C for 2 hours to create blunt ends.
(ii) Preparation of synthetic linker
Three micrograms of oligonucleotides having the
sequences of synthetic linkers, CGAATGACCCCCCTGGGCC and
1 3 41 389
-48-
CAGGGGGGTCATTCG, was phosphorylated by performing reac-
tion in 40 u1 of a reaction solution (composed of 50 mM
Tris-HC1, 10 mM MgCl2, 10 mM 2-mercaptoethanol and 1 mM
ATP) at 37°C for 60 minutes in the presence of 4 units
of T4 polynucleotide kinase.
Each of the phosphorylated oligonucleotides (0.2 up)
was dissolved in 20 u1 of a 100 mM NaCl-containing TE
solution [10 mM Tris-HC1 (pH 8.0) and 1 mM EDTA]. After
treatment at 65°C for 10 minutes, the oligonucleotides
were annealed by slow cooling to room temperature.
(iii) Preparation of G-CSF cDNA fragment
Sixty micrograms of the pBRG4 prepared in Example 9
which contained the cDNA shown in Fig. 3(A) was treated
with 100 units of a restriction enzyme ApaI (New England
Biolabs) and 50 units of DraI (Takara Shuzo Co., Ltd.)
at 37°C for 3 hours in 200 1~1 of a reaction solution
composed of 6 mM Tris-HC1, 6 mM MgCl2, and 6 mM 2-
mercaptoethanol. About 2 up of an ApaI - DraI fragment
(ca. 590 bp) was recovered by 1.2~ agarose gel
electrophoresis.
(iv) Ligation of fragments
About 0.1 up each of the fragments prepared in (i)
to (iii) was dissolved in 20 u1 of a ligation solution
(66 mM Tris-HC1, 6.6 mM MgCl2, 10 mM DTT, and 1 mM ATP).
After addition of 175 units of T4 DNA lipase, the solu-
tion was held overnight at 4oC to obtain a recombinant
vector (Fig. 8).
2) Transformation
Using 20 u1 of a reaction solution containing the
recombinant vector prepared in (iv), E, coli strain JM105
was transformed by the rubidium chloride procedure [see
T. Maniatis et al., Molecular Cloning, p. 252 (1982)]. The
plasmid was separated from an ampicillin-resistant colony
culture of the transformants and treated with restriction
enzymes, BamHI, AccII and ApaI to confirm that the transfor-
mants were the intended ones.
1 34~ 389
-4 g--
Example 13: Constructian of E. co i Recombinant Vector
(+VSE) and Transformation (Using PL Promoter-
Containing Vector)
1) Construction of recombinant vector
(i) Vector preparation
A hundred micrograms of a PL promoter-containing
vector pPL-lambda (Pharmacia) was treated overnight at
37°C with 50 units of a restriction enzyme BamHI in 100
u1 of a reaction solution [10 mM Tris-HCl (pH 7.6), 7 mM
MgCl2, 100 mM NaCl, and 10 mM DTTj.
By subjecting the reaction solution to 1~ agarose
gel electrophoresis, about 49 ug of an approximately 4-
kb fragment and about 11 ug of an approximately 1.2-kb
fragment were recovered.
The 4-kb fragment was dissolved in 100 u1 of a TE
buffer (for its composition, see above) and dephosphory-
lated by reaction with an alkali phosphatase (Takara
Shuzo Co., Ltd.) at 60°C for 60 minutes.
The other fragment of about 1.2 kb in length was
dissolved in 20 u1 of a buffer (10 mM Tris-HC1, 10 mM
MgCl2, 6 mM KC1, and 1 mM DTT) and treated overnight
with 20 units of a restriction enzyme MboII (New England
Biolabs) at 37°C.
By 4$ polyacrylamide gel electrophoresis, about 0.9
u9 of a BamHI-MboII fragment (ca. 200 bp) and about 1.9
ug of an MboII-BamHI fragment (ca. 310 bp) were
recovered.
(ii) Preparation of synthetic linker
Oligonucleotides having the sequences of synthetic
linkers, TAAGGAGAATTCATCGAT and TCGATGAATTCTCCTTAG, were
phosphorylated and annealed as in (ii) in Example 12, so
as to prepare a synthetic S/D linker.
(iii) Preparation of expression vector
One tenth of a microgram of the ca. 4-kb fragment,
0.05 ug each of the BamHI-MboII fragment having the OLPL
region and the MboII-BamHI fragment having the tLl
region [the three fragments being prepared in (i)j, and
0.1 u9 of the annealed synthetic S/D linker prepared in
~ 341 X89
-50-
(ii) were subjected to reaction overnight at 12°C in 40
u1 of a reaction solution (66 mM Tris-HC1, 6.6 mM MgCl2,
mM DTT, and 1 mM ATP) in the presence of 175 units of
T4 DNA ligase (Takara Shuzo Co., Ltd.) Twenty micro-
s liters of the reaction solution was used to transform E.
coli strain N99CI+ (Pharmacia) by the calcium chloride
procedure (see Molecular Cloning, ibid.)
The transformants were cultured and the plasmid was
recovered from the culture of their ampicillin-resistant
10 colonies. Treatment of the plasmid with restriction
enzymes, EcoRI, BamHI and Smal, showed that it was the
intended plasmid.
Two micrograms of-this plasmid was reacted with a
restriction enzyme ClaI (New England Biolabs) at 37°C
for 2 hours in 20 u1 of a buffer (10 mM Tris-HC1, 6 mM
MgCl2 and 50 mM NaCl). Thereafter, the enzyme was
inactivated by heating at 65°C for 10 minutes.
One microliter of the reaction solution was reacted
overnight at 12°C with 175 units of T4 DNA ligase
(Takara Shuzo Co., Ltd.) in a ligation solution having
the composition descfibed above. The reaction solution
was then used to transform E~, coli strain N99cI+
(Pharmacia). The plasmid was recovered from the culture
of ampicillin-resistant colonies of the transformants
and treated with EcoRI and BamHI to confirm that said
plasmid was the intended one.
(iv) Preparation of G-CSF expressing recombinant vector
and transf ormants
The expression plasmid prepared in (iii) was
treated with a restrict ion enzyme ClaI. After creating
blunt ends,_the plasmid was then worked up as in Example
12 to prepare a recombinant vector inserted a cDNA
fragment of G-CSF. This vector was used to transform E.
coli strain N4830 (Pharmacies Fine Chemicals) by the
calcium chloride procedure described in Molecular
Cloning (ibid. ) Identification of the desired transfor-
mants was achieved as in Example 12 (Fig. 9).
'~ 3 41 3~9
-51-
Example 14: Construction of ~. coli~~ecombinant Vector
(+VSE) and Transformation (Using trp Promoter-
Containing Vector)
1) Construction of recombinant vector
(i) Vector preparation
A plasmid, p0Yl, was prepared by inserting a
tryptophan promoter containing HpaII-TaqI fragment (ca.
330 bp) into pBR322 at the CIaI site. Ten micrograms of
this plasmid was treated with 7 units of a restriction
enzyme ClaI and 8 units of PvuII at 37°C for 3 hours in
30 u1 of a reaction solution composed of 10 mM Tris-HC1,
6 mM MgCl2 and 50 mM NaCl.
Subsequently, 2 ~,l of an alkali phosphatase (Takara
Shuzo Co., Ltd.) was added and reaction was carried out
at 60°C for 1 hour.
A DNA fragment (ca. 2.5 ug) of about 2.6 kb in
length was recovered from the reaction solution by 1%
agarose gel electrophoresis.
(ii) Preparation of Synthetic linker
Oligonucleotides having the sequences of synthetic
linkers, CGCGAATGACCCCCCTGGGCC and CAGGGGGGTCATTCG, were
phosphorylated and annealed as in (ii) in Example 12, so
as to prepare a synthetic linker.
(iii) Preparation of recombinant vector
About 1 ug of the vector fragment prepared in (i),
about 1 ug of the synthetic linker prepared in (ii) and
about 1 ug of the G-CSF cDNA fragment prepared in (iii)
in Example 12 were reacted with 175 units of T4 DNA
ligase overnight at 12°C in 20 u1 of a ligation solution
having the formulation described in Example 12, 1)(iv),
so as to obtain a recombinant vector (Fig. 10).
2) Transformation
Twenty microliters of the reaction solution prepared
in (iii) was used to transform ,E~ co i DHl by the rubidium
chloride procedure described in Molecular Cloning, ibid.
As in Example 12, the plasmid was recovered from
amplicillin-resistant colonies of the transformants, and
treatment of this plasmid with restriction enzymes, Apal,
1 34~ 389
-52-
DraI, NruI and Pstl, showed that the desired transformants
had been obtained.
Example 15: Cultivation of Transformants
1) Cultivation of the transformants (with tac) obtained
in Example 12
The transformants were cultured overnight at 37°C,
and 1 ml of the culture was added to 100 ml of a Luria
medium containing 25 ug/ml ar 50 ug/ml of amplicillin.
Cultivation was conducted for 2 - 3 hours at 37°C.
The cultivation was continued at 37°C for 2 - 4 hours
after addition of isopropyl--8-D-thiogalactoside to make
final concentration to 2 mM.
2) Cultivation of the transformants (with PL) obtained
. in Example 13
The transformants were cultured overnight at 28oC,
and 1 ml of the culture was added to 100 ml of a Luria
medium containing 25 or 50 ~g/ml of ampicillin. Cultivation
was conducted for about 4 hours at 28°C.
The cultivation was continued for 2 - 4 hours at 42°C.
3) Cultivation of the transfarmants (with trp) obtained
in Example 14
The transformants were cultured overnight at 37°C,
and 1 ml of the culture was added to 100 ml of M9 medium
containing 0.5$ glucose, 0.5$ Casamino acids (Difco) and 25
or 50 ug/ml of ampicillin. Cultivation was conducted for
4 - 6 hours at 37°C. After addition of 50 ug/ml of 3-S-
indolacrylic acid (IAA), the cultivation was continued for
4 - 8 hours at 37°C.
Example 16: Recovery and Purification of G-CSF Polypeptide
from E: coli
1) Recovery
The three species of transformants cultured in
Example 15 were subjected to the fallowing recovery
procedures.
