Note: Descriptions are shown in the official language in which they were submitted.
2~ ;7
IN-SITU HYBRIDIZATION IN SUSPENSION
FOR DETECTION OR SEPARATION OF CELLS
BACKGROUND OF THE INVENTION
This invention relates ~enerally to nucleic acids
and more specifically to techniques for hybridizing and
detecting nucleic acid sequences within a cell while the
cell is in suspension.
Complementary strands of nucleic acid such as DNA
or RNA can form a double-stranded molecule linked by
complementary bases in a process known as hybridization.
Hybrids may be formed between any two complementary
strands, so hybrids of DNA:DNA are possible, as are
DNA:RNA and RNA:RNA. The reaction is reversible under
particular temperature and salt concentration conditions.
Most often, nucleic acids are first isolated and then
permitted to hybridize with particular labelled
nucleotide sequences termed probes. While such nucleic
acid hybridization is well known in the art, methods for
hybridization of nucleic acid sequences within cells in
suspension have not been available.
In situ hybridization of nucleic acid in cells
affixed to slides and coverslips has been described by
Gall, J. and Pardue, M., Proc. Nat. Acad. Sci., (USA),
63:378-83 (1969). These early attempts at ~a situ
hybridization used, as probes, naturally occurring DNA
or RNA purified from cells or cell supernatants and
labelled with radioisotopes. Because of limited
sensitivity, however, only highly reiterated, or
amplified, genes were susceptible to the technique.
2~ ~ 3 '~
Nucleic acid hybridization techniques have since been
simplified by using recombinant DNA or synthetic
oligonucleotides as probes. See, for example, Venesky,
D. et al., Cell, 24:385-391 (1981) and Montgomery, E. A ,
et al, Cell, 14:673-80 (1978). Labelling probes with
nonradioactive compounds has further streamlined the
methodology, Rudkin, G.T. and Stollar, B.D., Nature,
265:472-73, (1977), Langer, P. R. et al., Proc. Natl.
Acad. Sci. (USA) 78:6633-37 (1981); Jablonski, et al.,
Nucleic Acids Research 14:6115-28 (1986).
In addition, in situ hybridization has been used to
detect DNA sequences within suspended nuclei removed from
cells, Trask, B., et al., Science, 230:1401-03, (1985),
Trask, B., et al., Human Genetics, 78:251-59 (19~8), Van
der Engh, G.J. and Trask, B.J. (1988), U.S. Patent No.
4,770,992. Trask, et al. cross-linked nuclei, isolated
from cells, with dimethylsuberimidate to prevent
disintegration of the nuclei during denaturation and
hybridization. N-acetoxy-2-acetylaminofluorene (AAF),
its iodinated analog AAIF, and biotin-labelled
chromosomal and cloned DNA probes were hybridized to
their respective targets and the probes detected with
anti-AAF or anti-AAIF antibodies and a secondary
rhodamine-labelled antibody (for AAF- or AAIF-labelled
probes) or fluorescein-avidin-DSC (for biotin-labelled
probes) by flow cytometry.
These methods of hybridizing isolated nucleic acid,
or nucleic acid in immobilized cells or suspended nuclei,
have various applications, for example in the detection
of the presence of infectious agents. Nevertheless, such
methods have serious limitations. For example, they do
not allow the detection of nucleic acid in the cytoplasm
2 ~ i
of the cells. Often only a small percentage of the cells
in a sample contain the nucleotide sequence of interest.
Detecting the presence of even a small number of infected
cells can be of critical importance, however. Where the
nucleic acid from a sample is isolated and pooled, the
dilution by non-complementary sequences from uninfected
cells can preclude detection of infected cells. On the
other hand, where hybridization is performed on
immobilized cells, detecting positive cells by microscopy
can be burdensome, time-consuming, and unreliable.
