Note: Descriptions are shown in the official language in which they were submitted.
CA 02017636 2000-O1-26
- 7 -
D a S C r 1 p t 1 O n
The invention concerns a new t-PA derivative, a DNA
sequence which codes for the new t-PA derivative',
expression plasmids which contain a DNA sequence which
codes for the t-PA derivative as well as a process for
the preparation of such plasmids, a process for the
production of the t-PA derivative and an agent for
dissolving blood clots which contains the t-PA
derivative.
Coagulated blood contains polymeric fibrin which is the
main component of the protein matrix. Fibrin is dissolved
under physiological conditions by a fibrinolytic system
in a reaction cascade which is similar to that of blood
coagulation. The central reaction in this is the
activation of plasminogen to plasmin which is for example
mediated by the tissue-type plasminogen activator t-PA.
Plasmin, in turn, dissolves fibrin which is the main
component of the protein matrix of coagulated blood. The
enzymatic activity of natural t-PA or t-PA obtained from
eukaryotes by genetic engineering, i.e. the catalytic
activation of plasminogen to plasmin, is very low in the
absence of fibrin or fibrinogen cleavage products, but it
can be substantially increased in the presence of these
proteins, namely by more than ten-fold.
T-PA is cleaved by proteases present in the blood into an
A-chain and a B-chain. Both parts of the chain remain
bound via a cysteine-bridge. The ability to stimulate the
activity of t-PA is a significant advantage in comparison
with other known plasminogen activators such as, for
example urokinase or streptokinase (cf. for example
M. Hoylaerts et al., J. Biol. Chem. 257 (1982),
CA 02017636 2000-O1-26
_ g -
2912-2919; W. Nieuwenhuizen et al., Biochem. Biophys.
Acta, 755 (1983), 531-533).
The mechanism of action of t-PA in vivo is described for
example in Korniger and Collen, Thromb. Hamostasis 46
(1981), 561-565. The focus of enzymatic activity on the
fibrin surface would seem to make it a suitable agent for
the treatment of pathological vascular occlusions (for
example myocardial infarction) which has been confirmed
to a large extent by clinical trials (Collen et al.,
Circulation 70 (1984), 1012; Circulation 73 (1986), 511).
A disadvantage of t-PA is however the rapid decrease in
its plasma concentration (clearance rate). As a result, a
relatively large amount of t-PA is necessary to achieve
an effective lysis of thrombi. On the other hand, high
therapeutic doses result in side effects such as for
example bleeding.
A natural degradation product of t-PA is described in
EP 0 196 920 which only contains the kringle 2 and the
protease domains of the t-PA, and whose N-terminal amino
acid is alanine 160 of the amino acid sequence described
by Pennica et al. in Nature 301 (1983), 214-221. The
clearance rate of this product of t-PA degradation does
not, however, differ significantly from that of the
natural t-PA. An improvement of this can only be achieved
by a chemical modification of the catalytic domain via
attachment of a blocking group.
It is therefore the object of the invention to modify
t-PA such that the resultant derivative has a much
reduced clearance rate and thus a longer half-life in
CA 02017636 2000-O1-26
- 9 -
blood plasma. In this process the ability to lyse thrombi
as well as the ability to be stimulated by fibrin should
be preserved.
