Note: Descriptions are shown in the official language in which they were submitted.
' ~ 200Z4B0
TITLE: PROCESS FOR THE PRODUCTION OF HUMAN LYSOZYME
DESCRIPTION OF THE TECHNICAL FIELD:
The present invention relates to a process for the
production of active human lysozyme by cultivation of yeasts
genetically manipulated for this purpose. More particularly, it
relates to a process wherein active human lysoz~me is produced in
high yield and secreted by the yeast cells from which it can
easily be recovered and purified.
Lysozyme is the common name given to enzymes widely
spread in nature and known to catalyze the hydrolysis of pep-
tidoglycan which is the major component of the bacterial cell
wall. As a result of this activity,~lysozymes have an antibac-
terial action and, for this reason, are believed to participate
in the various barriers to bacterial infection possessed by most
living organisms. Thus, in insects which lack lymphocytes and
immunoglobulins, the immune response to bacterial infection is
ensured by a multifactorial enzyme system of which lysozyme is an
important component (see for example D. HULTMARR et al., Eur. J.
Biochem. 106, 7, 1980). In higher anim~ls, although the physio-
logical role of lysozyme is still not known (see R. RAGHUNATHAN,
IRCS Med. Sci. 13, 480, 1985), its ubiquitous distribution sug-
gests this role might be important. It has been suggested that
it could have a stimulating action on the immune system (see P.
JOLLES, Biomedicine 25, 276, 1976). Human lysozyme at physio-
logical doses was shown to stimulate in vitro phagocytosis of
yeast cells by polymorphonuclear leucocytes (see M. KLOCKARS & P.
ROBERTS, Acta haemat. 58, 289, 1976). It has also been suggested
that lysozyme might have a general role of surveillance of
membranes and in the anti-tumor functions of macrophages (see
200Z480
E.F. OSSERMAN et al., Nature 243, 331, 1973). More recently, it
has been shown that lysozyme itself has some anti-tumor action
(see R. RAGHNATHAN, Cancer Detection and Prevention 5, 78,
1982). Already, chicken lysozyme is used, especially in Japan,
for a variety of pharmaceutical applications.
Chicken lysozyme belongs to a class of closely related
enzymes which also includes human lysozyme and which are referred
to as c (chicken) lysozymes. They are characterized by similar
physicochemical properties which include: a molecular weight of
about 15,000, close homology in amino acid sequence and tertiary
structure, the same enzymatic activity, e.g. some chitinase
activity, in contrast with g (goose) lysozymes which have a
molecular weight of about 20,0U0 and no chitinase activity (For a
review, see P. JOLLES & J. JOLLES, Mol. & Cell. Biochem.-63, 165,
1984).
However, despite these structural and physicochemical
similarities, lysozymes within the same class may have quite
different immunological properties. For example, chicken
lysozyme and human lysozyme do not cross-react with their respec-
tive antibodies (see A. FAURE & P. JOLLES, FEBS Lett. 10, 237,
1970). Therefore, human lysozyme is especially indicated for
pharmaceutical and even for food uses. However, unlike chi.cken
lysozyme for which an abundant source exists and is actually
exploited, i.e. from egg white, human lysozyme cannot be provided
in large amounts for commercial purposes except by culturing
cells whose DNA has been especially manipulated to express the
enzyme.
It is now current practice to clone and express in a
microbial host a gene coding for a heterologous protein, e.g. a
protein of human origin. Numerous examples can be found with
2002480
great details in the patent literature, some of which have
already reached commercial fruition. This is the case for e.g.
human insulin, growth hormone and alpha-interferon expressed in
the gram-negative bacterium Escherichia coli. In this host, high
expression levels can easily be obtained; however, the protein
thus produced is frequently concentrated as large inclusion
bodies where it is in insoluble and inactive form. In such
cases, in order to obtain the physiologically active protein, it
is necessary to apply a costly and tedious procedure of renatura-
tion, the yield of which may be as low as about 20% as is the
case of prochymosin (see F.A.O. MARSTON et al., Biotechnology 2,
800, 1984). The same type of phenomenon apparently takes place
-when a DNA segment coding for human lysozyme is expressed in E.
coli. After sonication of the cells, the synthesized human
lysozyme is found mainly associated with the cell debris. More-
over, the protein is not active and differs from the native human
lysozyme by the presence of an additional N-terminal methionine
residue (see M. MURAKI et al., Agric. Biol. Chem. 49, 2829,
1985).
To obviate these difficulties, attempts were made to
express human lysozyme in the gram-positive bacterium Bacillus
subtilis, which is known to secrete actively a number of hydro-
lytic enzymes into the external medium and which is extensively
used as host for the expression and secretion of heterologous
proteins. However, in the case of human lysozyme it was recently
shown that the secreted protein is enzymatically inactive,
probably through incorrect bond formation (see K. YOSHIMURA et
al., Biochem. & Biophys. Res. Comm. 145, 712, 1987).
Hosts other than bacteria can also be used for the
production of heterologous protein e.g. eukaryotic microorganisms
such as yeasts, especially Saccharomyces cerevisiae, or even
2002480
filamentous fungi. A typical example of the production in high
yield of a human protein in yeast is the intracellular expression
of active superoxide dismutase (see International patent
application W0 85/01503). However, when DNA coding for mature
human lysozyme is expressed in yeast, the same phenomenon as
observed in E.coli takes place, i.e. lysozyme is found associated
with cell debris from which it has to be extracted by
solubilizing agents such as concentrated urea (see European
patent application EP 0181634, p. 47). More recently, further
data were provided which show that mature lysozyme expressed in
yeast is indeed obtained in insoluble and inactive form, probably
as a result of incorrect formation of disulfide bonds (see T.
YAKAWA et al., Gene 56, 53, 1987).