The culture (100 ml) was centrifuged to obtain a cell
pellet, which was suspended in 5 ml of a mixture of 20 mM
Tris-HC1 (pH 7.5) and 30 mM NaCI.
r
-53-
Then, 0.2 M phenylmethylsulfonyl fluoride, 0.2 M EDTA
and a lysozyme were added in respective concentrations of 1
mM, 10 mM and 0.2 mg/ml, and the suspension was left for 30
minutes at 0°C.
The cells were lyzed by three cycles of freezing/
thawing, followed by optianal sonication. The lysate was
centrifuged to obtain the supernatant. Alternatively, the
lysate was treated with 8 M guanidine hydrochloride such
that its final concentration was 6 M guanidine hydro-
chloride, followed by centrifugation at 30,000 rpm for 5
hours, and recovery of the supernatant.
2) Purification
(i) The supernatant obtained in 1) was subjected to gel
filtration on an Ultrogel AcA54 column (4.6 cm~ x 90
cmL; LKB) at a flow rate of ca. 50 ml/hr with 0.01 M
Tris-HC1 buffer (pH 7.4) containing 0.15 M NaCl and
0.01% Tween 20 (Nakai Ragaku Co., Ltd.)
The fractions which showed activity upon analysis by
the method of CSA assay (b) (described earlier in this
specification) were selected and concentrated to a
volume of ca. 5 ml with an ultrafiltration apparatus,
pM-10 (Amicon) .
(ii) To the concentrated fractions were added n-propanol
(of the grade suitable for amino acid sequencing; Tokyo
Kasei Co., Ltd.) and trifluoroacetic acid, and the mix
ture was worked up such that the final concentrations of
n-propanol and trifluoroacetic acid were 30% and 0.1%,
respectively. The worked up mixture was left in ice for
about 15 minutes and centrifuged at 15,000 rpm for 10
minutes to remove the precipitate. The supernatant was
adsorbed on a u-Bondapak C18 column (of semipreparatory
grade: Waters; 8 mm x 30 cm) that had been equilibrated
with an aqueous solution containing n-proganol (see
above) and trifluoroacetic acid. The column was contin-
uously eluted with an aqueous solution of 0.1% tri-
fluoroacetic acid containing n-propanol with a linear
density gradient of 30 - 60%. ~fith Hitachi Model 685-50
(high-pressure liquid chromatographic apparatus of
1 3 41 389
-54-
Hitachi, Ltd.) and Hitachi Model 638-41 (detector of
Hitachi, Ltd.) being used, the adsorptions at 220 nm and
280 nm were measured simultaneously. After eluting, a
10-ul aliquot of each fraction was diluted 100-fold and
the dilutions were screened for active fractions by the
method of CSA assay (b). Activity was observed in the
peaks that were eluted at 40% n-propanol. These peaks
were combined and re-chromatographed under the same
conditions as used above and the fractions were checked
for their activity by the method (b). Again, activity
was found in the peaks for 40% n-propanol. These active
peaks were collected (four fractions = 4 ml) and freeze-
dried.
(iii) The freeze-dried powder was dissolved in 200 u1 of
an aqueous solution of 0.1% trifluoroacetic acid con-
taining 40% n-propanol, and the solution was subjected
to high-pressure liquid chromatography on TSK-G3000SW
column (7.5 mm x 60 cm: Toyo Soda Manufacturing Co.,
Ltd.) Elution was conducted at a flow rate of 0.4
2p ml/min with an aqueous solution of 0.1$ trifluoroacetic
acid containing 40%-propanol, and 0.4-ml fractions were
taken with a fraction collector, FRAC-100 (Pharmacia
Fine Chemicals). The fractions were checked for their
CSA as described above and the active fractions were
recovered. They were further purified on analytical u-
Bondapak C18 column (4.6 mm x 30 cm), and the main peak
was recovered and freeze-dried.
The protein so obtained was treated with 2-
mercaptoethanol and subjected to Sps-polyacrylamide gel
(15.0%) electrophoresis (15 mV, 6 hours). Upon staining
with Coomassie Blue, the desired G-CSF polypeptide could
be identified as a single band.
Example 17: Assay of G-CSF Activity (+VSE)
The CSF sample obtained in Example 16 was assayed in
accordance with the method of CSF assay (a) described
earlier in this specification. The results are shown in
Table 1.
-55- ~ ~ 4 ~ 3 B 9
Table 1
Human neutrophilic colonies
(colonies/dish)
Purified human G-CSF (20 ng) 73
CSF sample obtained in 68
Example 15 (50 ng)
Blank 0
Example 18: Amino Acid Analysis (+VSE)
1) Analysis of amino acid composition
The CSF sample purified in Example 16 was hydrolyzed
by routine procedures, and the amino acid composition of the
protein portion of the hydrolyzate was analyzed by a method
of amino acid analysis with an automatic amino acid analyzer,
Hitachi 835 (Hitachi Ltd.) The results are shown in Table 2.
Hydrolysis was conducted under the following conditions:
(l) 6 N HCI, 1.10°C, 24 hours, in vacuum
(ii) 4 N methanesulfonic acid + 0.2% 3-(2-
aminoethyl)indole, 110oC, 24 hours, 48 hours,
72 hours, in vacuum
The sample was dissolved in a solution (1.5 ml)
containing 40% n-propanol and 0.1% trifluoroacetic acid.
Aliquots each weighing 0.1 ml were dried with a dry nitrogen
gas and, after addition of the reagents listed in (l) or
(ii), the containers were sealed in vacuum, followed by
hydrolysis of the contents.
Each of the values shown in Table 2 was the average
of f our measurements, 24 hour value for (l) and 24, 48 and
72 hour values for (ii), except that the contents of Thr,
Ser, 1/2 Cys, Met, Val, Ile arid Trp were calculated by the
following methods (see "Tampaku Kagaku (Protein Chemistry)
II", A Course in Biochemical Experiments, Tokyo Kagaku
Dohjin):
-- For Thr, Ser, 1/2 Cys and Met, the time-dependent
profile of the 24, 48 and 72 hour values for (ii) was
extrapolated by zero hours.
-- For Val and Ile, the 72 hour value for (ii) was used.
1 3 41 389
-56-
-- For Trp, the average of 24, 48 and 72 hour values for
(ii) was used.
Tab a 2
(Amino Acid Analysis Data)
Amino acids Mole%
Asp (Asp + Asn) 2.3
Thr 4.0
Ser 8.5
Glu (Glu + Gln) 15.2
Pro 7.3
Gly 7.9
Ala ~ 10.7
~
1/2 Cys 2.8
Val 4.5
Met 2.0
Tle 2.3
Leu 18.3
Tyr 1.7
Phe 3.4
Lys 2.3
His 2.8
Trp 1.1
Arg 2.9
2) Analysis of N-terminal amino acids
The sample was subjected to Edman decomposition with
a gas=phase sequences (Applied Biosystems) and the PTH amino
acid obtained was analysed by routine procedures with a high-
pressure liquid chromatographic apparatus (Beckman Instru-
ments) and Ultrasphere-ODS column (Beckman Instruments).
1 3 ~+1 X89
-57-
After the column (5 ~..~m; 4.6 mm~ x 250 mm) was equilibrated
with a starting buffer [an aqueous solution containing 15 mM
sodium acetate buffer (pH 4.5) and 40% acetonitrile], the
sample (as dissolved in 20 u1 of the starting buffer) was
injected and separation was achieved by isocratic elution
with the starting buffer. During these operations, the flow
rate was held at 1.4 ml/min and the column temperature at
40°C. Detection of the PTH amino acid was accomplished
using the absorptions in the ultraviolet range at 269 nm and
320 nm. Standard samples (each weighing 2 nmol) of PTH
amino acid (Sigma) had been separated on the same line to
determine their retention times, which were compared with
those of the sample for the purpose of identification of the
N-terminal amino acids. As a result, PTH-methionine and
PTH-threonine were detected.
Example 19: Construction of E. coli Recombinant Vector
(-VSE) and Transformation
1) Using tac promoter-containing vector
The procedures of Example 12 were regeated except
that the "pBRG4 prepared ~n Example 9 which contained the
cDNA shown in Fig. 3(A)"~Isee (iii) in Example 12] was
replaced by the "pBRV2 prepared in Example 10 which
contained the cDNA shown in Fig. 4(A)". As in Example 12,
the transformants obtained were verified as the desired ones
(Fig. 11).
2) Using PL promoter-containing vector
The procedures of Example 13 were repeated using cDNA
(-VSE) and the transformants obtained were verified as the
desired ones (Fig. 12).
3) Using trp promoter-containing vector
The procedures of Example 14 were repeated using cDNA
(-VSE) and the transformants were verified as the desired
ones (Fig. 13).
Example 20: Assay of G-CSF Activity (-VSE)
The three species of transformants obtained in
Example 19 were cultured by the method described in Example
15. From the cultured E. coli cells, G-CSF polypeptides
were recovered and purified by the method described in
1 3 41 389
_$$_
Example 16, with the result that human G-CSF polypeptide was
obtained as a single band.
The so obtained CSF sample was assayed by the method
of CSF activity assay (a) described earlier in this specifi-
cation. The results are shown in Table 3.
Table 3
Human neutrophilic colonies
(colonies/dish)
Purified human G-CSF (20 ng) 73
CSF sample obtained in 73
Example 19 (50 ng)
Blank 0
Example 21: Amino Acid Analysis (-VSE)
1) Analysis of amino acid composition
The amino acid composition of the CSF sample purified
in Example 20 was analyzed by the method described in 1) in
Example 18. The results are shown in Table 4.
1 ~ 41 389
-59-
2) Analysis of N-terminal amino acids
The sample was subjected to analysis of the N-
terminal amino acids in accordance with the method described
in 2) in Example 18. As a result, PTH-methionine and PTH-
threonine were detected.