The object of the invention is therefore a tissue-type
plasminogen activator (t-PA derivative, also denoted
K1K2P in the Examples) which is characterized in that it
is not glycosylated and consists of the following amino
acid sequence:
(M)
Ser Tyr Gln Val Ile Asp Thr Arg Ala Thr Cys Tyr Glu Asp Gln Gly
5 10 15
Ile Ser Tyr Arg Gly Thr Trp Ser Thr Ala Glu Ser Gly Ala Glu Cys
20 25 30
Thr Asn Trp Asn Ser Ser Ala Leu Ala Gln Lys Pro Tyr Ser Gly Arg
35 40 45
Arg Pro Asp Ala Ile Arg Leu Gly Leu Gly Asn His Asn Tyr Cys Arg
50 55 60
Asn Pro Asp Arg Asp Ser Lys Pro Trp Cys Tyr Val Phe Lys Ala Gly
65 70 75 80
Lys Tyr Ser Ser Glu Phe Cys Ser Thr Pro Ala Cys Ser Glu Gly Asn
85 90 95
Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr Arg Gly Thr His Ser
100 105 110
Leu Thr Glu Ser Gly Ala Ser Cys Leu Pro Trp Asn Ser Met Ile Leu
115 120 125
Ile Gly Lys Val Tyr Thr Ala Gln Asn Pro Ser Ala Gln Ala Leu Gly
130 135 140
Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp Gly Asp Ala Lys Pro
145 150 155 160
Trp Cys His Val Leu Lys Asn Arg Arg Leu Thr Trp Glu Tyr Cys Asp
165 170 175
Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gln Tyr Ser Gln Pro Gln
180 185 190
CA 02017636 2000-O1-26
- 10 -
Phe Arg Ile Lys Gly Gly Leu Phe Ala Asp Ile Ala Ser His Pro Trp
195 200 205
Gln Ala Ala Ile Phe Ala Lys His Arg Arg Ser Pro Gly Glu Arg Phe
210 215 220
Leu Cys Gly Gly Ile Leu Ile Ser Ser Cys Trp Ile Leu Ser Ala Ala
225 230 235 240
His Cys Phe Gln Glu Arg Phe Pro Pro His His Leu Thr Val Ile Leu
245 250 255
Gly Arg Thr Tyr Arg Val Val Pro Gly Glu Glu Glu Gln Lys Phe Glu
260 265 270
Val Glu Lys Tyr Ile Val His Lys Glu Phe Asp Asp Asp Thr Tyr Asp
275 280 285
Asn Asp Ile Ala Leu Leu Gln Leu Lys Ser Asp Ser Ser Arg Cys Ala
290 295 300
Gln Glu Ser Ser Val Val Arg Thr Val Cys Leu Pro Pro Ala Asp Leu
305 310 315 320
Gln Leu Pro Asp Trp Thr Glu Cys Glu Leu Ser Gly Tyr Gly Lys His
325 330 335
Glu Ala Leu Ser Pro Phe Tyr Ser Glu Arg Leu Lys Glu Ala His Val
340 345 350
Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gln His Leu Leu Asn Arg
355 360 365
Thr Val Thr Asp Asn Met Leu Cys Ala Gly Asp Thr Arg Ser Gly Gly
370 375 380
Pro Gln Ala Asn Leu His Asp Ala Cys Gln Gly Asp Ser Gly Gly Pro
385 390 395 400
Leu Val Cys Leu Asn Asp Gly Arg Met Thr Leu Val Gly Ile Ile Ser
405 410 415
Trp Gly Leu Gly Cys Gly Gln Lys Asp Val Pro Gly Val Tyr Thr Lys
420 425 430
Val Thr Asn Tyr Leu Asp Trp Ile Arg Asp Asn Met Arg Pro
435 440 445
CA 02017636 2000-O1-26
- 11 -
It was established that, surprisingly, deletion of the
other domains which are present in native t-PA had no
effect on the thrombolytic efficacy of the protein and
that the fibrin-dependent stimulatability of the mutein
was the same as that of native t-PA.
A further object of the present invention is a DNA
sequence which codes for the t-PA derivative according to
the present invention and contains the following
sequence:
ATGTCTTACCAAGTGATCGATACCAGGGCCACGTGCTACGAGGACCAGGGCATCAGCTAC
AGGGGCACGTGGAGCACAGCGGAGAGTGGCGCCGAGTGCACCAACTGGAACAGCAGCGCG
TTGGCCCAGAAGCCCTACAGCGGGCGGAGGCCAGACGCCATCAGGCTGGGCCTGGGGAAC
CACAACTACTGCAGAAACCCAGATCGAGACTCAAAGCCCTGGTGCTACGTCTTTAAGGCG
GGGAAGTACAGCTCAGAGTTCTGCAGCACCCCTGCCTGCTCTGAGGGAAACAGTGACTGC
TACTTTGGGAATGGGTCAGCCTACCGTGGCACGCACAGCCTCACCGAGTCGGGTGCCTCC
TGCCTCCCGTGGAATTCCATGATCCTGATAGGCAAGGTTTACACAGCACAGAACCCCAGT
GCCCAGGCACTGGGCCTGGGCAAACATAATTACTGCCGGAATCCTGATGGGGATGCCAAG
CCCTGGTGCCACGTGCTGAAGAACCGCAGGCTGACGTGGGAGTACTGTGATGTGCCCTCC
TGCTCCACCTGCGGCCTGAGACAGTACAGCCAGCCTCAGTTTCGCATCAAAGGAGGGCTC
TTCGCCGACATCGCCTCCCACCCCTGGCAGGCTGCCATCTTTGCCAAGCACAGGAGGTCG
CCCGGAGAGCGGTTCCTGTGCGGGGGCATACTCATCAGCTCCTGCTGGATTCTCTCTGCC
GCCCACTGCTTCCAGGAGAGGTTTCCGCCCCACCACCTGACGGTGATCTTGGGCAGAACA
