~oo~~o~
_1_
SOMATOTROPIN ANALOGS
FIELD OF INVENTION
This invention relates to analogs of animal somatotropins. More
specifically, the invention relates to bovine somatotropin analogs.
BACKGROUND OF 'THE INVENTION
Somatotro~pins were originally discovered in pituitary gland
extracts from various, animal species. In general, somatotropins are
conserved molecules and similarities in amino acid sequences and
structure are found between different species of animals. Bovine
somatotropin (or growth hormone) has been well studied. The litera-
ture was reviewed by Paladini, A.C. et al., CRC Crit. Rev.
Biochem. 15:25-56 (1983).
Somatotropins, including bovine somatotropin, are globular
proteins comprising a single chain of approximately 200 amino acids,
having two inLramole~~ular disulfide bonds. Specifically, the most
common farm of natural bovine somatotropin (bSt) has a single 190-191
amino acid chain, a globular structure with two intramolecular
disulfide bonds and a molecular weight of about 22,000 daltons.
Natural t>St ext:racted from pituitary glands is, however, a
heterogeneous mixture of proteins. At least six major forms of the
protein have been described. The longest form has 191 amino acid
residues and an ala-phe amino terminus. The second form has 190
amino acid residues a;nd a phe amino terminus. The third form has 187
amino acid residues ;and a met amino terminus. The remaining three
forms of bSt substitute valine for leucine at position 127. In
addition to this heterogeneity, undefined heterogeneity of bSt has
also been described. (Hart, I.C. et al., Biochem. J. 218:573-581
(1984); Walla~:e, M. and Dickson, H.B.F., Biochem. J. 100:593-600
(1965)). Unde:Eined electrophoretic heterogeneity is seen when native
extracts are fractionated by anion exchange chromatography. It has
been shown that the defined forms have different relative potency in
bioassays. Also, it has been shown that other undefined species of
bSt when fractionated on ion exchange columns demonstrate varying
degrees of bioactivi.t:y in rat growth models (Hart, et al. and
Wallace and Dickson, ;supra).
It is not known whether undefined heterogeneity is due to
genetic variability, to in vivo post-translational modification, to
differences in phosplzorylation (Liberti, J.P, et al., Biochem. and
~0~05~02
_2_
Biophys. Res. Comm. 128:713-720, 1985) or to artifacts of isolation.
bSt produced by recombinant microorganisms, or extracted from
pituitary gland tissue, is important commercially. It increases
lactation in dairy cattle and increases size and meat production in
beef cattle. It is estimated that upwards to 20 mg per animal per
day will be needed to effect commercially acceptable improvements.
Such a dosage will require efficient methods of administration.
Improvements i.n the potency of bSt such as described in this inven-
tion will be of benefit because of resulting reductions in the amount
of drug administered to each animal per day.
Furthermore, one of the major problems in recovering recom-
binantly-produced proteins is the proper formation of the disulfide
linkages. bS~~ has t:wo such disulfide bridges in the native state.
bSt contains :Four cysteine residues located at amino acid positions
53, 164, 181 <ind 189 of mature bSt. The first two form a disulfide
bond which generates the so-called large loop while the latter two
form the small loop of bSt. The recombinant bovine somatotropin
(rbSt) protein produced in E, coli is in a reduced form and requires
in the isolation protocol an oxidation step to form the disulfide
bridges. It teas been observed that reducible dimeric and polymeric
forms of the protein are formed. Dimer has been shown to have
reduced biopotency in. the rat bioassay and reduced milk production in
dairy cows. The dimeric rbSt may also be antigenic. The present
invention overcomes these problems by eliminating the disulfide
bridges, in particular, between cysteines 181 and 189.
INFORMATION DISCLOSURE
Analogs of bSt are known (see, for example, European patent
applications '5,444 and 103,395 and Nucleic Acid Res. 10(20):6487
(1982)).
G. Winter- and A.R. Fersht, TIBS, 2, p. 115 (1984) review the
alteration of enzyme activity by changing amino acid composition at
key sequence locations. They refer to the change of a cysteine to a
serine residue in an enzyme with retention of enzyme activity.
L. Graf, et al, Int. J. Peptide Prot. Res., 7, pp. 467-73 (1975)
demonstrated that the disulfide linkage between cysteine-181 and
cysteine-189 i.s readily cleaved under mild conditions, i.e. , in the
absence of a denaturing agent. They also reported retention of
growth-promoting activity by the reduced bSt as measured in a rat
2005502
-3-
tibia test. This activity was dependent upon blocking the resulting
thiol groups with an uncharged alkylating reagent such as iodoacet
amide. They demonstrated that if alkylation was done with iodoaceta
mide rather than iodoacetic acid there was no significant loss of
growth-promoting activity.
M. Schleyer, et al, Hoppe-Seyler's Z. Physiol. Chem., 364, p.
291 (1983) described studies in which the disulfide bridges of
porcine growth hormone were cleaved by a variety of techniques with
retention of b:LOlogical activity.
M. Schleyer, et al, Hoppe-Seyler's Z. Physiol. Chem., 363, p.
1111 (1982) r~afer to cleavage of the disulfide bridges of human
growth hormone without completely abolishing biological. activity.
A. Wang, et al, Science, 224, p. 1431 (1984), U.S. patent
4,518,584 and U.K. patent application 2,130,219A refer to the
replacement of cystei.ne residues in interleukin-2 by serine and the
effect of the changer on biological activity. At least two of the
three cysteines appeaxed to be required for full biological activity.
P. Mantsa:La and H. Zalkin, J. Biol. Chem., 259, p. 14230 (1984)
refer to the effect of replacing a cysteine in the enzyme glutamine
amidotransfera:~e by a. phenylalanine residue. This change abolished
the ability of the enzyme to activate the amide from glutamine.
U.S. patent 3,264,186 describes the limited cleavage of bovine
growth hormone at methionine to produce an active protein.
T. Tokuna~;e, et al, Eur. J. Biochem. 153:445-449 (1985) refer to
changing the c:ysteinc: at position 165 to alanine in human growth
hormone to remove the disulfide bond between cys-53 and cys-165.
They found th~e ala-:L65 molecule has full biological activity as
examined by they body weight increase of hypophysectomized rats.
SUMMARY OF THE INVENTION
This invention relates to the enhancement of bioactivity,
processability, and product uniformity of animal somatotropins having
a cysteine to serin<a change in amino acids in at least one of
positions 53, :L64, 181 and 189 as exemplified in bSt (cys -~ ser) and
similar change; in sorn<itotropins from other species including porcine
and ovine.
