Note: Descriptions are shown in the official language in which they were submitted.
i
~I
;~oisss~
;,
DETECTION OF HUMAN TUMOR
PROGRESSION AND DRUG RESISTANCE
BACKGROUND DF THE INVENTION
The efficiency of cancer dhemotherapy protocols tends
progressively to decrease in inverse proportion to the target
tumor's progressive increase in drug resistance. Accordingly,
early detection of drug resistance would significantly benefit
the development, choice and timing of alternative treatment
strategies. Currently, the multidrug resistant (MDR) gene
offers a potential for monitoring tumor resistance to some
natural agents such as the vinca alkaloids, Vincristine and
Vinblastine: antibiotics such as Daunorubicin, Actinomycin D,
Doxorubicin, Mitomycin C, Etoposide (VP-16), Teniposide (VM-26)
and Mithramycin.
Amplification of genes associated with drug resistance has
been monitored by a modified polymerase chain reaction (PCR)
I
assay, as described in Kashani-Sabet, et al., "Detection of
Drug Resistance in Human Tumors by in Vitro Enzymatic
Amplification," Cancer Res. 48:5775-5778 (1988). Acquired drug
resistance has been monitored by the detection of cytogenetic i
abnormalities, such as homogeneous chromosome staining regions i
and double minute chromosomes.
Several shortcomings attend these procedures. Gene !
amplification techniques other than PCR are applicable only,to
DNA, require at least 106 tumor cells and cannot discriminate
20 166 67,~
~ess than two to four fold changes, whereas drug resistant tumors may be
indicated by
lower gene amplification levels. Drug resistance has been manifested by tumors
in the
absence of gene amplification or cytogenic abnormalities. The detection of
tumor
progression by imaging lacks reliability and precision.
No efficient, generally applicable non-invasive procedure for the early
detection of
or for monitoring the changes in drug resistance over time is presently known.
SUMMARY OF TH:E INVENTION
This invention utilizes changes in tumor cell RNA and DNA to detect the
progression and the temporal changes in resistance to chemotherapy of human
tumors.
Such changes are evidenced, for example, by qualitative and quantitative
differences in
RNA and DNA and by the differences and degree of differences between the
Southern
analysis patterns of DNA from specific cancer cell genes.
The invention also includes the identification of human cancer marker genes
characterized by unique gene transcript DNA patterns and pattern changes
revealed, for
example, by Southern analysis as cells pass pro,;ressively from a normal to a
cancerous or
drug resistant state. Procedures for the clinical monitoring of tumor
progression and of
the beginning and progression of drug resistance by comparison of DNA patterns
of
sequential tumor gene transcripts are described.
In accordance with an aspect of the invention, a method for determining the
presence or absence of cancer in a human patient which comprises:
(i) selecting a human gene from the ;;roup consisting of the dihydrofolate
reductase gene, the DNA polymerase beta gene, the dTMP synthase gene, the c-
fos gene,
the c-myc gene, and the H-ras gene, the transcripts of which, if said patient
has cancer,
contain a DNA marker which is not present in the transcripts from the same
gene if said
patient does not have cancer, wherein said DN~~ marker is a DNA sequence
detectable by
probe hybridization; and
(ii) analyzing the transcripts from said gene to determine the presence or
absence of said DNA marker.
In accordance with another aspect of the. invention, a method for determining
the
presence or absence of cancer in a human patient. which comprises:
(i) selecting a human gene from the group consisting of the dihydrofolate
- 2otsss~ ~~
_eductase gene, the DNA polymerase beta gene, the dTMP synthase gene; the c-
fos gene,
the c-myc gene and the H-ras gene, the transcripts of which, if said patient
has cancer,
include a DNA marker which is not present in the transcripts from the same
said gene if
said patient does not have cancer, wherein said DNA marker is a DNA sequence
detectable by probe hybridization;
(iii) amplifying from a transcript from said gene a target DNA sequence which
will include said DNA marker if present in said transcript; and
(iii) analyzing said amplified target sequence to determine the presence or
absence of said marker.
In accordance with a further aspect of the invention, a method for determining
whether human cancer cells are sensitive of resistant to a drug which
comprises;
(i) selecting a human gene from the group consisting of the dihydrofolate
reductase gene, the DNA polymerase beta gene, the dTMP synthase gene, the c-
fos gene,
the c-myc gene and the H-ras gene, the transcripts of which contain a DNA
marker
which is differs in the transcripts of said gene from drug sensitive and drug
resistant
human cancer cells, wherein said DNA marker is a DNA sequence the said
differences in
which are detectable by probe hybridization; and
(ii) analyzing the transcripts of said selected gene in a sample of said
cancer
cells to determine the presence of absence of or ~3ifferences in said DNA
marker.