TACCGGGTGGTCCCTGGCGAGGAGGAGCAGAAATTTGAAGTCGAAAAATACATTGTCCAT
AAGGAATTCGATGATGACACTTACGACAATGACATTGCGCTGCTGCAGCTGAAATCGGAT
TCGTCCCGCTGTGCCCAGGAGAGCAGCGTGGTCCGCACTGTGTGCCTTCCCCCGGCGGAC
CTGCAGCTGCCGGACTGGACGGAGTGTGAGCTCTCCGGCTACGGCAAGCATGAGGCCTTG
TCTCCTTTCTATTCGGAGCGGCTGAAGGAGGCTCATGTCAGACTGTACCCATCCAGCCGC
TGCACATCACAACATTTACTTAACAGAACAGTCACCGACAACATGCTGTGTGCTGGAGAC
ACTCGGAGCGGCGGGCCCCAGGCAAACTTGCACGACGCCTGCCAGGGCGATTCGGGAGGC
CCCCTGGTGTGTCTGAACGATGGCCGCATGACTTTGGTGGGCATCATCAGCTGGGGCCTG
GGCTGTGGACAGAAGGATGTCCCGGGTGTGTACACAAAGGTTACCAACTACCTAGACTGG
ATTCGTGACAACATGCGACCG 1341
CA 02017636 2000-O1-26
- 12 -
The DNA sequence according to the present invention
serves to express the t-PA derivative according to the
present invention when it is present on an expression
plasmid. An expression plasmid of this kind is a further
object of the invention as well as an expression plasmid
with a different DNA sequence which, however, also codes
for the t-PA derivative according to the present
invention. Due to the degeneracy of the genetic code
sequences which differ from the DNA sequence shown are
suitable for this purpose.
Besides the sequence coding for the t-PA derivative the
expression plasmid preferably also contains, apart from
an origin of replication, a promotor structure which can
be regulated (e. g. tac promotor), an efficient terminator
(e. g. fd), and a selection marker (e. g. (3-lactamase
gene).
A further object of the present invention is the plasmid
pA33. The preparation of this plasmid is described in
Example 1; it contains a DNA sequence which codes for the
t-PA derivative according to the present invention.
Yet a further object of the invention is a process for
the construction of one of the expression plasmids
according to the present invention, wherein a DNA
sequence which codes for the t-PA protein according to
the present invention or a derivative thereof which
contains further regions of the t-PA protein in addition
to the kringle I, kringle II and the protease domains is
incorporated into a plasmid and those domains which code
for amino acids which are not present in the t-PA
derivative according to the present invention are removed
or deleted by site-directed mutagenesis. The
corresponding cDNA may be used as the DNA sequence for
the t-PA protein or a derivative thereof.
CA 02017636 2000-O1-26
- 13 -
The choice of plasmid, into which the DNA sequence coding
for the t-PA derivative according to the present
invention is to be incorporated, is dependent on the host
cells which are later to be used to express the
derivative. Suitable plasmids, as well as the minimum
requirements for such a plasmid (e.g. origin of
replication, restriction site) are known to the expert.
Within the scope of the invention a cosmid, the
replicative double-stranded form of phages (~, M13), and
other vectors known to the expert can be used instead of
a plasmid. The method of site-directed mutagenesis is
described by Morinaga et al., Biotechnolgy 21, (1984),
634, and is carried out essentially as described.
Yet a further object of the invention is a process for
the production of a t-PA derivative according to the
present invention, which is characterized in that one of
the plasmids according to the present invention is
expressed in suitable host cells and the,product is
isolated from the culture medium or, after lysis of the
host cells, from the fluid in which the lysis was carried
out (e. g. buffer or also the culture medium). Prokaryotic
cells are preferably used as the host cells to produce
the t-PA derivative according to the present invention.
Examples of suitable prokaryotic cells include E. coli.
