Canadian Patents Database / Patent 1341531 Summary

Third-party information liability

Some of the information on this Web page has been provided by external sources. The Government of Canada is not responsible for the accuracy, reliability or currency of the information supplied by external sources. Users wishing to rely upon this information should consult directly with the source of the information. Content provided by external sources is not subject to official languages, privacy and accessibility requirements.

Claims and Abstract availability

Any discrepancies in the text and image of the Claims and Abstract are due to differing posting times. Text of the Claims and Abstract are posted:

  • At the time the application is open to public inspection;
  • At the time of issue of the patent (grant).
(12) Patent: (11) CA 1341531
(21) Application Number: 617061
(54) English Title: GENETICALLY ENGINEERED PLANT CELLS AND PLANTS EXHIBITING RESISTANCE TO GLUTAMINE SYNTHETASE INHIBITTORS, DNA FRAGMENTS AND RECOMBINANTS FOR USE IN THE PRODUCTION OF SAID CELLS ANDPLANTS
(54) French Title: CELLULES VEGETALES GENETIQUEMENT MODIFIEES, AINSI QUE DES PLANTS PRESENTANT UNE RESISTANCE AUX INHIBITEURS DE LA GLUTAMINE SYNTHETASE, ET AUSSI DES FRAGMENTS D'ADN ET DES RECOMBINES POUR LA PRODUCTION DE CES CELLULES ET DE CES PLANTES
(52) Canadian Patent Classification (CPC):
  • 47/4
  • 195/47
  • 195/1.22
  • 195/1.33
(51) International Patent Classification (IPC):
  • C12N 15/82 (2006.01)
  • C12N 9/10 (2006.01)
  • C12N 15/54 (2006.01)
  • A01H 5/00 (2006.01)
  • A01H 5/10 (2006.01)
(72) Inventors :
  • LEEMANS, JAN (Belgium)
  • BOTTERMAN, JOHAN (Belgium)
  • DE BLOCK, MARC (Belgium)
  • THOMPSON, CHARLES (Switzerland)
  • MOUVA, RAO (Switzerland)
(73) Owners :
  • BIOGEN IDEC MA, INC. (United States of America)
  • NV BAYER CROPSCIENCE (Belgium)
The common representative is: BIOGEN IDEC MA, INC.
(71) Applicants :
  • PLANT GENETIC SYSTEMS N.V. (Belgium)
  • BIOGEN, INC. (United States of America)
(74) Agent: LAVERY, DE BILLY, LLP
(74) Associate agent:
(45) Issued: 2007-06-12
(22) Filed Date: 1987-04-07
(30) Availability of licence: N/A
(30) Language of filing: English

English Abstract




The invention relates to a DNA fragment containing a
determined gene, the expression of which inhibits the antibiotic
and herbicidal effects of Bialaphos and related products. It also
relates to recombinant vectors, containing such DNA fragment,
which enable this protective gene to be introduced and expressed
into cells and plant cells.


French Abstract

La présente invention a pour objet un fragment d'ADN contenant un gène déterminé, dont l'expression inhibe les effets antibiotiques et herbicides de Bialaphos et produits connexes. La présente invention concerne également des vecteurs recombinants contenant lesdits fragments d'ADN, qui permettent ce gène protecteur d’être introduit et exprimé dans les cellules et les cellules végétales.


Note: Claims are shown in the official language in which they were submitted.



59

CLAIMS


1. Use of a plant to produce a seed or a next generation of plants, said plant
having a recombinant
DNA stably integrated in the nuclear genome of its cells, said recombinant DNA
comprising a
chimaeric gene comprising in sequence:
a) a promoter region comprising a promoter recognized by the polymerases of
cells of said
plant; and
b) a coding region comprising a DNA fragment encoding a protein having an
acetyltransferase
activity with respect to a glutamine synthetase inhibitor.


2. Use according to claim 1, wherein said DNA fragment encodes a polypeptide
having an
acetyltransferase activity with respect to phosphinothricin.


3. Use according to claim 2, wherein said DNA fragment is obtainable from the
genome of a
Streptomyces species.


4. Use according to claim 3, wherein said DNA fragment is obtainable from
Streptomyces
hygroscopius or Streptomyces viridochromogenes.


5. Use according to claim 1, wherein said DNA fragment encodes a protein with
phosphinothricin
acetyl transferase activity which has an approximate molecular weight of 22 Kd
or a part of said
protein of sufficient length to possess phosphinothricin acetyltransferase
activity.


6. Use according to claim 5, wherein said DNA fragment encodes a protein
comprising the amino acid
sequence.


X Ser Pro Glu Arg Arg Pro Ala Asp
Ile Arg Arg Ala Thr Glu Ala Asp MET
Pro Ala Val Cys Thr Ile Val Asn His
Tyr Ile Glu Thr Ser Thr Val Asn Phe
Arg Thr Glu Pro Gln Glu Pro Gln Glu
Trp Thr Asp Asp Leu Val Arg Leu Arg
Glu Arg Tyr Pro Trp Leu Val Ala Glu
Val Asp Gly Glu Val Ala Gly Ile Ala
Tyr Ala Gly Pro Trp Lys Ala Arg Asn
Ala Tyr Asp Trp Thr Ala Glu Ser Thr
Val Tyr Val Ser Pro Arg His Gln Arg
Thr Gly Leu Gly Ser Thr Leu Tyr Thr
His Leu Leu Lys Ser Leu Glu Ala Gln
Gly Phe Lys Ser Val Val Ala Val Ile





60


Gly Leu Pro Asn Asp Pro Ser Val Arg
Met His Glu Ala Leu Gly Tyr Ala Pro
Arg Gly Met Leu Arg Ala Ala Gly Phe
Lys His Gly Asn Trp His Asp Val Gly
Phe Trp Gln Leu Asp Phe Ser Leu Pro
Val Pro Pro Arg Pro Val Leu Pro Val
Thr Glu Ile

in which X encodes Met or Val, or a part of said protein of sufficient length
to possess
phosphinothricin acetyltransferase activity.


7. Use according to claim 5, in which said DNA fragment encodes a protein
comprising the amino acid
sequence


Met Ser Pro Glu Arg Arg Pro Val Glu
Ile Arg Pro Ala Thr Ala ala Asp MET
Ala Ala Val Cys Asp Ile Val Asn His
Tyr Ile Glu Thr Ser Thr Val Asn Phe
Arg Thr Glu Pro Gin Thr Pro Gin Glu
Trp Ile Asp Asp Leu Glu Arg Leu Gln
Asp Arg Tyr Pro Trp Leu Val Ala Glu
Val Glu Gly Val Val Ala Gly Ile Ala
Tyr Ala Gly Pro Trp Lys Ala Arg Asn
Ala Tyr Asp Trp Thr Val Glu Ser Thr
Val Tyr Val Ser His Arg His Gln Arg
Leu Gly Leu Gly Ser Thr Leu Tyr Thr
His Leu Leu Lys Ser MET Glu Ala Gin
Gly Phe Lys Ser Val Val Ala Val Ile
Gly Leu Pro Asn Asp Pro Ser Val Arg
Leu His Glu Ala Leu Gly Tyr Thr Ala
Arg Gly Thr Leu Arg Ala Ala Gly Tyr
Lys His Gly Gly Trp His Asp Val Gly
Phe Trp Gln Arg Asp Phe Glu Leu Pro
Ala Pro Pro Arg Pro Val Arg Pro Val
Thr Gln Ile


In which Met is encoded by the codon ATG, or a part of said protein of
sufficient length to possess
phosphinothricin acetyltransferase activity.




61


8. Use according to claim 6, in which said DNA fragment comprises the
nucleotide sequence:


NTG AGC CCA GAA CGA CGC CCG GCC GAC
ATC CGC CGT GCC ACC GAG GCG GAC ATG
CCG GCG GTC TGC ACC ATC GTC AAC CAC
TAC ATC GAG ACA AGC ACG GTC AAC TTC
CGT ACC GAG CCG CAG GAA CCG CAG GAG
TGG ACG GAC GAC CTC GTC CGT CTG CGG
GAG CGC TAT CCC TGG CTC GTC GCC GAG
GTG GAC GGC GAG GTC GCC GGC ATC GCC
TAC GCG GGC CCC TGG AAG GCA CGC AAC
GCC TAC GAC TGG ACG GCC GAG TCG ACC
GTG TAC GTC TCC CCC CGC CAC CAG CGG
ACG GGA CTG GGC TCC ACG CTC TAC ACC
CAC CTG CTG AAG TCC CTG GAG GCA CAG
GGC TTC AAG AGC GTG GTC GCT GTC ATC
GGG CTG CCC AAC GAC CCG AGC GTG CGC
ATG CAC GAG GCG CTC GGA TAT GCC CCC
CGC GGC ATG CTG CGG GCG GCC GGC TTC
AAG CAC GGG AAC TGG CAT GAC GTG GGT
TTC TGG CAG CTG GAC TTC AGC CTG CCG
GTA CCG CCC CGT CCG GTC CTG CCC GTC
ACC GAG ATC


In which N is A or G, or a part of said nucleotide sequence encoding a protein
of sufficient length
to possess phosphinothricin acetyltransferase activity.





62

9. Use according to claim 7, in which said DNA fragment comprises the
nucleotide sequence.


ATG AGC CCA GAA CGA CGC CCG GTC GAG
ATC CGT CCC GCC ACC GCC GCC GAC ATG
GCG GCG GTC TGC GAC ATC GTV AAT CAC
TAC ATC GAG ACG AGC ACG GTC AAC TTC
CGT ACG GAG CCG CAG ACT CCG CAG GAG
TGG ATC GAC GAC CTG GAG CGC CTC CAG
GAC CGC TAC CCC TGG CTC GTC GCC GAG
GTG GAG GGC GTC GTC GCC GGC ATC GCC
TAC GCC GGC CCC TGG AAG GCC CGC AAC
GCC TAC GAC TGG ACC GTC GAG TCG ACG
GTG TAC GTC TCC CAC CGG CAC CAG CGG
CTC GGA CTG GGC TCC ACC CTC TAC ACC
CAC CTG CTG AAG TCC ATG GAG GCC CAG
GGC TTC AAG AGC GTG GTC GCC GTC ATC
GGA CTG CCC AAC GAC CCG AGC GTG CGC
CTG CAC GAG GCG CTC GGA TAC ACC GCG
CGC GGG ACG CTG CGG GCA GCC GGC TAC
AAG CAC GGG GGC TGG CAC GAC GTG GGG
TTC TGG CAG CGC GAC TTC GAG CTG CCG
GCC CCG CCC CGC CCC GTC CGG CCC GTC
ACA CAG ATC


Or a part of said nucleotide sequence encoding a protein of sufficient length
to possess
phosphinothricin acetyltransferase activity.


10. Use according to any one of claims 1 to 9, in which said promoter is
selected from the group
consisting of a 35S promoter of Cauliflower Mosaic Virus, a TR1' promoter, a
TR2' promoter and a
promoter of the gene encoding the Rubisco small subunit.


11. Use according to claim 1, in which said recombinant DNA further comprises
a second DNA encoding
a chloroplast transit peptide between said promoter region and said coding
region.


12. Use according to claim 11, wherein said second DNA encodes the transit
peptide of a precursor of
the small subunit of ribulose-1,5, bisphosphate carboxylase or chlorophyl a/b
binding protein.


13. Use according to claim 1, in which said recombinant DNA further comprises
a 3'untranslated end
including a polyadenylation signal.





63


14. Use according to claim 13, in which said untranslated end is from a T-DNA
gene of an Agrobacterium
tumefaciens.


15. Use according to any one of claim 1 to 14, wherein said plant is
susceptible to transformation by
Agrobacterium.

Note: Descriptions are shown in the official language in which they were submitted.


134953;

This application is a division of Canadian application serial
number 534,044 (Division B) filed on April 7, 1987.