In accordance with another aspect of the invention, a method for determining
whether cancer cells are sensitive or resistant to a drug which comprises:
(i) selecting a gene from the group consisting of dihydrofolate reductase
gene,
the DNA polymerase beta gene, the dTMP synth~ase gene, the c-fos gene, the c-
myc gene
and the H-ras gene, the transcripts of which contain a DNA marker which is
differs in the
transcripts of said gene from drug sensitive and drug resistant human cancer
cells,
wherein said DNA marker is a DNA sequence the said differences in which are
detectable
by probe hybridization; and
(ii) amplifying a target sequence in a transcript of said selected gene,
wherein
said target sequence includes said DNA marker; and
(iii) analyzing said amplified target sequence to determine the presence or
absence of or differences in said DNA marker.
2a
2 0 1 6 6 6 7 ~~
In accordance with a further aspect of the. invention, a method for detecting
the
progression of a human tumor by analysis of a human tumor cell or tissue
sample which
comprises:
(i) selecting a gene from the group c~~nsisting of the dihydrofolate reductase
gene, the DNA polymerise (3 gene, the d'rMP synthase gene, the c-fos gene, the
c-
myc gene and the H-ras gene, the transcripts of which said gene from normal
cells,
wherein said DNA marker is a DNA sequence detectable by probe hybridization;
(ii) amplifying a target sequence of said selected gene present in said cell
sample which target sequence includes said DNA marker if present;
(iii) detecting and quantifying the DN~~ containing said DNA marker present in
said amplification product.
In accordance with a further aspect of thc; invention, a method for detecting
the
progression of human tumor growth or of the progression of human tumor drug
resistance
by analysis of a human tumor cell or tissue sarr~ple which comprises:
(i) selecting at least one gene the group consisting of the dihydrofolate
reductase gene, the DNA polymerise (3 ~;ene, the dTMP synthase gene, the c-fos
gene, the c-myc gene and the H-ras gene, the transcripts of which from drug
resistant human cells include a DNA marker not present in drug sensitive
cancer
cells, wherein said DNA marker is a DrdA sequence detectable by probe
hybridization;
(ii) amplifying DNA from patient samples taken at a series of defined time in-
intervals a target sequence of said selected gene present in said cell samples
which
target sequence includes said DNA marker;
(iii) detecting and quantifying the DNA containing said DNA marker in each of
said amplification products;
(iv) comparing the quantification values obtained in step (iii) with standard
values.
In accordance with a another aspect of the invention, a method comprises
amplifying a human DHFR gene sequence by a polymerise chain reaction in which
the
primers utilized are a primer having the sequence 3'-CGGAGGTCCTCCCGCTGCTGT-
5' positioned at bases 1301-1321, and a primer having the sequence 5'-
2k>
CA 02016667 2000-03-28
GAGCGGTGGCCAGGGCAGGTC-3' positioned at bases 1386-1406.
In accordance with another aspect of the invention, a method comprises
amplifying
a DNA polymerase (3 gene sequence by a polymerase chain reaction in which the
primers
utilized are a primer having the sequence 5'-GGAGCTGGGTTGCTCCTGCTCCCGT-3'
positioned at bases 21-46, and a primer having the sequence 5'-
GCCTTCCGTTTGCTCATGGCGGCCT-3'.
In accordance with a further aspect of the invention, a method comprises
amplifying a c-fos gene sequence by a polymerase chain reaction in which the
primers
utilized are a primer having the sequence 5'-ACGCAGACTACGAGGCGTCA-3'
positioned at bases 908-927, and a primer having the sequence 5'-
CTGCGCGTTGACAGGCGAGC-3' positioned at bases 1010-1029.
In accordance with another aspect of the invention, a method comprises
amplifying
a c-myc gene sequence by a polymerase chain reaction in which the primers
utilized are a
primer having the sequence 5'-TCCAGCTTGTACCTGCAGGATCTG-3' positioned at
bases 1-24 and a primer having the sequence 5'-
CGGTGTCTCCTCATGGAGCACCAG-3' positioned at bases 277-300.