In this connection, it is particularly preferable to
first separate or isolate the so-called "inclusion
bodies" (insoluble protein aggregates) which form during
this process from the soluble cell particles, to solub-
ilize the inclusion bodies containing t-PA by treatment
with guanidine hydrochloride, subsequently to derivatise
them with oxidized glutathione and finally to renature
the t-PA derivative by addition of L-arginine and
guanidine hydrochloride or glutathione. Exact instruc-
tions for the activation of t-PA from "inclusion bodies"
are for example disclosed in the patent applications
CA 02017636 2000-O1-26
- 14 -
EP-A 0 219 874 and EP-A 0 241 022. According to the
present invention any other method for the isolation of
the active protein from inclusion bodies can, however, be
employed as well.
The process according to the present invention is
preferably carried out in the presence of L-arginine, in
particular in a concentration of 25 to 1000 mmol/1.
After renaturation, the t-PA derivative may be
concentrated in a renaturation preparation and
subsequently a chromatographic purification may be
carried out by means of affinity chromatography.
The removal of foreign proteins according to the present
invention by affinity chromatography is carried out in a
preferred embodiment of the invention over an ETI
(Erythrina Trypsin Inhibitor) adsorber column. In this
connection, ETI is fixed on a carrier material (adsorber)
such as e.g. BrCN-Sepharose. The purification over an ETI
adsorber column has the advantage that the ETI adsorber
column material can be loaded directly from the
concentrated reoxidation preparation even in the presence
of such high concentrations of arginine as 0.8 mol/1
arginine. In this way, an aggregation of p-t-PA, which
can occur at low arginine concentrations under 25 mmol/1,
is avoided. Thus, it is especially preferred to carry out
the purification of the p-t-PA preparation over an ETI
adsorber column in the presence of 0.2 to 1.0 M,
preferably 0.5 to 1.0 M arginine. In this process the
solution containing the K1K2P/Pro has preferably a pH of
more than 6.5, particularly preferably of more than 7.
The elution from the ETI column is effected by lowering
the pH in the presence of arginine under conditions which
allow a good solubility of t-PA which was expressed in
CA 02017636 2000-O1-26
- 15 -
prokaryotes. Preferably the pH is in the acid range
during the elution, particularly preferably in the range
of 4 to 6.
A preparation of K1K2P/Pro produced according to the
present invention has a specific t-PA activity of
>0.4x106 IU/mg, preferably >0.6x106 IU/mg whose
stimulatability by fibrin cleavage products (activity in
the presence of fibrinogen peptides/activity without
fibrinogen peptides) is larger than ten-fold and
preferably larger than twenty-fold. The purity of the
preparation according to the present invention is more
than 90 o and preferably more than 95 %, especially more
than 98 0.
The t-PA derivative according to the present invention is
therefore particularly suitable, in association with a
physiologically acceptable carrier, for use in a
pharmaceutical agent for dissolving blood clots which
again is a further object of the invention.
The invention is elucidated by the following Example in
conjunction with the Figures.
Fig. 1 shows schematically the construction of
plasmid pA33.
Fig. 2 shows the time course of the plasma
concentration of the t-PA activity after
intravenous bolus injection of commercially
available t-PA (ActilyseR), in comparison with
the t-PA derivative according to the present
invention in a linear graph and
Fig. 3 shows the time course of the concentration in
a logarithmic graph.
CA 02017636 2000-O1-26
- 16 -
E x a m p 1 a 1
Construction of the plasmid pA33
The plasmid pePa133 served as the starting plasmid which
is described in the application EPA 0 242 836. All
experimental steps for the specific mutagenesis i.e. for
the deletion of the domains F and E from pePal33 (see
Fig. 1) were carried out essentially using the method of
Morinaga et al., Biotechnologie 21 (1984), 634. For this,
two cleavage preparations were prepared from pePa133.
Preparation A was cleaved with EcoRI and the largest
fragment was isolated. Preparation B was cleaved with
XhoI and in this way the product was linearized. The
following oligonucleotide was used for the heteroduplex
formation:
5' TAC CAA GTG ATC GAT ACC AGG GCC 3'
Those clones which contained the sought-after plasmid
pA33 were determined by colony hybridization with the
above-mentioned mutagenesis oligonucleotide. This plasmid
was characterized by restriction analysis and checked for
the absence of the SspI restriction cleavage site which
is located in the part of the t-PA expression cassette
coding for the finger domain.