More specifically, the invention relates to mammalian somato-
tropins in whi<:h at least one of the cysteine residues corresponding
to residues 53, 164, 7_81 and 189 i.s replaced with serine.
2005502
-4-
More specifically disclosed are mammalian somatotropins in which
both cysteine residues corresponding to residues 181 and 189 are
replaced with serine.
Even more specifically, are those bSt-analogs wherein the
cysteines located at amino acid residues 181 and 189 are converted to
serine (cys -~ ser bSt:) .
Specifically included are animal somatotropins in which the
cysteine residue corresponding to residue 181 is replaced with serine
or in which ohe cysteine residue corresponding to residue 189 is
replaced with serine. More specifically, the animals are mammals,
even more specifically bovines.
Also spec:ifical:Ly included are animal somatotropins wherein at
least one cysteine residue at position 53 or 164 is replaced with
serine, more specif.'i.cally, wherein the cysteine residue 53 is
replaced with serine, and more specifically wherein the cysteine
residue 164 i:; replac:ed with serine. More specifically, the animals
are mammals, even more specifically bovines.
Also provided are methods for enhancing the growth of animals
that comprises. treatment of the animals with an effective amount of
one of the disclosed. animal somatotropins, specifically wherein the
animal is a mammal, more specifically, wherein the mammal is a
bovine.
Also provided are methods for increasing milk production in a
female ruminant comprising the administration of an effective amount
of a animal somatotropin of this invention, more specifically,
wherein the riuninant is a dairy cow and wherein the somatotropin is
bSt.
Also provided are vectors comprising DNA coding for an animal
somatotropin having a.t least one of the cysteine residues correspond-
ing to residues 53, :L64, 181 and 189 changed to serine, specifically
which are capable of: directing the expression of the somatotropin-
like protein.
Also provided are microorganisms hosting said vectors, specifi-
cally from the bacterial genus, Escherichia.
Both chemical and genetic modifications of these amino acid
residues are embraced. by this invention.
The preferred genetic modifications rely upon single site
specific mutation methods for insertion of serine residues in
2oo~~oa
replacement of the naturally occurring cysteines.
DETAILED DESCRIPTION
Due to the molecular heterogeneity of somatotropins, the
position numbers of :amino acid residues of the various somatotropins
may differ. 7.'he term "native mammalian somatotropin" includes these
naturally occurring :species. Chart 1 illustrates one species of bSt
and the amino acid numbering that corresponds to the modification
sites of this invention. The numbering for other somatotropins may
differ. However, using the cysteines numbered 53, 164, 181 and 189
of the bSt in Chart 1, those of ordinary skill in the art can readily
locate corresponding amino acid sequences in other native animal
somatotropins, or their analogs, to achieve the desired enhanced
bioactivity, processability and product uniformity.
The phrase "cloaest-related native somatotropin" refers to the
narurally-occurring i'orm of animal somatotropin which when compared
to a specific somatatropin analog of the instant invention is more
closely identical in amino acid sequence than any other naturally
occurring form of animal somatotropin. For example, the bSt of Chart
1 is the. "clo:~est-related native somatotropin" to an analog wherein
the cysteine at pos_Ltion 53 is replaced with serine. The phrase
"somatotropin-like protein" refers to both native forms of somato
tropins and to analogs of native somatotropins provided that the
analogs have s:ufficie:nt protein identity with their parent compounds
to have bioactivity as either a growth promoter or as a stimulant for
milk production.
The phrase "animal somatotropin" refers to somatotropins
originating from an:Lmals and includes somatotropins derived from
either natural sources, e.g., pituitary gland tissue or from microor-
ganisms transformed by recombinant DNA techniques to produce a
naturally-occurring form of somatotropin. When, for example, a
specific mammalian source is named, such as a bovine somatotropin,
the somatotrop~in includes those derived from either natural sources
or from transformed microorganisms.
The term "microorganism" as used herein refers to both single
cellular prokaryotic and eukaryotic organisms such as bacteria,
yeast, actinomycetes and single cells from higher plants and animals
grown in cell culture. Transgenic animals are also known to those
skilled in the art for production of heterologous polypeptides.
2005502
-6-
The term "nat:Lve" refers to naturally-occurring forms of
somatotropins which may have been derived from either natural
sources, e.g., pituitary gland tissue or from microorganisms trans
formed b;y recombinant DNA techniques to produce a naturally-occurring
form of somatotropin.
The term "vector" includes both cloning plasmids and plasmids
for directing the expression of a somatotropin by virtue of the DNA
encoding the somatot:ropin being operatively linked to a promoter
capable of functioning in a microorganism. In some circumstances the
term vector can also include chromosomal insertion of the DNA
encoding the heterologous polypeptide.
Somatotropins are very similar in amino acid sequence and
physical structure. Although the processes described in the Examples
are directed toward bSt, the processes are equally applicable to any
animal somatotropin, particularly other mammalian somatotropins,
having the requisite cysteine residues available for conversion to
serine.
During the oxidation step in the isolation of rbSt, reducible
protein dimer and oT~igomer are formed by intermolecular disulfide
bridges. To overcome this problem, rbSt analogs have been con-
structed. These analogs include those having the DNA sequence
corresponding to the codons for cysteine at positions 181 and 189
changed to the: codon for serine, two other analogs having the codon
at either 181 or 189 changed to a serine codon, and one encoding a
truncated rbSt protein which contains a translational stop codon at
position 179. These four analogs were made as gene fusions and were
expressed using expression vector pCFM414 and the E. coli strain
AM343c. The c~ectors have been designated pRA-bSt/hyb-Ser181/9, pRA-
bSt/hyb-Ser181, pRA-b~St/hyb-Ser189, and pRA-bSt/hyb-179T. A vector
containing the. DNA which encodes an unmodified rbSt product, pRA-
bSt/hyb, was also constructed to serve as a control. All five of
these vectors were found to express rbSt at high levels in the AM343c
strain.
The higher relative potency of the cys ~ ser bSt is readily
determined using hypophysectomized rats (Evans, H.M. and Long J.A.,
Anat. Rec. 21:61, 192:L). Relative increases in total body weight are
recorded using pituitary bSt, rbSt and various fractions of bSt
analogs.