As disclosed in Belgian patent BE 901,223, enzymatic-
ally active lysozyme can be obtained from genetically manipulated
yeasts provided that DNA coding for the mature protein is fused
with a leader sequence coding for a signal peptide recognized by
the secretion machinery of the yeast cell. In this case, the
mature protein is secreted through the plasma membrane and then,
to an extent depending on conditions, excreted into the culture
medium. In said Belgian patent, it is thus shown that expressing
in yeast a complete cDNA coding for chicken prelysozyme results
in the production of enzymatically-active lysozyme, a large por-
tion of which, i.e. about 73%, is found solubilized in the
culture medium. Later it was shown that the N-ter~;n~l sequence
of the chicken lysozyme thus produced is identical to that of the
native enzyme, i.e. Lys-Val-Phe-Gly-Arg-Cys-Glu-Leu-Ala-Ala (see
J. OBERTO et al., 11th Int. Symp. Special. Yeast Mol. Biol. &
Genetics, Varna, Nov. 4-9, 1985; also see Belgian patent BE
903,626). These results demonstrate that the signal sequence of
Z002480
chicken lysozyme is correctly cleaved by the yeast secretion
system, making it possible to use said signal sequence to ensure
secretion of lysozymes from various sources as claimed in Belgian
patent BE 901,223, claim 3 for example. Advantage of this was
recently taken in the case of human lysozyme (see Y. JIGAMI et
al., Gene 43, 273, 1986 and K. YOSHIMURA et al., ref. cit.).
However, the yields reported are relatively small.
The possibility to have lysozyme secreted from the
yeast cells is of great practical advantage. Not only is the
enzyme thus obtained active and identical to the native protein,
but it is easily recovered and purified by known methods such as
those described in Belgian patent BE 903,626, supra, without
having to grind the cells and to apply complex and costly frac-
tionation and renaturation procedures. Still another advantage
of having the desired protein secreted from the cells is the
possibility of recovering the latter for some secondary use, e.g.
as a source of proteins and vitamins in feed formulations.
Actually, the high protein content of yeasts, their good amino
acid balance and the absence of cellulose therefrom make them a
valuable feed supplement for young husbandry animals such as
calves and piglets.
BRIEF SUMMARY OF THE INVENTION:
For the production by fermentation of a relatively
high-volume, medium-value enzyme such as lysozyme to be eco-
nomically feasible, it is not enough that provision be made to
have it secreted from the cells. It is also necessary to produce
it in high yield. Accordingly, it is an object of this invention
to provide an improved process for the production in high yield
of enzymatically-active lysozyme. It is a further object thereof
to achieve this production under such conditions that denatura-
tion of the enzyme is m;n;m;zed and that it is obtained in a
- ZOOZ4~30 ~
concentrated form easily processed for further purification.
' This invention is of particular interest when the lysozyme pro-
duced is relatively toxic for the yeast cell, more particularly
when human lysozyme is to be produced. Other objects and
advantages of the invention will become apparent from the follow-
ing description and from the examples.
These objects are accomplished by application of a
fermentation process wherein yeast cells whose DNA has been
appropriately engineered are induced to produce and to secrete
human lysozyme under growth-limited conditions.
In one aspect, the present invention relates to a
process for the production of enzymatically active lysozyme
~ ~ -comprising:
~ contacting growing yeast cells whose DNA has been
genetically engineered with a culture medium under growth-limited
conditions, and inducing said yeast cells to synthesize and
secrete enzymatically-active lysozyme.
In another aspect, the present invention relates to a
process for the production of enzymatically-active lysozyme
comprising:
growing yeast cells whose DNA has been genetically
engineered in a culture medium which represses synthesis of
enzymatically-active lysozyme,
contacting said growing yeast cells into a culture
medium under growth-limited conditions, and inducing said yeast
cells to synthesize and secrete enzymatically-active lysozyme.
-- 6
200Z480
In another aspect, the present invention relates to a
synthetic gene for human lysozyme, selected from the group
..~omprising the following sequence AAGGTTTTCGAAAGATGTGAGCTAGCTAGAA
TTCCAAAAGCTTTCTACACTCGATCGATCTT
CTTTG~ TTGGGTATGGACGGTTACAGAGGTATCTCCTTGGCTAACTGGATG~ GGCC
GAAACTTCTCTAACCCATACCTGCCAATGTCTCCATAGAGGAACCGATTGACCTACACAAACCGG
AAGTGGGAATCTGGTTACAACACCAGAGCTACCAACTACAACGCTGGTGA~ TCTACCGACTA
TTCACCCTTAGACCAA~lGllGlGGTCTCGATGGTTGATGTTGCGACCACTGTCTAGATGGCTGAT
CGGTATcTTccAAATcAAcTccAGATAcTGGTGTAAcGAcGGTAAGAccccAGGTGcTGTTAAcG
GccATz~(~AAr~GTTTAGTTGAGGTcTATGAccAcATTGcTGccATTcTGGGGTccAcGAcAATTGc
CTTGTCACTTGTCCTGTTCTGCl1lGllGr~AGA~ACATCGCTGACGCTGTCGCCTGTGCTAAG
GAACAGTGAACAGGACAAGACGAAACAACGTTCTGTTGTAGCGACTGCGACAGCGGACACGATTC
-AGAGll~ lAGAGACCCACA~GGTATCAGAGCTTGGGTTGCTTGGAGAA~GATGTCAAAACAG
TCTCAACAATCTCTGGGTGTTCCATAGTCTCGAACCCAACGAACCTClllGlCTACAGTTTTGTC
AGACGTTAGACAATACGTCCAAGGllGlGGTGTT
TCTGCAATCTGTTATGCAGGTTCCAACACCACAA and the mutants thereof coding
for a protein which is different from native human lysozyme and
which retain a muramidase activity.
BRIEF DESCRIPTION OF THE FIGURES: ;~
Figure 1 illustrates a sequence of a synthetic gene
coding for human lysozyme, which was synthesized with yeast
preferred codons (J.L. BENNETZEN and B.D. HALL, J. Biol. Chem.
257, 3026, 1982) using phosphoramidite chemistry on an Applied
Biosystems DNA Synthesizer.
Figure 2 illustrates plasmid pAB24AGScLysH, which may
be used for the expression in yeast of human lysozyme, and which
was obtained by insertion into the yeast-E.coli shuttle vector
2002480
pAB24 of a human lysozyme expression cassette comprising the
regulatable ADH2-GAP promoter, chicken lysozyme signal sequence,
human lysozyme gene shown in Figure 1 and GAP ter~;nAtor.
Figure 3 illustrates a sequence of a mutant human
lysozyme gene with Gly-4, which was constructed using a synthetic
fragment from the Spel site in the chicken signal to the Nhel
site in the human gene in which the codon at position 4 of the
mature protein was changed from GAA (glutamic acid) to GGA
~glycine).
Figure 4 illustrates plasmid pAB24AGScLysHGly4, which
is identical to that shown in Figure 2 except that the mutant
gene of Figure 3 is substituted for the human lysozyme gene shown
in Figure 1.