GENETICALLY ENGINEERED PLANT CELLS AND PLANTS EXHIBITING
RESISTANCE TO GLUTAMINE SYNTHETASE INHIBITORS, DNA FRAG-
MENTS AND RECOMBINANTS FOR USE IN THE PRODUCTION OF SAID
CELLS AND PLANTS.
The invention relates to a process for protecting
plant cells and plants against the action of glutamine
synthetase inhibitors.
It also relates to applications of such process,
particularly to the development of herbicide resistance
into determined plants.
It relates further to non-biologically transformed
plant cells and plants displaying resistance to glutamine
synthetase inhibitors as well as to suitable DNA fragments
and recombinants containing nucleotide sequences encoding
resistance to glutamine synthetase inhibitors.
Glutamine synthetase (hereafter simply desiqnated
by GS) constitutes in most plants one of the essential
enzymes for the development and life of plant cells. It is
known that GS converts glutamate into glutamine. GS is
involved in an efficient pathway (the only one known
nowadays) in most plants for the detoxification of ammonia
released by nitrate reduction, aminoacid degradation or
photorespiration. Therefore potent inhibitors of GS are
very toxic to plant cells. A particular class of
herbicides has been developped, based on the toxic effect
due to inhibit inhibition of GS in plants.
These herbicides comprise as active ingredient a
GS inhibitor.
There are at least two possible ways which might
lead to plants resistant to the inhibitors of the action
of glutamine synthetase ; (1) by changing the target. It
can be envisaged that mutations in the GS enzyme can lead
to insensitivity towards the herbicide ; (2) by inactiva-
tion of the herbicide. Breakdown or modification of the
herbicide inside the plant could lead to resistance.


13 4153.~
2
Bialaphos and phosphinothricin (hereafter simply
designated by PPT) are two such inhibitors of the action
of GS, (ref. 16, 17) and have been shown to possess
excellent herbicidal properties (see more particularly
ref. 2 as concerns Bialaphos).
Bialaphos has the following formula (I)
CH3 NH2 ; H3 H3
H0 - 1 P - CH 2 - CH C C H
0 H H H
PPT has the following formula (II)

IH3 NH2
HO - P - CH 2- CH 2- CH .
11 o COOH
Thus the structural difference between PPT and
Bialaphos resides in the absence of two alanine aminoacids
in the case of PPT.
These two herbicides are non selective. They inhi-
bit growth of all the different species of plants present
on the soil, accordingly cause their total destruction.
Bialaphos was first disclosed as having antibiotic
properties, which enabled it to be used as a pesticide or
a fungicide. Bialaphos can be produced according to the
process disclosed in united-states patent n' 3 832 394,
assiqned to MEIJI SEIKA KAISHA LTD. It comprises cultivating

Strentomvices hvaroscopicus, such as the strain available
at the American Type Culture Collection, under the ATCC
number 21,705, and recovering Bialaphos from its culture
medium. However, other strains, such as Strevtomvices
viridochromoaenes, also produce this compound (ref. 1).
Other tripeptide antibiotics which contain a PPT
moiety are or might be discovered in nature as well, e.q.
phosalacin (ref. 15).
PPT is also obtained by chemical synthesis and is
commercially distributed by the industrial Company


13 4 1 5 3 1
3
HOECHST.

A number of Streptomyces species have been disclo-
sed which produce highly-active antibiotics which are
known to incapacitate procaryotic cell functions or enzy-
mes. The Streptomyces species which produce these anti-
biotics would themselves be destroyed if they had not a
self defence mechanism against these antibiotics. This
self defence mechanism has been found in several instances
to comprise an enzyme capable of inhibiting the antibiotic
effect, thus of avoiding autotoxicity for the Streptomyces
species concerned. This modification is generally reversed
when the molecule is exported from the cell.
The existence of a gene which encodes an enzyme
able to modify the antibiotic so as to inhibit the anti-
biotic effect against the host has been demonstrated in
several Streptomyces producing antibiotics, for example,
in S. fradiae, S. azureus, S. vinaceus, S. ervthreus, pro-
ducing neomycin, thiostrepton, viomycin, and MLS (Macro-
lide Lincosamide Streptogramin) antibiotics respectively
(ref. 4), (ref. 5), (ref. 6),(ref.14 by CHATER et al.,
1982 describes standard techniques which can be used for
bringing these effects to light).
In accordance with the present invention, it has
been found that Streptomvices hvaroscopicus ATCC 21,705,
also possesses a gene encoding an enzyme responsible of
the inactivation of the antibiotic properties of
Bialaphos. Experiments carried out by the applicants have
lead to the isolation of such a gene and its use in a
process for controlling the action of GS inhibitors, based
on PPT or derived products.
An object of the invention is to provide a new
process for controlling the action in plant cells and
plants of GS inhibitors.
Another object of the invention is to provide DNA


13 4 1 5 3
1
4
fragments and DNA recombinants, particularly modified
vectors containing said DNA fragments, which DNA fragments
contain nucleotide sequences capable, when incorporated in
plant cells and plants, to protect them against the action
of GS inhibitors.
A further object of the invention is to provide
non-biologically transformed plant cells and plants
capable of neutralizing or inactivating GS inhibitors.
A further object of the invention is to provide a
process for selectively protecting plant species against
herbicides of a GS inhibitor type.
More specifically an object of the invention is
to provide a DNA fragment transferable to plant cells- and
to whole plants- capable of protecting them against the
herbicidal effects of Bialaphos and of structurally
analogous herbicides.
A further object of the invention is to provide
plant cells resistant to the products of the class
examplified by Bialaphos, which products possess the PPT
unit in their structure.
The process according to the invention for
controlling the action in plant cells and plants of a GS
inhibitor when contacted therewith, comprises providing
said plants with a heterologous DNA fragment including a
foreign nucleotide sequence, capable of being expressed
in the form of a protein in said plant cells and plants,
under condition such as to cause said heterologus DNA
fragment to be integrated stably through generations in
the cells of said plants, and wherein said protein has an
enzymatic activity capable of inactivating or neutra-
lization of said glutamine synthetase inhibitor.
A preferred DNA fragment is one derived from an
antibiotic-producing-Streptomyces strain (or a sequence
comprising a nucleotide sequence encoding the same
activity) and which encodes resistance to a said GS


13 4 1 5 3 1
inhibitors.
Preferred nucleotide sequences for use in this
invention encode a protein which has acetyl tranferase
5 activity with respect to said GS inhibitors.
A most preferred DNA fragment according to the
invention comprises a nucleotide sequence coding for a
polypeptide having a PPT acetyl transferase activity.
A particular DNA fragment according to the
invention, for the subsequent transformation of plant
cells, consists of a nucleotide sequence coding for at
least part of a polypeptide having the following sequen-
ce
R SER l'RO GLU
I 83
ARG ARG PRO ALA ASP ILE ARG ARS ALA THR GLU ALA ASP MET PRO
228
ALA VAL CYS THR I LE VAL ASN H I S TYR I LE GLU THR SER THR VAL
273
ASN PHE. ARG THR GLU PRO GLN GLU PRO GLN GLU TRP THR ASP ASP
3L8. . "
LEU VAL ARG LEU AR G GLU ARG TYR PRO TRP LEU VAL ALA GLU VAL
363
ASP GLY GLU :'At. ALA GLY ILE ALA TYR ALA GLY PRO TRP LYS ALA
408 25 AR3 ASN ALA TYR ASP TRP THR ALA GLU SER THR VAL TYR VAL SER

453
PRO ARG HIS GLN AR G THR GLY LEU GLY SER THR LEU TYR THR HIS
498
LEU LEU LYS ScR LEU GLU ALA GLN GLY PHE LYS SER VAL VAL ALA
~~3 =
VA!. ILE GLY LEU PRO ASN ASP PRO SER VAL ARG MET HIS GLU ALA
S38
LEU GLY TYR ALA PRO ARG GLY MET LEU ARG ALA ALA GLY PHE LYS
633
HIS GLY ASN TRP HIS ASP VAL GLY PHE'TRP GLN LEU ASP' PHr5 =SER
678
LEU PRO VAL PRO PRO ARG PRO VAL LEU PRO VAL THR GLU ILE
723


93 4153 ~
6
in which X represents MET or VAL, which part of said po-
lypeptide is of sufficient length to confer protection
against Bialaphos to plant cells, when incorportated
genetically and expressed therein, i.e. as termed
hereafter "plant-protecting capability" against Bialaphos.
A preferred DNA fragment consists of the following
nucleotide sequence
. OTO AGC CCA GAA
183 - = ,
CGA CGC CCG GCC GAC ATC CGC CGT GCC ACC GAG GCG GAC ATO CC
228

GCG GTC TGC ACC ATC GTC AAC CAC TAC ATC GAG ACA AGC ACO 6TC
273

AAC TTC CGT ACC GAG CCG CAG GAA CCG CAG GAG TGG. ACG GAC GAC
318

CTC GTC C~uT CTG CGG GAG CGC TAT CCC TGG CTC GTC GCC GAG GTG
363
~ . . . .
GAC GGC GAG GTL GCC GGC ATC GCC TAC GCG GGC CCC TGG AAG GCA
408

CGC AAC GCC TAC GAC TGG ACG GCC GAG TCG ACC GTG TAC GTC TCC
453
.._, .~_ .
CCC CGC CAC CAG CGG ACG GGA CTG GGC TCC ACG CTC TAC ACC CAC
498

CTG CTG AAG TCC CTG GAG GCA CAG GGC TTC AAG AGC GTG GTC GCT
543

GTC ATC GGG CTG CCC AAC GAC CCG AGC GTG CGC ATS CAC GAG GCG
JS8

CTC GGA TAT GCC CCC CGC GGC ATG CTG CGG GCG GCC GGC TTC AAG
633

CAC GGG AAC TGG CAT GAC GTG GGT TTC TGG CAB CTG GAC TTC AGC
678

CTG CCG GTA CCG CCC CGT CCG GTC CTG CCC GTC ACC GAG ATC
723

or of a part thereof expressing a polypeptide having


1341531
7
plant-protecting capability against Bialaphos.
The invention also relates to any DNA fragment
differing from the preferred one indicated hereabove by
the replacement of any of its nucleotides by others, yet
without modifying the genetic information of the preferred
DNA sequence mentioned hereabove (normally within the
meaning of the universal genetic code), and furthermore to
any equivalent DNA sequence which would encode a poly-
peptide having the same properties,particularly a
Bialaphos-resistance-activity.
It will be understood that the man skilled in the
art should be capable of readily assessing those parts of
the nucleotide sequences that could be removed from either
side of any of the DNA fragments according to the
invention, for instance by removing terminal parts on
either side of said DNA fragment, such as by an
exonucleolytic enzyme, for instance Ba131, by recloninq
the remaining fragment in a suitable plasmid and by
assaying the capacity of the modified plasmid to transform
appropriate cells and to protect it against the Bialaphos
antibiotic or herbicide as disclosed later, whichever
assay is appropriate.
For the easiness of language, these DNA fragments
will be termed hereafter as "Bialaphos-resistance DNA". In
a similar manner, the corresponding polypeptide will be
termed as "Bialaphos-resistance enzyme".
While in the preceding discussion particular
emphasis has been put on DNA fragments capable, when
introduced into plant cells and plants, to confer on them
protection against Bialaphos or PPT, it should be under-
stood that the invention should in no way be deemed as
limited thereto.
In a same manner, the invention pertains to DNA
fragments which, when introduced into such plant cells,
would also confer on them a protection against other GS


13 4 1 5 3 1
8
inhibitors, for instance of intermediate products involved
in the natural biosynthesis of phosphinotricin, such as
the compounds designated by the abbreviations MP101 (III),
MP102 (IV), the formula of which are indicated hereafter
10
20
30


1341531
9
0 NH 2
I
HO- P- CH2 CH2- CH- COOH (III)
I

H ii
I
HO- P- CH2 CH2- CH- CO- Ala- Ala (IV)
I
H
More generally, the invention has opened the route
to the production of DNA fragments which, upon proper
incorporation into plant cells and plants, can protect
them against GS inhibitors when contacted therewith, as
this will be shown in a detailed manner in relation to
Bialaphos and PPT in the examples which will follow.
This having been established, it will be
appreciated that any fragment encoding an enzymatic
activity which would protect plant cells and plants
against said GS inhibitors, by inactivationg, should be
viewed as an equivalent of the preferred fragments which
have been disclosed hereabove. This would apply especially
to any DNA fragments that would result from genetic
screening of the genomic DNAs of strains, particularly of
antibiotic-producing strains, likely to possess genes
which, even- though structurally different, would encode
similar activity with respect to Bialaphos or PPT, or even
with respect to other GS inhibitors. This applies to any
gene in other strains producing a PPT derivative.
Therefore, it should be understood that the
language "Bialaphos-resistance DNA" or "Bialaphos-
resistance enzyme" used thereafter as a matter of
convenience is intended to relate not only to the DNAs and