2005502
_, _
Administration of cys -~ ser bSt into dairy cattle is done
according to L:nown methods using any route effective to deliver the
required dosage to the animal's circulatory system. Modes of
administration include oral, intramuscular injections, subcutaneous
injections and. the use of timed-release implants. The preferred mode
of administration is by subcutaneous injection using a timed-release
implant. Appropriate vehicles for injections include physiologically
compatible buffers such as sodium bicarbonate, sodium phosphate, or
ammonium phosphate solutions. Timed-release implants are known in
the art, e.g., U. S. Pat. 4,333,919.
The effective dosage range is from 1.0 to 200 milligrams per
animal per day. The greater the amount of bSt given, the greater the
resulting increase in growth, lactation or numbers of mammary
parenchymal cells. Most preferably, the dosage range is from 5 to 50
milligrams per day.
Because growth hormones are very similar in their amino acid
sequences, hormones originating from one species can usually enhance
the growth of ether unrelated animal species. The bSt analogs of the
present invention can be used to produce increased growth in the
species in which native bSt has been shown to have growth-related
bioactivity such as lbovines, sheep, rats, salmon and chickens. The
preferred animals are bovines used for beef such as bulls, heifers or
steers.
Beef cattle are slaughtered just prior to reaching full maturity
and size. Cy,s -~ ser bSt can be used to produce increased growth
rates in beef ~~attle by administration any time between weaning until
slaughter. Cys -~ seer bSt is administered to beef cattle for a
minimum of 30 days and for a maximum of 450 days depending upon
desired time of slaughter. Animals used for veal are typically
slaughtered at appro~;imately 6 months of age and 10 to 30 mg/day of
cys -~ ser bSt is administered up until the age of slaughter to
effectuate desired increases in growth rate.
For purposes of increasing lactation in bovines, particularly
dairy cows, c.ys -~ s~er bSt is administered between 30 and 90 days
post-partum anal continued for up to 300 days. Cys -~ ser bSt will
also increase lactation in other commercial milk-producing animals
such as goats ;and sheep.
Strains: The MC1000 (F-, araDl39, del(araABC-leu)~6~9, galU,
-8_ 200 5502
trpam, malBam, rspL, :relA, thi) (available in the Experiments with
Gene Fusion Strain Kiv, Cold Spring Harbor Laboratory, Cold Spring
harbor, N<~w York ) an<i JM83 (ara, del(lae-pro), rspL, phi80 lacZ
de1M15) (avaiable from American Type Culture Collection, 12301
Parklawn Drive, Rockville, Maryland 20852) strains are used as
competent cells for ve<:t:or construction. The AM343c (F-, sup° tonA)
strain is used for inductions, It was derived from expression'strain
AId343C by curing the strain of the endogenous expression plasmid
pCFM414-bGH. Strain A,M343C (also designated UC~9801) was deposited
at Agricultural/Research Service Culture Collection, Northern
Regional Research Center, 1815 North University Street, Peoria,
Illinois 61604, on 24 ,January 1989, and was given accession number
NRRL B-18443. An alternative strain for expression is BST-1C (see
U.S. Patent No. 5,240,837).
Plasmids: The pUC!1 (J. Vieira and J. Messing, Gene 19, pp. 259-
268 (1982), awailable~ from Beth esda Research Laboratories) and
pCFM414-bGH vecl:ors were used in the constructions describe herein.
The pCFM414-bell vector (deposited with strain AM343C, above) was
constructed from pCFM414 (U.S. Patent 4,710,473) by inserting an
EcoRI/BamIII fragment that contains the trp promoter, and the trpL
ribosome binding; site from E, coli, and a synthetic bSt gene. The
pTrp-BStml and the pTrp-BStmlb vectors are described in U.S.
Patent No. 5,240,837. $oth of these vectors were constructed using a
bSt cDNA gene (see U.S. 1?atent No. 5,240,837). Both
vectors have been modified in the DNA sequence encoding the bSt
carboxyl-terminus. Th,e pTrp-BStml vector has a BamHI restriction
site immediately after the translational stop codon for bSt~and
contains a serine codon at position 189. The pTrp-BStmlb vector is
similar to pTrp-BStml except that it contains a cysteine codon
corresponding to position 189 of bSt.
Media: Media hams been previously described (J. H. Miller,
Experiments in Molecular Genetics, Cold Spring Harbor Laboratory,
Cold Spring Harbor, New York .published in 1972) .
DNA Preparation and CloCring protocols: Most DNA preperation and
general techniques are done by techniques well known to those skilled
in the art (see, T. Maniatis, et al, Molecular Cloning: A Laboratory
Manual, Cold Spring I-larbor Laboratory, Cold Spring harbor, New York
(1982)). Specifically, DNA
_9_ 200 5502
is prepared as previously described (J.E. Mott, et al, EMBO J., 4,
pp. 1887-1.891 (1985)). Restriction digestions and ligations are
performed according to the manufacturers' recommendations. Restric-
tion enzymes and ligase are purchased from New England Biolabs. DNA
fragments are i:colated from agarose gels by one of two techniques.
For fragments smaller than 800 bps, the bands are cut from the gel,
crushed and frozen on dry ice in the presence of phenol. The aqueous
phase is separat:ed by centrifugation and ethanol precipitated. For
fragments greater than 800 by the band is cut from the gel and
electro-eluted ('T. Maniatis, et al, supra).
Plasmid Transformations: Cells to be transformed are grown over
night and subcultured 1/100. These cells are grown to mid-log phase,
5 ml is centrifuged and resuspended in 10 ml of cold 50 mM CaCl2, and
incubated on ice or at: 4° C for at least one hour. The cells are
again centrifuged and taken up in 0.5 ml 50 mM CaCl2. Approximately
100 ~1 of cells is incubated on ice with plasmid DNA for one hour.
Cells are heat shocked for 7 min. at 37° C, and are plated on LB
plates containing 100 ~g/ml ampicillin. Selections for runaway
vectors are done at 27° C. Selections for non-runaway,vectors are
done at 37° C.
Oligomer Purification: Oligomers are synthesized and purified as
previously described (11.S. Patent No. 5,240,837).