Example 22: Preparation of pHGA410 Vector (for Use with
Animal Cells, +VSE Line)
The EcoRI fragment prepared in Example .9 which had
the cDNA shown in Fig. ~(A) was treated with a restriction
Tab a 4
(Amino Acid Analysis Data)
1 ~ 41 389
-60-
enzyme, DraI, at 37°C for 2 hours, followed by treatment
with the Rlenow fragment of DNA polymerase I (Takara Shuzo
Co., Ltd.) to create blunt ends. One microgram of BglII
linker (8mer, Takara Shuzo Co., Ltd.) was phosphorylated
with ATP and joined to about 1 ug of the separately obtained
mixture of DNA fragments. The joined fragments were treated
with a restriction enzyme, BgIII, and subjected to agarose
gel electrophoresis. Subsequently, only the largest DNA
fragment was recovered.
This DNA fragment was equivalent to about 710 base
pairs containing a human G-CSF polypeptide coding portion
(see Fig. 6). A vector pdKCR [Fukunaga et al., Proc. Natl.
Acad. Sci., USA, 81, 5086 (1904)) was treated with a
restriction enzyme, BamHI, and subsequently dephosphorylated
with an alkali phosphatase (Takara Shuzo Co., Ltd.) The
vector DNA obtained was joined to the 710-by cDNA fragment
in the presence of T4 DNA ligase (Takara Shuzo Co., Ltd.),
so as to produce pHGA410 (Fig. 14). As shown in Fig. 14,
this plasmid contained the promoter of SV4U early gene, the
replication replication origin of SV40, part of the rabbit
S-globin gene, the replication initiating region of pBR322
and the pBR322-derived g-lactamase gene (Ampr), with the
human G-CSF gene being connected downstream of the promoter
of the SV40 early gene.
Example 23: Construction of Recombinant Vector (+VSE) for
Use in Transformation of C127 Cells
1) Construction of pHGA410 (H)
Twenty micrograms of the plasmid pHGA410 (Fig. 14)
prepared in Example 22 was dissolved in a reaction solution
composed of 50 mM Tris-HC1 (pH 7.5), 7 mM MgCl2, 100 mM
NaCl, 7 mM 2-mercaptoethanol and 0.01 bovine serum alubmin
(BSA). A restriction enzyme, EcoRI (10 - 15 units; Takara
Shuzo Co., Ltd.) was added and the reaction solution was
held at 37°C for about 30 minutes to cause partial digestion
with EcoRI. Subsequently, the DNA fragment was subjected to
two treatments with a 1:1 mixture of phenol/chlorof orm, one
treatment with ether, and precipitation with ethanol.
1 3 41 389
-61-
The DNA fragment obtained was dissolved in 50 u1 of a
solution composed of 50 mM Tris-HC1, 5 mM MgCl2, 10 mM DTT,
and 1 mM each of dATP, dCTP, dGTP and dTTP. After 5 u1 of
the Rlenow fragment of ,~ co i DNA polymerase (Takara Shuzo
Co., Ltd.) was added, the solution was incubated at 14°C for
2 hours to produce blunt ends.
By subsequent 0.8% agarose gel electrophoresis, 6 up
of a DNA fragment of about 5.8 kbp in length was recovered.
Five micrograms of the recovered DNA fragment was re
dissolved in 50 u1 of a reaction solution composed of 50 mM
Tris-HC1 (pH 7.6), 10 mM MgCl2, 10 mM DTT and 1 mM ATP.
After 2 up of HindIIi linker (Takara Shuzo Co., Ltd.) and
100~units of T4 DNA lipase (Takara Shuzo Co., Ltd.) were
added, reaction was carried out overnight at 4°C.
Subsequently, treatments with phenol and ether and
precipitation with ethanol were conducted. The precipitate
was dissolved in 30 ~l of a solution composed of 10 mM Tris-
HC1 (pH 7.5), 7 mM MgCl2 and 60 mM NaCl, and the solution
was incubated at 37°C for 3 hours in the presence of 10
units of HindIII. After re-treatment with T~ DNA lipase,
the resulting DNA was used to transform Es c~li strain DH1
by the rubidium chloride procedure (see Molecular Cloning,
ibid.) From ampicillin-resistant (Ampr) colonies of the
transformants, cells were selected which harbored a plasmid
which was identical to pHGA410 except that HindIII was
inserted at the EcoRi site. The so obtained plasmid was
named pHGA410 (H) (Fig. 15).
2) Construction of expression recombinant vector pTN-G4
Twenty micrograms of the pHGA~lO (H) thus obtained
was dissolved in 50 u1 of a reaction solution composed of 10
mM Tris-HCl (pH 7.5), 7 mM MgCl2, 175 mM NaCl, 0.2 mM EDTA,
7 mM 2-mercaptoethanol and 0.01% bovine serum albumin.
After 20 units of Sall (Takara Shuzo Co., Ltd.) were added,
the reaction solution was incubated at 37°C for 5 hours.
Following treatment with phenol and precipitation with
ethanol, incubation was conducted as in 1) for about 2 hours
at 14°C in the presence of the Rlenow fragment of DNA
polymerase (Takara Shuzo Co., Ltd.), so as to create blunt
1 3 41 389
-62-
ends. Without being subjected to DNA recovery by agarose
gel electrophoresis, the reaction solution was immediately
subjected to precipitation with ethanol. The resulting DNA
fragment was treated with HindIII and 5 g of a HindIII-SalI
fragment (ca. 2.7 kbp) was recovered by 1~ agarose gel
electrophoresis. In a separate step, a plasmid pdBPV-1
having a bovine papilloma virus (BPV) [this pl.asmid was
obtained by courtesy of Dr. Howley and is described in
Sarver, N, Sbyrne, J.C. & Howley, P.M., Proc. Natl. Acad.
Sci., USA, 79, 7147-7151 (1982)] was treated with HindIII
and PvuII, as described by Nagata et al. [Fukunaga, Sokawa
and Nagata, Proc. Natl. Acad. Sci., USA, 81, 5086-5090
(1984)], to obtain an 8.4-kb DNA fragment. This 8.4-kb DNA
fragment and the separately obtained HindIII-SalI DNA
fragment (ca. 2.7 kb) were ligated by T4 DNA ligase. The
ligation product was used to transform E. coli strain DH1 by
the rubidium chloride procedure described in Molecular
Cloning, ibid. E. coli colonies harboring a plasmid having
the pHGA410-derived G-CSF'~cDNA were selected. This plasmid
was named pTN-G4 (Fig. 15).
~sc~enovirus type II [Tanpakushitsu, Rakusan, Koso
(Proteins, Nucleic Acids, and Enzymes), 27, December, 1982,
Ryoritsu Shuppan] was similarly treated to obtain a plasmid
~ pVA, that contained a ca. 1700-by Sall-HindIII fragment
harboring VAI and VAII, and.a fragment containing VAI and
VAII was recovered from this plasmid. This fragment was
inserted into pTNG4 at the HindIII site so as to obtain
pTNG4VAa and pTNG4VA~ (Fig. 15). Because of the VA gene of
adenovirus, these plasmids were capable of enhanced expres-
sion of a transcription product from the early promoter of
SV40.
Example 24: Transformation of C127 Cells and G-CSF
Expression Therein (+VSE)
Before it was used to transform mouse 0127 cells, the
pTN-G4 obtained in Example 23 was treated with a restriction
enzyme, BamHI. Twenty micrograms of the plasmid pTN-G4 was
dissolved in 100.u1 of a reaction solution [10 mM Tris-HC1
(pH 8.0), 7 mM MgCl2, 100 mM NaCI, 2 mM 2-mercaptoethanol
~ ~~~ 389
-63_
and 0.01$ BSA] and treated with 20 units of BamHI (Takara
Shuzo Co., Ltd.), followed by treatments with phenol and
ether, and precipitation with ethanol.
Mouse C127I cells were grown in a Dulbecco's minimal
essential medium containing 10% bovine fetal serum (Gibco).
The C127I cells growing on plates (5 cm~) were transformed
with 10 up, per plate, of the separately prepared DNA by the
calcium phosphate procedure [see Haynes, J. & Weissmann, C.,
Nucleic Acids Res., 11, 687-706 (1983)]. After treatment
with glycerol, the cells were incubated at 37oC for 12
hours.
The incubated cells were transferred onto three fresh
plates (5 cm~) and the media were changed twice a week. At
day 16, the foci were transferred onto fresh plates and
subjected to serial cultivation on a Dulbecco's minimal
essential medium containing 10% bovine fetal serum (Gibco),
so as to select clones having high G-CSF production rate.
These clones produced G-CSF at a level of approximately 1
mg/L. Further cloning gave rise to clanes that were capable
of producing G-CSF at levels of 10 mg/L or higher. In
addition to the C127I cells, NIEi3T3 cells could also be used
as host cells.
Example 25: Expression of G-CSF in CHO Cells (+VSE)
1) Construction of pHGG4-dhfr
Twenty micirograms of the plasmid pHGA410 obtained in
Example 22 was dissolved in 100 u1 of a reaction solution
containing 10 mM Tris-HC1 (pH 7.5), 7 mM MgCl2, 175 mM NaCl,
0.2 mM EDTA, 0.7 mM 2-mercaptoethanol and 0.01% BSA. Reac-
tion was carried out overnight at 37oC in the presence of 20
units of a restriction enzyme SalI (Takara Shuzo Co., Ltd.),
followed by treatments with phenol and ether and precipita-
tion with ethanol.
The precipitate of DNA was dissolved in 100 u1 of a
reaction solution composed of 50 mM Tris-HC1, 5 mM MgCl2, 10
mM DTT, and 1 mM each of dATP, dCTP, dGTP and dTTP, and
reaction was carried out at 14°C for 2 hours in the presence
of the Klenow fragment of -E. coli DNA polymerase (10 u1;
1 3 41 389
-64-
Takara Shuzo Co., Ltd.), followed by treatments with phenol
and ether, and precipitation with ethanol.