Figure 5 illustrates plasmid pAB24AGScLysC, which is
identical to that shown in Figure 2 except that the expression
cassette consists of the ADH2-GAP promoter, a complete chicken
lysozyme cDNA and the ADH1 terminator.
Figure 6 illustrates plasmid pAB24GScLysC is identical
to that shown in Figure 2 except that the expression cassette
consists of the constitutive GAP promoter, the same chicken
lysozyme cDNA as shown in Figure 5 and the GAP ter~in~tor.
Figure 7 shows plasmid pAB24AGalphaFLysH, which is
substantially identical to that shown in Figure 2 except that the
alpha factor leader sequence is substituted for the chicken
lysozyme signal sequence.
Figure 8 shows plasmid YIP5AGScLysH, which was obtained
by insertion into integration plasmid YIP5 of the same human
lysozyme expression cassette as used for the construction of
plasmid pAB24AGScLysH shown in Figure 2.
Figure 9 illustrates a flow sheet of an embodiment of
one particular mode of practicing the invention, wherein the
. ZOOZ480
secreted lysozyme is recovered by extraction from the liquid
medium.
Figure 10 illustrates a flow sheet of another embodi-
ment of the process wherein lysozyme production is carried out
under such conditions that the secreted portion thereof remains
associated with the yeast cell wall.
DETATT.~n DESCRIPTION OF THE PREFERRED EMBODIMENTS:
As emphasized above, the first demonstration of the
possibility to make yeast, through genetic engineering tech-
niques, able to produce and to secrete enzymatically-active
lysozyme was made with chicken lysozyme as a model compound.
More specifically, in example 2.2 of Belgian Patent BE 901,223,
there is described the transformation of a leu2 strain of
Saccharomyces cerevisiae (GRF18) with a plasmid (plys50) com-
prising the entire sequence of the endogenous 2-micron plasmid,
the defective LEU2 gene of plasmid pJDB219 (see J.D. BEGGS,
Nature 275, 104, 1978) for selection in yeast, bacterial
sequences for replication and selection in E.coli and an
expression cassette wherein a complete chicken lysozyme cDNA is
under the transcription control of the yeast promoter p415. In
this example, lysozyme expression and secretion were evidenced by
the ability of both a cell homogenate and the cell-free culture
medium itself to lyse cells of Micrococcus lysodeikticus. Total
activity amounted to 162 units/ml, that is 118 units in the
medium and 44 units associated with the cells.
The same type of results is obtained when using another
2-micron-based expression plasmid wherein transcription of the
chicken lysozyme cDNA is ensured by the strong constitutive
promoter of the GAP gene coding for glyceraldehyde phosphate
dehydrogenase. In a first attempt to express human lysozyme, we
2002480
have in this latter construction replaced the DNA portion coding
for mature chicken lysozyme by a synthetic DNA segment coding for
mature human lysozyme. The sequence used, shown in Figure l, was
derived primarily in order to utilize codons preferred by
S.cerevisiae for the high level expression of its own genes. In
addition, silent mutations were used to introduce unique restric-
tion enzyme sites for possible subsequent manipulation of the
sequence. Unexpectedly, using this construction, no leu+ trans-
formants could even be obtained upon transformation by conven-
tional methods and selection on leucine-deficient medium. Thus,
apparently, human lysozyme when actively synthesized in yeast
protoplasts reduces cell viability, possibly by interfering with
the synthesis of chitin which is a normal constituent of the
yeast cell wall (see E. CABIB & R. ROBERTS, Ann. Rev. Biochem.
5l, 763, 1982).
However, we have found that when transcription of the
same human lysozyme-coding DNA segment is put under the control
of a regulatable promoter and provided that depression thereof is
carried out under growth-limited conditions, active lysozyme
synthesis takes place without apparent detrimental effect on cell
physiology. By contrast, when lysozyme synthesis occurs under
,
conditions permitting growth, not only is biomass production
impaired but, still more strikingly, lysozyme synthesis is too
limited to be of practical interest. Such a dependence of human
lysozyme synthesis on growth-limited conditions is not observed
with chicken lysozyme. This is surprising in view of the simi-
larity between the enzymatic properties of both enzymes. At
first glance, this difference might be ascribed to the fact that
human lysozyme has a specific activity about 2.5 times higher
than that of chicken lysozyme tsee R.E. CANFIELD et al. in
-- 10 --
; 2002480
"Lysozyme", Ed. E.F. OSSERMAN, R.E. CANFIELD and S. BEYCHOK,
Academic Press, 1974, p. 63). However, when the primary struc-
ture of the former is altered by site-directed mutagenesis so
that the Glu residue in position 4 is substituted by a Gly
residue as in chicken lysozyme, the same inhibition of lysozyme
synthesis under growth conditions is observed, whereas the
specific activity of the mutated protein with M.lysodeikticus as
substrate is not significantly higher than that of chicken
lysozyme.
Accordingly, it is an important aspect of the present
invention to provide a process wherein growth and lysozyme syn-
thesis are substantially consecutive instead of simultaneous
events. This can easily be achieved by using for the transcrip-
tion of the lysozyme-encoding DNA segment a repressible yeast
promoter. Various promoters of this type are known. For
instance, the promoter of the gene coding for acid phosphatase
can be used as taught in European patent EP 100,561. As dis-
closed recently in European patent EP 213,593, this property is
related to the presence, upstream of the PH05 gene, of two acti-
vation sequences which can be used to construct regulatable
hybrid promoters, e.g. by fusion with the promoter of the GAP
gene. Actually, as described in European patent EP 164,556, a
variety of such hybrid promoters can be constructed by combining
different yeast promoters, especially strong promoters from genes
coding for glycolytic enzymes as GAP, with a regulatory region
corresponding to different repressible genes, e.g. GALl, GAL10,
PH05, SUC2, MAL6S, MAL6T, CYCl, ADH2 or genes under general amino
acid control such as HiSl, HiS3, HiS4, TRP5 or LEU3. For
instance, the ADH2 gene is repressed by glucose and derepressed
in the presence of a non-fermentable carbon source such as
-- 11 --
2002480 ::
ethanol. Thus, by using such regulatable promoters, it is
possible, by carefully controlling the composition of the culture
medium, to have lysozyme expression switched on or off,
independently of growth. Other yeast promoters regulated by a
change of temperature can also be used.