Formation of Synthetic Fragments: The synthetic DNA fragments
for the introduction of the termination codon at position 179 are
formed by heating oligonucleotides JM-1 and JM-2 (Chart 2) in the
presence of ligation buffer to 100° C and allowing the mixture to
cool to room temperature. To generate the four oligonucleotide block
for the 181 ands 189 serine substitutions, oligomers JM-4 and 5 are
first kinased with hi;~h specificity P32-labeled gamma-ATP and then
hybridized to ,;~M-3 and JM-6 (Chart 3). The four oligonucleotide
structure is ligated and isolated from a non-denaturing polyacryl-
amide gel.
Induction Protocol: Cells containing vectors derived from the
pCFM414 runaway vector are grown overnight at 27° C and subcultured
1/50 in broth supplemented with 100 ~g/ml ampicillin. The cells are
grown in a New Brunswi'_ck air shaker at approximately 250 rpm and at
27° C. When the cello reach an O.D. 550 of between 0.2 and 0.4, a
sample for SDS PAGE is taken and the cultures are transferred to a
~YTrade-mark
-lo- 2p0 5502
37° C air shaker. Cells containing vectors derived from pURA-1 are
induced as previously described (U. S. Patent No. 5,240,837).
SDS PAGE: The SDS PAGE protocol has been previously described
(J. E. Mott, et al, Proc. Natl. Acid. Sci. USA, 82, pp. 88-92 (1985)).
The sequencing k:Ct SequenaseTM is purchased from United States
Biochemical. Sequencing is performed according to the manufacturers'
recommendations. DNA for double-stranded sequencing is prepared by
the method of L. B. Agellon and T. T. Chen, Gene Anal. Techn. 3
pp.86-89 (1986). For sequencing double-stranded DNA, the annealing
protocol is modified as follows: 3p1 of 2M NaOH, 2mM EDTA is added to
12~~1 double-stranded plasmid DNA and incubated for 5 minutes at room
temperature, 3~1 of 100ng/pl primer is added and the mix is incubated
for 10 minutes followed by the addition of 6~1 of 3M sodium acetate.
After an additional 5 minute incubation, 1001 of ice-cold 958
ethanol is added and the DNA is precipitated for 20 minutes on dry
ice. The DNA is pelle:ted, rinsed with 70$ ethanol and vacuum dried.
After resuspen:>ion in 8~1 water and 2p1 sequencing buffer, the
sequencing is continued according to the manufacturer's directions.
2.51 of the dGTP termination mixes A, C, G and T are pipetted into
individual wells of a microtiter plate and pre-warmed at 37°C. The
Sequenase enzyme is diluted 1:8 in ice cold TE buffer. For the
labeling reaction, lpl of O.1M DTT, 2p1 of the diluted label mix, 2~c1
of 35S-dATP and 2~1 of diluted Sequenase are added to the annealed
DNA and the reactions ncubated for 2 minutes at room temperature.
For the termination reaction, 3.51 of the labeling reaction is added
to each termination well (A, C, G and T) and incubated for an
additional 5 minutes. The reactions are stopped with 4p1 of stop
mix. After boiling the reactions for 2 minutes at 75°C, 4p1 of each
reaction are loaded onto a sequencing gel.
The temperature sensitive runaway vector pCFM414-bGH expresses
high levels of rbSt. 7.'he vector contains a synthetic rbSt gene which
is expressed from th<~ trp promoter and uses the trpL ribosomal
binding site for initiation of translation. This synthetic rbSt gene
and the cDNA bSt gene (U. S. Pat. No. 5;240,837) both have a unique PstI
restriction site: at this sequence which corresponds to amino acids 90
and 91. Thus hybrid bSt: genes can be made using this common in-frame
site. A hybrid gene, bSt/hyb, containing the sequence encoding the
N-terminal region of the synthetic gene and the carboxyl terminus of
2005502
-11-
the cDNA gene is expressed to produce rbSt protein at high levels
when cloned into the: pCFM414 vector. Using the bST/hyb gene the
distal portion of t:he bSt gene can be altered using the unique
restriction s~Ltes located in the cDNA segment. The cDNA, for
example, contains a MstII restriction site at the sequences which
encode amino skids 1'75, 176 and 177. These can be used to replace
the sequence for the carboxyl terminus with synthetic DNA fragments
which alter the cysteine codon at positions 181 and 189 or
prematurely terminate. translation. In order to take advantage of
restriction sites, the hybrid genes must be placed in a vector in
which these sites remain unique.
Example 1 Construction of a bSt Gene Encoding a Truncated bSt
Lacking the Small Loop
1. Cons'tructio'n of pDH23
The pUC-9 vector (J. Vieira and J. Messing, Gene, 19, pp.259-268
(1982), available from Bethesda Reasearch Laboratories, Gaitherburg,
Maryland 20877) is a. constitutive high copy number vector derived
from pBR322. It contains the gene for ampicillin resistance and the
lac promoter expressing the lacZ' beta-galactosidase gene. The lacZ'
gene encodes a small N-terminal peptide fragment which is capable of
functionally complementing a peptide fragment produced by the
lacZde1M15 beta-galactosidase gene (Vieira and Messing, supra). This
complementation can be visualized by using the chromogenic substrate
X-Gal (Bethesda Research Laboratories, Gaithersburg, MD) which turns
blue in cells with :functioning beta-galactosidase. pUC9 has been
modified to contain unique restriction sites within the sequence for
lacZ' which are referred to as the polyclonal sites. DNA fragments
which are inserted into these sites destroy the ability of the lacZ'
peptide to be produced and to complement the lacZde1M15 beta-galac-
tosidase protein. Such cells do not turn blue in the presence of the
X-Gal indicator .
The pUC-9 vector does not contain a MstII restriction site but
does contain unique sites in lacZ' polylinker for EcoRI, BamHI, PstI,
and HindIII. 'The pUC-9 vector is modified to eliminate the PstI and
the HindIII sites which would interfere with the hybrid gene con-
struction and subsequent modification. This is accomplished by
digesting the vector with HindIII and HinII. A HinII site is also
present i.n the polyclonal site. The HindIII site is filled with PolA
-12- 200 5502
klenow, the vector i:3 ligated and transformed into competent JM83
cells. Resultant plasmids are screened and a candidate selected
which has lost the Hi.ndIII and PstI restriction sites but retained
the BamHI and EcoRI sites. This alteration to the polyclonal site
does not affect the ability of the lacZ' peptide to complement since
the lacZ' gene retains the proper reading frame. The resultant
vector is desiL;rated lpDH23. The unique EcoRI and BamHI restriction
sites permit the cloning of the synthetic bSt gene.