An EcoRI linker was attached to the DNA in the pre-
cipitate by the following procedures: the DNA was dissolved
in 50 u1 of a reaction solution composed of 50 mM Tris-HC1
(pH 7.4), 10 mM DTT, 0.5 mM spermidine, 2 mM ATP, 2 mM
hexamine-cobalt chloride and 20 ug/ml of BSA. Reaction was
carried out at 4°C for 12 - 16 hours in the presence of
EcoRI linker (Takara Shuzo Co., Ltd.) and 200 units of T4
DNA ligase (Takara Shuzo Co., Ltd.) After treatment with
phenol, washing with ether and precipitation with ethanol,
all being conducted in accordance with routine procedures,
the DNA precipitate was partially digested with EcoRI and
3 ~g of a DNA fragment of about 2.7 kbp in length was
recovered by 1~ agarose gel electroghoresis.
The plasmid pAdD26S'VpA [Kaufman, R.G. & Sharp, P.A.,
Mol. Cell Biol., _2, 1304-1319 (1982)] was treated with EcoRI
and dephosphorylated by treatment with a bacterial alkaline
phosphatase (BAP). More specifically, 20 ug of pAdD26SVpA
and 20 units of EcoRI were added to a reaction solution [50
mM Tris-HC1 (pH 7.5), 7 mM MgGl2, 100 mM NaCl, 7 mM 2-
mercaptoethanol and 0.01$ BSA] and reaction was carried out
at 37°C for 10 hours. Subsequently, 5 units of BAP was
added to the reaction solution, and reaction was carried out
at 68oC for 30 minutes. Following treatment with phenol,
the EcoRI fragment of pAaD26SVpA was recovered by electro-
phoresis in a yield of approximately 5 fig.
The fragment of about 2.7 kbp in length and the
pAaD26SVpA, each weighing 0.5 ug, were annealed. The
resulting plasmid was used to transform E. coli strain DH1
by the rubidium chloride procedure, and the colonies harbor-
ing the plasmid of pHGG4-dhfr were selected. The obtained
plasmid was named pHGG4-dhfr (Fig. 16a).
The alternative procedure was as follows: the plas-
mid pHGA410 was treated with SaII and partially digested
with EcoRI without any EcoRI linker being attached. A DNA
fragment of about 2.7 kbp in length was recovered and
treated with the Klenow fragment of k~. coli DNA polymerase
~ 3~1 389
-65-
to create blunt ends. An EcoRI fragment having blunt ends
was prepared from pAaD26SVpA as described above. This EcoRI
fragment and the separately prepared fragment (ca. 2.7 kbp)
were treated with T~ DNA ligase to prepare pHGG4-dhfr.
The pHGA410 (H) prepared in Example 23 was treated
with restriction enzymes, HindIII and Sall, as described in
2) in Example 23, and the HindIII-SalI fragment was joined
to the blunt-ended EcoRI fragment of pAdD26SVpA described
above. This method could also be employed to prepare pHGG4-
dhfr (Fig. 16b) .
2) Construction of pG4DR1 and pG4DR2
Ten micrograms of the plasmid pAaD26SVpA mentioned in
1) was dissolved in 50 ml of a reaction solution containing
50 mM Tris-HC1 (pH 7.5), 7 mM MgCl2, 100 mM NaCl, 7 mM 2-
mercaptoethanol and 0.01% BSA. After addition of 10 units
each of the restriction enzymes, EcoRT and BamHI, reaction
was carried out at 37°C for 10 hours, followed by treatment
with phenol and washing with ether. A DNA fragment of ca. 2
kb was recovered by electrophoresis through a 1% low-melting
point agarose gel. The recovered DNA fragment was treated
with the Klenow fragment of DNA polymerase by routine proce-
dures so as to create blunt ends. The blunt-ended DNA frag-
ment was subjected to treatment with phenol, washing with
ether and precipitation with ethanol.
Ten micrograms of the plasmid pHGA410 (H) obtained in
1) of Example 23 was dissolved in SO u1 of a reaction solu-
tion containing 10 mM Tris-HC1 (pH, 7.5), 7 mM MgCl2 and 60
mM NaCl. Reaction was carried out at 37°C for 6 hours in
the presence of 10 units of HindIII. A DNA fragment was
recovered by electrophoresis through a 1% low-melting point
agarose gel that was conducted by routine procedures. The
recovered DNA fragment was subsequently treated with BAP and
blunt ends were created by treatment with the Rlenow frag-
ment. Following treatment with phenol and washing with
ether, the DNA fragment was joined at blunt ends to the
previously obtained ca. 2-kb DNA fragment with a T4DNA
1 ~ 41 389
-66-
ligase by the following procedures: 1 ug of each DNA frag-
ment was dissolved in 30 ul of a reaction solution contain-
ing 66 mM Tris-HC1 (pH, 7.5), 6.6 mM MgCl2, 5 mM DTT and
1 mM ATP, and reaction was carried out at 6°C for 12 hours
in the presence of 50 units of a T4DNA ligase. The ligation
product was used to transform Es coli strain DHl. As a
result, pG4DR1 and pG4DR2 shown in ~''ig. 16c were obtained.
3) Transformation and expression
CHO cells (dhfr- strain; courtesy of Dr. L. Chasm of
Columbia University) were cultivated for growth in alpha-
minimal essential medium containing 10~ calf serum (a-MEN
supplemented with adenosine, deoxyadenosine and thymidine)
in plates (9 cm~, Nunc). The cultured cells were trans-
formed by the calcium phosphate procedure [Wigler et al.,
Cell, 14, 725 (1978)] in the following manner.
A carrier DNA (calf thymus DNA) was added in an appro-
priate amount to 1 g of the plasmid pHGG4-dhfr prepared in
1), and the mixture was dissolved in 375 ul of a TE solution,
followed by addition of 125 ul of 1 M CaCl2. After the solu-
tion was cooled on ice for 3 - 5 minutes, 500 ul of 2 x HBS
(50 mM Hepes, 280 mM NaCl, and 1.5 mM phosphate buffer) was
added to the solution. After re-coating on ice, the solu-
tion was mixed with 1 ml of the culture of CHO cells,
transferred onto plates, and incubated for 9 hours in a C02
incubator. The medium was removed from the plate and,
following washing with TBS (iris-buffered saline), addition
of 20$ glycerol-containing TBS, and re-washing, a non-
selective medium (the a-MEN medium described above except
that it was supplemented with nucleotides) was added. After
2-day incubation, a 10-fold dilution of the culture was
transferred onto a selective medium (not supplemented with
nucleotides). The cultivation was continued, with the
medium being replaced by a fresh selective medium every 2
days, and the resulting colonies were selected and trans-
ferred onto fresh plates, where the cells grew in the
presence of 0.02 uM methotrexate (MTX), followed by cloning
through growth in the presence of 0.05 uM MTX, which was
later increased to 0.1 uM.
9 341 389
-67-
The transformation of CHO cells may also be accom-
plished by cotransformation with pHGG4 and pAdD26SVpA (see
Scahill et al., Proc. Natl. Acad. Sci., USA, 80, 4654-4658
(1983) ] .
CHO cells were also transformed by the following
procedures: pG4DR1 or pG4DR2 that was prepared in 2) was
preliminarily treated with Sall and KpnI respectively to
obtain DNA fragments and 10 ug of these fragments was used
to transform CHO cells as above; the transformed cells were
subjected to continued cultivation in a series of selective
media in the manner described above; about 7 days later, no
less than 100 distinct colonies appeared per plates these
colonies were transferred en masse to a fresh plate and
subjected to continued cultivation in a series of selective
media in the presence of 0.01 uM M'I'X, whereupon ten-odd
colonies appeared; the same procedures were repeated with
the MTX concentration being serially increased to 0.02 uM,
0.05 uM and 0.1 uM, and the colonies that survived were
selected; colony selection.could be achieved in a similar
manner even when the 10-odd colonies obtained were individ-
ually selected and subj~bted to cultivation at increasing
MTX concentrations.
A recombinant vector that harbors a "polycistronic
gene" may also be used to transform CHO cells. An example
of this alternative method is as follows: pAdD26SVpA was
treated with PstI and the recovered two fragments were
joined to a pBRG4-derived CSF cDNA fragment so as to
construct a recombinant vector wherein the adeno virus
promoter, CSF cDNA, DHFR and the poly(A) site of SV40 were
inserted in the order written. This recombinant vector was
used to transform CHO cells.
Example 26: Assay of G-CSF Activity (+VSE)
The supernatants of cultures of 0127 cells and CHO
cells which were obtained in Examples 24 and 25, respec-
tively, were adjusted to a pH of 4 with 1 N acetic acid.
After addition of an equal volume of n-propanol, the result-
ing precipitate was removed by centrifugation. The super-
natant was passed through an open column (l~ x 2 cmL) filled
~ 34~ 389
-68-
with a C8 reverse-phased carrier (Yamamura Kagaku R.K.) and
elution was conducted with 50% n-propanol, The eluate was
diluted two-fold with water and subjected to reverse-phased
high-pressure liquid chromatography on YMC-C8 column
(Yamamura Kagaku K.K.), followed by elution with n-propanol
(30 - 60% linear density gradient) containing 0.1$ TFA. The
fractions which were eluted at n-propanol concentrations of
about 40% were recovered, freeze-dried and dissolved in 0.1
M glycine buffer (pH 9). As a result of these procedures,
the human G-CSF in the C127 and CHO cells was concentrated
about 20-fold.
As controls, cells were transformed with human G-CSF
cDNA-free plasmids and the supernatants of their cultures
were concentrated in accordance with the procedures
described above. The human G-CSF activities of the samples
were assayed by the method of human G-CSF activity assay (a)
described earlier in this specification. If the efficiency
of expression is adequately high, the supernatants of cul-
tures may be directly assayed without being concentrated.
The results are summarized in Table 5, wherein the data are
based on concentrated samples.