Flow cytometry is a technique for rapidly sorting
individual cells, microorganisms and cell organelles into
groups based on observable differences. Briefly
summarized, the technique involves passing a stream of
material to be measured (cells, lysed cells or other
material) in single file past a light source where the
particular property is detected, usually based on the
reaction of the light to the materials. A computer then
directs the separation of the material as desired. This
technique is very rapid and allows separation of from 104
to 106 cells per minute.
Fluorochromes are most often used to label the
cellular component of interest before passing the cell
sample past the light source. A variety of fluorochromes
have been used to nonspecifically stain DNA, RNA and
proteins for cytometric analysis. Immunological
techniques have been used to detect cell surface markers
and cell interior markers specifically with fluorescent
antibodies.
Nonfluorescent dyes can also be utilized in this
system. Cells can absorb light as they pass through a
2 ~ 7~i ~
focused light beam, and light transmitted by cells
stained with nonfluorescent dyes can be quantitated and
related to analyte concentration. This technique can
help measure the expression of various target molecules
in cells. A summary of flow cytometry as a technique is
provided in Muirhead, K.A., et al., Biotechnology, 3:337-
56 (1985).
It has been known for some time that DNA or RNA can
be hybridized in cells which have been affixed to slides
or another solid support. Further, it has been known
that in situ hybridization may be used to detect DNA
sequences within suspended nuclei removed from cells.
Until now, however, methods for nucleic acid
hybridization within cells in suspension had not been
available. It was commonly believed that without the
structural support of a slide or another solid matrix,
cellular components would disintegrate during the
rigorous hybridization procedures. See, for example,
U.S. Patent No. 4,770,992. Moreover, even if the cells
remain intact during the procedures, there is difficulty
in both getting the probe inside the cell and nuclear
membranes and washing unbound probe out of cells after
hybridization.
There thus exists a long-felt need for methods to
hybridize probes to nucleic acid in suspended cells.
Such a method would be of particular use in conjunction
with automated methods for identifying and separating
cells, such as flow cytometry. The present invention
satisfies this need and provides related advantages as
well.
2 ~ rdJ ~
SUMMARY OF THE INVENTION
The present invention provides a technique for the
hybridization of nucleotide probes to nucleic acids
within a cell while the cell remains in suspension. The
technique comprises fixing the suspended cell,
hybridizing the nucleic acid within the cell with an
oligonucleotide probe and detecting the hybridized probe.
The nucleic acid can be denaturated prior to
hybridization and endogenous enzymes can be ablated. The
invention also provides a technique for categorizing
cells by flow cytometry based on differences in taryet
nucleic acid sequence. Additional objects and advantages
of the invention will be apparent to those skilled in the
art upon reading the specification and claims.
A cell suspended in fluid having a hybridized
nucleotide probe therein is also provided as well as a
kit for detecting a specific nucleotide sequence in a
cell suspended in a fluid. The kit comprises a means for
fixing the suspended cell and a nucleotide probe
complementary to a nucleotide sequence within the
suspended cell. The kit can also include a means for
detecting the hybridized probe.
DETAILED DESCRIPTION OF THE INVENTION
A method is provided for detecting a specific
nucleotide sequence in the nucleic acid in a cell
suspended in a fluid. The method comprises (1) fixing
the suspended cell in such a way as to permit a
nucleotide probe to penetrate without disrupting the
suspended cell, (2) providing a nucleotide probe
complementary to the specific nucleotide sequence within
2 ~ ; r~
the suspended cell under conditions permitting
hybridization, and (3) detecting hybridized probe within
the cell, whereby hybridized probe indicates the presence
of the specific nucleotide sequence. The method can
include the further step of denaturing the nucleic acid
before hybridizing with a nucleotide probe or ablating
endogenous enzymes.
As used herein, the term probe or nucleotide probe
refers to a labelled nucleotide sequence. The
nucleotides can be deoxyribonucleotides or
ribonucleotides. The number of nucleotides present in
the probe is variable, depending on the application.