2. Construction. of bSt/hyb a Synthetic bSt - bSt cDNA Hybrid
Gene
The synthetic bSt gene is isolated from plasmid pCFM414-bGH as
an EcoRI/BamHI fragment and is cloned into the pDH23 vector which is
previously digested with BamHI and EcoRI. The EcoRI/BamHI fragment
also contains the trp promoter and the trpL ribosome binding site.
The resultant vector j~s designated pDH-bSt. In this vector the PstI
and BamHI restriction sites in the bSt gene are unique.
A PstI/BawEiI fragment is isolated from the pTrp-BStml vector.
This vector contains the bSt cDNA which is expressed from the trp
promoter and u:>es the trpL ribosomal binding site. The bSt gene in
pTrp-BStml is modified to encode a serine at position 189. The pTrp-
BStml vector i~; digested with Pstl and BamHI and a fragment of about
315 by is isolated which contains the DNA sequence for the carboxyl
terminus of bSt. This fragment is ligated into plasmid pDH-bSt,
which is previously digested with PstI and BamHI replacing the Pstl
to BamHI sequence of the synthetic bSt gene. The resultant vector
from this cloning is designated pDH-bSt/hyb-1895. This construction
contains the unique restriction site MstII which is located between
the Pstl and BamHI restriction sites of the bSt gene.
3, pI7H-bSt/hyb-1895 Vector Derivatives
Three vectors are derived from pDH-bSt/hyb-1895 of section 2.
For the first cloning, the pDH-bSt/hyb-189S vector is digested with
PstII and BamEiI and the large vector fragment is isolated. A
PstI/BamHI fragment :Ls isolated from pTrp-BStmlb fU.S.Pat.No.5,240,837).
pTrp-BStmlb is similar to pTrp-BStml except that it contains a syn-
thetically der.-Lved oligonucleotide fragment cloned between the MstII
and BamH:L restriction sites. This fragment is identical to the
fragment described im Chart 3 except that it contains the cysteine
codon TGC at the positions corresponding to amino acids 181 and 189.
2t~t~55D2
-13-
The codon usage is optimized and a HindIII restriction site is
engineered into the sequence between codons 181 and 189. The
PstI/BamHI fragment is isolated from pTrp-BStmlb and ligated into the
large fragmenvt of the pDH-bSt/hyb-189S vector to generate pDH-
bSt/hyb. The lbSt gene of pDH-bSt/hyb encodes the natural bSt.
For the next two clonings the pDH-bST/hyb-189S is digested with
MstII and BamHI and t:he large vector fragment from the digestions is
isolated. A synthetic fragment derived from four oligonucleotides is
shown in Chart 3. This synthetic fragment is designed to be inserted
into the Mst7:I/BamHl; restriction sites. The insertion of this
fragment generates a gene encoding a bSt protein with serine at amino
acid positions 181 and 189. This fragment is ligated to the large
MstII/BamHI fragment of pDH-bSt/hyb-1895 to create the second vector
pDH-bSt/hyb-Se:r181/9. In this vector the restriction sites PstI,
MstII, HindIII, and BamHI are unique.
The third vector derived from pDH-bSt/hyb-189S is made by
inserting the synthetic fragment shown in Chart 2. This fragment
encodes a translational stop codon corresponding to position 179 of
the bSt. The :fragment is ligated to the MstII/BamHI fragment of pDH-
bSt/hyb-1895 t.o generate a bSt gene that encodes a truncated bSt
lacking the small loovp. This vector is called pDH-bSt/hyb-179T.
The pDH-bSt/hyb-Ser181/9 and pDH-bSt/hyb-179T constructions are
confirmed by DIVA sequence analysis.
Example 2 Construction of bSt Genes with Individual Serine
Substitutions Encoded at either Position 181 or 189
This example set=s forth the cloning strategy for constructing
genes with inciividua~l serine codons at position 181 or 189. Two
starting vectors are used, pDH-bSt/hyb and pDH-bSt/hyb-Ser181/9
(Example 1). pDH-b;>t/hyb encodes the natural bSt gene and pDH-
bSt/hyb-Ser181/9 has ;~erine codons for amino acids 181 and 189. Both
vectors have a unique HindIII restriction site located between the
sequence for these two codons. Digestion of these vectors with EcoRI
and HindIII generates; two fragments from each vector. The 850 by
fragment contains the trp promoter and about 95$ of the bSt gene
inclusive of the 181 codon. The 850 by fragments are exchanged
between the starting rectors in the cloning so that the fragment from
pDH-bSt/hyb containing a cysteine codon at 181 is introduced into the
pDH-bSt/hyb-Ser181/9 vector which has the serine codon at 189, and
_14_ zoo 5502
conversely the 850 by fragment containing the serine 181 codon from
pDH-bSt/hyb-Se~rl81/9 Ls cloned into the pDH-bSt/hyb vector containing
the 189 cysteine codon. The results of this cloning are two vectors,
pDII-bSt/hyb-Ser181 and pDH-bSt/hyb-Ser189, which express bSt analogs
containing single cysteine to serine substitutions at either amino
acid position :L81 or 189.
Example 3 pCFM414 Clonings
For high :Level e:Kpression the modified genes are cloned into the
expression vector pClfit414-bGH. pCFM414-bGH is digested with EcoRI
and BamHI and the large vector fragment is purified, thus removing
the endogenous bSt gene. The vectors pDH-bSt/hyb, pDEi-bSt/hyb-
Ser181/9, pDH-bSt/hyb-Ser181, pDH-bSt/hyb-Ser189 and pDH-bSt/hyb-179T
are digested with EcoRI and BamHI, and an 870 by fragment containing
the trp promoter, trpL ribosome binding site and the entire bSt gene
is isolated from each. The fragments are individually ligated to the
pCFM414 vector fragm<~nt and transformed into competent cells of E.
cola strain MC1000. Plasmid DNA for the individual constructions is
prepared. The resultant vectors are designated pRA-bSt/hyb, pRA
bSt/hyb-Ser181,/9, pRA-bSt/hyb-Ser181, pRA-bSt/hyb-Ser189 and pRA
bSt/hyb-179T.
Example 4 Expression of the pRA Vectors
The vectors pF;A-bSt/hyb, pRA-bSt/hyb-Ser181/9, pRA-bSt/hyb-
Ser181, pRA-bSt/hyb-Ser189 and pF;A-bSt/hyb-179T are transformed into
competent cells of E. cola AM343c. The cultures are induced as
described above, and. a six hour post-induction sample from each
culture is analyzed by SDS PAGE. All constructs show high level
expression of their respective rbSt proteins. Alternatively, E. coli
strain BST-1C is used for expression (U. S. Patent No. 5,240,837).