1 341 389
-69-
Table 5
Assay of Human G-CSF Activity
Human neutrophilic
colonies
(colonies/dish)
Purified 96
human
G-CSF
(20 ng)
Culture of C127 cells
transformed with pdBPV-1 0
(concentrated 20-f old}
Culture of 3T3 cells
transformed with pdBPV-1 0
(concentrated 20-fold)
B PV
Culture of 0127 cells
transformed with pTNG4 82
(concentrated 20-fold)
Culture of 3T3 cells
transformed with pTNG4 85
(concentrated 20-fold)
Culture of CHO cells
transformed with pAdD26SVpA 0
(concentrated 20-fold}
Culture of CHO~~cells
dhfr transformed with pHGG4-dhfr 110
(concentrated 20-fold)
Culture of CHO cells
transformed with pG4DRl 105
(concentrated 20-fold)
Example 27: Amino Acid Analysis and Sugar Analysis (+VSE)
1) Analysis of amino acid composition
The crude CSF sample~prepared in Example 26 was
purified in accordance with the procedures described in
Example 2(iii). The purified CSF sample was hydrolyzed by
routine procedures, and the protein portion of the hydroly-
zate was checked for its amino acid composition by a special
method of amino acid analysis with Hitachi 835 automatic
amino acid analyzer (Hitachi, Ltd.) The results are shown
in Table 6. Hydrolysis was conducted under the following
conditions:
(i) 6 N HC1, 110oC, 24 hours, in vacuum
1 3 41 389
-70_
.(ii) 4 N methanesulfonic acid + 0.2% 3-(2-
aminoethyl)indole, 110°~C, 24 hours, 48 hours,
72 hours, in vacuum.
The sample was dissolved in a solution (1.5 ml)
containing 40% n-propanol and 0.1% trifluoroacetic acid.
Aliquots each weighing 0.1 ml were dried with a dry nitrogen
gas and, after addition of the reagents listed in (i) or
(ii), the containers were sealed in vacuum, followed by
hydrolysis of the contents.
Each of the values shown in Table 6 was the average
of f our measurements, 24 hour value for (i) and 24, 48 and
72 hour values for (ii), except that the contents of Thr,
Ser, 1/2 Cys, Met, Val, Ile and Trp were calculated by the
following methods (see "Tampaku Kagaku (Protein Chemistry)
II", A Course in Biochemical Experiments, Tokyo Ragaku
Dohjin):
-- For Thr, Ser, 1/2 Cys and Met, the time-dependent
profile of the 24, 48 and 72 hour values for (ii) were
extrapolated for zero hours.
-- For Val and Ile, the 72 hour value for (ii) was used.
-- For Trp, the average of 24, 48 and 72 hour values for
(ii) was used.
_71_ .1 ~ 4 1 3 8 9
Table
Amino Acid Analysis Data
Amino acids ~ Mole$
Asp (Asp -w Asn ) 2. 3
Thr 3,9
Ser 8.5
Glu (Glu + G1n) ~ 15.3
Pro ~ 7.4
g
t
ly 7.8
Ala ' 10.8
1/2 Cys 2.8
Val 4.5
Met 1.7
Ile 2.3
Leu 18.6
Tyr 1.7
Phe 3.4
Lys 2. 3
His 2.8
Trp 1.1
Arg ~ 2.8
2) Sugar composition analysis
An internal standard (25 nmal of inositol) was added
to 200 ng of the purified CSF sample used in the analysis
of amino acid composition l). After addition of a methanol
solution (500 u1) containing 1.5 N HCI, reaction was carried
out at 90°C for 4 hours in a N2 purged, closed tube. After
the tube was opened, silver carbonate (Ag2C43) was added
to neutralize the contents. Thereafter, 50 u1 of acetic
~ 3 41 389
-72-
anhydride was added and the tube was shaken for an adequate
period. Subsequently, the tube was left overnight in the
dark at room temperature. The upper layer was put into a
sample tube and dried with a nitrogen gas. Methanol was
added to the precipitate and the mixture was washed and
lightly centrifuged. The upper layer was put into the same
sample tube and dried. After addition of 50 1~1 of a TMS
reagent (5:1:1 mixture of pyridine, hexamethyl disilazane
and trimethylchlorosilane), reaction was carried out at 40°C
for 20 minutes and the reaction product was stored in a deep
freezer. A standard was prepared by combining 25 nmol of
inositol with 50 nmol each of galactose (Gal), N-acetyl
galactosamine (Gal NAc), sialic acid and any other appro-
priate reagents.
The samples thus prepared were subjected to gas
chromatographic analysis under the following conditions:
Conditions of analysis
Column . 2$ OV - 17 VINgort HP, 60 - 80 mesh, 3 m,
glass
Temperature : elevated from 110 to 250°C at 4°C/min.
Carrier gas (N2) pressure . initially 1.2 - 1.6 kg/cm2
finally 2 - 2.5 kg/cm2
Sensitivity : 103 MS2 range, 0.1 - 0.4 volts
Pressure : H2, 0.8 kg/cm2
air, 0.8 kg/cm2
Sample feed : 2.5 - 3.0 u1.
As a result of the analysis, galactose, N-acetyl
galactosamine and sialic acid were identified in the CSF
sample of the present invention.
Example 28: Preparation of pHGV2 Vector (for Use with
Animal Cells, -VSE line)
The EcoRI fragment prepared in Example 10 which had
the cDNA shown in Fig. 4(A) was treated with a restriction
enzyme, DraI, at 37°C for 2 hours, followed by treatment
with the Klenow fragment of DNA polymerase T (Takara Shuzo
Co., Ltd.) to create blunt ends. One microgram of BglII
linker (8mer, Takara Shuzo Co., Ltd.) was phosphorylated
with ATP and joined to about 1 ug of the separately obtained
1 3 41 389
-73-
mixture of DNA fragments. The joined fragments were treated
with a restriction enzyme, BgIII, and subjected to agarose
gel electrophoresis. Subsequently, only the largest DNA
fragment was recovered.
This DNA fragment was equivalent to about 700 base
pairs containing a human G-CSF polypeptide coding portion
(see Fig. 6). A vector pdKCR [Fukunaga et al., Proc. Natl.
Acad. Sci., USA, 81, 5086 (1984)] was treated with a restric-
tion enzyme, BamHI, and subsequently dephosphorylated with
an alkali phosphatase (Takara Shuzo Co., Ltd.), The vector
DNA obtained was joined to the about 700 cDNA fragment in
the presence of T4 DNA ligase (Takara Shuzo Co., Ltd.), so
as to produce pHGV2 (Fig. 17). As shown in Fig. 17, this
plasmid contained the promoter of SV40 early gene, the
replication initiating region of SV40, part of the rabbit S-
globin gene, the replication initiating region of pBR322 and
the pBR322-derived S-lactamase gene (Ampr), with the human
G-CSF gene being connected downstream of the promoter of the
SV40 early gene.
Example 29: Construction of Recombinant Vector (-VSE) for
Use in Transformation of 0127 Cells
1) Construction of pHGV2(H)
Twenty micrograms of the plasmid pHGV2 (Fig. 17)
prepared in Example 28 was treated by the procedures
described in 1) in Example 23, so as to prepare a plasmid
named pHGV2(H) (Fig. 18).
2) Construction of expression recombinant vectors pTN-V2,
pTNVAa and pTNVA~
With 20 ug of the pHGV2(H) being used, the procedures
described in 2) in Example 23 were repeated to select E.
coli harboring a plasmid having the pHGV2-derived G-CSF
cDNA. This plasmid was named pTN-V2 (Fig. 18).
Adenovirus type II [Tampakushitsu, Kakusan, Koso
(Proteins, Nucleic Acids, and Enzymes), 2,-7, December, 1982,
Ryoritsu Shuppan] was similarly treated to obtain a plasmid,
OpVA, that contained a ca. 1700-by SalI-HindIII fragment
harboring VAI and VAII, and a fragment containing VAI and
VAII was recovered from this plasmid. This fragment was
~ ~ 4~ 3a9
-74-
inserted into pTN-V2 at the HindIII site so as to obtain
pTNVAa and pTNVAs (Fig. 18). Because of the VA gene of
adenovirus, these plasmids were capable of enhanced expres-
sion of a transcription product from the early promoter of
SV40.
Example 30: Transformation of C127 Cells and G-CSF
Expression Therein (-VSE)
The pTN-V2 obtained in Example 29 was treated with a
restriction enzyme, BamHI, before it was used to transform
mouse C127 cells.
Mouse C127I cells were transformed with the so
prepared DNA to express G-CSF (see Example 24) and clones
having high G-CSF production rate were selected. These
clones produced G-CSF at a level of approximately 1 mg/L.
By further cloning, clones capable of producing G-CSF
at a level of 10 mg/L could be selected. In a similar
manner, C127 cells were transformed with the pTNVAa and
pTNVAB obtained in Example 29, and the transformants were
selected for clones having high capability of G-CSF produc-
tion; as for pTNVAa, clones capable of producing G-CSF at
yields of 20 mg/L or more could be obtained, while clones
having a lower productivity (a few mg/L) were obtained by
transformation with pTNVA~.
In addition to the C127I cells, NIH3T3 cells could
also be used as host cells.
Example 31: Expression of G-CSF in CHO Cells (-VSE)
1) Construction of pHGV2-dhfr
A DNA fragment of about 2.7 kbp in length was
prepared from 20 ug of the plasmid pHGV2 (Example 28) by the
procedures described in 1) in Example 25. This fragment
(0.5 ug) and the EcoRI fragment of pAaD26SVpA (0.5 ug) were
annealed. The resulting plasmid was used to transform Es
coli strain DH1 by the rubidium chloride procedure, and the
colonies harboring the plasmid of pHGV2-dhfr were selected.
The obtained plasmid was named pHGV2-dhfr (Fig. 19a).
The alternative procedure was as follows: the plas-
mid pHGV2 was treated with SalI and partially digested with
' 1 3 41 '~89
-75-
EcoRI without any EcoRI linker being attached. A DNA frag-
ment of about 2.7 kbp in length was recovered and treated
with the Rlenow fragment of E. coli DNA polymerase to create
blunt ends. A blunt-ended EcoRI fragment was prepared from
pAdD26SVpA as described above. This EcoRI fragment and the
separately prepared fragment (ca. 2.7 kbp) were treated with
T4 DNA ligase to prepare pHGV2-dhfr.
The pHGV2 (H) prepared in 1) of Example 29 was
treated with restriction enzymes, HindIII and SalI, as
described in 2) in Example 29, and the HindIII-SalI fragment
was joined to the blunt-ended EcoRI fragment of pAdD26SVpA
described above. This method could also be employed to
prepare pHGG4-dhfr (Fig. 19b).