CA 02017636 2000-O1-26
- 17 -
E x a m p 1 a 2
Preparation of active K1K2P/Pro from E. coli
a) Cell lysis and preparation of the inclusion bodies
(IB's)
1.6 kg cell wet-weight (E. coli, DSM 3689), transformed
with the plasmid pA33 was suspended in 10 1 0.1 mol/1
Tris-HC1, 20 mmol/1 EDTA, pH 6.5, 4°C. 2.5 g lysozyme was
added to this and incubated for 30 minutes at 4°C;
afterwards complete cell lysis was carried out by high
pressure dispersion. 5 1 0.1 mol/1 Tris-HC1, 20 mmol/1
EDTA, 6 % Triton X100 and 1.5 mol/1 NaCl, pH 6.5 was
added and mixed with the lysate solution and incubated
for a further 30 minutes at 4°C. Following this the
inclusion bodies (IB's) were separated by centrifugation.
The pellet was suspended in 10 1 0.1 mol/1 Tris-HCl,
20 mmol/1 EDTA, pH 6.5, incubated for 30 minutes at 4°C
and the IB-preparation was isolated by subsequent
centrifugation.
b) Solubilization of the IB's
8.7 g IB's (wet-weight) were suspended in 100 ml 0.1 M
Tris, 6 M guanidine, 0.1 M DTE, pH 7.5 and stirred for 30
minutes at 25°C.
After adjustment of the pH to pH 3 with HCl (25 0), the
solution was dialysed against 4 mol/1 guanidine-HCl,
pH 2.5 (3 x 3 1, 24 h, 4°C).
CA 02017636 2000-O1-26
- 18 -
c) Derivatization
The above-mentioned dialysate was adjusted to 50 mmol/1
with oxidized glutathione (GSSG) and to 100 mmol/1 with
Tris and the pH value was titrated to 7.5 with 5 mol/1
NaOH. The preparation was incubated for 90 min at 25°C.
After adjusting the pH value to pH 3 with HC1 (25 %), a
dialysis against 10 mmol/1 HCl (3 x 100 1, 48 h, 4°C) was
carried out.
d) Renaturation
A 10 1 reaction vessel was filled with 0.8 mol/1 Arg/HC1,
pH 8.5, 1 mmol/1 EDTA, 1 mmol/1 GSH (glutathione). The
renaturation was carried out at 20°C by a three-fold
addition at 24 hour intervals of 100 ml of the derivative
which had previously been dialysed against 6 mol/1
guanidine-HC1, pH 2.5 .
After the renaturation a preparation is obtained with a
specific activity of 50 - 75 KU/mg (test according to H.
Lill, Z. gesamte inn. Med. ihre Grenzgeb. (1987), 42,
478-486)
e) Concentration of the renaturation preparation
The renatured preparation can, if required, be
concentrated on a haemodialyzer.
CA 02017636 2000-O1-26
- 19 -
E x a m p 1 a 3
Purification of K1K2P/Pro from E. coli
The purification of K1K2P/Pro from E. coli is carried out
by affinity chromatography on Erythrina-Trypsin-Inhibitor
(ETI)-Sepharose.
The renaturation preparation was concentrated 1 . 5 on a
haemodialyzer (Asahi AM 300) and dialysed overnight
against 0.8 mol/1 Arg/HC1, pH 7.5 and centrifuged. 1.8 1
dialysate was applied (4 column volumes (CV)/h) to an
ETI-Sepharose column (120 ml) which had been equilibrated
with 0.8 mol/1 Arg/HC1, pH 7.5 and was washed with buffer
(0.8 mol/1 Arg/HC1, pH 7.5, 0:5 mol/1 NaCl) until the
absorbance of the eluate at 280 nm reached the blank
value for the buffer. After washing for a second time
with 5 CV 0.3 mol/1 Arg/HC1, pH 7.0 the elution was
carried out with 0.3 mol/1 Arg/HC1, pH 4.5.
Volume Activity CProt. SA F*
(ml) KU/ml mg/ml KU/mg
dialysate 1800 74 1.05 70 15
K1K2P/Pro 200 610 0.82 744 28
*F = stimulation by fibrin = activity in the presence of
fibrin/activity in the absence of fibrin.