In accordance with a further aspect of the invention, a method comprises
amplifying a H-ras gene sequence by a polymerase chain reaction in which the
primers
utilized are a primer having the sequence 5'-TGAGGAGCGATGACGGAATA-3'
positioned at bases 1661-1680, and a primer having the sequence 5'-
GACTTGGTGTTGTTGATGGC=3' positioned at bases 2183-2202.
Description of the PCR Assav_
Figure 1 is a schematic diagram, outlining the steps of a modified PCR assay
useful in the invention. Two converging, preferably about 15 to 25 base,
oligoprimers oriented in opposite directions, are provided for the 5' and 3'
ends of the gene sequence to be analyzed. See Kashani-Sabet, et al., supra.
2c
~01666'~
Tumor cells for the PCR assay are obtained from patients
tissue or peritoneal fluid, and total RNA for use as a template
. is isolated as described.
To replicate a specific sequence which preferably includes
a restriction site, the oppositely oriented primers are
i
annealed to the RNA template. Addition of reverse
transcriptase yields first strand polymerization. Cycles of
denaturation, annealing, and polymerization ensue upon addition
i
of heat-stable DNA Polymerase. This process is continued for a I
plurality of rounds. Inclusion of ribonuclease A after the
completion of round one tends to eliminate RNA which may
compete for primer binding.
In general, the amplified aequence, or a restriction
fragment thereof, is detected in the reaction product by
hybridization with a complementary probe. The amplified DNA is
cut.with a restriction enzyme. The resulting fragments are
separated by gel electrophoresis. The gel is then laid on a
piece of nitrocellulose, and a flow of an appropriate buffer is
set up through the gel, perperndicular to the direction of
electrophoresis, toward the nitrocellulose filter. The flow
I
causes the DNA fragments to be carried out of the gel onto the
filter, where they bind, so that the distribution of the DNA
fragments in the gel is replicated on the nitrocellulose. The
DNA is then denatured and fixed onto the filter. A
complementary radioactively labeled probe is then hybridized to
I
the DNA sequence on the filter. Autoradiography of the filter
identifies which fragment or fragments contain the sequence
I
under study, each fragment being identified according to its
I
molecular weight. A variation on this technique is to .
I
hybridize and do autoradiography directly in the gel, rather
than on a nitrocellulose filter.
-3-
2~1~~G'~
Table I identifies target and primer sequences and
~~restriction sites for eleven gene transcripts.
ZABLE I
Oligonucleotide Primers of RNA
Expression in Drug Resistant Tumor Cells
Location of the
Oligonucleotide in
Transcript Amplified Fragment the Nucleotide Seguence*
Predicted Restriction Primers Probe
Size (bp) Site 5'oligo 3'oligo i
nucleotide nucleotide I
DHFR 136 Ava II 1301-1321 1406-1386 1364-1340 '
dTMP
synthase 171 Pst I -3-21 168-146 122-101
T kinase 184 Hinf I 58-83 242-219 141-119
~' DNA pol a 202 Hae III 138-158 340-318 240-215
DNA pol ,B 108 Kpn I 21-46 129-103 98-73
i
c-fos 121 Pst I 908-927 1029-1010 985-961
c-myc 300 Alu I 1-24 300-277 216-193
H-ras 273 Msp I 1661-1680 2183-2202 1782-1763
Multidrug i
Resistant ,
(MDR) I 332 Hph I 16-39 342-321 201-180 j
Actin 240 Bgl II ~25-44 269-245 155-132
Phosphglycerate i
Kinase .
(PGK) 166 Alu I 1364-1386 1529-1507 1405-1427 i
* See Journal of Clinical Laboratory Analysis, Vol. 3, No. 5
(August 1989) (Tn Press). ' ,
Figures 2-7 are schematic maps which identify the target,
primer and probe sequences and the position of the primers for
i
use in PCR assays of the DHFR, dTMP, DNA polymerase ,B, c-fos, i
~~c-myc, and H-ras genes. Optimum amplification requir;:~
'selection of appropriate primers for each selected gene
. sequence.
As shown in Fig. 2, DHFR-3 (#3) is the 3'-5' oligoprimer
complementary to DNA (bases 1301-1321) having the sequence CGG
AGG TCC TCC CGC TGC TGT. #2 is the 5'-3' oligoprimer '
complementary to mRNA (bases 1386-1406) having the sequence GAG
-4-
i
.~....~.~._... .. ,
2~1~~~~
CGG TGG CCA GGG CAG GTC. The target sequence bases 1301-1406
includes an Ava 2 restriction site. The probe for identifying
the target sequence has the sequence GTT CTG GGA CAC AGC GAC GAT
GCA.