2) Construction of pV2DRl and pV2DR2
Ten micrograms of the plasmid pAdD26SVpA mentioned in
1) was dissolved in 50 ml of a reaction solution containing
50 mM Tris-HCl (pH, 7.5), 7 mM MgCl2, 100 mM NaCl, 7 mM 2-
mercaptoethanol and 0.01% BSA. Reaction was carried out at
37°C for 10 hours in the presence of 10 units each of the
restriction enzymes, EcoRI and BamHI. Therefore, treatment
with phenol and washing with ether were conducted by routine
procedures. A DNA fragment of ca. 2 kb was recovered by
electrophoresis through a 1% low-melting point agarose gel.
The recovered DNA fragment was treated with the Rlenow
fragment of DNA polymerase by routine procedures so as
to create blunt ends. The blunt-ended DNA fragment was
subjected to treatment with phenol, washing with ether
and precipitation with ethanol.
Ten micrograms of the plasmid pHGV2(H) obtained in 1)
of Example 29 was dissolved in 50 ~l of a reaction solution
containing 10 mM Tris-HC1 (pH, 7.5), 7 mM MgCl2 and 60 mM
NaCl. Reaction was carried out at 37°C for 6 hours in the
presence of 10 units of HindIII. A DNA fragment was
recovered by electrophoresis through a 1% low-melting point
agarose gel that was conducted by routine procedures. The
recovered DNA fragment was subsequently treated with BAP and
blunt ends were created by treatment with the Klenow frag-
ment. Following treatment with phenol and washing with
~ ~ 4~ 3a'~
-76-
ether, the DNA fragment was joined at blunt ends to the
previously obtained ca. 2-kb DNA fragment with a T4DNA
lipase by the following procedures: 1 up of each DNA frag-
ment was dissolved in 30 u1 of a reaction solution contain-
s ing 66 mM Tris-HC1 (pH, 7.5), 6.6 mM MgCl2, 5 mM DTT and
1 mM ATP, and reaction was carried out at 6°C for 12 hours
in the presence of 50 units of a T4DNA lipase. The ligation
product was used to transform E. coli strain DH1. As a
result, pV2DRl and pV2DR2 shown in fig. 19c were obtained.
3) Transformation and expression
CHO cells were transformed with the plasmid pHGV2-
dhfr for G-CSF expression in accordance with the procedures
described in 3) in Example 25.
The transformation of CHO cells may also be accom-
plished by cotransformation with pHGV2 and pAdD26SVpA.
CHO cells were also transformed by the following
procedures: pV2DRl or pV2DR2 that was prepared in 2) was
preliminarily treated with SalT and KpnI respectively to
obtain DNA fragments and 10 up of these fragments was used
to transform CHO cells as above; the transformed cells were
subjected to continued cultivation in a series of selective
media in the manner described above; about 7 days later, no
less than 100 distinct colonies appeared per plate; these
colonies were transferred en masse to a fresh plate and
subjected to continued cultivation in a series of selective
media in the presence of 0.01 uM MTX, whereupon ten-odd
colonies appeared; the same procedures were repeated with
the MTX concentration being serially increased to 0.02 uM,
0.05 uM and 0.1 uM, and the colonies that survived were
selected; colony selection could be achieved in a similar
manner even when the 10-odd colonies obtained were individ-
ually selected and subjected to cultivation at increasing
MTX concentrations.
A recombinant vector that harbors a "polycistronic
gene" may also be used to transform CHO cells. An example
of this alternative method is as follows: pAdD26SVpA was
treated with Pstl and the recovered two fragments were
joined to a pBRV2-derived CSF cDNA fragment so as to
1 3 41 389
_77_
construct a recombinant vector wherein the adeno virus
promoter, CSF cDNA, DHFR and the poly(A) site of SV40 were
inserted in the order written. This recombinant vector was
used to transform CHO cells.
Example 32: Assay of G-CSF Activity (-VSE)
By the procedures described in Example 26, human G-
CSF was obtained from the supernatants of cultures of C127
cells and CHO cells which were obtained in Examples 30 and
31, respectively. The human G-CSF activity of each of the
recovered samples was assayed as in Example 26. The results
are shown in Table 7,
1 34~ 389
-78-
Tab a 7
Assay of Human G-CSF Activity
Human neutrophilic
colonies
(colonies/dish)
Purified 96
human
G-CSF
(20 ng)
Culture of C127 cells
transformed with pdBPV-1 0
(concentrated 20-fold)
Culture of 3T3 cells
transformed with pdBPV-1 0
(concentrated 20-fold)
B PV
Culture of C127 cells
transformed with pTN-V2 107
(concentrated 20-fold)
Culture of 3T3 cells
transformed with pTN-V2 103
(concentrated 20-f old)
Culture of CHO cells
transformed with pAdD26SVpA 0
(concentrated 20-fold)
Culture of CHO~'cells
dhfr transformed with pHGV2-dhfr 111
(concentrated 20-fold)
s
Culture of CHO cells
transformed with pV2DR1 F
113
(concentrated 20-fold)
Example 33: Amino Acid Analysis and Sugar Analysis (-VSE)
1) Analysis of amino acid composition
The crude CSF sample 'prepared in Example 32 was
purified in accordance with the procedures described in
Example 2(iii). The purified CSF sample was subjected to
analysis of amino acid composition by the procedures
described in 1) in Example 27. The results are shown in
Table 8.
1 3 41 389
-79-
Table 8
Amino Acid Analysis Data
Amino acids Mole%
Asp (Asp + Asn) 2.3
Thr 4.0
Ser 8.1
Glu (Glu + Gln) 15.1
Pro 7.5
Gly 8.0
Ala 10.9
1/2 Cys 2.8
Val 3.9
Met 1.7
Ile 2.3
Leu 18.9
Tyr 1.7
Phe 3.5
Lys 2.3
s
His ~ 2.9
c
Trp ' 1.2
Arg ~ 2.9
2) Analysis of sugar composition
The purified CSF sample used in the analysis of amino
acid composition in 1) was also subaected to analysis of its
sugar composition by the same procedures and under the same
conditions as those described in 2) in Example 27. As a
result of this analysis, the presence of galactose, N-acetyl
galactosamine and sialic acid in the CSF sample of the
present invention was verified.
1 34~ 389
_80-
Example 34: Construction of Recombinant Veetar Containing
Chromosomal Gene for Expression in COS Cells
The plasmid pBRCE38 that was ok~tained in Example 11
and which contained the chromosomal gene shown in Fig. 5 was
treated with EcoRI. The pSVH*K+ plasmid described by
Banerji et al. in Cell, 27, 299 (1981) was treated with KpnI
to remove the globin gene. The plasmid was further
subjected to partial digestion with HindIII so as to remove
part of the late gene of SV40. The fragments were rejoined
l0 to prepare an expression vector pML-E+.
This vector was treated with the restriction enzyme,
EcoRI, and dephosphorylated with an alkaline phosphatase
(Takara Shuzo Co., Ltd.) to obtain a vector DNA, which was
linked to the aforementioned chromosomal DNA with the aid of
a T4DNA ligase (Takara Shuzo Co., Ltd.) to obtain pMLCE3o(.
As shown in Fig. 20, this plasmid contained the enhancer of
SV40 gene, the replication origin of SV40, the replication
origin of pBR322 and the pBR322-derived ~-lactamase gene
(Ampr), and had the human G-CSF chromosomal gene joined
downstream from the enhancer of SV40 gene.
Example 35: Expression of Human G-CSF Chromosomal Gene in
COS Cells
COS-1 cells (provided by courtesy of Dr. Gluzman of
Cold Spring Harbor Laboratory, D.S.A.) that had been grown
to a density of about 70~ in Petri dishes (9 cm~, Nunc)
using a DMEM medium (Dulbecco's mod~.fied Eagle's medium
available from Nissui Seiyaku K.K. under the trade mark
NISSUI > containing 10~ calf serum were transformed by
either the calcium phosphate procedure [Wigler et al., Cell,
14, 725 (1978)) or the DEAF-dextran:chloroquine method [see,
for example, Gordon et al., Science, 228, 810 (10985)].
Transformation by the calcium phosphate procedure
was conducted as follows: 160 ug of the plasmid pMLCE3~x
prepared in Example 34 was dissolved in 320 u1 of a TE
solution and, after addition of distilled water (3.2 ml),
504 u1 of 2 M CaCl2 was added.
To the resulting solution, 4 ml of 2 x HBS (50 mM
Hepes, 280 mM NaCl, 1.5 mM phosphate buffer, pH 7.12) was
-81-
added and the mixture was cooled on ice for 20 - 30 minutes.
The cooled mixture was added dropwise to the medium in an
amount of 1 ml per Petri dish where the COS-1 cells had
grown. After cultivation for 4 hours at 37°C in a C02 incu-
bato n the cells were washed with a serum-free DMEM medium,
then left to stand for about 3 minutes at room temperature
in 5 ml of a DMEM medium containing 20% glycerol, and re-
washed with a serum-free DMEM medium. After the serum-free
DMEM medium was removed, 10 ml of a DMEM medium containing
10% calf serum was added and cultivation was conducted over-
night in a C02 incubator. After the medium was replaced by
a fresh one of the same type, cultivation was conducted for
an additional 3 days.
Transformation by the DEAE-dextran:chloroquine method
was conducted as follows: as in the calcium phosphate
procedure, COS-1 cells were cultivated to grow to a density
of 70% and washed twice with a serum-free DMEM medium; to
the washed cells, a serum-free DMEM medium containing 250
ug/ml of DEAF-dextran and 2 ug/ml of the plasmid pMLCE3o(
prepared in Example 34 was added and cultivation was
conducted at 37°C for 12 hours; subsequently, the cells were
washed twice with a serum-free DMEM medium and subjected to
further cultivation at 3?oC far 2 hours in a DMEM medium
containing 10% calf serum and 1 mM chloroquine; thereafter,
the cells were washed twice with a serum-free DMEM medium
and cultured at 37°C for an additional 3 days in a DMEM
medium containing 10% calf serum.