As also emphasized above, another important aspect of
the present invention is that lysozyme expressed in yeast under
growth-limited conditions is secreted thereform. This is also a
surprising fact when it is taken into consideration that most
experimental evidences presently available point to the fact
that, in yeast, protein secretion is correlated to cell growth
(see R. S~F.~M~, TIBS, July 1982, p. 243). In contrast to this,
-~as the yeast cells are maintained at the stationary phase, the
amount of secreted lysozyme found outside the plasma membrane
increases at the expense of the amount found intracellularly.
Nevertheless, as those skilled in the art know, in
order to ensure secretion of lysozyme through the plasma mem-
brane, it is necessary that the lysozyme-encoding DNA segment be
appropriately equipped with a leader sequence coding for a signal
peptide allowing the translated protein to be translocated into
the lumen of the endoplasmic reticulum and processed into the
mature enzyme. This leader sequence can be any sequence coding
for any signal peptide, homologous or heterologous, which is
recognized and correctly cleaved by the yeast secretion
machinery. As already discussed above, efficient secretion
results from the use of the sequence enccding the signal peptide
of chicken lysozyme but sequences coding for other heterologous
signal peptides can also be used. On the other hand, homologous
- signal sequences can be used. For example, an efficient and well
documented secretory expression method consists in using the
- 12 -
Z002480
leader region of the precursors of the yeast mating pherormones
alpha- and a-factors (see, e.g., European patents EP 116,2~1 and
EP 123,289).
The lysozyme-encoding DNA segment to be expressed by
the process of the invention can be any DNA sequence coding for
human lysozyme, i.e. for a protein having muramidase activity and
substantially the same amino acid sequence as native human
lysozyme. It can be a cDNA obtained by reverse transcription of
mRNA transcribed from the native human gene. Alternatively, it
can be any synthetic DNA segment encoding human lysozyme as here-
above defined. A significant advantage of the latter method is
that the nucleotide sequence of the DNA segment thus synthesized
can be so designed as to comprise the codons most frequently used
in yeast, in order to improve translation efficiency. In accord-
ance with the above definition, any DNA segment coding for a
protein wherein some modifications with respect to native human
lysozyme would have been brought for practical purposes, e.g.
improved thermal stability and/or specific activity, has to be
~~ considered as comprised within the scope of the present inven-
tion.
; To have lysozyme expressed in yeast and secreted there-
- from, an expression cassette comprising those different elements,
i.e., from 5i to 3', the repressible promoter, the DNA sequence
coding for an appropriate signal peptide, the lysozyme-encoding
DNA segment and, preferably, a yeast transcription terminator,
has to be constructed and inserted appropriately into a yeast
expression vector. One possibility is to make use of a plasmid
able to replicate autonomously in yeast in a large number of
copies as those where use is made as marker of the defective LEU2
- gene. A preferred version of such expression plasmids are those
- 13 -
CA 02002480 1998-0~-01
derived from the yeast endogenous 2-micron plasmid and, still
preferably, those comprising the complete sequence thereof. In
this case, it is possible to use for transformation cir~ strains
of yeast, i.e. strains cured from their 2-micron plasmids.
Transformants thus obtained only contain the chimaeric plasmid
constructed with the lysozyme gene. The number of copies thereof
is therefore maximized and plasmid instability resulting from
recombination reactions is minimized. Nevertheless, for maximum
expression stability, it may be preferred to integrate the
expression cassette into the yeast genome. A great number of
expression systems can thus be devised by a judicious combination
of various construction elements, a large number of which are
already available in the art.
The yeast that can be used in accordance with the
present invention will preferably be of the genus Saccharomyces
and more preferably of the species Saccharomyces cerevisiae, i.e.
baker's yeast. One reason for this is that the biological
properties thereof are relatively well known. Another important
reason is that S.cerevisiae is typically a GRAS (generally
recognized as safe) microorganism, especially suitable for "Good
Industrial Large Scale Practice" as defined recently by the
Organization for Economic Cooperation and Development (OECD).
However, the process of the present invention can also be applied
with advantage to other species of yeasts, e.g. Kluyveromyces
lactis, Pichia pastoris, Saccharomycopsis lipolytica,
Schwannomyces alluvius, Schizosaccharomyces pombe, and the like.
As realized by those skilled in the art, when a DNA
segment coding for human lysozyme is put under the control of a
repressible promoter as described above, it is possible to grow
the host organism while avoiding the enzyme to be synthesized.
- 14 -
Z002480
For that, growth conditions such that the promoter remains
repressed have to be maintained. For instance, when use is made
of the PH05 promoter, the inorganic phosphate in the culture
medium has to be monitored at a sufficiently high value, e.g. by
controlled addition of inorganic phosphate to the medium, until
the desired cell concentration is obtained. Then, upon inter-
rupting addition and provided that the other nutrients are not in
limiting amount, the concentration of inorganic phosphate in the
medium will decrease as a result of continued growth so as to
reach a value low enough to induce lysozyme synthesis but not to
ensure active growth.
Similarly, when use is made of a promoter repressed by
glucose and derepressed by ethanol such as the A~H2 promoter, the
concentration of glucose should be maintained at a level high
enough to ensure growth but not lysozyme synthesis. Such condi-
tions result in the production of ethanol, as a consequence of
the so-called Crabtree effect (see for example 0. KAPPELI et al.,
CRC Critical Reviews in Biotechnology 4 (3), 299, 1986). Then,
upon interrupting glucose feeding, lysozyme synthesis will take
place at the expense of the ethanol thus produced.
According to a preferred way to practice the invention,
yeast cultivation and lysozyme production are carried out as
separate operations. In a first medium, yeast growth takes place
in the absence of lysozyme synthesis up to the desired cell
density. Then cells are transferred into a medium selected for
ensuring lysozyme synthesis but only limited growth. The major
advantage of this method is that optimal conditions for both
operations can be applied independently. These operations can be
carried out batchwise, semi-continuously as in fed-batch opera-
tions, or fully continuously.
.; .
2002480
To provide yet more detailed description of the process
of the present invention, reference will now be made to Figure 9,
which illustrates a particular mode of practising the invention
and therefore should not be considered as limiting its scope. In
the process thus illustrated, yeast cultivation is carried out in
fermentation tank 1 where provision is made for air from line 2
and of appropriate nutrients from line 3. These nutrients should
be supplied in quantities sufficient to ensure active growth but
repressed lysozyme synthesis as explained above. They comprise a
carbon source which may be pure glucose or sucrose or industrial
spent liquors such as molasses. The other nutrients required for
growth may be in the form of mineral salts such as (NH4)2SO4, and
KH2PO4, which may be supplemented with growth factors such as
- -~amino acids, vit~min~; and metal salts, as generally used in
baker's yeast production. Alternatively, they may be provided in
the form of more complex natural products such as yeast extract,
peptone, malt extract, and the like.