1341531
enzymes specifically concerned with resistance to PPT or
most directly related derivatives, but more generally with
other DNAs and enzymes which would be capable, under the
5 same circumstances, of inactivating the action in plants
of GS inhibitors.
The invention also relates to DNA recombinants
containing the above defined Bialaphos-resistance DNA
fragments recombined with heterologous DNA, said
10 heterologous DNA containing regulation elements and said
Bialaphos-resistance DNA being under the control of said.
regulation elements in such manner as to be expressible in
a foreign cellular environment compatible with said
regulation elements. Particularly the abovesaid
Bialaphos-resistance-DNA fragments contained in said DNA
recombinants are devoid of any DNA region involved in the
biosynthesis of Bialaphos, when said Bialaphos-resistance-
DNA fragment originate themselves from Bialaphos-producing
strains.
By "heterologous DNA" is meant a DNA of an other
origin than that from which said Bialaphos-resistance-DNA
originated, e.g. is different from that of a Streptomvices
bvaroscopicus or Strentomvices viridochromoaenes or even
more preferably a DNA foreign to Streptomyces DNA.
Particularly said regulation elements are those which are
capable of controlling the transcription and translation
of DNA sequences normally associated with them in said
foreign environment. "Cellular" refers both to micro-
organisms and to cell cultures.
This heterologous DNA may be a bacterial DNA, par-
ticularly when it is desired to produce a large amount of
the recombinant DNA, such as for amplification purposes.
In that respect a preferred heterologous DNA consists of
DNA of E. coli or of DNA compatible with E. coli. It may
be DNA of the same origin as that of the cells concerned
or other DNA, for instance viral or plasmidic DNA known as


1341531
11
capable of replicatinq in the cells concerned.
Preferred recombinant DNA contains heterologous
DNA compatible with plant cells, particularly Ti-plasmid
DNA.
Particularly preferred recombinants are those
which contain GS inhibitor inactivating DNA under the
control of a promoter recognized by plant cells, particu-
larly those plant cells on which inactivation of GS
inhibitors is to be conferred.
Preferred recombinants accordinq to the invention
further relate to modified vectors, particularly plasmids,
containing said GS-inhibitor-inactivating DNA so posi-
tioned with respect to regulation elements, including
particularly promoter elements, that they enable said GS
inhibitor-inactivating DNA to be transcribed and
translated in the cellular environment which is compatible
with said heterologous DNA. Advantageous vectors are those
so engineered as to cause stable incorporation of said GS
inhibitor inactivating DNA in foreign cells, particularly
in their genomic DNA. Preferred modified vectors are those
which enable the stable transformation of plant cells and
which confer to the corresponding cells, the capability of
inactivating GS inhibitors.
It seems that, as described later, the initiation
codon of the Bialaphos-resistance-qene of the Streptomvices
hvaroscovicus strain used herein is a GTG codon. But in
preferred recombinant DNAs or vectors, the Bialaphos-
resistance-gene is modified by substitution of an ATG
initiation codon for the initiation codon GTG, which ATG
enables translation initiation in plant cells.
in the example which follows, the plant promoter
sequence which has been used was constituted by a promoter
of the 35 S cauliflower mosaic virus. Needless to say that
the man skilled in the art will be capable of selecting
other plant promoters, when more appropriate in relation


1341531
12
to the plant species concerned.
According to an other preferred embodiment of the
invention, particularly when it is desired to achieve
transport of the enzyme encoded by the Bialaphos-
resistance-DNA into the chioroplasts, the heterologous DNA
fragment is fused to a gene or DNA fragment encoding a
transit peptide, said last mentioned fragment being then
intercalated between the GS inhibitor inactivating gene
and the plant promoter selected.
As concerns means capable of achieving such cons-
tructions, reference can be made to the following
Eurdpean Patent Office Application no. 85 402556.2,
filed on December 20, 19-85, published August 6, 1986.
Reference can also be made to the scientific li-
terature, particularly to the following articles : I
- VAN DEN BROECK et al., 1985, Nature, 313,
358-363 ;
- SCHREIER and al'., Embo. J., vol. 4, n' 1, 25-32.
For the sake of the record, be it recalled here
that under the expression 'transit peptide', one refers to
a polypeptide fragment which is normally associated with a
chloroplast protein or a chloroplast protein sub-unit in a
precursor protein encoded by plant cell nuclear DNA. The
transit peptide then separates from the chioroplast pro-
tein or is proteolitically removed, during the transloca-
tion process of the latter protein into the chloroplasts.


13 4 1 5 3
1
13
Examples of suitable transit peptides are those associated
with the small subunit of ribulose-1,5 biphosphate (RuBP)
carboxylase or that associated with the chlorophyl a/b
binding proteins.
There is thus provided DNA fragments and DNA
recombinants which are suitable for use in the process
defined hereafter.
More particularly the invention also relates to a
process, which can be generally defined as a process for
producing plants and reproduction material of said plants
including a heterologous genetic material stably
integrated therein and capable of being expressed in said
plants or reproduction material in the form of a protein
capable of inactivating or neutralizing the activity of a
glutamine synthetase-inhibitor, comprising the non
biological steps of producing plants cells or plant tissue
including said heterologous genetic material from starting
plant cells or plant tissue not able to express that
inhibiting or neutralizing activity, regenerating plants
or reproduction material of said plants or both from said
plant cells or plant tissue including said genetic
material and, optionally, biologically replicating said
last mentioned plants or reproduction material or both,
wherein said non-biological steps of producing said plant
cells or plant tissue including said heterologous genetic
material, comprises transforming said starting plant cells
or plant tissue with a DNA-recombinant containing a
nucleotide sequence encoding said protein, as well as the
regulatory elements selected among those which are capable
of enabling the expression of said nucleotide sequence in
said plant cells or plant tissue, and to cause the stable
integration of said nucleotide sequence in said plant
cells and tissue, as well as in the plant and reproduction
material processed therefrom throughout generations.
The invention also relates to the cell cultures


1341531
14
containing Bialaphos-resistance-DNA, or more generally
said GS-inhibitor-inactivating DNA, which cell cultures
have the property of being resistant to a composition
containing a GS inhibitor, when cultured in a medium
containing a such composition at dosages which would be
destructive for non transformed cells.
The invention concerns more particularly those
plant cells or cell cultures in which the
Bialaphos-resistance DNA is stably integrated and which
remains present over successive generations of said plant
cells. Thus the resistance to a GS inhibitor, more
particularly Bialaphos or PPT, can also be considered as
a way of characterizing the plant cells of this invention.
Optionally one may also resort to hybridization
experiments between the genomic DNA obtained from said
plant cells with a probe containing a GS inhibitor
inactivating DNA sequence.
More generally the invention relates to plant
cells, reproduction material, particularly seeds, as well
as plants containing a foreign or heterologous DNA
fragment stably integrated in their respective genomic
DNAs, said fragments being transferred throughout
generations of such plant cells, reproduction material,
seeds and plants, wherein said DNA fragment encodes a
protein inducing a non-variety-specific enzymatic activity
capable of inactivating or neutralizing GS inhibitors,
particularly Bialaphos and PPT, more particularly to
confer on said plant cells, reproduction material, seeds
and plants a corresponding non-variety-specific phenotype
of resistance to GS inhibitors.
"Non-variety-specific" enzymatic activity or
phenotype aims at referring to the fact that they are not
characteristic of specific plant genes or species as this
will be illustrated in a non-limitative way by the
examples which will follow. They are induced in said plant


1341531
materials by essentially non-biological processes
applicable to plants belonging to species normally
unrelated with one another and comprising the incorpora-
5 tion into said plant material of heterologous DNA, e.g.
bacterial DNA or chemically synthesized DNA, which does
not normally occur in said plant material or which
normally cannot be incorporated therein by natural
breeding processes, and which yet confers a common
phenotype (e.g. herbicide resistance) to them.
10 The invention is of particular advantageous use in
processes for protecting field-cultivated plant species
against weeds, which processes comprise the step of
treating the field with an herbicide, e.g. Bialaphos or
PPT in a dosage effective to kill said weeds, wherein the
cultivated plant species then contains in their genome a
DNA fragment encoding a protein having an enzymatic
activity capable of neutralizing or inactivating said GS
inhibitor.
By way of illustration only, effective doses for
use in the abovesaid process range from about 0.4.to about
1.6 kg/Hectare of Bialaphos or PPT.
There follows now a disclosure of how the
preferred DNA fragment described hereabove was isolated
starting from the Streptomvices hvvroscopicus strain
available at the American Type Culture Collection under
deposition number ATCC 21 705, by way of examplification
only.
The following disclosure also provides the techni-
que which can be applied to other strains producing
compounds with a PPT moiety.
The disclosure will then be completed with the
description of the insertion of a preferred DNA fragment
conferring to the transformed cells the capability of
inactivating Bialaphos and PPT. Thus the Bialaphos-
inactivating-DNA fragment designated thereafter by


1341531
16
Bialaphos-resistance gene or "sfr" gene, isolated by the
above described technique into plasmids which can be used
for transforming plant cells and conferring to them a
resistance against Bialaphos, also merely by way of
example for non-limitative illustration purposes.
The following disclosure is made with reference to
the drawings in which :
- fig. 1 is a restriction map of a plasmid contai-
ning a Streptomvices hygroscopicus DNA fragment encoding
Bialaphos-resistance, which plasmid, designated hereafter
as pBG1 has been constructed according to the disclosure
which follows ;
- fig. 2 shows the nucleotide sequence of a smal-
ler fragment obtained from pBG1, subcloned into another
plasmid (pBG39) and containing the resistance gene ;
- fig. 3 shows the construction of a series of
plasmids given by way of example, which plasmids aim at
providing suitable adaptation means for the insertion
therein of the Bialaphos-resistance gene or "sfr" gene ;
- fig. 4A and 4B show the construction of a series
of plasmids given by way of example, which plasmids con-
tain suitable plant cell promoter sequences able to ini-
tiate transcription and expression of the foreign gene
inserted under their control into said plasmids ;
- fig. 5A shows a determined fragment of the nu-
cleotide sequence of the plasmid obtained in figure 3;
- fig. 5B shows the reconstruction of the first
codons of a Bialaphos-resistance gene, from a Foc]I/$qIII
fragment obtained from pBG39 and the substitution of an
ATG initiation codon for the GTG initiation codon of the
natural "sfr" gene ;
- fig. 5C shows the reconstruction of the entire
"sfr" gene, namely the last codons thereof, and its inser-
tion into a plasmid obtained in figures 4A and 4B ;
- fig. 6A shows an expression vector containing


13 4 1 5 3 fi
17
the "sfr' qene placed under the control of a plant cell
promoter ;
- fig. 6B shows another expression vector deriving
from the one shown in fig. 6A, by the substitution of some
nucleotides.
- fiq. 7 shows the construction of a series of
plasmids qiven by way of examples, to ultimately produce
plasmids containing the promoter region and the transit
peptide sequence of a determined plant cell gene, for the
insertion of the "sfr' gene under the control of said pro-
moter region and downstream of said transit peptide se-
quence.
- fig. 8 to 11 will be referred to hereafter.
The following experiment was set up to isolate a
Bialaphos-resistance-gene from S. hvaroscopicus, according
to standard techniques for cloning into Streptomvices.
2.5 uq of S. hvaroscopicus genomic DNA and 0.5 pq
of Streptomvices vector pIJ61 were cleaved with Pstl accor-
dinq to the method described in ref. 6. The vector frag-
ments and genomic fragments were mixed and ligated
(4 hours at 10'C followed by 72 hours at 4'C in ligation
salts which contain 66 mM Tris-HC1 (pH 7.5), 1 mM EDTA,
10 mM MgC12, 10 mM 2-mercaptoethanol and 0.1 mM ATP) at a
total DNA concentration of 40 pg ml1 with T4 DNA ligase.
Ligation products were introduced into 3 x 109 B. lividans
strain 66 protoplasts by a transformation procedure media-
ted by polyethylene-glycol (PEG) as described hereafter.
These protoplasts gave rise to 5 x 107 colonies and
4 x 10 4 pocks after regeneration on 20 plates of R2 agar
containing 0.5 % of Difco yeast extract (R2 YE). Prepara-
tion and composition of the different mediums and buffers
used in the disclosed experiments are described herein-
after. When these lawns were replica-plated on minimal