Oligoprimers and probes for t:he dTMP synthase gene are shown
in Fig. 3. The target sequence includes bases -3 to 168. #2 is
the 3'-5' oligoprimer complementary to DNA (bases -3 to 21)
having the sequence GCC ATG CCT GTG GCC GGC TCG GAG. #3 is the
5'-3' primer complementary to mRNA (bases 146-168) having the
sequence AGG GTG CCG GTG CCC GTG CGG T. #4 (bases 101 to 122) is
the probe for identifying the target sequence. The probe has the
sequence AGG ATG TGT GTT GGA TCT GCC CCA. The target sequence
includes a PstI restriction site.
Oligoprimers and probes for t:he DNA polymerase ~ gene are
shown in Fig. 4. #1 is the 5'-3' ~~ligoprimer complementary to
DNA (exon 1, bases 21-46) having a sequence of GGA GCT GGG TTG
CTC CTG CTC CCG T. #2 is the 5'-3' oligoprimer complementary to
m-RNA (exon 1 bases 103 129) having a sequence GCC TTC CGT TTG
CTC ATG GCG GCC T. #3 is the probe, (bases 73-98) for identifying
the target sequence bases 21 to 12!x. The probe sequence is ACC
AGG GAC TAG AGC CCT CTC CCA G. Thca target sequence includes a
KpnI restriction site.
Oligoprimers and probes for the c-fos gene are shown in. Fig.
5. #1 is the 5'-3' oligoprimer complementary to m-RNA (exon 1,
bases 908-927) having a sequence AC:G CAG ACT ACG AGG CGT CA. #2
is the 5,-3, oligoprimer complementary to DNA (exon 1, bases
1010-1029) having a sequence CTG CGC GTT GAC AGG CGA GC. The
target sequence includes bases 908 to 1029. #4 is the probe for
identifying the target sequence (bases 961-985) has the sequence
TGA GTG GTA GTA AGA GAG GCT ATC. The target sequence includes a
Pst I restriction site.
Oligoprimers and probes for the c-myc gene are shown in Fig.
6. #1 is a 5'-3' oligoprimer complementary to either DNA or RNA
(exon 1, bases 1-24) having a sequence of TCC AGC TTG TAC CTG CAG
GAT CTG. #2 is the 5'-3' oligoprimer complementary to DNA or a
probe for RNA (exon 2, bases 193-216). It has a sequence AGG AGC
~016f 6'~
CTG CCT TTC CAC AGA. ~3 is a 5'-?' oligoprimer (exon 2, 277-300)
having the probe sequence CGG TGT CTC CTC ATG GAG CAC CAG. There
is a base 87 AluI restriction site: between 1 and 300. The target
sequence, bases 1-300 includes an Alu I restriction site at base
87.
Oligoprimers and probes for the H-ras gene are shown in
Figure 7. The amplified fragment stretches from base 1661 to
base 2202 (541 DNA bases, 273 RNA bases). ~1, a sense
oligonucleotide, spans bases 1661-1680 and contains the sequence:
5'-TGAGGAGCGATGACGGAATA-3'. ~2.i.; an antisense oligonculeotide,
encodes nucleotides 2183 to 2202 and has the sequence:
5'-GACTTGGTGTTGTTGATGGC-3'. ,~3 is. the probe oligonucleotide
spanning bases 1763-1782 and encodes the sequence:
5'-ACCTCTATAGTAGGGTCGTA-3'. ~1 and ,~2 are used as primers for
the polymerization assay. ,~3 is Used as the probe to detect the
amplified target sequence. The 2i'3 base RNA sequence contains a
cleavage site for MspI at position 1786 which yields two
fragments of 136 and 137 base pairs in length upon digestion.
Only the 171 base pair cleavage fragment contains the sequence
complementary to ~3. Hybridization of the digested PCR product
with the end labeled probe should yield only one band.
Oligoprimers and probes for t:he DNA polymerase a gene are:
5' GCT AAA GCT GGT GA(~ AAG TAT A
3' CTC ATC AGC ATC AA(~ GGC ATC AT
Probe TCC TGG CGT GCC TG~~ ACC AGC TTC GA
Oligoprimers and probes for i:he MDR1 gene are:
5' AGC AGC TGA CAG TC(: AAG AAC A
3' GTT GCT GCT TAC AT'.C CAG GTT TC
Probe AGA GAC ATC ATC TG'.C AAG TCG G
Table II relates some of the several genes useful in this.
invention to chemotherapeutic agents.