CA 02017636 2000-O1-26
- 20 -
E x a m p 1 a 4
Characterization of purified K1K2P/Pro from E. coli
a) Characterization of the protein
- SDS-PAGE and Reversed-Phase HPLC
The homogeneity of the preparation purified by
affinity chromatography on ETI-SepharoseTM was
demonstrated by SDS-PAGE and reversed-phase HPLC
(RP-HPLC). An apparent molecular weight for K1K2P
from E. coli of 50800 Da + 2000 Da was calculated
from the relative distance of migration in an
electrophoretic analysis of the purified material.
The densitometric analysis showed a purity of > 900.
RP-HPLC is based on the different interactions of
proteins with hydrophobic matrices. This property
was used as an analytical method to quantify the
degree of purity.
The analysis of the purified K1K2P/Pro from E.coli
was carried out on a Nucleosil 300 separation column
(Knauer) using a trifluoroacetic acid/acetonitrile
gradient (buffer A: 1.2 ml trifluoroacetic acid in
1000 ml H20; buffer B: 300 ml H20, 700 ml
acetonitrile, 1 ml trifluoroacetic acid; 0 - 100 %).
Integration of the chromatographic analysis yielded
a purity of >95 %.
CA 02017636 2000-O1-26
- 21 -
- N-terminal sequence
The N-terminal amino acid sequence was determined
using an ABI 470 sequencer with a standard programme
and on-line PTH detection. The determined sequence
S1-Y2-Q3-V4-I5-D6-T7-R8-A9-T10-C11-Y12-E13-D14
agreed with the expected sequence deduced from the
DNA-sequence.
b) Activity determination
The in vitro activity of K1K2P/Pro from E. coli was
determined according to H. Lill, Z. gesamte inn.
Med. ihre Grenzgeb. (1987), 42, 478-486. The
specific activity (SA) was 650000 IU/mg ~ 200000
IU/mg. The stimulatability of K1K2P/Pro from E.coli
in this test system by BrCN-fibrinogen fragments
(activity in the presence of fibrinogen fragments
divided by activity in the absence of fibrinogen
fragments) was 25-30.
c) In vitro binding to fibrin
The in vitro binding of K1K2P/Pro to fibrin was
determined according to the method described by
Higgins and Vehar (Higgins, D.L. and Vehar, G.A.
(1987), Biochem. 26, 7786-7791).
It shows that K1K2P/Pro compared to t-PA from CHO
cells has no significant binding to fibrin.
CA 02017636 2000-O1-26
- 22 -
E x a m p 1 a 5
Pharmacokinetics of K1K2P/Pro in the rabbit
The pharmacokinetic properties of K1K2P/Pro were compared
to those of ActilyseR (Alteplase, Thomae GmbH, Biberach,
FRG) in New-Zealand white rabbits. Both fibrinolytic
agents were injected intravenously for 1 min at a dose of
200000 IU/kg body weight (bw). Plasma samples were taken
before and at defined times after the injection. The t-PA
activity in the plasma was measured with a spectrophoto-
metric test according to J. H. Verheijen et al., (Thromb.
Haemostas. 48, 266, 1982), modified according to H. Lill
(Z. ges. Inn. Med. 42, 478, 1987).
A computer programme for non-linear regression modified
according to H.Y. Huang (Aero-Astronautics-Report 64,
Rice University, 1-30, 1969) was used to calculate the
pharmacokinetic parameters. When fitting the curves, a 1
or 2 compartment model was assumed which is different
from individual to individual. In each case, before the
calculation, the value for the endogenous basal
concentration was subtracted from the subsequent values.
K1K2P/Pro is eliminated in only 2 of 6 animals with a
fast a and a slow (3 phase. In these 2 animals the alpha
phase portion was 53 0 of the total elimination. In
contrast, all animals in the ActilyseR group show a fast
alpha phase whose portion amounts to more than 70 0 of
the total elimination. K1K2P/Pro is eliminated mainly
with only one half-time which is 15.1 + 3.1 min. In
contrast, ActilyseR has a fast half-time of 1.63 min and
a slow half-time of 10.1 min (Tab. 1). The total plasma
CA 02017636 2000-O1-26
- 23 -
clearance of K1K2P/Pro is 6.3 _+ 1.5 ml/kg/min and is
thus considerably lower than that of ActilyseR (Cltot -
22.9 + 9.1 ml/kg/min).
All in all, K1K2P/Pro represents a t-PA mutant which, in
comparison with ActilyseR as the state of the art, has a
clearly improved pharmokinetic profile (Fig. 2 and 3).