13 4 1 5 3 1
18
medium plates containing 50 pg ml-1 Bialaphos, drug resis-
tant colonies appeared at a frequency of 1 per 10 4 trans-
formants. After purification of the drug resistant colo-
nies, there plasmid DNA was isolated and used to retrans-
form S. lividans protoplasts. Non selective regeneration
followed by replication to Bialaphos-containing-medium
demonstrated a 100 % correlation between pocks and
Bialaphos resistant growth. The recombinant plasmids of
several resistant clones all contained a 1.7 Kb PstI in-
sert (see fig. 1).
Subcloning of the herbicide resistance gene
The 1.7 Kb PstI insert was then subcloned into the
high copy number streptomycete vector pIJ385 to generate
plasmid pBG20. S. lividans strains which contained pBG20
were more than 500 times more resistant to Bialaphos.
S. lividans growth is normally inhibited in minimal medium
containing 1 ug/ml Bialaphos ; growth of transformants
containing pBG20 was not noticeably inhibited in a medium
containing 500 ug/mi Bialaphos. The PstI fragment was also
subcloned in either orientation into the pstl site of the
plasmid pBR322, to produce plasmids pBG1 and pBG2, accor-
ding to their orientation. A test on minimal M9 medium
demonstrated that E. coli E8767 containing pBG1 or pBG2
was resistant to Bialaphos.
A 1.65 Kb PstI -BamHl fragment was subcloned
from pBG1 into the plasmid pUC19 to produce the plasmid
pBG39, and conferred Bialaphos resistance to E. coli,
W3110, C600 and JM83.
Using an in vitro coupled transcription-
translation system (ref. 5) from B. lividans extracts, the
1,65 Kb PstI - BamHI fragment in pBG39 was shown to direct
the synthesis of a 22 Kd protein. In the following, this
1,65 Kb insert includes a fragment coding for a 22 Kd pro-
tein and will be called "sfr" gene.


1341531
19
Fine mappina and seauencina of the aene
A 625 bp Sau3A fragment was subcloned from pBG39
into pUC19 and still conferred Bialaphos resistance to a
E. coli W3110 host. The resulting clones were pBG93 and
pBG94, according to the orientation.
The orientation of the gene in the ;"3A fragment
was indicated by experiments which have shown that
Bialaphos resistance could be induced with IPTG from the
pUC19 lac promoter in pBG93. In the presence of IPTG
(0.5 mM) the resistance of pBG93/W3110 increased from 5 to
50 Ng/ml on a M9 medium containing Bialaphos. The W3110
host devoid of pBG93, did not grow on M9 medium containing
5pg/ml Bialaphos. These experiments demonstrated that the
Sau3A fragment could be subcloned without loss of activi-
ty. They also provided for the proper orientation as shown
in the fig. 2, enclosed thereafter. The protein encoded by
these clones was detected by using coupled transcription-
translation systems derived from extracts of S. lividans
(ref. 7). Depending on the orientation of the .9AU3A frag-
ment, translation products of different sizes were obser-
ved ; 22 Kd for pBG94 and 28 Kd for pBG93. This indica-
ted that the Iau3A fragment did not contain the entire
resistance gene and that a fusion protein was formed which
included a polypeptide sequence resulting from the trans-
lation of a pUC19 sequence.
In order to obtain large amounts of the protein, a
1.7 Kb PstI fragment from pBG1 was cloned into the high
copy number Streptomycete replicon pIJ385. The obtained
plasmid, pBG20, was used to transform S. hvaroscooicus.
'
Transformants which contained this plasmid had more than
5 times as much PPT acetylating activity and also had
increased amounts of a 22 kd protein on sodium dodecyl-
sulfate gels (SDS gels). Furthermore, both the acetyl
transferase and the 22 kd protein appeared when the pro-
duction of Bialaphos begun. The correlation of the jn


1341531
vitro data, kinetics of synthesis, and amplified expres-
sion associated with pBG20 transformants strongly implied
that this 22 Kd band was the gene product.
The complete nucleotide sequence of the 625 bp
5
5y3A fragment was determined as well as of flanking se-
quences. Computer analysis revealed the presence of an
open reading frame over the entire length of the _$y3A
fragment.
Characterization of the sfr gene product
A series of experiments were performed to deter-
mine that the open reading frame of the "sfr" gene indeed
encoded the Bialaphos resistance enzyme. To determine the
5' end of the resistance gene, the NH 2-terminal sequence
of the enzyme was determined. As concerns more particu-
larly the technique used to determine the said sequence,
reference is made to the technique developed by
J. VANDEKERCKHOVE, Eur. J. Bioc. 1U, p. 9-19, 1985, and
to French patent applications, n' 85 14579 filed on October
lst, 1985 and published April 3, 1987, and no. 85 13046
filed on Se tember 2nd, 1985 and
p published March 6, 1987.
This technique allows the immobilization on glass
fibre sheets coated with the polyquaternary amine commer-
cially available under the registered trademark POLYBRENE
of proteins and of nucleic acids previously separated on a
sodium dodecylsulfate containing polyacrylamide gel. The
transfer is carried out essentially as for the protein
blotting on nitrocellulose membranes (ref. 8). This allows
the determination of amino-acid composition and partial
sequence of the immobilized proteins. The portion of the
sheet carrying the immobilized 22 kd protein produced by
S. hygroscopicus pBG20 was cut out and the disc was
mounted in the reaction chambre of a gas-phase sequenator
to subject the glass-fibre bound 22 Kd protein to the
Edman degradation procedure. The following amino-acid se-
quence was obtained


13415 31
21
Pro-Glu-Arg-Arg-Pro-Ala-Asp-Ile-Arg-Arg
This sequence matched an amino-acid sequence which
was deduced from the open reading frame of the 625 bp
Sau3A fragment. It corresponded to the stretch from codon
3 to codon 12.
Thus, the NH2-terminus of the 22 Kd protein was
upstream of this sequence. It was determined that transla-
tion of the actual protein was likely to be initiated 2
amino-acids earlier at a GTG initiation codon. GTG is
often used as initiator codon in Streptomyces and transla-
ted as methionine. The protein translated from the GTG
initiation codon would be 183 amino-acids long and would
have a molecular weight of 20 550. This was in good agree-
ment with the observed approximate molecular weight of
22 000.
Furthermore, the termination codon, TGA, was lo-
cated just downstream of the ,"3A site. Cloning of the
625 bp 5=3A fragment in aD_&MHI site digested pUC19 did
not result in the reconstruction of the termination codon.
This explained the fusion proteins which were observed in
the in vitro transcription-translation analysis.
Mechanism of PPT-resistance
Having defined a first phenotype and some of the
physical characteristics of the resistance gene and its
gene product, a series of experiments was then carried out
to understand the mechanism by which it confers resistan-
ce. As described hereabove, PPT is the portion of
Bialaphos which inhibits glutamine synthetase (GS) and
that N-acetyl PPT is not an inhibitor. Using a standard
assay (ref. 9), S. hvaroscoaicus ATCC 21 705 derivates
were shown to contain a PPT acetyl transferase which was
not found in S. lividans. The activity does not acetylate
the Bialaphos tripeptide. S. lividans carrying the re-
sistance gene cloned in pBG20 or pBG16 (a plasmid contai-
ning the 625 bp ;A,y3A fragment cloned into another


13 4 1 5 3
1
22
streptomycete vector, pIJ680) also contained the activity
which could acetylate PPT but not Bialaphos. The PPT deri-
ved reaction product produced by extracts of pBG20/
S. lividans was isolated.in order to confirm that it was
indeed acetyl-PPT. Analysis by mass spectroscopy showed
that the molecular weight had increased relative to PPT by
the equivalent of one acetyl group. It was thus concluded
that the 625 bpMW3A fragment contained sequences which
code for PPT acetyl transferase.
The experimental conditions and reagents used in
the techniques disclosed hereabove were as follows :
Preparation and composition of the mediums and buffers
above used
1' P medium : 10.3 g of sucrose, 0.025 g of K2 SO4
0.203 g of MqC12.6H20 and 0.2 ml of a trace element solu-
tion are dissolved in 80 ml of distilled water and auto-
claved. Then in order, 1 ml of KH2PO4 (0.5 %), 10 ml of
CaC121 2H 20 (3.68 %), and 10 ml of TES buffer (0.25 M),
pH : 7.2) are added. Trace element solution (per litre)
ZnC12 , 40 mg ; FeC13 . 6H2 0, 200 mg ; CuC12 . 2H2 0, 10 mg
MnC12.4H20, 10 mg ; Na2B407 . 10H20, 10 mg
(NH4) 6Mo7024 .4H20, 10 mg.
2' R2YE . 10.3 g of sucrose, 0.025 g of K2 S04 ,
1.012 g of MgCl2.6H20, 1 g of glucose, 0.01 g of Difco
casamino acids, and 2.2 g of Difco agar are dissolved in
80 ml distilled water and autoclaved. 0.2 ml of trace
element solution, 1 ml of KH 2P0 4 (0.5 %), 8.02 ml of
CaCl 2.2H 20 (3.68 %), 1.5 ml of L-proline (20 %), 10 ml of
TES buffer (0.25 M) (pH : 7.2), 0.5 ml of (1 M) NaOH, 5 ml
of yeast extract (10 %) are sequentially added.
3' IL : 10 mM TRIS HC1, 1 mM EDTA, pH 8Ø
4' y.EME : Difco yeast extract (0.3 %), Difco pep-
tone (0.5 %), oxoid malt extract (0.3 %), glucose (1
Transformation of S. lividans protoplasts
1. A culture composed of 25 ml YEME, 34 % sucrose, 0.005 M


13 4155 1
23
MqC12r 0.5 % glycine, in a 250 ml baffled flask, is cen-
trifuged during 30 to 36 hours.
2. The pellet is suspended in 10.3 % sucrose and centri-
fuqed. This washing is repeated once.
3. The mycelium is suspended in 4 ml lysozyme solution
(1 mq/ml in P medium with CaC12 and MqC12 concentrations
reduced to 0.0025 M) and incubated at 30'C for 15 to
60 minutes.
4. The solution is mixed by pipetting three times in a
5 ml pipette and incubated for further 15 minutes.
5. P medium (5 ml) is added and mixed by pipetting as in
step 4.
6. The solution is filtered through cotton wool and pro-
toplasts are gently sedimented in a bench centrifuge at
800 x G during 7 minutes.
7. Protoplasts are suspended in 4 ml P medium and centri-
fuged again.
8. Step 7 is repeated and protoplasts are suspended in the
drop of P medium left after pouring off the supernatant
(for transformation).
9. DNA is added in less than 20 N1 TE.
10. 0.5 ml PEG 1 000 solution (2.5 g PEG dissolved in
7.5 ml of 2.5 % sucrose, 0.0014 K2 So4 , 0.1 M CaCl2 , 0.05 M
TRIS-maleic acid, pH 8.0, plus trace elements) is immedia-
tely added and pipetted once to mix the components.
11. After 60 seconds, 5 ml of P medium are added and the
protoplasts are sedimented by gentle centrifugation.
12. The pellet is suspended in P medium (1 ml).
13. 0.1 ml is plated out on R2YE plates (for transforma-
tion dry plates to 85 % of their fresh weigh e. g. in a
laminar flow cabinet).
14. Incubation at 30'C.
A- Construction of a"sfr" gene cassette
A"sfr" gene cassette was constructed to allow
subsequent cloning in plant expression vectors.