Example S Construction of an Alternative Expression System for
the bSt Analog Containing Serine at Positons 181 and
189
Vector pDH-bSt/hyb-Ser181/9 as described above contains between
its EcoRI and Pstl sites the trp promoter, trpL ribosome binding
site, and the synthetic bSt DNA sequence encoding amino acids 1 to 90
of bSt, from t:he PstI site to the MstII site it contains a sequence
derived from t:he cDNA gene corresponding to amino acid positions 91
to 176 (Example 1), and from the MstII to BamHI restriction sites
contains sequences derived from the synthetic oligonucleotide block
200 5502.
- 15 -
(Example 1). The portion of the gene derived from the synthetic bst
gene can be deleted by digesting pDH-bSt/hyb-Ser181/9 with EcoRI and
PstI and isolating i:he large vector fragment. The deleted segment can
be replaced with an EcoRI, PstI restriction fragment from pTrp-BStm4
(U.S. Patent No. 5,240,837), which contains the trp promoter, and the
trpL ribosome binding site and the DNA sequence from the cDNA encoding
amino acids 1 to 90 of bSt. This DNA also contains a GCC to GCT codon
change at the codon corresponding to the second alanine of bSt which
results in improved expression (U.S. Patent No. 5,240,837). The
resultant vector is called pDH-bStm4-Ser181/9.
To introduce the bStm4-Ser181/9 cDNA gene into the pURA
expression vector (U. S. Patent No. 5,240,837), both the pDH-
bStm4Ser181/9 and AURA-1 vectors are digested with EcoRI and BamHI
restriction enzyme;. The large vector fragment from pURA-1 and the
smaller bSt gene fragment from pDH-bStm4-Ser181/9 are isolated and
ligated together with a BamHI transcriptional termination fragment of
rpoC (U.S. Patent No. 5,240,837). The ligated DNA is used to
transform competent= cells of MC1000. The resultant vector, pURA-
bstm4-Ser181/9 is identical to pURA-4 (U. S. Patent No. 5,240,837)
except that it contains the 181 and 189 cys -a ser modifications.
For expression, the vector is transformed into the BST-1C
strain (U. S. Patent No. 5,240,837) and induced as previously described
(U. S. Patent No. 5,240,837).
Example 6 Consi~ruction of bSt Genes with Serine Replacing
Cystsaine at Position 53 or 164
Ser-53 or ser-164 is made from DNA encoding bSt having
serine at those positions by oligonucleotide-directed mutagenesis on
a double-stranded DNA plasmid, using the following procedure:
The oligonucleotide primer is phosphorylated by incubating
4 ul of oligonucleotide (4 Ng) with 54 pl of water, 7 N1 of buffer
(0.5 M Tris-HC1, pl-I 7.4, 0.1 M MgCl~, 0.1 M dithiothreitol), 2 ul of
50 mM ATP, and 3 ul of 10 units/N1 T4 polynucleotide kinase to a final
volume of 70 N1 at: 37° C for 60 minutes. The reaction mixture is
extracted with phenol and ether, evaporated to dryness, and dissolved
in 3 N1 of HBO. Two N1 of this phosphorylated oligonucleotide is mixed
with 15 N1 of. denatured plasmid DNA (denatured by incubating 2 pg of
DNA in 12 N1 with ~1 N1 of 2 N NaOH and 2 mM EDTA for 15-20 minutes at
room temperature), follawed by the addition of 6 N1 of 3 M
JJ:
-16- 200 5502
sodium acetate, and 100 pl of ethanol. The mixture is kept in dry
ice for 15-30 minutes and the precipitate is collected by centrifuga-
tion, washed with 708 ethanol, dried, and dissolved in 25 pl of 10 mM
Tris-HG1, pfi 7.4 and 1 mM EDTA. This solution is added with 1 pl of
S the phosphorylat.ed oli;gonucleotide, 20 pl of water, 7.5 pl of 1 M
Tris-HC1, pH 8.3, 10 ~1 of 0.2 M NaCl, 25 ~1 of 0.1 M MgCl2, 20 ~1 of
mM dNTP, 17.5 ~1 of 5 mM ATP, 20 ~1 of 0.4 M ~-mercaptoethanol, 16
ul of Klenow enzyme (80 units), 20 ~1 of T4 DNA ligase (8,000 units),
and 18 ~1 of T4 gene 3:! protein (32 fig). The reaction mixture, in a
10 total volume of 200 ~1, is incubated at 37° C for 1 hour, mixed with
NaCl to final 0.2 M, extracted with phenol and ether, and precipi-
tated with ethanol. The precipitate is dissolved in 100 ~1 of 10 mM
Tris-HC1, pH 7.4 and 1 ;mM EDTA and used for transformation of E. cold
Dtll, MC1000 or other appropriate strains. Depending on the transfor-
mation efficiency, 2-20 pl of the mutagenized plasmid are used for
transformation.
The transformants carrying the plasmid with the mutation are
screened for by colony hybridization, using the mutagenesis oligonu-
cleotide as the probe amd selecting washing conditions to detect the
mutation over the wild-type background. The procedures for hybridi-
zation are as described in T. Maniatis, E.F. Fritsch and J. Sambrook,
Molecular Cloning. In general, 1-2 pg of the oligonucleotide probe
is phosphorylated with 100-200 MCi of (T-32P)ATP and 10-20 units of
T4 polynucleotide kinase in 50 mM Tris-HCl, pH 7.8, 10 mM MgCl2, and
10 mM dithiothreotol, Ln a total volume of 20 ~1. Hybridization is
carried out in 5x Denhardt's, 5x SSC and 0.1$ SDS at 42° C. The
filters are was'~hed in 5x SSC and 0.1$ SDS at a temperature which
allows the oligonucleotide probe to remain annealed to the changed
sequence and dissociated from the wild-type sequence. Transformants
that hybridize :~trongl~~ with the oligonucleotide probe are selected
and DNA sequencing is carried out to confirm the altered sequence.