E x a m p 1 a 6
Pharmacodynamics of K1K2P/Pro in the rabbit
The rabbit model for jugular vein thrombosis established
by D. Collen et al. (J. Clin. Invest. 71, 368, 1983) was
used to examine the thrombolytic efficacy. The
fibrinolytic agents or the solvent were injected
intravenously over 1 min as a bolus. Afterwards the rate
of thrombolysis was determined and selected parameters of
the coagulation system as well as the number of platelets
were determined (Table 2).
At the same dose (200000 IU/kg body weight) K1K2P/Pro
achieved a statistically significantly higher rate of
thrombolysis of 50.7 + 6.5 o after intravenous bolus
injection than ActilyseR (24.1 + 3.7 0). The dose of
ActilyseR with a comparable thrombolysis efficacy to
K1K2P/Pro is 800000 IU/kg body weight (Table 2).
With an equipotent dosage of K1K2P/Pro in comparison with
ActilyseR there were less effects on the coagulation
parameters fibrinogen, plasminogen and alphaz-antiplasmin
compared with the solvent group, which, however, do not
differ from the effects of an equipotent dose of
ActilyseR.
CA 02017636 2000-O1-26
- 24 -
K1K2P/Pro is thus a t-PA mutant which has a thrombolytic
efficacy after bolus injection in the rabbit model of
jugular vein thrombosis which is greatly increased in
comparison with ActilyseR. In this K1K2P/Pro has
maintained its fibrin specificity to an extent which also
applies for ActilyseR.
CA 02017636 2000-O1-26
- 25 -
o +~
a~
a~
0
O x ,-~ ~o ~ ~
a -
o ~ ~ r' ~
a~
x ~ ~ +~ ~' +
I
~ N y
U
O -r-~ U
~ u1
U ~ -rl
.1-)
O ~-I
~
U u1 t~
O
f.~, u1
-r-I
r~ rl +~
O ~ 4-I O
U
v7 ,fl ~ O
~ N
rt1 -~ -r-~ +~
r-I -k ~ Ul (~
~ ~
a~ +.~x a, ~ ~,,~ -~ s~
~ -~
o ~,
~ ~ ~
.-Ib~N + ~ - O
~ ~
Sa U x U U
~-I
m a~ x ~
o
~C o
~
o ~ ~ ~
-~ ra
+
U _ M ~-i lfl ~ ~ l
Q ~ ~
. -k N r
ra r~ U ~ M ~ o~ ~9 ~ U C~
~
U 5..1 ~ ~ ~ O N bi
bi
+ I ~ + I U r~
O ~ 't3 .~-i
N N x rl U rl
.~ N N ~ S-I -rl
-r-I
~ -r-I ~-I
U)
~ N .-1 ~ o~ 01 V' ~ ~ N
rl
O ,~ -r-I ~ 00 ' N ~ S-1
-r~ O
U a.-> ~ ~ ,-~ y n u~ U ~ Cl
a-~
U~ U ~ ~ ~ r~
-r-I
~ -r-I~ tY7
U H ~ ~ +I
~-1 ~ S-I +I -1~ td -I-)
-r-I
W rd O 4-1
4-1 O 4-a
O O ,~ O
r~
rl ~-I
W'
,~ ~ ~ ~ O U
~-I -1-~ N ~ . ~ . . -r-I~ ~ -r-I
W
O -rl N ~ -'~p ~~ ~ ~,-~ +->(~
~
x ,-~ ,-~ ~ '-I + ~ ~-I~-I
~ O
-rl ~--I
~ ~ U
U1 a--> - O ~-~ N
x
~-I U S-Irlr~ D
r0 +~ +~U N O
U
+~ .~" tn .~.,'
-r-I
~ ~ ' ~
W - ~ ~ i~ O
M
~-I ~ 3 N -r-I~ N 4-If~~ -r-I
f~
00 ~ O rl'~ ~-1
C2.~ N '~ ~ Cdr~ N
~ O
"O 'N N
U +~ O
w-1 .~ ~ r0rb O
+~ ~ U .-I+-~N U
S-a
O O b~ -,~ O O S-a
O
Enra rCS
4-a
~
.~G N ~ ,- N ~ W
1
O X17 H ~ ~ p"~ C!~
~
O -,.-1.~r~ ~. L1i .-. + ~ ~ ~ N
~ ~ I ~
-~. p ~-1~.,'-rl l0 N l0 -L-~ r-I
~ I I ~
ra ~ ~ U ~ ~ +~U
p ~ ~
Ga ~UFC " x " ~ N
N -xU FC
CA 02017636 2000-O1-26
' - 26 -
3
~ 00 ~' M O1 ~ 00
V' M (~ ~ ~ N
+I +I +~ +I +~ +I
O l0 ~ lQ N ~ M
b +~ p
r
r
r ~ r-1 O1 ~' ~ lfl
O ~1' O lfl !~ 00
0 O ~
OO N
U ~
D
3 ,--I
O p
, O M
O b~ W -~I M ~
W 17 d' lfl M ~ -rl
CL \
+~ +I +I +~ +I +I
Y ~ ~--1r-i lfl
O
.