Preferably, the range is between 10 and 2000 nucleotides,
more preferably between 15 and 50, most preferably 20 to
2~. As used herein, oligonucleotide refers to nucleotide
sequences less than 200 residues in length. Various
labels are well known in the art and include
fluorophores, enzymes, and radioactive isotopes, haptens
and other ligands. Methods for making such labelled
probes are described, for example, in PCT Publication No.
W0 84/03285. Where a probe is used to detect the
presence of complementary sequences in a cell in
suspension, the probe can be a single selected
homogeneous sequence or can be a mixture of various
selected sequences. A mixture can be used, for example,
to increase the sensitivity of the assay or to permit
detection even where a portion of the nucleic acid in the
target cell is variant, as a result, for example, of
genetic alteration.
The present invention is useful for detecting a
target nucleic acid sequence in a single cell in
suspension. The technique may be achieved using
automatic flow analysis, for example, flow cytometry.
In one embodiment, the technique involves manufacturing
oligonucleotides by methods known in the art. See, for
example, United States Patent No. 4,500,707 Matteucci and
Caruthers, (1981), J. Am. Chem. Soc., 103:3185-3191,
which is incorporated herein by reference. These
oligonucleotides are then labelled with enzymes,
fluorophores or ligands (molecules with high affinity for
other molecules), also by means known in the art. See,
for example Jablonski, E.G., et al. (1986), Nucleic Acids
Research 14:6115-6128; Heller, M.J., et al. (1986), Fed.
Proc. 45:1516; PCT Publication No. W0 84/03285, all of
which are hereby incorporated by reference. These
labelled oligonucleotides may be used as probes for
hybridization with DNA or RNA in the nucleus or in the
cytoplasm of cells. The presence of hybridized cellular
DNA or RNA is then established by detecting the label on
the probe.
The in situ hybridization assay set forth here may
be used in tandem with flow cytometry to assist for
example in the diagnosis of various agents that infect
or invade cells (viruses, chlamydia, certain bacteria and
certain parasites) and to diagnose cancer and genetic
diseases.
Detection by microscopic analysis can be used in
place of flow cytometry, but flow cytometry is preferred.
The technique of the present invention may be combined
with flow cytometry to form an automated, rapid detection
or quantitation system for use in hospitals and research
laboratories. The technique of the present invention may
also be used separately and the labelled cells may be
detected in a subsequent step, if desired.
A technique of the present invention may be briefly
summarized as follows: (1) oligonucleotide probes are
synthesized and labelled with enzymes, fluorophores,
ligands or other detectable labels; (2) the probes are
then hybridized with DNA or RNA in a fixed suspended
cell, using the methods set out below; (3) the labels in
the cells are detected using known optical techniques;
and (4) the cells are separated, if desired.
In accordance with the invention, synthetic probes,
preferably DNA, are prepared using conventional
techniques. The probes are designed to be complementary
to particular nucleotide sequences, termed target
sequences of nucleic acids within the fixed cell. The
selection of nucleotide sequence of the probe is within
the skill and choice of those in the art. Although long
chain probes (greater than 200 nucleotides) can be used
and may be more sensitive than shorter probes, synthetic
oligonucleotide probes (10 to 200 nucleotides, preferably
15 to 50 nucleotides) are preferred. Since higher
concentrations of oligonucleotide probes can be used in
the technique of the invention, maximum hybridization
can usually occur within a short time, for example, ten
minutes or less. Moreover, oligonucleotides may be
labelled directly, while long probes must typically be
labelled indirectly, adding complexity and expense to the
process but without providing significant additional
reliability. A directly labelled probe is one where the
label to be detected is directly attached to the probe.
An indirectly labelled probe is one which has attached
to it a moiety through which the label to be detected is
subsequently attached. Additionally, short probes can
more easily permeate cells than can longer probes.
r.3 ~i ~
Examples of labels include enzymes, fluorophores and
ligands. Other labels are available and are well known
in the art. Enzyme labels include alkaline phosphatase,
horseradish peroxidase, B-galactosidase, glucose oxidase
and luciferase. Fluorophores include fluorescein and
Texas Red. Ligand labels include biotin, digoxigenin,
AAF and AAIF.