1341531
24
Isolation of aZ_9_kI-$qjII fragment from the plas-
mid pBG39 containing a"sfr" gene fragment led to the loss
of the first codons, including the initiation codon, and
of the last codons, including the stop codon.
This fragment of the "sfr" gene could be recons-
tructed in vitro with synthetic oligonucleotides which
encode appropriate amino-acids.
The complementary synthetic oligonucleotides were
5'-CATGAGCCCAGAAC and 3'-TCGGGTCTTGCTGC.
s By using such synthetic oligonucleotides, the 5'
end of the "sfr" gene could be reformed and the GTG ini-
tiation codon substituted for a codon well translated by
plant cells, particularly an ATG codon.
The DNA fragment containing the oligonucleotides
linked to the "sfr" gene was then inserted into an appro-
priate plasmid, which contained a determined nucleotide
sequence thereafter designated by an "adapter" fragment.
This adapter fragment comprised :
- a TGA termination codon which enabled the last
codons of the "sfr" gene to be reformed
- appropriate restriction sites which enabled the
insertion of the fragment of the nucleotide sequence
comprising the "sfr" gene partially reformed with the
synthetic oligonucleotides ; this insertion resulted in
the reconstruction of an intact "sfr" gene ;
- appropriate restriction sites for the isolation
of the entire "sfr" gene.
The "sfr" gene was then inserted into another
plasmid, which contained a suitable plant promoter sequen-
ce. The plant promoter sequence consisted of the cauli-
flower mosaic virus promoter sequence (p35S). Of course
the invention is not limited to the use of this particular
promoter. Other sequences could be chosen as promoters
suitable in plants, for example the TR 1'-2' promoter
region and the promoter fragment of a Rubisco small


1341531
subunit gene from Arabidopsis thaliana hereafter
described.
1' Construction of the plasmid aLK56.2 (fia. 3)
The construction of plasmid pLK56.2 aimed at ob-
5
taining a suitable adaptor including the following sequen-
ce of restriction sites :Ija&I, D=HI, =I, J~RUI, DgIII,
~ii I, ~ia HI, indIlI and I.
The starting plasmids used for this construction,
10 pLK56, pJB64 and pLK33 were those disclosed by BOTTERMAN
(ref. 11).
The DNA fragments hereafter described were iso-
lated and separated from low melting point agarose (LGA).
The plasmid pLK56 was cleaved by the enzymes $MHI
15 and MiO. A NcoI-V-OgI fragment (referred to in the
drawings by arc "a" in broken line) obtained from plasmid
pJB64 was substituted in pLK56 for the BApHI-jLUI fragment
shown at "b". Ligation was possible after filling in the
B42HI and N=I protruding ends with the DNA polymerase I
20 of E. coli (Klenow's fragment).
Particularly recircularization took place by means
of a T4 DNA ligase. A new plasmid pLK56.3 was obtained.
This plasmid was cleaved by the enzymes XbaI and
~I.
The ag~HI-plll fragment of pLK33 (c) (on fig. 3)
was substituted for the XbAI-ELtI fragment (d) of pLK56.3,
after repairing of their respective ends by Kienow's
fragment.
After recircularization by means of the T4 DNA
ligase, the obtained plasmid pLK56.2 contained a nucleo-
tide sequence which comprised the necessary restriction
sites for the subsequent insertion of the "sfr" gene.
2' Construction of the vlasmid pGSH150 (fic. 4A)
Parallel with the last discussed construction,


1341531
26
there was produced a plasmid containing a promoter sequen-
ce recognized by the polymerases of plant cells and inclu-
ding suitable restriction sites, downstream of said promo-
ter sequence in the direction of transcription, which
restriction sites are then intented to enable the accomo-
dation of the "sfr" gene then obtainable from pLK56.2,
under the control of said plant promoter.
Plasmid pGV825 is described in DEBLAERE et al.
(ref. 10). Plasmid pJB63 is from BOTTERMAN (ref. 11).
pGV825 was linearized with PvuII and recircula-
rized by the T4 DNA ligase, resulting in the deletion of
an internal viII fragment shown at (e), (plasmid pGV956).
pGV956 was then cleaved by RMHI and $gIII.
The BamHI-BgIII fragment (f) obtained from pJB63
was dephosphorylated with calf intestine phosphatase (CIP)
and substituted for the BMHI-BUII fragment of pGV956.
Plasmid pGV1500 was obtained after recirculariza-
tion by means of T4 DNA ligase.
An ~cQRI-HindIII fragment obtained from plasmid
pGSH50 was purified. The latter plasmid carried the dual
TR 1'-2' promoter fragment described in VELTEN et al.,
(ref.13). This fragment was inserted in pGV1500, digested
with RpAI and HindIII and yielded pGSH150.
This plasmid contains the promoter fragment in
front of the 3' end of the T-DNA transcript 7 and aDjLMHI
and g"I sites for cloning.
3' Construction of the vlasmid pGSJ260 (fia. 4B)
CP3 is a plasmid derived from pBR322 and which
contains the 35S promoter region of cauliflower mosaic
virus within a DamHI fragment.
pGSH 150 was cut by $AMHI and ,@_qLII I.
The B&MHI-DqJII fragment (h) of CP3, which con-
tained the nucleotide sequence of p35S promoter, was
substituted for the BAMHI-B_qJII fragment (i) in pGSH150 to
form plasmid pGSJ250. pGSJ250 was then opened at its $qlII


1341531
27
restriction site.
A BamHI fragment obtained from mGV2 (ref. 12) was
inserted in pGSJ250 at the gqj<II site to form plasmid
pGSJ260.
However prior to inserting the "sfr" gene obtai-
nable from pLK56.2 into plasmid pGSJ260, it was still de-
sirable to further modify the first in order to permit
insertion in a more practical manner. Thus pLK56.2 was
further modified as discussed below to yield pGSR1.
Starting from plasmid pGSJ260, two plasmid cons-
tructions for subsequent transformations of plant cells
were made :
- a first plasmid permitting the expression of the
"sfr" gene in the cytoplasm of plant cells, and
- a second plasmid so modified as to achieve
transport of the Bialaphos-resistance enzymes to the chlo-
roplasts of plant cells.
First case : nlasmid enablina the expression of the "sfr"
aeUe in the cvtovlasm of plant cells
c'7onina of the sfr aene cassette in a plant expression
vector (nGSR2) (fia. 5)
On figure 5A, the nucleotide sequence of the adap-
ter of pLK56.2 is shown. In particular, the locations of
D4AHI, =I, $qjII restriction sites are shown.
This adapter fragment was cleaved by the enzymes
=I and $qIII.
Figure 5B shows the FQ$I-gglII fragment (j) obtai-
ned from pBG39. The locations of these two restriction
sites are shown on figure 2.
Using synthetic oligonucleotides, the first codons
of the "sfr" gene were reformed, particularly the 5' end
of the gene in which a ATG initiation codon was substitu-
ted for the initial GTG codon.
This FQ$I-DAIII fragment completed with the syn-
thetic oligonucleotides was then substituted in pLK56.2


1341531
28
for the fi=I-B-qjII fragment of the adapter. The 3' end of
the gene was thus reformed too, after recircularization
with T4 DNA ligased. The plasmid obtained, pGSR1, thus
contained the entire "sfr" gene inserted in its adapter.
The plasmid pGSJ260 was then opened by ~ja HI
(fig. 5C) and the ~a,mHI fragment obtained from pGSR1,
which contained the entire "sfr" gene, was inserted into
pGSJ260.
The obtained plasmid, pGSR2 (see fig. 6A)
contained a pBR322 replicon, a bacterial streptomycin
resistance gene (SDM-SP-AD-transferase) and an engineered
T-DNA consisting of :
- the border fragments of the T-DNA
- a chimeric kanamycin gene which provided a domi-
nant selectable marker in plant cells ; and
- a chimeric "sfr" gene.
The chimeric "sfr" gene consisting of
- the promoter region of the cauliflower mosaic
virus (p35S) ;
- the "sfr" gene cassette as described in fig. 5
- the 3' untranslated region, including the poly-
adenylation signal of T-DNA transcript 7.
pGSR2 was introduced into Aarobacterium
tumefaciens recipient C58C1RifR (pGV2260) according to the
procedure described by DEBLAERE et al. (ref. 10).
This strain was used to introduce the chimeric
"sfr" gene in N. tabacum SR1 plants.
Two variant plasmids deriving from pGSR2, namely
pGSFR280 and pGSFR281, have been constructed. They differ
in the untranslated sequence following the transcription
initiation site. In pGSR2, this fragment consists of the
following sequence :
GAGGACACGCTGAAATCACCAGTCTCGGATCCAM
while it consists of
GAGGACACGCTGAAATCACCAGTCTCTCTACAAATCGATCCAM


1341531
29
in pGSR280 and of
GAGGACACGCTGAAATCACCAGTCTCTCTACAAATCGAZQ
in pGSFR281, with an ATG codon being the initiation codon
of the "sfr" gene. The "sfr" gene is also fused to the
TR1'-2' promoter in the plasmid pGSH150 (fig. 4A) yielding
pGSFR160 and pGSFR161 (fig. 6B). These plasmids contain
slight differences in the pTR2 "sfr" gene configuration :
the "sfr" gene is correctly fused to the endogenous gene
2' ATG in pGSFR161 (for sequences see ref. 13), whereas 4
extra base pairs (ATCC) are present just ahead of the ATG
codon in pGSFR160. Otherwise, plasmids p65FR161 and
p65FR160 are completely identical.
All plasmids are introduced in Agrobacterium by
cointegration in the acceptor plamids pGV2260 yielding the
respective plasmids pGSFR1280, pGSFR1281, pGSFR1160 and
pGSFR1161.
Second case construction of a vlasmid containing the
"sfr" gene downstream of a DNA seauence encoding a transit
peptide and suitable for achieving subseauent transloca-
tion of the "sfr" gene expression product into plant-cell-
chloroplasts
In another set of experiments, the nucleotide
sequence which contained the "sfr" gene was fused to a DNA
sequence encoding a transit peptide so as to enable its
transport into chloroplasts.
A fragment of the "sfr" gene was isolated from the
adapter fragment above described and fused to a transit
peptide. With synthetic oligonucleotides, the entire "sfr"
gene was reconstructed and fused to a transit peptide.
The plasmid (plasmid pATS3 mentioned below) which
contained the nucleotide sequence encoding the transit
peptide comprised also the promoter sequence thereof.
Construction of the plasmid nGSg4 which contains the "sfr"
ene fused to a DNA seauence encoding transit nentide
cr (fia. 7)


1341531
Plasmid pLK57 is from BOTTERMAN, (ref.11). Plasmid
pATS3 is a pUC19 clone which contains a 2 Kb EcoRI genomic
DNA fragment from Arabidopsis thaliana comprising the pro-
5 moter region and the transit peptide nucleotide sequence
of the gene, the expression thereof is the small subunit
of ribulose biphosphate carboxylase (ssu). The A. thaliana
small subunit was isolated as a 1 500 bp = RI-jRhI frag-
ment. The cleavage site exactly occurs at the site
where the coding region of the mature ssu protein starts.
Plasmids pLK57 and pATS3 were opened with Eg2RI
and qj2hI. After recircularization by means of the T4 DNA
ligase, a recombinant plasmid pLKAB1 containing the se-
quence encoding the transit peptide (Tp) and its promoter
region (Pssu) was obtained.
In order to correctly fuse the "sfr" gene at the
cleavage site of the signal peptide, the N-terminal gene
sequence was first modified. Since it was observed that
N-terminal gene fusions with the "sfr" gene retain their
enzymatic activity, the second codon (AGC) was modified to
a GAC, yielding an M=I site overlapping with the ATG
initiator site. A new plasmid, pGSSFR2 was obtained. It
only differs from pGSR1 (fig. 5B), by that mutation. The
H=I-$AMHI fragment obtained from pGSFR2 was fused at the
j2hI end of the transit peptide sequence. In parallel, the
"sfr" gene fragment was fused correctly to the ATG initia-
tor of the ssu gene (not shown in figures).
Introduction of the "sfr" cene into a different plant
saecies
The Bialaphos-resistance induced in plants by the
expression of chimeric genes, when the latter have been
transformed with appropriate vectors containing said
chimeric genes, has been demonstrated as follows. The
recombinant plasmids containing the "sfr" gene were intro-
duced separately by mobilization into Acrobacterium strain
C58C1 RifR (pGV2260) according to the
procedure described


1341531
31
by DEBLAERE and al., Nucl. Acid. Res., 13, p. 1 477, 1985.
Recombinant strains containing hybrid Ti plasmides were
formed. These strains were used to infect and transform
leaf discs of different plant species, according to a
method essentially as described by HORSH and al., 1985,
Science, vol. 227. Transformation procedure of these
different plant species given by way of example, is
described thereafter.