.
r-i O ~ O I~ M
O
p, ,~ o
x N
b
a~
N
Gl 3 -
~ v
l
m
M M
d ~ ~ ~ r mo d' ~ N
' '
M N
+I +I o m
+~ +~ +~ +~
~
w ~, p ~,
' '
a~ o . . . . o
U O O N S
l
~ ~ O M rl -I -r
N al OD ~ ~
rl ~.,' O ~ +~ fd
O
.1.1 ~ N W lfl
b O
ri rl II
O1 f-I l'~ d" ~ ~
N
O N N ~' N
~ +~ +~ +~ +~ +I +~ ~
O
il ',~ ~ O
4) ~ ~ 01 u7 u7 01 ~ ,-~ -r-I S-I
~ N 61 O O
rl ,ti ~ ao 01 01 ~
!.: i.~ ~ ~-1 U
+~
U cn f~, ra
G) s~ ~ O N
v1 .n ov ov ov ov ov ov N ,.~2
..i
.r
r-1 al ~ rd
H
0
~
r-
1 r1
ua
~ N ~ '~
.n !~ ~ -~ .~ ~
+ p +
O U
Cl~ .4 O
rl 0 O ~ ~ ~'
O - .I-~ ,~ +~
-I + I .L2
-
r
C) N Gl O s-i u1 r.>r O ~, N ~ II
'd ~-I .p ~ I E- W-I ~ -r-i E-i
W ~
H C~ W Z3 H .r ~
U -~ O
CA 02017636 2000-O1-26
- 27 -
E x a m p 1 a 7
Optimized expression in E. coli
To increase the yield of expression product, the sequence
encoding the K1K2P-gene was subcloned in a plasmid with a
high copy number. Plasmid pePa 126.1 described in the
patent application P 39 31 933.4 was used for this. This
plasmid is composed mainly of the vector pKK223-3 and the
sequence coding for t-PA as described in the application
EP-A 0 242 835.
An fd-terminator sequence was first integrated into this
plasmid. For this, the plasmid pePa 126.1 was linearized
with the restriction enzyme Hind III. The plasmid cleaved
in this manner was separated by gel electrophoresis and
isolated preparatively. The plasmid pLBUl (Gentz et al.,
(1981) PNAS 78 (8):4963) was cleaved with Hind III and a
Hind III fragment of about 360 by which contained the fd-
terminator was isolated preparatively by gel
electrophoresis and gel elution. The linearized plasmid
pePa 126.1 and the 360 by Hind III fragment from pLBUl
were ligated. The ligation preparation was cotransformed
with the plasmid pUBS 500, described in the application
P 39 31 933.4 in E. coli, DSM 2102. From the clones,
those were selected that contained the desired plasmid
pePa 126 fd which differs from the starting plasmid pePa
126.1 in that it contains a second Hind III cleavage
site.
Two fragments were isolated from the plasmid pePa 126 fd:
a BamHI/PvuI-fragment of 3.4 kb size and a PvuI/XmaI
fragment of 1.3 kb size. Both these fragments were
ligated with a BamHI/XmaI fragment of about 1.6 kb
CA 02017636 2000-O1-26
- 28 -
from the plasmid pA33 and transformed with the plasmid
pUBS 500 into E. coli. The resultant plasmid was-named
pA33 fd and can be distinguished from pePa 126 fd in that
in a restriction digest with EcoRI the second smallest
EcoRI fragment from pePa 126 fd of about 610 by length is
about 250 by shorter in pA33 fd.