The supernatant of the so obtained culture of COS-1
cells was adjusted to a pH of 4 with 1 N acetic acid. After
addition of an equal volume of n-propanol, the resulting
precipitate was removed by centrifugation. The supernatant
was passed through an open column (l~ x 2 cmL) filled with a
C8 reverse-phased carrier (Yarnamura Ragaku R.K.) and elution
was conducted with 50% n-propanol. The eluate was diluted
two-fold with water and subjected to reverse-phased high-
pressure liquid chromatography on YMC-C8 column (Yamamura
Ragaku R.R.), followed by elution with n-propanol (30 - 60%
linear density gradient) containing 0.1% TFA. The fractions
1 3 41 3~9
-82-
which were eluted at n-propanol concentrations of about 40%
were recovered, freeze-dried and dissolved in 0.1 M glyci-
dine buffer (pH 9). As a result of these procedures, the
human G-CSF in the supernatant of the culture of COS-1 cells
was concentrated about 20-fold.
As controls, COS-1 cells were transformed with G-CSF
chromosomal-gene free pML-E+ by the above-described proce-
dures and the supernatant of the resulting culture was
concentrated.
The human G-CSF activities of the obtained samples
were assayed by the "Method of Human G-CSF Activity Assay
(a)" described earlier in this specification. The results
are Summarized in Table 9.
Table 9
Human neutrophilic colonies
(colonies/dish)
Purified human G-CSF (20 ng) 18
Culture of COS cells
~
transformed with pML-E 0
(concentrated 20-fold)
Culture of COS cells
transformed with pMLCE3a 23
(concentrated 20-fold)
Culture of COS cells
transformed with pMLCE3a 19
(concentrated ZO-f old)
Example 36: RNA Analysis of G-CSF (Chromosomal Gene)
COS cells cultivated to a cell concentration of 8 x
106 cells/plate (9 cm~) were transformed with 80 ug of the
plasmid pMLCE3a. After 48 hours, the totel RNA was prepared
in accordance with the procedure of Chirgwin [Biochemistry,
18, 5294 - 5299 (1979)x.
The plasmid pBRG4 obtained in Example 9 was cleaved
with restriction enzyme AhaIII and the resulting pBRG4-
derived DNA fragment was radiolabelled with [Y-32P]ATP
using T4 polynucleotide kinase to obtain an ca. 2.8-kb DNA
fragment containing G-CSF cDNA. The fragment was recovered
and used as a DNA probe. After the DNA probe (I.5 x 105
1 3 41 389
-83-
c.p.m., 2.8 x 106 c.p.m./ug DNA) was denatured, it was
mixed with 20 ~,g of the total RNA prepared from COS cells.
Hybridization at 45°C for 15 hours was conducted. The
mixture was digested with 200 units/ml or A00 units/ml of
S1 nuclease (P.L. Biochemicals) in accordance with the
procedures of Weaver and Weissmann [Nucleic Acid Res., 7,~
1175 - 1193 (1979)], followed by 4% polyacrylamide gel
electrophoresis in the presence of 8.3 M urea. Detection
by autoradiography was then conducted.
As a result, a band corresponding to 722 by was
observed as a strongly radiolabelled band in COS cells, from
which a band corresponding to 487 by was also detected.
Therefore, the RNA of COS cells was found to contain
G-CSF mRNAs of both +VSE and -VSE line.
Example 37: Amino Acid Analysis and Sugar Analysis
(Chromosomal Gene)
1) Analysis of amino acid composition
The crude CSF sample.prepared in Example 35 was
purified in accordance with the procedures described in
Example 2(iii). The purified CSF sample was subjected to
analysis of amino acid composition by the procedures
described in 1) in Example 27. The results are shown in
Table 10.
~ 3 41 389
-s4-
Table 10
Amino Acid Analysis Data
Amino acids ~ Mole%
Asp (Asp + Asn) 2.3
Thr 4.9
Ser 8.3
Glu (Glu + Gln) 15.3
Pro 7.4
Gly 7.9
Ala 10.8
1/2 Cys 2.8
Val , 4.3
Met 1.7
Ile ~ 2.
i 3
Leu 18.7
Tyr ~ 1.7
Phe = 3.4
Lys ' 2.3
His ~ 2.9
Trp ' 1.1
f
Arg ; 2.9
2) Analysis of sugar composition
The purified CSF sample used in the analysis of amino
acid composition in 1) was also subjected to analysis of its
sugar composition by the same procedures and under the same
conditions as those described in 2) in Example 27. As a
result of this analysis, the presence of galactose, N-acetyl
galactosamine and sialic acid in the CSF sample of the
present invention was verified.
1 3 41 389
-85-
Example 38: Expression of Human G-CSF Chromosomal Gene in
C127 Cells
The plasmid pMLCE3a obtained in Example 34 was
treated with EcoRI and a fragment of ca. 4 kb was recovered
by the procedures described in Molecular Cloning, ibid. The
recovered fragment was used as a source of the chromosomal
G-CSF gene.
The fragment was treated with the Rlenow fragment of
DNA polymerise I to create blunt ends (A).
The promoter of SV40 (ca. 0.4-kb EcoRI-EcoRI
fragment) was cut out from the plasmid pHGA410 (as prepared
in Example 22) by the procedures described in Molecular
Cloning, ibid., and was subsequently treated with the Klenow
fragment of DNA polymerise (B).
' In a separate step, a plasmid pdBPV-1 having a bovine
papilloma virus (BPV) [this plasmid was obtained by courtesy
of Dr. Howley and is described in Sarver, N., Sbyrne, J.C. &
Howley, P.M., Proc. Natl. Acid. Sci., USA, 79, 7147-7151
(1982)] was treated with HindTII and PvuII to obtain a DNA
fragment of ca. 8.4 kb. This fragment was treated with the
Klenow fragment of DNA polymerise T and dephosphorylated
with a bacterial alkaline phosphatase (C).
The DNA fragments (A), (B) and (C) each weighing 0.1
ug were dissolved in 20 u1 of a reaction solution [50 mM
Tris-HC1 (pH 7.6), 10 mM MgCl2, 10 mM DTT, 1 mM ATP] and
reaction was carried out overnight at 4°C in the presence of
180 units of a T4DNA ligase.
The reaction solution was subsequently treated by the
rubidium chloride procedure described in Molecular Cloning,
ibid. so as to obtain the plasmid pTNCE3a (Fig. 21).
The DNA fragment (A) used as a source of the chromo-
somal G-CSF gene may be replaced by a DNA fragment of ca.
1.78 kb that is obtained by the following procedures: 20 ug
of pMLCE3a is dissolved in 100 u1 of a mixture of 10 mM
Tris-HC1 (pH 8.0), 7 mM MgCl2, 100 mM NaCl, 7 mM 2-
mercaptoethanol and 0.01% BSA; the solution is incubated at
37oC for 5 hours in the presence of 20 units of StuI and
subjected to electrophoresis through 1.2% agarose gel.
1 3 41 389
f
-86-
The so obtained plasmid pTNCE3a was used to transform
mouse C127 I cells as in Example 24 and clones that ex-
pressed the human G-CSF chromosomal gene and which had a
high capacity for producing G-CSF were selected.
Example 39: Expression of Human G-CSF Chromosomal Gene in
CHO Cells
As in the case of expression in C127 cells, the
plasmid pMLCE3a was treated with Stul and a DNA fragment of
ca. 1.78 kb was recovered; alternatively, the same plasmid
was treated with EcoRI and an EcoRI fragment of about 4 kb
was recovered. Either fragment was suitable for use as a
source of the chromosomal G-CSF gene.
The source fragment was treated with the Rlenow
fragment of DNA polymerase I (a).
As in Example 38, the gromoter of SV40 (EcoRI-EcoRI
fragment) was cut out from pHGA410 to obtain a fragment of
about 0.4 kb, which was similarly treated with the Rlenow
fragment of DNA polymerase (b).
In a separate step, the plasmid pAdD26SVpA plasmid
[Kaufman, R.G. & Sharp. P.A.. Mol. Cell. Biol., 2, 1304-1319
(1982)] was treated with EcoRI, then with the Klenow frag-
ment of DNA polymerase, and finally dephosphorylated by
treatment with a bacterial alkaline phosphatase (c).
The fragments, (a), (b) and (c), each weighing 0.1 ug
were dissolved in 20 ~1 of a reaction solution [50 mM Tris-
CH1 (pH 7.6), 10 mM MgCl2, 10 mM DTT, 1 mM ATP] and reaction
was carried out overnight at 4°C in the presence of 180
units of a T4DNA ligase.
The reaction solution was subsequently treated by the
rubidium chloride procedure described in Molecular Cloning,
ibid., so as to transform 1E. coli strain DH1. The resulting
Tetr colonies were screened for those containing the plasmid
pD26SVCE3a.
As shown in Fig. 22, the plasmid pD26SVCE3a has the
CSF gene linked to the early gene of SV40, and the dhfr gene
linked downstream from the principal late promoter of
adenovirus.
~ 3 ~~ 3ss
The plasmid pAdD26SVpA was treated with EcoRI and
BamHI as in 2) of Example 25, so as to obtain a DNA fragment
(ca. 2 kb) containing the dhfr gene. This fragment was
linked to fragment (a) and the EcoRI-SaII fragment of
pHGA410 (H), so as to construct an Ampr expression vector
pDRCE3a (Fig. 22).
CHO cells were transformed with the so obained
plasmids, pD26SVCE3a and pDRCE3a, as in Example 25. By
repeated selection through growth in the presence of MTX,
clones of a G-CSF producing strain were obtained.
Example 40: Assay of the G-CSF Activity of Transformants
(expressing human chromosomal gene)
The supernatants of cultures of 0127 cells and CHO
cells which were obtained in Examples 38 and 39, respec-
Lively, were worked up as in Example 26 to obtain human G-
CSF and its activity was assayed. The results are shown
in Table 11.