15
25
35


13 4153 1
32
1. Leaf disc transformation of Hicotiana tabacum
Used Media are described thereafter
A1 MS salt/2 + 1% sucrose
0.8 % agar
pH 5.7

A10 B5-medium + 250 mg/1 NH4N03
750 mg/1 CaC12 2H2O
0.5 g/l 2-(N-Morpholino)ethane-
sulfonic acid (MES) pH 5.7
30 g/l sucrose
A 11 B5-medium + 250 mg/l NH4NO3
0.5 g/l MES pH 5.7
2 % glucose
0.8 % agar
40 mg/l adenine

+ 1 mg/1 6-Benzylaminopurine
(BAP)
0.1 mg/1 Indole-3-acetic acid
(IAA)
500 mg/1 Claforan
A 12 B5-medium + 250 mg/1 NH4NO3
0.5 g/l MES pH 5.7
2 % glucose
0.8 % agar
40 mg/1 adenine

+ I mg/1 BAP
200 mg/1 claforan


13 4153 1
33
A 13 MS-salt/2 + 3 % sucrose
0.5 MES g/1 pH 5.7
0.7 % agar
200 mg/1 claforan

Bacterial medium = min A:(Miller 1972) 60 mM
K2HP04, 3H20,
33 mM KH2PO4 ; 7.5 mM (NH4 )2S04
1.7 M trinatriumcitrat; 1 mM
MgSO4
2 g/l glucose ; 50 mg/1 vita-
mine B1

- Plant material
Nicotiana tabacum cv. Petit Havana SR1
Plants are used 6 to 8 weeks after subculture on
medium A1
- Infection
- midribs and edges are removed from leaves.
- Remaining parts are cut into segments of about
0.25 cm2 and are placed in the infection medium A10 (about
12 segments in a 9 cm Petri dish containing 10 ml A10).
- Segments are then infected with 25 N1 per Petri
dish of a late log culture of the Agrobacterium strain
grown in min A medium.
- Petri dish are incubated for 2 to 3 days at low
light intensity.
- After 2 to 3 days medium is removed and replaced
by 20 ml of medium A1O containing 500 mg/1 clarofan.
_ Selection and shoot induction
- The leaf discs are placed on medium A11 contain-
ing a selective agent :
100 mg/1 kanamycin and
10 to 100 mq/1 phosphinotricin.


13 4 1 5 3 1
34
- Leaf discs are transferred to fresh medium week-
ly.
- After 3 to 4 weeks regenating calli arise. They
are sepa rated and placed on medium A12 with the same con-
centration of selective agent as used for the selection.
- Rooting
- After 2 to 3 weeks the calli are covered with
shoots, which can be isolated and transferred to rooting
medium A13 (without selection).
- Rooting takes 1 to 2 weeks.
- After a few more weeks, these plants are
propagated on medium A1.

2. Tuber disc infection of Solanum tuberosum (potato)

Used media are described thereafter
C1 B5-medium + 250 mg/ 1 NH4NO3
300 mg/ l( CaCH 2PO4) 2
0.5 g/1 MES pH 5.7
0.5 g/l polyvinylpyrroli-
done (PVP)
40 g/l mannitol (=0.22M)
0.8 % agar
40 mg/1 adenine
C2 B5-medium + 250 mg/1 NH4NO3
400 mg/1 glutamine
0.5 g/1 MES pH 5.7
0.5 g/1 PVP
g/l mannitol
40 mg/1 adenine
0.8 % agar



1341531
+ 0.5 mg/1 transzeatine
0.1 mg/1 IAA
500 mg/1 clarofan
5
C5 MS salt/2 + 3 % sucrose
0.7 % agar
pH 5.7

10 C7 B5-medium + 250 mg/1 NH4NO3
400 mg/i glutamine
0.5 g/1 MES pH 5.7
0.5 g/l PVP
20 g/l mannitol
20 g/l glucose
15 40 mg/1 adenine
0.6 % agarose

+ 0.5 mg/i transzeatine
0.1 mg/1 IAA
20 500 mg/1 clarofan
C8 B5-medium + 250 mg/1 NH4NO3
400 mg/1 glutamine
0.5 g/1 MES pH 5.7
25 0.5 g/1 PVP
20 g/l mannitol
20 g/1 glucose
mg/1 adenine
0.6 % agarose

+ 200 mg/1 clarofan
I mg/1 transzeatine


1341531
36
C 9 B5-medium + 250 mg/ 1 NH4 NO3
400 mg/1 glutamine
0.5 g/l MES pH 5.7
0.5 g/l PVP
20 g/l mannitol
20 g/1 glucose
40 mg/1 adenine
0.6 % agarose
+ 1 mg/1 transzeatine
0.01 mg/1 Gibberellic acid A3
(GA 3)
100 mg/1 clarofan
C 11 MS salt/2 + 6 s sucrose
0.7 % agar

Bacterial medium = min A : (Miller 1972 60 mM K2HP04.3H20;
33 mM KH2P04; 7.5 mM (NH4)2S04;
1.7 trinatriumcitrat; 1 mM
MgSO4 ;
2 g/1 glucose; 50 mg/1 vitami-
ne B1.
- PLant material
Tubers of Solanum tuberosum c.v Berolina
c.v D6sir&e
- Infection
- Potatoes are peeled and washed with water.
- Then they are washed with concentrated commer-
cial bleach for 20 minutes, and
- rinsed 3 to 5 times with sterile water.
- The outer layer is removed (1 to 1.5 cm)
- The central part is cut into discs of about 1
cm2 and 2 to 3 mm thick.
- Discs are placed on medium C1 (4 pieces in a 9


~341531
37
cm Petri dish).
- 10 m1 of a late log culture of an Agrobacterium
strain grown in min A medium is applied on each disc.
- Discs are incubated for 2 days at low light
intensity.
- Selection and shoot induction
- Discs are dried on a filter paper and transfer-
red to medium C2 with 100 mg/i kanamycin.
- After one month small calli are removed from the
discs and transferred to medium C7 containing 50 mg/1
kanamycin.
- After a few more weeks, the calli are transfer-
red to medium C8 containing 50 mg/1 kanamycin.
- If little shoots start to develop, the calli are
transferred to elongation medium C9 containing 50 mg/1
Kanamycin.
- Rooting
- Elongated shoots are separated and transferred
to rooting medium C11.
- Rooted shoots are propagated on medium C5.
3. Leaf disc infection of Lvcorersicum esculentum (tomato)
Used media are described thereafter
A1 MS salt/2 + 1 % sucrose
0.8 % agar
pH 5.7

B 1 B5-medium + 250 mg/1 NH4NO3
0.5 g/1 MES pH 5.7
0.5 g/1 PVP
300 mg/1 Ca (H2P04 )2
2 % glucose
mg/1 adenine
40 g/1 mannitol


1341531
38
B 2 B5-medium + 250 mg/1 NH4NO3
0.5 g/l MES pH 5.7
0.5 g/1 PVP
400 mg/1 glutamine
2 % glucose
0.6 % agarose
40 mg/1 adenine
40 g/1 mannitol

+ 0.5 mg/1 transzeatine
0.01 mg/1 IAA
500 mg/1 claforan
B 3 B5-medium + 250 mg/1 NH4NO3
0.5 g/i MES pH 5.7
0.5 g/l PVP
400 mg/i glutamine
2 % glucose
0.6 % agarose
40 mg/1 adenine
g/l mannitol

+ 0.5 mg/1 transzeatine
0.01 mg/1 IAA
500 mg/1 clarofan
B 4 B5-medium + 250 mg/ 1 NH4NO3
0.5 g/1 MES pH 5.7
0.5 g/1 PVP
400 mg/1 glutamine
2 % glucose
0.6 % agarose
mg/1 adenine
20 g/1 mannitol


1341531
39
+ 0.5 mg/1 transzeatine
0.01 mg/1 IAA
500 mg/1 clarofan
B 5 B5-medium + 250 mg/1 NH4 N03
0.5 g/1 MES pH 5.7
0.5 g/l PVP
400 mg/1 glutamine
2 % glucose
0.6 % agarose
40 mg/1 adenine
10 g/l mannitol

+ 0.5 mg/1 transzeatine
0.01 mg/1 IAA
500 mg/1 clarofan
B6 B5-medium + 250 mg/1 NH4NO3
0.5 g/l MES pH 5.7
0.5 g/l PVP
400 mg/1 glutamine
2 % glucose
0.6 % agarose
40 mg/1 adenine

+ 0.5 mg/1 transzeatine
0.01 mg/1 IAA
200 mg/1 clarofan
B7 B5-medium + 250 mg/1 NH4NO3
0.5 g/l MES pH 5.7
0.5 g/1 PVP
400 mg/1 glutamine
2 % glucose
0.6 % agarose


1341531
40 mg/1 adenine

+ 1 mg/1 transzeatine
200 mg/1 clarofan
5

B8 MS salt/2 + 2 % sucrose
0.5 g/l MES pH 5.7
0.7 % agar

10 B9 B5-medium + 250 mg/1 NH4NO3
0.5 g/1 MES pH 5.7
0.5 g/l PVP
2 % glucose
0.6 % agarose
15 40 mg/1 adenine

+ 1 mg/1 transzeatine
0.01 mg/1 GA3

20 Bacterial medium = min A:(Miller 1972) 60 mM
K2 HP04 .3H20 ;
33 mM KH2P04; 7.5 mM (NH4 )2S04 ;
1.7 N trinatriumcitrat; 1 mM
MqSO4 ;
25 2 g/l glucose; 50 mg/1 vitami-
ne B1
- Plant material
;,vcopersicum esculentum cv. Lucullus.
30 Plants are used 6 weeks after subculture on medium A1.
- Infection
- Midrib is removed from the leaves.
- Leaves are cut in segments of about 0.25 to 1
cm 2(the edges of the leaves are not wounded, so that only
maximum 3 sides of the leaf pieces is wounded).
35 - Segments are placed in infection medium B1


1341531
41
(upside down), about 10 segments in a 9 cm Petri dish.
- Segments are then infected wiht 20 ul per Petri
dish of a late log culture of the Agrobacterium strain
grown in min A medium.
- Petri dishes incubate for 2 days at low light
intensity.
- Medium is removed after 2 days and replaced by
20 ml of medium B1 containing 500 mg/1 clarofan.
- Selection and shoot induction
- The leaf discs are placed in medium B2 + 50 or
100 mg/1 kanamycin.
- Each 5 days the osmotic pressure of the medium
is lowered by decreasing the mannitol concentration,
transfers are done consecutively in medium B3, B4' B5'
and B 6.
- After one month calli with meristems are separa-
ted from the leaf discs and placed on medium B7 with 50 or
100 mg/1 kanamycin.
- Once little shoots have formed, calli are
transferred to elongation medium B9 with 50 or 100 mg/1
kanamycin.
- Rooting
- Elongated shoots are separated and transferred
to medium B8 for rooting.
- Plants are propagated on medium A1.
Greenhouse tests for herbicide resistance
Material and method
In this experiment, two herbicides comprising
phosphinotricin as active ingredient, are used.
These compounds are those commercially available
under the registered trademarks BASTA R and MEIJI
HERBIACER.
These products are diluted to 2 % with tap water.
Spraying is carried out on a square metre area from the


1341531
42
four corners. Temperature of the greenhouse is about 22'C
for tobaccos and tomato, and above 10'C to 15'C for
potato.