Yeast cultivation will be conducted up to the highest
possible cell concentration compatible with normal process opera-
tion. In most cases, the yeast concentration reached in tank 1
will be comprised between 0.5 and 10% of dry weight, preferably
between 3 and 6%. Below 0.5%, the volumes to be handled become
disproportionate with the amount of useful products to be recov-
ered and above 10% practical problems arise, e.g. from the high
viscosity of the cell suspension.
The biomass produced in tank 1 is sent through line 4
to centrifuge 5 where it is concentrated. The clarified medium
is at least partly recycled to tank 1 via line 6, the remaining
being discarded. The concentrated cell suspension is transferred
through line 7 to tank 8. Part of this suspension may also be
- 16 -
2002480
recycled to tank 1 through line 9; this is especially interesting
in continuous operation to achieve high cell density and high
productivity of the biomass.
In tank 8, provision is made for nutrients from line 10
and for air from line 11. The conditions therein will be such as
to bring complete derepression of the lysozyme expression system,
and therefore they depend on the promoter selected to control
gene transcription. For the reasons emphasized above, it is also
important that these conditions be so adjusted as to limit
growth, e.g. by limiting the concentration of some factors
required for growth but not for protein synthesis.
The suspension of the lysozyme-producing yeasts is
withdrawn from tank 8 through line 12. The cells are separated
in centrifuge 13 from the medium which is at least partly
recycled to tank 8 via line 14 after treatment for lysozyme
extraction in extraction unit 15. This latter operation can
easily be achieved by adsorption on ion exchange or affinity
materials from which the enzyme can then easily be recovered by
elution with, e.g. aqueous NaCl from line 16. The eluate is
subsequently sent via line 17 to purification unit 18 where it is
subjected to a treatment which may comprise a combination of
other classical methods such as ultrafiltration, crystallization,
and the like. Finally, a dry product ready for commercialization
can be obtained by lyophilization or spray drying (not shown).
In practising the invention, it may be advantageous,
for at least two reasons, to apply in tank 8 conditions such that
a major part of the lysozyme secreted from the yeast cells
remains associated to the cell wall. The first reason is that
cell-associated lysozyme is protected against deactivation which
progressively takes place when the enzyme is liberated into the
- 17 -
Z002480
/~
medium. The second reason is that, as taught in Belgian patent
BE 903,626, a substantial fraction of said cell-associated
lysozyme can be recovered in concentrated form by a simple wash
with an aqueous solution of a mineral salt. Figure 10 shows an
embodiment of the process of the invention where such conditions
are applied in tank 8. The yeast suspension is withdrawn from
tank 8 through line 12. In centrifuge 13, the cells are
separated from the medium which is at least partly recycled to
tank 8 via line 14, the rem~; n; ng being discarded. The cells
from centrifuge 13 are contacted in line 19 with an aqueous solu-
tion of a mineral salt from line 20 whereby the lysozyme asso-
ciated to the cell wall is liberated therefrom. Said salt should
be water-soluble, relatively neutral and preferably-nontoxic to
the yeast cells. Specific examples are: NaCl, KCl, NaNO3, KNO3,
Na2SO4, (NH4)2SO4 and the like. For reasons of economy, NaCl
will generally be preferred. The concentration thereof to be
used for efficient recovery of the cell-associated lysozyme is
not critical and may, for example, be varied between 0.2 and 2.0
M. In practice, a concentration of NaCl comprised between 0.5
and 1.0 M is used with advantage. Concentrations below 0.5 M
generally result in a limited recovery with the consequence that
a substantial part of the lysozyme produced is lost with the
residual cells. On the other hand, concentrations above 1.0 M
will generally not bring any improvement. The lysozyme thus
liberated is then separated from the residual cells in centrifuge
24 and can be further purified in unit 18 by the same techniques
as mentioned hereabove. Thus, the yeast cell wall itself can act
and can be exploited as an adsorbing material for recovering the
enzyme.
. ~
To apply this latter mode of operation, it is important
to limit the concentration of mineral salts in tank 8.
200Z480
Conversely, if it is preferred to recover the major part of the
enzyme from the medium by extraction in unit 15, as in the
first-mentioned mode of operation, it is better to increase the
concentration of mineral salts in tank 8. For this purpose, the
same salts in the same concentration range as defined hereabove
for the recovery of cell-associated lysozyme can be used. As the
following examples will show, the presence of salt in high con-
centration may be detrimental for growing yeast but not for
yeast-producing lysozyme under growth-limited conditions. There-
fore, it is a further advantage of the present two-step process
to provide means for growing yeast under conditions optimal for
biomass production and then inducing lysozyme synthesis under
conditions ensuring optimal excretion of the enzyme into the
medium.
The residual yeasts obtained from whatever mode of
operation can be recovered and used as such eventually after
further treatment such as pressing or drying. Such residue can
also be partly recycled to tank 8 for further lysozyme production
or recycled to fermenter 1 as a source of nutrients and growth
factors, eventually after appropriate disrupting treatment.
The above statements as well as other embodiments of
the present invention will now be made more apparent by the
following examples which are given for illustration only and are
not intended to limit the scope of the invention.
-- 19 --
. .- ' '- '_ "
2002480
EXAMPLES
1. PLASMID-MEDIATED EXPRESSION OF (1) HUMAN LYSOZYME, (2) A GLY-
4 MUTANT OF HUMAN LYSOZYME AND (3) CHICKEN LYSOZYME IN YEAST
USING THE CHICKEN LYSOZYME SIGNAL SEQUENCE FOR SECRETION
1.1. Construction of the expression vectors
1.1.1. Human lysozyme
Oligonucleotides corresponding to the sequence of thehuman lysozyme gene with yeast preferred codons were synthesized
using phosphoramidite chemistry on an Applied Biosystems DNA
Synthesizer. The individual oligonucleotides were designed using
a computer program which ~xim;zeS overlaps and min;m;Ses
incorrect annealing. All of the molecules had a 5' phosphate
except for the 5'terminus. The entire gene was annealed and
ligated together, and the full length ligation product (see
Figure 1) isolated from an agarose gel. It was then phos-
phorylated on the 5' terminus with T4 polynucleotide kinase and
ligated into plasmid pAGAP1 which had been treated with Ncol and
Sall and alkaline phosphatase. pAGAPl is a derivative of pPGAP
(See J. TRAVIS et al., J. Biol. Chem. 260, 4384, 1985) in which
the GAP promoter (glyceraldehyde-3-phosphate dehydrogenase gene
491 promoter) has been replaced with the hybrid ADH2-GAP promoter
(see L.S. COUSENS et al., Gene 61, 265, 1987). The lysozyme gene
was then subjected to dideoxy sequence analysis and the designed
sequence was verified. The expression cassette consisting of the
ADH2-GAP promoter, chicken lysozyme signal sequence, human
lysozyme gene, and GAP terminator was excised with BamHl and
inserted into the yeast - E.coli shuttle vector pAB24 (see P.J.