Using the above techniques, oligonucleotide-directed mutagenesis
to generate DNA encoding bSt with serine at position 53 or 164 is
carried out with plasmi.d pURA-m4 (U.S.Pat.Ido.5,240,837). To change cys-53
to serine, an oligonucleotide with the sequence GTTGCCTTCTCTTTCTCTGA-
AAC is used for mutagenesis and as a probe for colony hybridization
with washing temperature for the filters at 51° C. The plasmid with
the change. is called pURA-m4-53ser. The serine substitution at
~v0 5502
-17-
posit:Lon 164 is generated with the oligonucleotide CTGCTCTCCTCTTTCCG-
GAAGG using 51° C for washing of filters and the resulting plasmid
i.s
called pURA-m~+-164ser.
Example 7 Construction of a bSt Gene with Serine Replacing
5 Cysteine at Both Positions 53 artd 164.
This strategy uses the Pstl site located at codon 90 of the bSt
gene to splice together the bSt sequences with single serine sub-
stitutions at position 53 or 164. To remove other PstI sites in the
vector for convenient manipulation, the bSt sequence with serine at
10 position 164 is subcloned into pUll23 by isolating the EcoRI/BarnliI
small fragment containing the trp promoter and the bSt gene from
pURA-m4-164ser and ligating it to the EcoRI/BarnHI large vector
fragment isolated .From pDH23. The resulting plasmid pDl1-m4-164ser
has a single PstI site at codon 90 of the bSt gene. The EcoRI/PstI
15 large vector fragment containing the 3' half of the bSt sequence with
serine at position 164 is isolated from pDH-m4-164. This fragment is
ligated to t:he small EcoRI/PstI fragment containing the trp promoter
and the 5' half of the bSt encocti.ng sequence with serine at position
53 isolated from pURA-m4-53ser. The resulting plasmid is named pDH
20 m4-53/164ser.
For high level expression of bSt with serine at positions 53 and
164, the EcoRI/Hind:~lI small fragment containing the trp promoter and
the bSt sequence is isolated from pDH23-m4-53/164ser. This .fragment
is ligated t;o the EcoRI/HindIII large vector fragment isolated from
25 pURA-m4. The result:3.ng plasmid is named pURA-m4-53/164ser.
Example 8 Construction of a bSt Gene with Serine at Positions
53 , l-64, 181, and 189.
To construct: a vector encoding bSt with serine replacing
cysteine at positions 53, 164, 1.81, and 189, the EcoRI/MstII small
30 fragment carrying the trp promoter and most of the bSt coding
sequence with serine at positions 53 and 164 is isolated from pDH-
m4-53/164ser. 1'kiis fragment is ligated to the EcoRI/PistII large
vector fragrn~~nt containing the 3' bSt coding sequence with serine at
positions 181 and 189 isolated from pDll-bSt/hyb-ser181/9. The
35 resulting plasmid is named pDll-rn4-53/16+/181/189ser. For high level
expression of rbSt with all 4 cysteine residues replaced by serine,
the EcoRI/BamflI small fragment containing the trp promoter and the
bSt coding sequence wi.tlt seri.ne at positions 53, 164, 181 and 189 is
-18- 200 5502
isolated from pDH-m4-53,/164/181/189ser (Fragment I). The EcoRI/BaroHI
large vector frs:gment (Fragment II) and the 350 by Bamtil fragment
carrying the trFinscription terminator for the E. cola genes rpoBC
(Fragment III) are isolated from pURA-m4. Fragments I, II and III
are ligated and <i plasmad with the terminator in the correct orienta-
tion is selected and named AURA-m4-53/164/181/189ser.
Example 9 Expression of bSt with Serine at One or More of the
Positiona 53, 164, 181 and 189.
The vector pURA-m~E-53ser, pURA-m4-164ser, pURA-m4-53/164ser or
pURA-m4-53/164/1l31/189ser is transformed into E. coli BSt-1C and
induced as described in patent application U.S. Patent No. 5,240,837.
Example 10 Biological Activity of Cys -~ Ser bSt Analogs
AM343c cello transformed with pRA-bSt/hyb-Ser181/9 were grown in
200 L of beer using a modified Luria Broth. Initially the cells were
grown at 27°C, F~H 7 until an A550 of 1 was obtained. Induction was
caused by a temperature shift to 37°, a pH shift to 6 and the
addition of yeast extract(U.S.Pat.No.5,240,837). rbSt is harvested from
the cells collected by centrifugation as follows:
1) Cells acre first lysed with lysozyme and the lysate is then
washed with Tergitol.
2) The DN~~ is sheared and the inclusion bodies are washed and
then solublized with sodium lauroyl sarcosine.
3) rbSt so produced is oxidized and folded by stirring with air
for 24 hrs.
4) Sodium Lauroyl sarcosine is removed by treatment with Dowex-
1x4.
5) rbSt mixture i.s chromatographed over DEAE-Sepharose and the
rbSt fractions are recovered and lyophilized.
For the rat bioassay, hypophysectomized, female, Sprague-Da~ley
rats are purchased from Charles River Laboratories, Inc. The rats
are divided into test groups of 7 rats per group. A standard
pituitary-derived bSt for control is dissolved in 0.15 M NaCl/0.03 M
sodium bicarbonate buffer, pH 10.8. The pH of the solution is
adjusted to 9.5 and the solution is diluted to a protein concentra
tion of 2 mg/ml with a similar buffer at pH 9.5. The test rbSts are
*
prepared as lyophilized powders containing Tween 80 and rnannitol in
sodium bicarbonate buffer. These are reconstituted to a 10 mg/ml
solution which is then diluted 1:5 to make stock solutions. In
*Trade-mark
200502
-19-
addition to the cys -~ ser analogs, a preparation of recombinantly
produced natural rbSt: is used as a control. Each animal in the test
groups is injected trice daily (100 pl/injection) for a total dosage
of 7.5, 15, 3() or 60 mg protein/day for a total of nine days. The
rats are weighed daily throuout the treatment period, except week-
ends.