Protected linker arm nucleoside 3'-phosphoramidite
was prepared by the method of Ruth, J. DNA, 3:123 (1984).
The linker arm monomer was incorporated directly into
automated oligonucleotide synthesis employing an Applied
Biosystems Model 380A DNA synthesizer using the
phosphoramidite chemistry on controlled pore glass as
first described by Matteucci and Caruthers, Tetrahedron
Letters 21:719-722 (1980), which is incorporated herein
by reference. The purified oligonucleotide was
covalently cross-linked to alkaline phosphatase using the
homobifunctional reagent disuccinimidyl suberate through
the reactive primary amine on the linker arm by the
method of Jablonski et al., Nucleic Acids Research,
24:6115-6128 (1986).
The preferred conditions for nucleic acid
denaturation is a combination of heat 50C to 100C,
preferably 65-70C, and a formamide concentration of 40%
to 100%, preferably about 70% ultrapure: 30% low salt
buffer).
The hybridization technique is useful for i~ situ
hybridization within cells in suspension. Before
hybridization can occur, the cell must be fixed.
Fixation is the chemical preservation of cells or tissue
so that the structure will be minimally altered from the
2 ~ r ~l
normal state. There are generally two types of
fixatives, crosslinking (for example, paraformaldehyde,
glutaraldehyde) and precipitating (alcohols). For
suspension i situ hybridization, fixation with
paraformaldehyde is preferred, although other
crosslinking fixatives will achieve effective results.
The preferred amount of paraformaldehyde is between 0.5%
and 5~. Precipitating fixatives are less desirable, as
cell morphology is not well maintained and cells tend to
clump.
After cells are fixed, it may be necessary to ablate
endogenous enzyme by treating cells with 0.2N HCl.
Treating cells with acid destroys cellular enzymes which
may act to turn over alkaline phosphatase substrates, in
addition to further permeabilizing cells. In the course
of fixation, the cell must be opened enough so that the
probe can penetrate the cell, but not enough so that the
nucleus and cytosol (including mRNA and viral RNA or DNA)
will escape. In addition, unreacted probe can be washed
out of the cell to remove background labels yet the cell
must still be kept intact to analyze without removing the
hybridized sequences.
After cells are fixed, nucleic acid within the cells
can be denatured. Denaturing agents or conditions for
nucleic acid include formamide, glyoxal, heat (90C to
100C, preferably 0 to 0.3M salt concentration), acid or
base (DNA only) treatments. Denaturation with a
combination of heat (~65C) and formamide (both DNA and
RNA denaturation) is preferred. Where the secondary
structure of the nucleic acid does not provide a barrier
to hybridization, for example where the nucleic acid is
shorter, single stranded RNA or where the probe is short
2 ~
and recognizes an exposed sequence, denaturation is not
necessarily required.
After denaturation, if used, probe in hybridization
buffer is added immediately and hybridization commences.
Conditions for hybridization depend on probe base
content. Hybridization can occur in the presence or
absence of formamide (<40%) and in a temperature range
of ambient temperature (23C) to 75~C for alkaline
phosphatase probes; the temperature and formamide
concentration are experimentally determined. Washing of
unreacted or loosely bound probe from cells occurs at a
temperature and salt concentration which are likewise
experimentally determined (23-75C,<0.3M). Detection of
alkaline phosphatase labelled probe hybridized to its
complement in cells occurs preferably with the addition
of NBT and BCIP substrates, although other substrates
(especially substrates which give insoluble products) can
also be utilized. A red to purple product is desired.
In situ hybridization of cells, accomplished in
suspension, is well adapted to automation and thus is
highly desirable for applications where a complete
automated system is preferable, for example, for clinical
diagnostic purposes.
To illustrate the technique of in situ hybridization
of cells in suspension, the following examples are
provided. These examples are intended to illustrate the
invention rather than to limit its applicability.