BARR et al., J. Exp. Med. 165, 1160, 1987). The resulting
plasmid, pAB24AGScLysH, is shown in Figure 2.
- 20 -
~- 2002480 ~--
1.1.2. Gly-4 mutant human lysozyme
In order to make the analogous plasmid containing a
mutation in the human lysozyme gene of Glu-4 to glycine (see
~igure 3)r standard methods were used to synthesize part of the
gene from the Spel site in the chicken signal to the Nhel site in
the human gene in which the codon at position 4 of the mature
protein was changed from GAA (glutamic acid) to GGA (glycine).
Reconstruction of the expression vector yielded the plasmid
pAB24AGScLysHGly4, which is shown in Figure 4.
1.1.3. Chicken lysozyme
Similar methods could be used to make a plasmid with
the chicken lysozyme gene driven by the ADH2-GAP promoter. This
plasmid, pAB24AGScLysC, is shown in Figure 5.
1.2. Expression and secretion of lysozymes in yeast
These three plasmids were transformed into S.cerevisiae
....... . . :
strain GRF180, a derivative of GRF18 (E. ERHART & C.P.
HOLLENBERG, J. Bact. 156, 625, 1983) from which the endogenous 2-
micron circle had been cured, and leucine prototrophs selected.
Transformants were grown in m;nim~l medium lacking leucine and
cont~ining 8% glucose for 2 days at 28~C. They were then used to
inoculate cultures of complex medium (YEP:1% yeast extract + 2%
peptone) containing 8% glucose at a ratio of 1:150 and these
cultures were grown at 28~C at 180 rpm. After 5 days of culture,
aliquots of 10 ml were removed, centrifuged at 2500 g for 10
minutes and lysozyme activity determined in the culture super-
natant (SO fraction). Assays were done according to the method
of D. SHUGAR (see Biochim. Biophys Acta 8, 302, 1952) using
Micrococcus lysodeikticus as substrate. One unit of activity is
defined as that amount of enzyme which causes a decrease in
2002480
absorbance at 450 nm of 0.001 per minute using a suspension of
M.lysodeikticus in 66 mM potassium phosphate, pH 6.24, at 25~C in
a 1 ml reaction mixture.
Cells from the transformants were suspended in 1 ml of
0.1 M sodium phosphate buffer, pH 6.5, containing 0.5 M NaCl and
incubated for 5 minutes at 4~C. The cells were removed by
centrifugation and the lysozyme activity in the salt wash (frac-
tion Sl) was determined. In order to determine the amount of
lysozyme which was intracellular, the cell pellets were vortexed
for 5 minutes with glass beads in 0.1 M sodium phosphate buffer,
pH 6.5, cont~;n;ng 0.5 M NaCl and 0.05~ Triton X-100* in a Braun
homogenizer. After separation of the cellular debris by centri-
fugation at 12500 g, lysozyme activity present in the soluble
intracellular fraction (fraction S2) was determined.
The results obtained are shown in Table 1.
TABLE 1
Expression of various lysozyme qenes
using the regulated ADH2-GAP promoter
___________________________________________________________________________
Lysozyme Medium OD Lysozyme activity (U/ml) Plasmid
~ SO Sl S2 Total U/OD stability (%)
___________________________________________________________________________
Human Glucose 294828549660 12562 433 97
Ethanol 160 114 82 196 12 11
Human Glucose 320 731 4616 5347 167 90
Gly-4 Ethanol 170 46 12 58 3 39
Chicken Glucose 3445214003930 5782 170 97
Ethanol 182082701070 1548 86 95
________________________________ _________________________ ________________
* trade mark
- 22 -
2~
Total lysozyme activity was 433 U/OD ~units of activity
per unit of optical density) for human and 167 and 170 U/OD for
human mutant and chicken lysozyme, respectively, when ~rown in
glucose. In all three cases between 14 and 32% of the total
activity is secreted: it is found in the medium (SO) and/or asso-
ciated to the cells from which it can be released without break-
ing the cells by the NaCl wash (Sl), the latter activity
corresponding to that fraction of lysozyme which is secreted but
which is still adsorbed to the yeast cell wall.
1.3. Isolation, purification and characterization
of the secreted lysozymes
In order to purify the yeast-derived recombinant
lysozymes, cultures of the three plasmid transformants in strain
GRF180 were grown for 5 days in YEP medium containing 8% glucose
as described above. The cells were concentrated by centrifuga-
tion for 15 munutes at 2500 g and then they were resuspended in
an equal volume of 0.1 M sodium phosphate buffer, pH 6.5, con-
tAin;ng 0.5 M NaCl. After a 60 minute incubation at 4~C, the
supernatant was collected by centrifugation, diluted 10 fold with
0.1 M sodium phosphate buffer pH 6.5, and loaded on a CM-
Sepharose*fast flow (Pharmacia) column. After loading was com-
pleted, the column was washed with the same buffer and the
lysozyme then eluted with the same buffer containing 0.5 M
NaCl. Fractions contAi~ing lysozyme activity determined as
described above were pooled, concentrated by ultrafiltration on
an Amicon Diaflow*membrane, desalted on a Sephadex*&-25 column
and lyophilized.
The specific activities of the lysozyme preparations
were determined by first measuring the lysozyme activity as
described above and using the Biorad protein assay with chicken
Tr~murk - 23 -
2002480
, lysozyme as standard to measure protein concentrations. The
'~ results are shown in Table 2.