6
~ 201666'
n
TABLE II
Gene Cancer Chemotherapeutic Agents
~, TS Cycle
!jDHFR Methotrexate (MTX)
~dTMP Synthase Cisplatin, SFUra, FdUrd
~;Thymidine Kinase Cisplatin, MTX, SFUra, FdUrd
DNA Repair Enzymes
DNA polymerase a Cisplatin
DNA polymerase ~S Cisplatin, araC, alkylating
agents, some natural
products, and X-ray Radiation
Oncoqenes
c-fos Cisplatin
c-myc Cisplatin, MTX, araC, VP-16
H-ras Cisplatin
Multidruq Resistance Genes
MDR I Adriamycin, Actinomycin D
Topoisomerase II colchicine, Vinblastine,
Vincristine, daunorubicin,
VP-16, VM-26 and mithramycin
Glutathione-S Transferase (GST;i Alkylating agents
DESCRIPTION OF 1?REFERRED EMBODIMENTS I
The preferred embodiments c~f the invention utilize the DNA
polymerase a and p genes, the dTMP gene, the DHFR gene, the MDR
gene and the c-fos, c-myc and H-ras oncogenes.
I
The DNA polymerase ~ gene has been shown to be elevated in
drug resistant tumor cells treated with antimetabolites, e.g., i
I
ara-C, alkylating agents, some natural products,e.g., VP-16,
and cisplatin. Changes in the DNA of DNA polymerase p evidence
the progression of tumor formation and temporal changes in drug
i
resistance. ~ '
I
i
i
1
2016~6'~ i
I
Most chemotherapeutic agewts damage DNA directly or I
indirectly. The dTMP synthase cycle is the sole de novo source
of thymidine, the availability of which is rate limiting in DNA
synthesis and the repair of DNA, damage. The dTMP cycle i
ii
-accordingly has been a selected target for several cancer
therapeutic agents, such as met:hotrexate (MTX), 5-fluorouracil
(5-FUra) and fluorodeoxyuridine: (FdUrd).J Tumor cells
i
i
resistant to cisplatin display increased levels of dTMP ;
synthase by elevated gene expression in vitro and by gene I
amplification in vivo.J I
Pattern Difference Between The DNA of
DNA Polymerase ,9 From Normal and Cancer Tissues
i
Figs. 8-ll depict EcoRI digestion for Southern analyses of
DNA polymerase p DNA from four hypes of human cancer.
Fig. 8 is a Southern analysis comparison of the DNA of DNA
polymerase p DNA from a human colon carcinoma HCT8 cell lines i
i
sensitive (S), and resistant (D;I to cisplatin, normal colon '
tissue (N) and colon carcinoma i:issue from a patient (PK) that
failed cisplatin and 5 fluorouracil chemotherapy. The lane PK
pattern from the carcinoma cell:. includes a band at a 5.5 Kb not
present in the normal tissue pataern.
Fig. 9 is a Southern analysis of the DNA of the DNA i
i
polymerase ~ from the cancer tissue of six human ovarian ,
carcinoma patients. Patients DM, MD, TS, BD and DL) were
i
treated with cisplatin in combination with 5 fluorouracil.
Patient HS was treated with cisplatin in combination with i t
I
I
Bertino, J.R., "Toward Selectivity in Cancer Chemotherapy:
The Richard and Hinda Rosenthal Foundation Award Lecture," Cancer j
Res. 39:293-304 (1979).
Scanlon, K.J., et al., supra; Lu, Y., et al., "Biochemical i
and Molecular Properties of Cisplatin-Resistant A2780 Cells Grown '
in Folinic Acid," J.Biol.Chem. 283:4891-4894 (1988).
._g-
.I
,,
~01666'~
c toxane . The
Y polymerise ~ DN7~ from all patients except DM lost
a high molecular weight band (;tOKb) upon development of
' resistance to chemotherapy. A low molecular weight band (5.5 Kb)
was lost in 3 of the 6 drug resistant patients, i.e., patients
i
iiDL, BD, and D. In Fig. 9, lanEa D pertains to a drug resistant
ovarian cell line and lane S peartains to drug sensitive ovarian
cell line.