Results
- Tobacco spraytest
a) Nicotiana tabacum cv. Petit Havana SR1
plants transformed with the chimeric "sfr" genes as
present in pGSFR1161 or pGSFR1281, as well as unstrans-
formed control plants (from 10 cm to 50 cm high) are
treated with 20 1 BASTAR/ha. Control SR1 plants die after
6 days, while transformed plants are fully resistant to 20
1 BASTAR/ha and continue growing undistinguishable from
untreated plants. No visible damage is detected, also the
treatment is repeated every two weeks. The treatment has
no effect in subsequent flowering. The recommended dose oF
BASTAR herbicide in agriculture is 2.5-7.5 1/ha.
b) A similar experiment is performed using 8
1/ha MEIJI HERBIACER. The transformed plants (the same as
above) are fully resistant and continue
growing undistin-
guishable from untreated plants. No visible damage is
detectable.
- Potato spraytest
Untransformed and transformed potato plants
(Solanum tuberosum cv. Berolina) (20 cm high) with the
chimeric "sfr" gene as present in pGSFR1161 or pGSFR1281
are treated with 20 1 BASTAR/ha. Control plants die after
6 days while the transformed plants do not show any
visible damage. They grow undistiguishable from untreated
plants.
- tomato spraytest
Untransformed and transformed tomato plants
(lvcopersium esculentum c.v. luculus) (25 cm high) with
the chimeric "sfr" gene as present in pGSFR1161 and
pGSFR1281 are treated with 20 1 BASTAR/ha. control plants


1341531
43
die after six days while transformed plants are fully
resistant. They do not show any visible damage and grow
undistiguishable from untreated plants.
- Growth control of phytopathogenic fungi with
transformed plants
In another set of experiments, potato plants ex-
pressing chimeric "sfr" genes as present in pGSFR1161 or
pGSFR1281 are grown in a greenhouse compartment at 20'C
under high humidity. Plants are innoculated by spraying 1
ml of a suspension of 106 Phvtophtora infestans spores per
ml. Plants grow in growth chambers (20'c, 95 % humidity, 4
000 lux) until fungal disease symptoms are visible (one
week). One set of the plants are at that moment sprayed
with Bialaphos at a dose of 8 1/ha. Two weeks later,
untreated plants are completely ingested by the fungus.
The growth of the fungus is stopped on the Bialaphos
treated plants and no further disease symptoms evolve. The
plants are effectively protected by the fungicide action
of Bialaphos.
- Transmission of the PPT resistance through seeds
Transformed tobacco plants expressing the chimeric
"sfr" gene present in pGSFR1161 and pGSFR1281 are brought
to flowering in the greenhouse. They show a normal
fertility.
About 500 Fl seeds of each plant are sown in soil,
Fl designating seeds of the first generation, i.e directly
issued from the originally transformed plants. When
seedlinqs are 2-3 cm high, they are sprayed with 8 1
BASTAR/ha. 7 days later, healthy and damaged plants can be
distinguished in a ratio of approximately 3 to 1. this
shows that PPT resistance is inherited as a dominant
marker encoded by a single locus.
10 resistant Fl seedlings are grown to maturity
and seeds are harvested. F2 seedlings are grown as
described above and tested for PPT-resistance by spraying


134153 1
44
BASTAR at a dose of 8 1/ha. Some of the Fl plants produce
F2 seedlings which are all PPT-resistant showing that
these plants are homozygous for the resistance gene.The
invention also concerns plant cells and plants non-
essentially-biologically-transformed with a GS inhibitor-
inactivatinq-qene according to the invention.
In a preferred embodiment of the invention, plant
cells and plants are non-biologically-transformed with the
"sfr" gene hereabove described.
Such plant cells and plants possess, stably
integrated in their genome, a non-variety-specific
character which render them able to produce detectable
amounts of phosphinotricin-acetyl transferase.
This character confers to the transformed plant
cells and plants a non-variety-specific enzymatic activity
capable of inactivating or neutralizing GS inhibitors like
Bialaphos and PPT.
Accordingly, plant cells and plants transformed
according to the invention are rendered resistant against
the herbicidal effects of Bialaphos and related compounds.
Since Bialaphos was first described as a
fungicide, transformed plants can also be protected
against fungal diseases by spraying with the compound
several times.
In a preferred embodiment, Bialaphos or related
compounds is applied several times, particularly at time
intervals of about 20 to 100 days.
The invention also concerns a new process for
selectively protecting a plant species against fungal
diseases and selectively destroying weeds in a field
comprising the steps of treating a field with an
herbicide, wherein the plant species contain in their
genome a DNA fragment encoding a protein having an
enzymatic activity capable of neutralizing or inactivating
GS inhibitors and wherein the used herbicide comprises as


13 4 1 5 3 1
active ingredient a GS inhibitor.
It comes without saying that the process according
to the invention can be employed with the same efficiency,
5 either to only destroy weeds in a field, if plants are not
infected with fungi , either to only stop the development
of fungi if the latter appears after destruction of weeds.
In a preferred embodiment of the process according
to the invention, plant species are transformed with a DNA
10 fragment comprising the "sfr" gene as described hereabove,
and the used herbicide is PPT or a related compound.
Accordingly, a solution of PPT or related compound
is applied over the field, for example by spraying,
several times after emergence of the plant species to be
15 cultivated, until early and late germinating weeds are
destroyed.
It is quite evident that before emergence of
plant species to be cultivated, the field can be treated
with an herbicidal composition to destroy weeds.
20 On the same hand, fields can be treated even
before the plant species to be cultivated are sowed.
Before emergence of the desired plant species,
fields can be treated with any available herbicide,
including Bialaphos-type herbicides.
25 After, emergence of the desired plant species,
Bialaphos or related compound is applied several times.
In a preferred embodiment, the herbicide is
applied at time intervals of about from 20 to 100 days.
Since plants to be cultivated are transformed in
30 such a way as to resist to the herbicidal effects of
Bialaphos-type herbicides, fields can be treated even
after emergence of the cultivated plants.
This is particularly useful to totally destroy
early and late germinating weeds, without any effect on
the plants to be produced.
Preferably, Bialaphos or related compoud is


13 4 1 5 3 1
46
applied at a dose ranging from about 0.4 to about 1.6
kg/ha, and diluted in a liquid carrier at a concentration
such as to enable its application to the field at a rate
ranging from about 2 to about 8 1/ha.
There follows examples, given by way of illustra-
tion, of some embodiments of the process with different
plant species.
- SuQarbeets
The North European sugarbeet is planted from March
up to April 15, depending upon the weather condition
and more precisely on the precipitation and average
temperature. the weeds problems are more or less the same
in each country and can cause difficulties until the crop
15 closes its canopy around mid-July.
Weed problems can be separated in three situa-
tions :
- early germination of the grassy weeds,
- early germinating broadleaved weeds,
- late germinating broadleaved weeds.
Up to now, pre-emergence herbicides have been
succesfully used. Such compounds are for example those
commercially available under the registered trademarks :
PYRAMINR, GOLTIx- and VENZARR. However, the susceptibility
to dry weather conditions of these products as well as the
lack of residual activity to control late germinating
weeds have led'the farmer to use post-emergence products
in addition to pre-emergence ones.
Table (I) thereafter indicates the active ingre-
dients contained in the herbicidal compositions cited in
the following examples.



13 4 1 5 3 1
47
TABLE (I)

Commercial Name Active Ingredient Formulation
AVADEX R Diallate EC 400 g/l
AVADEX BW R Triallate EC 400 g/l
GOLTIXR Metamitron WP 70 %
RONEET R Cycloate EC 718 g/l
TRAMAT R Ethofumerate EC 200 g/1
FERVINAL R Alloxydime-sodium SP 75 %
BASTAR Phosphinotricin 200 g/l
PYRAMIN FL R Chloridazon SC 430 g/l

According to the invention, post-emergence
herbicides consist of Bialaphos or related compounds,
which offer a good level of growth control of annual
grasses (Bromus, Avena spp., Alonecurus, POA) and
broadleaves (Galium, Polvaonum, Senecio, Solanum,
Mercurialis).
Post-emergence herbicides can be applied at
different moments of the growth of sugarbeet ; at a
cotyledon level, two-leave level or at a four-leave level.
Table (II) thereafter represents possible systems
of field-treatment, given by way of example.
In those examples, the post-emergence herbicide of
the class of Bialaphos used is BASTAR, in combination with
different pre-emergence herbicides. Concentrations are
indicated in 1/ha or kg/ha.

35


~''~ W N N
~ p ~ ~
Ln o Ln
TABLE (lI)
('OSS1IiI F. WFIAIrUNIRUI. SYSlIF1S 1N SUGARIIrrfS, UIISCI) ON TIIC USE OF
UASTAR ~ I'ROVIDING BEETS ARE MADE
RESISTnIII AGA1NSr =1IlC I.AI1ER ci1ChlICAL (in 1L or kg/ha).

.I're-sowincl i're-eu;rclence Colyle(lgns Two-leaves Four leaves

= ,
1. AVAI)IiXit - BAS1'AR BASTAR/ tramat -

3.5 It 3 it 3 It 1.5 It 2. AVAI)EXK (:OL'I'IXR - - -

3.5 1t /i kg
3 RONEI=7'It C01.'1'IXR - - - o0
4 It 5 kg

4. RONEIiTIt G()i.'l' I XK - BAS7'AR -
4 It 2.5 kg 3 lt

5. TRAMA'I'It - - BASTAR BASTAR/GOLTIXR
It 3 It 2 It 2 kg
6. - GOI.TIXR - BASTAR -
2.'- k3 It

7. - - IfAS'I'A /t rainat - BASTAK/GOL'I'IXR
W
3 It 1.7 lt 3 It 2 kg
. -~-
8= PYKAMINIt - I3AS'I'AR Venzar - ~
6 It 3 It I kg ~
9. - - IIAS'rAlt ItASTAR/c;OI.'rl xR - w
3 It 3 It 2 kg
...s
10. DIALI.A'I'liR PYRAMINR -
3.5 il 6 It BAS'fAR/Metamitron
3 It I kg
.. ~


1341531
49
- Potatoes
Potatoes are grown in Europe on about 8.106 Ha.
The major products used for weed control are
Linuron/monolinuron or the compound commercially available
under the denomination METRABUZIN
These products perform well against most
weedspecies.
However, weeds such as Galium and Solanum plus
late germinating Chenopodium and Polvaonum are not always
effectively controlled, while control of the annual
grasses is also sometime erratic.
Once again, late germinating broadleaved weeds are
only controllable by post-emergence applications of
herbicides such as BASTAR.
Table (III) thereafter represents some examples
given by way of example of field-treatment in the case of
potatoes.

TABLE (III)

Weeds control systems in potatoes, based on the use of
BASTAR, providing potatoes are rendered resistant to
BASTAR


Linuron + monolinuron (375 g + 375 g/ha) *prior to emergen-
ce
BASTAR 3-4 lt/ha after emergence (5-15 cm)
BASTAR/fluazifop-butyl 3-4 lt/ha + 2 it/ha after emergence
(5-15 cm)

Linuron WP 50 % (AFALONR)
Monolinuron WP 47.5 % (ARESSIN R)
fluazifop-butyl EL 250 g/1 (FUSILADER)
The strains pGSJ260 and pBG39 used hereabove have


1341531
been deposited on December 12nd, 1985, at the "German
Collection of Micro-organisms" (DEUTSCHE SAMMLUNG VON
MIKROORGANISMEN) at Gottingen, Germany. They received the
5 deposition numbers DSM 3 606 and DSM 3 607 respectively.
Further embodiments of the invention are described
hereafter with reference to the figures in which :
- fig. 8 shows the restriction map of a plasmid
pJS1 containing another Bialaphos-resistance-gene ;
- fig. 9 shows the nucleotide sequence of the
"sfrsv" gene containing the resistance gene ;
- fig. 10 shows the amino acid homology of "sfrsv"
gene and "sfr" gene,
- fig. 11 shows the construction of a plasmid,
given by way of example, which contains the "sfrsv" gene
and suitable for the transformation of plant cells.
Another Bialaphos-resistance-gene has been
isolated form another Bialaphos-producing-strains, i.e.
streptomyces viridochromoaenes. This second resistance-
gene is thereafter designated by "sfrsv" gene.
This second preferred DNA fragment according to
the invention, for the subsequent transformation of plant
cells, consists of a nucleotide sequence coding for at
least part of a polypeptide having the following sequen-
ce
30


1341531
51

V S P E R R P V E I R P A T A A D M
A A V C D I V N H Y I E T S T V N P
R T E P Q T P Q E W I D D L E R L Q

D R Y P W L V A E V E G V V A G I A
Y A G P W K A R N A Y D W T V E S T
V Y V S H R H Q R L G L G S T L Y T

H L L K S M E A Q, G F K S V V A V I
L P N D P S V R L H E A L G Y T A
R G T L R A A G Y K H G G W H D V G
F W Q R D F E L P A P P R P V R P V
T Q I *