For the cow bioassay, lactating Holstein cows were used. These
cows were free of metabolic disorders, mastitis, disease and medica-
tion before assingment to the study. The cows were blocked in four
replicates of five cows each based on the average milk yield on days
3 and 2 befor~a the t:irst injection of test compound. Cows between
122 and 289 days postpartum were used for the study. The five cows
of each block were assingned randomly to one of three experimental
groups: 5 mg and 15 mg each daily of cys -~ ser rbSt, rbSt process
control and non-injected control group. Cows were injected at about
0745 to 0815 hours daily; i.e., 2 to 3 hours after milking. The same
lyophilized preparations used for the rat study were used to make 10
mg/ml stock solutions for the injections. Injections were made once
daily in the semitendinous muscle and continued for 7 days. Cows
were milked at 0500 ~3nd 1600 hours according to the routine milking
schedule and cnethodo'Logy of the dairy. Calibrated milk jars were
used to estimate individual cow milk weights at each milking for each
cow in the study from 3 to 5 days after the 7 days of injections,
i.e., a total of 15~ days. Milk yield was adjusted to 3.5$ fat
corrected milk.
A summary of the analytical profiles of the cys 1 ser analog
preparation and the control preparation of recombinantly-produced
natural rbSt is given in Table 1.
2005502
-20-
Table 1
Assay control cxs - ser
RIA 92% 18%
SDS-PAGE (Monomer) 97.8$ 98.0%
IEF (Major pI) 8.1 and 8.2 8.1 and 8.2
Endotoxins 1.5 EU/mg protein 6.2 EU/mg protein
HPLC-SEC Polymer 0.00% Polymer 0.008
Monomer 97.97% Monomer 98.99$
84.34% by wt. 90.93% by wt.
RP-HPLC 0x.116.7% Ox. 120.32
Red. 0.73% Red. 0.2%
DNA Content 0.15 ng/mg 0.115ng/mg
E. coli Protein <0.05% 0.052%
*This analog had botlh cysteines at positions 181 and 189 replaced
with serine (lE~l, 189;) .
Generally the two preparations are similar in their analytical
profiles. However, in the radioimmune assay the cys -~ ser bSt analog
was only 18% ofd the s nandard as compared to 92% for the control.
Milk yields were also higher for cows treated with the cys -~ ser
bSt (181, 189) analog as compared to the natural rbSt control (Table
2).
Table 2
Fat Corrected Milk Yield
(kg milk/day)
Dose (mg)
Compound 0 5 15
Control 24.6
rbSt Control 25.0 25.7
Cys -~ ser 27.6 26.2
(181, 189)
When injected into hypohysectomized rats, the cys -~ ser (181,
189) rbSt is snore active than the control preparation in inducing
body weight gain (Tab:Le 3).
-21- 200 55 oz
Table 3
Body Weight Gain Potency in
Hypophysectomized Rats
Relative to Pituitary Relative to rbSt Control
PotE~ncy Potency
Comgound EstiLmate 95$ CL Estimate 95$ CL
Pituitary
bSt 1L.0
rbSt Control
:L.42
1.09-1.87
1.0
Cys -~ :L.78 1.36-2.35 1.25 0.96-1.64
ser
Example Eatpression of bSt with Serine at Positions 181
11 and 189
using Vector pURA-bStm4-Ser181/189
Cells (BST-1C) were transformed with pURA-bStm4-Ser181/189
and
grown in
200 liters
o:E beer.
The rbSt was harvested
from the collected cells as in Expample 10 except that
it was
necessary to repeat Steps 4 (sodium lauroyl sarcosine removal
by
Dowex-1x4 treatment) and 5 (chromatography on DEAE-Sepharose).
This
was done for two preparations from the fermentation. In
vitro
analyticaldata are given in Table 4.
Table 4
AnalysE~s of rbSt Analog Preparations
Assa Preparation A Preparation B
RIA 41$ 31$
(iPLC '
Oxidized (Wt $) 72.68 74.05
Reduced (Wt $) 0.78 0.21
SEC
Polymer (Area $) 0.92 0.00
Dimer (Area
$) 4.05
3.95
Monomer (Area $) 93.51 94.15
Monomer (Wt$) 84.17 79.55
Total Protein
by
Amino Acid
Anal~rsis
98.0 95.3$
*Trade-mark
~o~Ssa~
-22-
CHART 1. Amino Acid Sequence Of Bovine Somatotropin
1
ala phe pro ala met ser leu ser gly leu phe ala asn ala val
20
leu arg ala gln his leu his gln leu ala ala asp thr phe lys
15
glu phe glu ark; thr t:yr ile pro glu gly gln arg tyr ser ile
gln asn thr gln val ala phe cys phe ser glu thr ile pro ala
pro thr gly lya asn glu ala gln gln lys ser asp leu glu leu
20 80
leu arg ile se:r leu leu leu ile gln ser trp leu gly pro leu
100
25 gln phe leu ser arg val phe thr asn ser leu val phe gly thr
35
120
ser asp arg val tyr glu lys leu lys asp leu glu glu gly ile
leu ala leu met arg glu leu glu asp gly thr pro arg ala gly
140
gln ile leu lys gln thr tyr asp lys phe asp thr asn met arg
160
ser asp asp ala leu l.eu lys asn tyr gly leu leu ser cy~ phe
180
arg lys asp leu his l.ys thr glu thr tyr leu arg val met lys
190
cys arg arg ph.e gly glu ala ser cys ala phe
2005502
-23-
CHART 2. Assembly of a Synthetic DNA Fragment for Introduction of a
Translational Terminator at Codon 179.
A. Sequence of Individual Oligomers
JM-1 3' GGATAATGTGGGAGT
JM-2 3' CCCACATTATCCCTAG
B. Sequence of the Synthetic Fragment
5' TGAGGGTGTAATAGG
CCCACATTATCCCTAG
CHART 3. Construction of a Synthetic Fragment for Cysteine to Serine
Codon Changes at Positions 181 and 189.
1) Sequence of the Individual Olagomers used to Construct the
Synthetic Fragment.
JM-3 3' CTTTGCTGCCCTAAAGTATTGGGAGT
JM-4 3' GGATAATCTTTCGCCTCCTTCGAAGTGG
JM-5 3' CCCAATACTTTAGGGCAGCAAAGCCACTT
JM-6 3' CGAAGGAGGCGAAAGATTATCCCTAG
2) Configuration of the Oligomers in the Synthetic Fragment
5' JM-3 JM-4 3'
3' JM-5 JM-6 5'
3) Sequence of the dsDNA Synthetic Fragment
5'-TGAGGG'TTATGAAATCCCGTCGTTTCGGTGAAGCTTCCTCCGCTTTCTAATAGG
CCC.AATACTTTAGGGCAGCAAAGCCACTTCGAAGGAGGCGAAAGATTATCCCTAG-5'
4) Location of Key Restriction Sites
MstII HindIII BamHI
1815 1895