EXAMPLE I
Cytomegalovirus (CMV)-infected and uninfected human
fetal foreskin fibroblast (HFFF) cells were treated with
2 ~ S'i ~
0.5% paraformaldehyde in phosphate-buffered saline (PBS),
a common buffer, for one minute at 60C. Treating for
ten minutes at ambient temperature (23C) was an
acceptable alternative.
The fixed cells were suspended for two minutes at
room temperature with 0.2N HCl. The nucleic acids within
the suspended cells were denatured with a mixture of 70%
formamide (ultrapure) and 30% 2X SSC (0.3M sodium
chloride, 0.03M sodium citrate, pH 7.0) for 10 minutes
at 70C.
The cells were then immediately hybridized by
placing them in "hybridization buffer" with a mixture of
four 2.5 nM alkaline phosphatase-labelled probes (20-22
bases) specific for CMV for ten minutes at 55C.
"Hybridization buffer" contains 5X SSC (0.75 sodium
chloride, 0.075M sodium citrate, pH 7.0), combined with
0.5% bovine serum albumin (BSA, Fraction V).
Alternatively, the cells and probe were mixed with 30%
formamide in 70% hybridization buffer at 37C for ten
minutes.
CMV sequences are available from GenBank,
(IntelliGenetics, Mountain View, CA) Accession Nos.
25 K01090, M10063, M11911). The following nucleotide
sequences were used as probes:
1) 5' GGCGAAAAGAAGACGCGTGT 3'
2) 5' TTCTATGGAGGTCAAAACAGCG 3'
3) 5' TGGCCAAAGTGTAGGCTACAAT 3'
4) 5' GGAAAGTCCGAATCCTACACAT 3'
2 0 ~ ~ ~ r;~ ~
Excess probe was washed out of the cells three
times, for 2 minutes each, with lX SSC (0.15M sodium
chloride, 0.015M sodium citrate, pH 7.0) and cells
separated from wash by low speed centrifugation at 55DC.
Alternatively, cells were washed three times with 0.5X
SSC (0.075M sodium chloride, 0.0075M sodium citrate, pH
7.0) at 37C.
Substrate was added to cells so that the labelling
enzyme was detected. A 1 ml solution of 0.33 mg/ml nitro
blue tetrazolium (NBT) and 0.17 mg/ml 5-bromo-4-chloro-
3-indolylphosphate (BCIP) in alkaline phosphatase (AP)
buffer (O.lM Tris-HCl, pH 8.5; O.lM NaCl, 0.05M MgCl2:
and O.lmM ZnCl2) was pre-warmed to 37C and added to the
cells. Incubation took place for 1.0 hour, during which
time the enzyme label converted the substrate to an
insoluble purple dye. The cells were rinsed with
distilled water and were ready for analysis and/or
separation by acceptable methods, including cell
cytometry. Cells positive for virus turned an opaque
blue-purple, while uninfected cells remained colorless.
EXAMPLE II
Human immunodeficiency virus (HIV) persistently
infected and uninfected CEM cells (lymphoid cell line)
were treated with 1.0% paraformaldehyde in PBS for ten
minutes at ambient temperature. The fixed cells were
suspended for two minutes at room temperature in 0.2N
HCl. The nucleotides in the suspended cells were
denatured with a mixture of 70% formamide (ultrapure) and
30% 2X SSC for 10 minutes at 70C.
2 ~
14
The cells were immediately hybridized by placing
them in hybridization buffer with a mixture of twenty 2.5
nM alkaline phosphatase-labelled probes (20-24 bases)
specific for HIV for ten minutes at 55C. HIV sequences
are available from GenBank, Accession number K03455.
Labelling was as described in Example I. Excess probe
was washed out of the cells three times, with lX SSC at
45C.
Substrate was added to cells so that the labelling
enzyme was detected. A 1 ml solution of 0.33 mg/ml nitro
blue tetrazolium (NBT) and 0.17 mg/ml 5-bromo-4-chloro-
3-indolylphosphate (BCIP) in alkaline phosphatase (AP)
buffer was pre-warmed to 37C and added to the cells.