35


1341531
52
which part of said polypeptide is of sufficient length to
confer protection against Bialaphos-"plant-protecting-
capability"-, to plant cells, when incorporated
geneti.cally and expressed therein. Reference will also be
made here-
after to the "plant-protecting-capability" against
Bialaphos of the abovesaid nucleotide sequence.
Meaning of the designation of amino acids by a
single letter is given therafter.
Alanine A Leucine L
Arginine R Lysine K
Asparagine N Methionine M
Aspartic Acid D Phenylalanine F
Cysteine C Proline P
Cystine C Serine S
Glycine G Threonine T
Glutamic Acid E Tryptophan W
Glutamine Q Tyrosine Y
Histidine H Valine V
Isoleucine I

30


13 4153 1
53
This second preferred DNA fragment consists of the
following nucleotide sequence :

TAAAGAGGTGCCCGCCACCCGCTTTCGCAGAACACCGAAGGAGACCACAC
~ GTGAGCCCAGAACGACGCCCGGTCGAGATCCGTCCCGCCACCGCCGCCGA
CATGGCGGCGGTCTGCGACATCGTCAATCACTACATCGAGACGAGCACGG
TCAACTTCCGTACGGAGCCGCAGACTCCGCAGGAGTGGATCGACGACCTG

GAGCGCCTCCAGGACCGCTACCCCTGGCTCGTCGCCGAGGTGGAGGGCGT
CGTCGCCGGCATCGCCTACGCCGGCCCCTGGAAGGCCCGCAACGCCTACG
ACTGGACCGTCGAGTCGACGGTGTACGTCTCCCACCGGCACCAGCGGCTC
GGACTGGGCTCCACCCTCTACACCCACCTGCTGAAGTCCATGGAGGCCCA
GGGCTTCAAGAGCGTGGTCGCCGTCATCGGACTGCCCAACGACCCGAGCG

TGCGCCTGCACGAGGCGCTCGGATACACCGCGCGCGGGACGCTGCGGGCA
GCCGGCTACAAGCACGGGGGCTGGCACGACGTGGGGTTCTGGCAGCGCGA
CTTCGAGCTGCCGGCCCCGCCCCGCCCCGTCCGGCCCGTCACACAGAT
-
GAGCGGAGAGCGCATGGC

35


1341531
54
or of a part thereof expressing a polypeptide having
plant-protecting capability against Bialaphos ;
There follows hereafter the description of
experiments carried out for the isolation of the "sfrsv"
resistance gene, the construction of expression vectors
which contain the resistance gene and which allow the
subsequent transformation of plant cells, in order to
render them resistant to GS inhibitors.
Cloning of the bialanhos-resistance-"sfrsv" gene
from Strentomvices viridochromogenes
The strain Strentomvices viridochromoaenes DSM

25
35


13 4 1 5 3 1
40736 (ref 1) was grown and total DNA of this strain was
prepared according to standard techniques. DNA samples
were digested respectively with stI, ;MI and Sau3AI in
5 three different reactions and separated on an agarose gel,
together with plasmid DNA from pGSR1 (fig. 5B) digested
with BamHI. In a Southern analysis the DNA was blotted on
a nitrocellulose filter and hybridized with the labbeled
pamHI fragment from pGSR1 containing the "sfr" gene. In
all four lanes of the gel, a restriction fragment was
10 showing strong homology with the probe : aPstI fragment
of about 3 kb, a naI fragment of about 1.2 kb and Sau3AI
fragment of 0.5 kb. In order to clone this gene, pstI
restriction fragments were directly cloned in the
Escherichia coli vector pUC8. 3000 colonies obtained after
transformation were transferred to nitrocellulose filters,
and hybridized with the "sfr" probe. Positive candidates
were further tested for their growth on minimal medium
plates containing 300 Ng/ml PPT. One transformant that
grew on PPT-containing-medium was further analysed. The
plasmid map and relevant restriction sites of this plasmid
pJS1 are represented in fig. 8. The strain MC1061 (pJS1)
has been deposited on March 06, 1987 at the DEUTSCHE
SAMMLUNG VON MIKROORGANISMEN (DSM) under deposition number
DSM 4023. The clone restriction fragment has been
sequenced according to the Maxam and Gilbert method and
the coding region of the gene could be identified through
homology. The sequence of the "sfrsv" gene is represented
in fig.9 and the homology on the nucleotide and amino acid
sequence level with "sfr" gene is shown in fig. 10.
Expression ofthe "sfrsv" aere
A"sfrsv gene cassette" was also constructed to
allow subsequent cloning in plant expression vectors. A
&anII-$q11I fragment containing the "sfrsv" coding region
without the initiation codon GTG was isolated from pJS1.


13415 31
56
This fragment was ligated in the vector pLK56-2 digested
with NcoI and Bc,II, together with a synthetic
oligonucleotide 5'-CATGAGCC-3', similar with the one
described for "sfr" gene and shown in fig. 5. The
construction of pGSR1SV is schematically shown in fig. 11.
Since similar cassettes of both genes are present in
respectively pGSR1 and pGSR1SV, previous described
constructions for the expression of the "sfr" gene in
plants can be repeated.
Enzymatic analysis of crude extracts from E. coli
strains carrying plasmid pGSR1SV demonstrated the
synthesis of an acetylase which could acetylate PPT. This
was shown by thin layer chromotography of the reaction
porducts.
The "sfrsv" gene was then inserted into the
plasmid vector pGSJ260 (fig. 4B) under the control of the
CaMV 35s promoter, to yield a plasmid pGS2SV, similar to
pGSR2 (fig. 6A) except that the "sfrsv" gene is substitu-
ted for the "sfr" gene.
It is clear that herbicide resistance genes of the
above type may be obtained from many other microorganisms
that produce PPT or PPT derivatives. Herbicide resistance
gene can then be incorporated in plant cells with a view
of protecting them against the action of such Glutamine
Synthetase inhibitors. For instance, a Bialaphos-
resistance-gene is obtained from Kitasotosporia (ref. 15).
Transformed plant cells and plants which contain
the "sfrsv" resistance gene can be obtained with plasmid
pGSR2SV, using the same Agrobacterium-mediated-trans-
formation system as hereabove described for the transfor-
mation of different plant species with the "sfr" gene.



13 4 1 5 3 1
57
Plants are regenerated and tested for their
resistance with similar spraying tests as described
hereabove. All plants behaved similarly and show resist-
ance against herbicides consisting of glutamine synthetase
inhibitors.
Finally, the inventors also pertains to the
combination of the plants resistant to an inhibitor of
glutamine synthetase as defined above with the corres-
ponding inhibitor of glutamine synthetase for use in the
production of cultures of said plants free form weeds.

20
30


134153~
58
REFERENCES
1. BAYER et al., HELVETICA CHEMICA ACTA, 1972
2. WAKABAYASHI K. and MATSUNAKA S., Proc. 1982, British
Crop Protection Conference, 439-450
3. M. MASON et al., PHYTOCHEMISTRY, 1982, vol. 21, n' 4,
p. 855-857.
4. C. J. THOMPSON et al., NATURE, July 31, 1980, vol. 286,
n' 5 772, p. 525-527
5. C. J. THOMPSON et al., JOURNAL OF BACTERIOLOGY, August
1982, p. 678-685
6. C. J. THOMPSON et al., GENE 20, 1982, p. 51-62
7. C. J. THOMPSON et al., MOL. GEN. GENET., 1984, 195,
p. 39-43
8. TOWBIN et al., PROC. NATL. ACAD. SCI. USA, 1979, 76,
p. 4 350-4 354
9. METHODS OF ENZYMOLOGY, V.XLIII, p. 737-755
10. DEBLAERE H. et al., 1985, Nucl. Acid. Res., 13, 1 477
11. BOTTERMAN J., February 1986, Ph. D. Thesis, State
University of Ghent
12. DEBLAERE R., february 1986, Ph. D Thesis, Free
University of Brussel, Belgium
13. VELTEN et al, EMBO J. 1984, vol. 3, n'12, p. 2 723-
2 730
14. CHATER et al, Gene cloning in Streptomyces. Curr. Top.
Microbiol. Immunol., 1982, 96, p. 69-75
15. OMURA et al, J. of Antibiotics, Vol. 37, 8, 939-940,
1984
16. MURAKAMI et al, Mol. Gen. Genet., 205, 42-50, 1986
17. MANDERSCHEID and WILD, J. Plant Phys., 123, 135-142,
1986


Sorry, the representative drawing for patent document number 1341531 was not found.

For a clearer understanding of the status of the application/patent presented on this page, the site Disclaimer , as well as the definitions for Patent , Administrative Status , Maintenance Fee  and Payment History  should be consulted.

Admin Status

Title Date
Forecasted Issue Date 2007-06-12
(22) Filed 1987-04-07
(45) Issued 2007-06-12

Abandonment History

There is no abandonment history.

Maintenance Fee

Description Date Amount
Last Payment 2019-05-22 $250.00
Next Payment if small entity fee 2020-06-12 $125.00
Next Payment if standard fee 2020-06-12 $250.00

Note : If the full payment has not been received on or before the date indicated, a further fee may be required which may be one of the following

  • the reinstatement fee set out in Item 7 of Schedule II of the Patent Rules;
  • the late payment fee set out in Item 22.1 of Schedule II of the Patent Rules; or
  • the additional fee for late payment set out in Items 31 and 32 of Schedule II of the Patent Rules.

Payment History

Fee Type Anniversary Year Due Date Amount Paid Paid Date
Filing $0.00 1987-04-07
Maintenance Fee - Patent - Old Act 2 2009-06-12 $100.00 2009-05-29
Maintenance Fee - Patent - Old Act 3 2010-06-14 $100.00 2010-05-17
Maintenance Fee - Patent - Old Act 4 2011-06-13 $100.00 2011-05-11
Maintenance Fee - Patent - Old Act 5 2012-06-12 $200.00 2012-05-22
Maintenance Fee - Patent - Old Act 6 2013-06-12 $200.00 2013-05-21
Registration of Documents $100.00 2013-10-02
Registration of Documents $100.00 2013-10-02
Registration of Documents $100.00 2013-10-02
Maintenance Fee - Patent - Old Act 7 2014-06-12 $200.00 2014-05-20
Maintenance Fee - Patent - Old Act 8 2015-06-12 $200.00 2015-05-20
Maintenance Fee - Patent - Old Act 9 2016-06-13 $200.00 2016-05-18
Maintenance Fee - Patent - Old Act 10 2017-06-12 $250.00 2017-05-17
Maintenance Fee - Patent - Old Act 11 2018-06-12 $250.00 2018-05-24
Maintenance Fee - Patent - Old Act 12 2019-06-12 $250.00 2019-05-22
Current owners on record shown in alphabetical order.
Current Owners on Record
BIOGEN IDEC MA, INC.
NV BAYER CROPSCIENCE
Past owners on record shown in alphabetical order.
Past Owners on Record
AVENTIS CROPSCIENCE N.V.
BAYER BIOSCIENCE NV
BAYER CROPSCIENCE N.V.
BIOGEN N.V.
BIOGEN, INC.
BOTTERMAN, JOHAN
DE BLOCK, MARC
LEEMANS, JAN
MOUVA, RAO
PLANT GENETIC SYSTEMS N.V.
THOMPSON, CHARLES
Past Owners that do not appear in the "Owners on Record" listing will appear in other documentation within the application.

To view selected files, please enter reCAPTCHA code :




Filter Download Selected in PDF format (Zip Archive)
Document
Description
Date
(yyyy-mm-dd)
Number of pages Size of Image (KB)
Cover Page 2007-06-12 1 23
Abstract 2007-06-12 1 16
Description 2007-06-12 58 1,993
Claims 2007-06-12 5 139
Drawings 2007-06-12 26 581
Assignment 2013-10-02 15 540
Correspondence 2005-01-25 2 33
Correspondence 2007-04-23 1 33
Prosecution-Amendment 2005-05-10 1 38
Prosecution-Amendment 2003-09-26 2 62
Prosecution-Amendment 2003-02-04 1 32
Prosecution-Amendment 2005-10-05 2 58
Prosecution-Amendment 2005-01-25 2 54
Prosecution-Amendment 2003-07-24 2 52
Assignment 1996-09-06 3 121