TABLE 2: Specific activities of purified lysozymes
_ _ _ _ _
Lysozyme Origin Specific activity
(units per microgram of protein)
_________________________________________________________________
Human Milk 756
Yeast 727
Human Gly-4 Yeast 281
Chicken Egg white 263
Yeast 302
_________________________________________________________________
Based on the values given therein, the total synthesis of the
three lysozymes in glucose medium as shown in table 1 is 17, 19
and 19 mg/l for human, human mutant and chicken lysozyme respec-
tively. SDS polyarcrylamide gel analysis showed that all three
samples migrated as single bands having the same mobilities as
the appropriate controls: human milk lysozyme for the human
proteins and egg-white lysozyme for the chicken enzyme. When
subjected to automated Edman degradation, all three proteins had
a single N-terminus of lysine, and further sequence analysis gave
the sequences expected from the DNA sequences. Thus, the chicken
signal sequence is processed correctly from all three proteins.
Comparative Example 1
The growth protocol described in Example 1.2 was
repeated for all three proteins except that 1% ethanol was used
as carbon source instead of 8% glucose. This medium is such that
cell growth and lysozyme synthesis occur simultaneously. When
lysozyme activity in the three cultures were determined, the
- 24 -
. . _ . . .
. ' ~ 2002480 ~i
,
results shown in Table 1 were obtained. For both the human and
human mutant proteins, growth in ethanol decreased lysozyme pro-
duction dramatically to less than 5% of the levels when cells
were grown in 8% glucose. In contrast, chicken lysozyme expres-
sion was only decreased to 50% of the level observed in the 8%
glucose culture.
These results clearly demonstrate that for achieving in
yeast a synthesis of human lysozyme (authentic or mutant, not
chicken) active enough to be of practical interest, it is neces-
sary to work under such conditions that, in accordance with the
invention, growth does not simultaneously take place.
Further tests were still carried out to estimate
plasmid stability under the culturing conditions used in the
above Examples. These tests consist in det~rm; n; ng on Petri
dishes the fraction of yeast cells still displaying leucine
prototrophy at the end of the experiment, i.e., cells having
. _ _ _ _ _
retained the lysozyme expression plasmid. The results thus
obtained are also quoted in Table 1. They show that in the case
of human lysozyme (authentic or mutant, not chicken), cells grown
in the presence of ethanol have substantially lost the plasmid.
Thus, it appears that growth is so impaired by human lysozyme
synthesis that cells having lost the plasmid as a result of
mitotic segregation rapidly overcome those still bearing the
plasmid.
Comparative Example 2
~ sing standard methods, the three lysozyme genes whose
expression in yeast is illustrated in Example 1 were inserted
into expression cassettes using the strong constitutive GAP pro-
moter. The chicken lysozyme construct is shown in Figure 6; the
human and human mutant plasmids are identical except for the
. -'' 2002480 -
lysozyme genes. When these plasmids were transformed into strain
GRF180 and leucine prototrophs selected, no transformants could
be obtained with the human and human mutant plasmids, whereas
transformants were easily obtained with the chicken lysozyme
expression plasmid. These transformants were grown as described
in Example 1 and lysozyme activity determined. Total chicken
lysozyme activity was 110 U/OD as compared to 173 U/OD for the
regulated expression plasmid bearing the ADH2-GAP promoter.
This confirms the conclusion drawn from Comparative
Example 1 that the synthesis of human lysozyme is detrimental for
growing yeast cells. To ascertain that this effect is not
restricted to the specific yeast strain used in the above experi-
ments, the transformation protocol of this comparative example
was repeated with strain AH22 (A. HINNEN et al., Proc. Natl.
Acad. Sci. USA 75, 1929, 1978), strain S150-2B (C. HADFIELD et
al., Gene 52, 59, 1987), strain Y-294 (G.S. BRUGGE et al., Mol.
Cell. Biol. 7, 2180, 1987) and strain MC16 cir (A.B. FUTCHER &
B.S. COX, J. Bact. 157, 283, 1984). Substantially the same
results were obtained as with strain GRF180.
2. PLASMID-MEDIATED EXPRESSION OF HUMAN LYSOZYME IN YEAST USING
THE ALPHA FACTOR LEADER FOR SECRETION
2.1 Construction of the expression vector
Plasmid pAB24AGalphaFLysH (see Figure 7) was made by
isolating the Nhel-BamHl fragment containing most of the human
lysozyme gene without the chicken signal sequence and the GAP
terminator from plasmid pAB24AGScLysH (Figure 2). A synthetic
Xba-Nhe adapter was used to link this fragment to a BamHl-Xba
fragment cont~ining the ADH2-GAP promoter fused to the alpha
factor leader (see A.J. BR~KE et al., Proc. Natl. Acad. Sci. USA
81, 4642, 1984). The resulting BamH1 expression cassette
- 26 -
' - 2002480
:, .
~7
consisting of promoter, alpha factor leader, human lysozyme gene,
and terminator was inserted into plasmid pAB24, yielding
pAB24AGalphaFLysH shown in Figure 7.
2.2 Expression and secretion of human lysozyme
This plasmid was transformed into yeast strain GRF180,
a cir~ derivative of GRFl8, and leucine prototrophs selected.
Transformants were grown in leucine selective medium cont~in;ng
8% glucose for 2 days and then diluted 1:20 into YEP medium con-
t~;n;ng 2% glucose. After 3 days of growth at 30~C, cells were
harvested and lysozyme activity determined as described above.
The results are shown in Table 3.
TABLE 3: Expression and secretion of human lysozyme using the
alpha factor leader
Plasmid Medium Lysozyme activity (U/ml)
SO + S1 S2 Total
_________________________________________________________________
pAB24 YEP+2% glucose 0 0 0
PAB24AGalphaFLysH YEP+2% glucose 114 136 250 -~
_________________________________________________________________ :~
Ctearly, lysozyme is expressed and secreted by the alpha factor
leader lysozyme fusion constructs, although the levels are lower
~han with the chicken signal.
3. INTEGRATION-MEDIATED EXPRESSION OF HUMAN LYSOZYME IN YEAST
3.1 Construction of the inteqration vector
The human lysozyme expression cassette whose construc-
tion is described in Example 1.1 was excised out of plasmid
pAB24AGScLysH (see Figure 2) by digestion with restriction enzyme
BamHl and inserted into integration plasmid YIP5 (see K. STRUHL
et al., Proc. Natl. Acad. Sci USA 76, 1035, 1979) yielding
plasmid YIP5AGScLysH shown in Figure 8.