Incubation took place for 0.5 hours, during which time
the enzyme label converted the substrate to an insoluble
purple dye. The cells were rinsed with distilled water
and were ready for analysis and/or separation by
acceptable methods, including cell cytometry. Cells
positive for virus turned an opaque blue-purple, while
uninfected cells remained colorless.
EXAMPLE III
Herpes simplex virus type 1 (HSV)-infected and
uninfected HEp-2 cells were treated with 0.5%
paraformaldehyde in PBS for one minute at 60~C. The
fixed cells were then suspended for two minutes at room
temperature in 0.2N HCl. The cells were further treated,
in suspension, with 0.01~ hydrogen peroxide in methanol
for 20 minutes at ambient temperature.
The nucleic acids in the cells were denatured with
a mixture of 70% formamide (ultrapure) and 30% 2X SSP
(0.36M NaCl, 20 mM NaH2P04, pH 7.0) 10 minutes at 70C.
The cells were immediately hybridized by placing them in
"hybridization buffer II" with 5 nM horseradish
peroxidase-labelled 22 base probe specific for HSVl and
HSV2 for ten minutes at 50C. The HSV sequence is
available from GenBank, Accession No. J02224. Purified
oligonucleotide was covalently cross-linked to
horseradish peroxidase by the method of Jablonski, et
al., Nucleic Acids Research, 24:6115-6128 (1986), which
is incorporated herein by reference. "Hybridization
buffer II" contained 5X SSP (0.9M NaCl; 50 mM NaH2P04, pH
7.0) and 0.5% BSA (Fraction V). Excess probe was washed
out of the cells three times, with lX SSP (0.18M NaCl;
lOmM NaH2P04, pH 7.0) at 50C.
Substrate was then added to the cells so that the
labelling enzyme could be detected. A 1 ml solution of
0.5 mg/ml 0-dianisidine dihydrochloride in HRP buffer
(O.lM imidazole, O.lM NaCl, pH 7.4 with 0.001% hydrogen
peroxide) was added to the cells. Incubation took place
for 1.0 hour at ambient temperature, during which time
the enzyme label converted the substrate to an orange
dye. The cells were rinsed with distilled water and were
ready for analysis and/or separation by acceptable
methods, including cell cytometry. Cells positive for
virus turned orange, while uninfected cells remained
colorless.
EXAMPLE IV
Herpes simplex virus (HSV)-infected and uninfected
HEp-2 cells are treated with 0.5% paraformaldehyde in
PBS. The fixed cells are then suspended for two minutes
at room temperature with 0.2N HCl.
16
The suspended cells are denatured with a mixture of
70% formamide (ultrapure) and 30% 2X SC for 10 minutes
at 70C. The cells are immediately hybridized in
hybridization buffer with six 5 nM Texas Red-labelled and
(separately) six fluorescein-labelled 22-25 base probes
specific for HSVl and HSV2 for ten minutes at 60C.
Purified oligonucleotides were labelled via the linker
arm with isothiocyanate or sulfonyl chloride derivatives
of either Texas Red or fluorescein by the method of PCT
Publication No. W0 84/03285.
Excess probe is washed out of the cells three times,
as before, with lX SSC at 50C. Cells are ready for
analysis and/or separation by acceptable methods,
15~ including cell cytometry. Cells positive for virus
demonstrate, upon excitation, increased photon emission
at the proper wavelength.
It will be readily apparent to those skilled in the
art that the methods described in the Examples above may
be readily automated. Methods of performing flow
cytometry are well known, and various flow cytometers are
commercially available. See, for example, Shapiro, H.
M., Practical Flow Cytometry, Alan R. Liss, Inc., New
York (1988), which is incorporated herein by reference.
The hybridized cells may be fed directly into the
entrance of flow cytometry instrument, for detection by
fluorescence or by optical density, depending on the
label used.
Those skilled in the art will recognize that
alterations may be made to the invention described above
without departing from the scope or spirits thereof.