-~~- 1 ~ 41 389
Table 11
Assay of Human G-CSF Activity
Human neutrophilic
colonies
(colonies/dish)
Purified 85
human
G-CSF
(20 ng)
Culture of C127 cells
transformed with pdBPV-1 0
(concentrated 20-fold)
B PV
Culture of 0127 cells
transformed with pTNCE3a 83
(concentrated 20-fold)
Culture of CHO cells
transformed with pAdD26SVpA 0
(concentrated 20-fall)
Culture of CHO cells
dhfr transformed with pD26SVCE3a 85
(concentrated 20-fold)
Culture of CHO cells
transformed with- pDRCE3a 86
(concentrated 20-fold)
Example 41: Molecular Weight and Isoelectric Point of
Transf ormants
The gurified CSF samples used in the analysis of
amino acid composition in Examples 16, 20, 27, 33 and 37
were subjected to measurements of their molecular weights
and isoelectric points by the following procedures.
1) Molecular weight
The molecular weight of the CSF was determined by
sodium dodecylsulfate-polyacrylamide gel electrophoresis
(SDS-PAGE). The electrophoretic equipment was PROTEANTH
(16 cm, product of Bio-Rad Corporata.on), using a gel made
up of a polyacrylamide slab gel (T = 15%, C = 2.6%) measur-
ing 140 mm x 160 mm x 1.5 mm, and a concentrating gel (T =
3%, C = 20%). A denatured CSF sample was prepared by the
following procedure: CSF was boiled for 3 minutes in a
solution containing 2% of sodium dodecylsulfate in 0.46 M 2-
mercaptoethanol. After performing electrophoresis with 4 u9
of the sample with a constant current of 30 mA for 4 hours,
~ 3 41 389
-89_
the gel was removed and stained with 0.25% Coomassie
Brilliant Blue R 250 (product of Sigma Chemical Co.) for
band detection. The following substances were used as molec-
ular weight markers after similar treatments: phosphorylase
B (mol. wt. 92,500), bovine serum albumin (BSA, mol. wt.
67,000), ovalbumin (OVA, mol, wt. 45,000), carbonic
anhydrase (mol, wt. 31,000), soybean trypsin inhibitor
(mol. wt. 21,500) and lysozyme (mol wt. 14,400).
As a result, a single band corresponding to a molec-
ular weight of 185,000 ~ 1,000 was detected for each of the
CSF samples obtained in Example 16 [E. coli/cDNA (+VSE)]
and Example 20 [E. coli/cDNA (-VSE)], and a single band
correponding to a molecular weight of 19,000 + 1,000 was
detected from each of the CSF samples obtained in Example 27
[C127,CH0/cDNA (+VSE)], Example 33 ~:C127,CH0/cDNA (-VSE)]
and Example 37 (COS/gDNA).
2) Isoelectric point
The isoelectric point of the CSF of the present
invention was determined by a flat bed, isoelectric electro-
phoretic apparatus, FBE-3000 (product of Pharmacia Fine
Chemicals). After 2-hour electrophoresis with a constant
power of 30 watts (Vmax = 2,000 volts) on a polyacrylamide
gel (T = 5%, C = 3%, 115 mm x 230 mm) containing Pharmalyte
(pH = 4 - 6.5, Pharmacia Fine Chemicals) and 4M urea, the
CSF was fixed with 30% methanol/10% trichloroacetic acid/35%
sulfosalicylic acid, and stained with Coomassie Brilliant
Blue R-250. A Low pI kit (pH: 2.5 - 6.5, product of
Pharmacia Fine Chemicals) was used as a isoelectric point
marker.
Analysis of band separation at a pH of 4 to 6.5 gave
a single band corresponding to pI = 6.1 for each of the CSF
samples obtained in Example 16 and 2U, and gave three
distinct bands corresponding to pI = 5.5, 5.8 and 6.1 for
each of the CSF samples s~ obtained in Example 27, 33 and 37.
Example 42: Protective Effect of Human G-CSF against
Microbial Infection
Test Method
1. Protection against infection with Pseudpmonas aeruginosa
~ 34~ ~a9
-90_
Endoxan (trade name of Shionogi & Co., Ltd.) was
administered intraperioneally into 8-9-wk-old ICR mice (male:
35.3 ~ 1.38 g in body weight) in a dose of 200 mg/kg. The
mice were then divided into three groups; two groups were
given four subcutaneous injections (each 0.1-ml dose), at 24-
hr intervals, of a solvent [1$ propanol and 0.5$ (w/v) mouse
serum albumin in physiological saline] containing human G-CSF
(25,000 or 50,000 units/mouse), whereas the other group was
given only the solvent in accordance with the same schedule.
Three hours after the last injection, the mice in each group
were infected with Pseudomonas
aeruginosa GNB-139 by subcutaneous injection (3.9 x 105
CFU/mouse). Twenty-one hours after the infection, the
first two groups were given another subcutaneous injection
of the solvent containing human G-CSF (25,000 or 50,000
units/mouse) and the other group given the solvent only.
The protective effect of human G-CSF was checked by
counting the number of mice which were alive 10 days after
the infection.
Preparation of cell suspension
Pseudomonas aeru inosa GNB-139 was cultured overnight
with shaking at 37°C in a Heart Infusion liquid medium
(trade name of Difco}. The culture was suspended in a
physiological saline solution.
2. Protection against infection with Candida
Endoxan (trade name of Shionogi & Co., Ltd.) was
administered intraperitoneally into 8-wk-old ICR mice (male;
40.5 ~ 1.60 g in body weight) in a dose of 200 mg/kg. The
mice were then divided into two groups; one group was given
four subcutaneous injections (each 0.1-ml dose), at 24-hr
intervals, of a solvent [1~ propanol and 10$ (w/v) ICR mouse
serum in physiological saline] containing human G-CSF
(50,000 units/mouse), whereas the other group was given only
the solvent in accordance with the same schedule. Four
hours after the last injection, the mice in each group were
infected with Candida albicans U-50-1 (strain isolated from
urine of leukemic patients; courtesy by Bacteriological
1 34~ 3$9
-91_
Laboratory, Tohoku University, School of Medicine) by intra-
venous injection (5.6 x 105 CFU/mouse). The protective
effect of human G-CSF was checked by counting the number of
mice which were alive ten days after the infection.
Preparation of cell suspension
Candida albicans U-50-1 was cultured overnight with
shaking at 37°C in a yeast extract-containing Sabouraud
liguid medium (2~ dextrose from Junsei Pure Chemicals Co.,
Ltd.; 10$ Tryptocase Peptone, trade name of BBL; 5$ yeast
extract from Difco; pH, 5.6). The culture was washed twice
with physiological saline and suspended in physiological
saline.
3. Protection against infection with intracellular
parasitic Listeria
Endotoxan (trade name of Shionogi & Co., Ltd.) was
administered intraperitoneally to 7-wk-old ICR mice (male:
34.7 ~ 1.24 g in body weight) in a dose of 200 mg/kg. The
mice were then divided into two groups; one group was given
four subcutaneous injections (each 0.l-ml dose), at 24-hr
intervals, of a solvent [1$ n-propanol and 10$ (w/v) ICR
mouse serum in physiological saline] containing human G-CSF
(50,000 units/mouse) while the other group was given only
the solvent in accordance with the same schedule. Four
hours after the last injection, the mice in each group were
_infected with Listeria monocvtogenes 46 (by courtesy of
Microbiological Laboratory, Tohoku University, School of
Medicine) by intravenous injection of 1.0 x 107 CFU/mouse.
The protective effect of human G-CSF' was checked by counting
the number of mice which were alive 12 days after the
infection.
Preparation of cell suspension
Listeria monocytoaenes 46 was cultured overnight with
shaking at 37°C in a Brain-Heart Infusion liquid medium
(trade name of Difco). The culture was suspended in physi-
ological saline.
Results
1 ~ 41 3gg
-92-
i) Tests 1, 2 and 3 were conducted with the E, coli G-
CSF (+VSE) polypeptide obtained in Example 16. The results
are shown in Tables 12, 13 and 14.
Table 12
Effect against Pseudomonas aeruainosa
Group CSF concentration Live mice/
(units/mouse/day) mice tested
Solvent 0 0/10
CSF-containing solvent 25,000 6/10
CSF-containing solvent I 50,000 8/10
Table 13
Effect against Candida albicans
Group CSF concentration Live mice/
(units/mouse/day) mice tested
Solvent 0 0/10
CSF-containing solvent 50,000 10/10
Table 14
Effect against Liste~ia monoc~toctenes
Group CSF concentration Give mice/
(units/mouse/day) mice tested
Solvent 0 0/10
CSF-containing solvent 50,000 10/10
ii) Test 1 was conducted with the E~ coli G-CSF (-VSE)
polypeptide obtained in Example 20. The results are shown
in Table 15.
1 34~ 389
-93-
Table 15
Effect against Pseudomonas aeruginosa
Group CSF concentration Live mice/
(units/mouse/day) mice tested
Solvent 0 0/10
CSF-containing solvent 25,000 6/10
CSF-containing solvent ~ 50,000 8/10
iii) Test 1 was conducted with a CHO cell derived, puri-
fied human G-CSF sample (+VSE) that was the same as what was
used in the analysis of amino acid composition in Example
27. The results are shown~in Table 16.
Table 16
Effect against Pseudomonas aeru~inosa
Group CSF concentration Live mice/
(units/mouse/day) mice tested
Solvent 0 0/10
CSF-containing solvent '. 25,000 9/10
CSF-containing solvent 50,000 10/10
Substantially the same results were attained when
Test 1 was conducted with a 0127 cell derived, purified
human G-CSF sample which was the same as what was used in
the analysis of amino acid composition in Example 27.
iv) Test 1 was conducted with a CHO cell derived,
purified human G-CSF sampl a (-VSE) which was the same as
what was used in the analysis of amino acid composition in
Example 33. The results are shown in Table 17.
1 34~~ 389
_94_
Tab Le 17
Effect against Ps u~"~i mog~s ae,~uainosa
Group CSF concentration Live mice/
(units/mouse/day) mice tested
solvent 0 0/10
CSF-containing solvent 25,000 9/10
CSF-containing solvent ~ 50,000 10/10
Substantially the same results were attained when
Test 1 was conducted with a 0127 cell derived, purified
human G-CSF sample which was the same as what was used in
the analysis of amino acid composition in Example 33.