- 2002480
,
3.2 Expression and secretion of human lysozyme
This plasmid was linearized with Sac2 in the GAP termi-
nator and then transformed into strain GRF181, an ura3 deletion
derivative of GRF180. Uracil prototrophs were selected on uracil
selective plates cont~;ning 8% glucose. Transformants were then
grown in uracil-selective medium cont~;ning 8~ glucose and
diluted 1:20 into YEP medium cont~in;ng 8% glucose for expres-
sion. After 5 days, the cultures were harvested and lysozyme
activity measured as described above. The results are shown in
Table 4. Lysozyme activity was clearly demonstrated for these
integrants but levels were lower than those seen for the plasmid-
mediated expression under the same conditions.
TABLE 4: Expression of human lysozyme from GRF181 integrants
_________________________
~ Integrant N~ 1 2 3 4 5 6
______ _____________________
OD 23 23 21 22 21 22
Lysozyme activity
SO + Sl (U/ml) 601 282207 139 1741397
S2 (U/ml) 224 128 64 73 374 59
Total 825 410271 211 5481456
U/OD 36 18 13 10 26 66
__________________________________________ ______________________
4. INFLUENCE OF SODIUM CHLORIDE ON THE DISTRIBUTION OF HUMAN
GLY-4 MUTANT LYSOZYME IN CULTURES OF TRANSFORMED YEASTS
The yeast strain GRF180 transformed with plasmid
pAB24AGScLysHGly4 (see Figure 4) was grown in m;n;~l medium
lacking leucine and cont~;n;ng 8% glucose for 3 days at 28~C.
The resulting culture was then used to inoculate at 1:150 ratio a
complex YEP medium cont~;n;ng 8% glucose. The same protocol for
- 28 -
- Z002480
lysozyme determination as described in Example 1 was applied to
the cultures obtained after 89 and 209 hours of incubation at
28~C. To determine the effect of mineral salt on lysozyme dis-
tribution, an aliquot part of the culture was supplemented with
NaCl to 0.5 M NaCl after 89 hours and incubation was continued as
in the control culture. In another experiment using the same
inoculum, 0.5 NaCl was present from the start of the culture.
The results obtained are set forth in Table 5.
TABLE 5: Influence of NaC1 on the secretion of human Gly-4
mutant lysozyme from transformed yeasts
_________________________________________________________________ ,
Incubation NaC1 OD Lysozyme activity Lysozyme distribution (%)
time (hr) (0.5 M) U/ml U/OD SO Sl S2
_________________________________________________________________
. 89 - 33 3626 110 0 11 89
-- -209 - 33 3946 120 2 30 68
209 + 27 3436 127 52 3 45
_________________________________________________________________
89 + 21 1562 74 29 1 70
209 + 22 1542 70 67 2 31
The data in Table 5 show that in conventional YEP medium, most of
the lysozyme is found intracellularly (S2 fraction), the more so
as the incubation time is lower. By contrast, when NaCl is added
~to the system, lysozyme is mainly found in the SO+S1 fraction,
i.e. is prednmin~ntly secreted. Substantially, the same lysozyme
distribution is obtained when NaCl is present from the start of
the culture; however, in this case, growth is somewhat inhibited.
The same type of results are obtained with yeasts
transformed to produce authentic human lysozyme.
- 29 -
': 2002480
5. INFLUENCE OF A SYN1'~:'1'IC YEAST CULTURE MEDIUM ON THE
SYNTHESIS AND SECRETION OF HUMAN LYSOZYME
The yeast strain GRF180 transformed with plasmid
pAB24AGScLysH (see Figure 2) was grown in minim~l medium lacking
leucine and cont~ining 8% glucose for 3 days at 28~C, the result-
ing culture was then used to inoculate at a 1:6 ratio a complex
YEP medium which contained 8% glucose. After 48 hours at 28~C,
the cells were harvested by centrifugation and resuspended in the
same volume of a synthetic medium whose composition is given in
Table 6.
- 30 -
;'' 2002480
TABLE 6: Synthetic medium for the synthesis and secretion of :-
human lysozyme
KH2PO4 . 6 g
- MgSO4.7H2O 3 g
CaCl2 2H2~ 0.1 g
NaCl 0.1 g
(NH4)2So4 40 g
Caseine hydrolysate 20 g
Vitamin mix. 10 ml
Biotine 0.002%
Folic acid 0.002%
Calcium Pantothenate 0.4%
Nicotinic acid 0.4%
Pyridoxine ~ HCl 0.4%
Thiamine ~ HC1 0.4%
p-Aminobenzoic acid 0.2%
Riboflavine . 0.2%
- Myoinositol 2.0%
Trace elements solution 10 ml
MnSO4 0 4%
ZnSO4 0-4%
FeC12 0.2%
Sodium molybdate 0.2%
Boric acid 0.5%
Cupric sulfate 0.04%
KI 0.1%
Nucleotides and amino acids supplements 40 ml
Adenine 1%
Uridine 1%
Tryptophane 1%
Methionine 1%
Cysteine 1%
Threonine 1%
Histidine 0.05%
Water q.s.p. l liter
Z002480
For the sake of comparision, an aliquot part of the
cells was resuspended in a fresh YEP medium. Both media were
supplemented with 8% glucose. The resulting suspensions were
then further incubated at 28~C for 90 hours and the lysozyme
distribution in the cultures determined as explained in Example
1.
The results obtained are shown in Table 7.
~ABLE 7: Influence of the medium on the synthesis and secretion
of human lysozyme by transformed yeasts
_________________________________________________________________
Medium OD Lysozyme activity Lysozyme distribution (%)
(+8% glucose) U/ml U/OD SO Sl S2
_________________________________________________________________
Synthetic 59 10992 186 68 5 27
Complex (YEP) 56 6542 117 4 19 77
_______________________________________________________________ ~
The data in Table 7 confirm those of the preceding
example in that YEP medium, although favorable for growth, does
not promote extensive secretion: about 3/4 of the lysozyme pro-
duced remains intracellular. By contrast, in the synthetic
medium used, about 3/4 of the lysozyme is secreted, 93% of which
being released into solution, i.e., in a form easily recoverable
by conventional means, e.g. ultrafiltration.
However, other experiments have shown that this syn-
thetic medium does not ensure especially active growth. Thus,
again, it appears that it is important, in accordance with the
present invention, to dissociate biomass production from lysozyme
synthesis and select separately the conditions of both steps in
order to achieve optimum production of human lysozyme.