The Fig. 10 Southern analy.cis shows that the DNA from the DNA
polymerise ~9 gene from tissue from four breast carcinoma patients
BC1-BC4 is characterized by an additional band at 5.2 Kb and at
5.5 Kb as compared with normal tissue (NBT). Tissue from three
of the four patients (BC1-3) yielded an additional band at 5.5
Kb. The 5.2 Kb bands provide a marker to discriminate normal
from neoplastic tissue. The D and S lanes relate to drug
resistant and drug sensitive human breast tissues.
.The Fig. 11 Southern,analysis shows that the DNA of the DNA
polymerise ~ gene from human leukemia cells resistant to
j
cisplatin (DDP), VP-16 or MTX has additional bands at about 15 Kb !
as compared to the same gene from normal tissues) lanes 5.
These band changes provide markers for drug resistance in
neoplastic cells, including human leukemia cells. A like band
change is not observed in the case of cells resistant to ara-C.
The foregoing experiments utilized normal tissue and
untreated tissue as standards representing drug sensitive cells. j
i
Cells obtained from a patient prior to treatment and stored
provide an internal drug sensitive cell standard.
Normal and colon carcinoma tissues were obtained from five
separate patients and analyzed by the methods previously I
described for their restriction enzyme fragment pattern for,DNA i
polymerise a (Fig. 12a) and DNA polymerise ~ (Fig. 12b).
-g-
~ v~Ul~6~"~
Figure 12a shows by Southern analysis that the restriction
enzyme pattern of the DNA from DNA polymerise a is similar for
the normal (N 1-5) and colon carcinoma (T 1-5) samples.
Figure 12b, shows a Southern analysis of the restriction
I
enzyme patterns of the DNA of hNA polymerise p, the tumor samples
T1-T5 lack bands at 12 Kb and 7.5 Kb, present in the normal tissue
samples (N 1-5). Two bands at 5.2 Kb and 5.5 Kb, not present in
the normal tissue samples, are present in the colon cancer
samples.
This invention includes visualization of temporal changes in
the restriction enzyme fragment: patterns and fragment pattern
differences between normal, sensitive, and drug resistant tissue
to monitor all stages of the progression of human tumor growth
and of drug resistance.
Labelled nucleotide sequences in Southern or Northern
I
analysis bands are routinely quantified by comparison of signal I
intensity from such bands with a standard. When the amount of
the target sequence is quite small, such quantification
techniques may be inadequate. I
Pursuant to this invention the quantification of small DNA
samples from tissue or cells ils readily and efficiently
accomplished.
The intensity of the signal from a labelled target sequence
in a given Southern analysis band is a function of the number of
rounds of amplification required to yield a band of preselected
i
or predetermined signal intensity. See, e.g., Kashani-Sabet,
j
supra. i
I
This invention entails the determination of a set of
standards which identify quantatively the signal intensity from a i
unique or preselected Southern analysis band after a selected i
number of PCR amplification rounds.
I
-10-
zossss~
Comparison of the signal intensity of like Southern analysis
bands derived from patient cell or tissue samples similarly
amplified for a like number of hounds provides a ready and
' efficient monitor of the progre:;s of both tumor size and tumor
i;
~~drug resistance.
_E7{AMPLE
Tissue or cell samples are prepared with known, progressively
increasing quantities of a gene transcript which yields a unique
cancer marker band. For exampl~a, colon carcinoma tissue or cell
samples containing progressivel~t increasing specific amounts of
the transcript of DNA polymeras~a p are prepared. The DNA
polymerase ~ target DNA sequence: in each sample is PCR amplified
under like conditions for each of a plurality of predetermined
rounds. The intensity of the signal from each amplified sample
after each predetermined plurality of rounds is recorded to
provide a set of standards. Each standard in the set is the
quantified intensity of the signal after one of the predetermined !
pluralities of amplification rounds.
I
DNA from a patient tissue cell sample is subjected to
Southern analysis by the method used to prepare the standards.
The intensity of the signal from the unique marker band after
amplification for one or more of the pluralities of rounds used
to prepare the standards is measured. Comparison of these signal
I
intensity measurements from DNA of the patient sample with the j
standards provides a monitor of the existence and progress of
i
tumor size and of tumor drug resistance of the patient samples.
i
The absence and continuing absence of a signal from the
patient samples indicates freec',om at least from the type of tumor
to which the analyses apply. The initial appearance of a signal
from a patient sample at a given amplification round level is i
evidence of incipient or appearing drug resistance. Increase in
I
-11-
_ 201666'
the magnitude of the signal in subsequently taken samples
provides a temporal monitor of tumor progression per se and of
tumor resistance to chemotherapy.
-12-
