Note: Descriptions are shown in the official language in which they were submitted.
CA 02046016 2001-10-26
HIV MONOCLONAL ANTIBODY
This invention relates to an immunological
technology for providing a novel substance for prophylaxis,
and the treatment and diagnosis of viral infectious
diseases. More particularly, it relates to a monoclonal
antibody being capable of substantially neutralizing human
immunodeficiency virus (abbreviated as HIV), which is the
etiologic agent of acquired immunodeficiency syndrome
(abbreviated as AIDS), and to a hybridoma being capable of
secreting the monoclonal antibody.
Technical Background and Prior Art
HIV is a retrovirus which is known to cause
diseases such as AIDS and AIDS-related complex (abbreviated
as ARC). It is well known that prototype HIV includes human
T-lymphotropic virus type III (abbreviated as HTLV-III) and
lymphadenopathy associated virus (abbreviated as LAV). The
above diseases are prevalent worldwide, and it has been
desired to develop a vaccine or a therapeutic method for
the treatment thereof. However, successful therapies have
not been developed to date. The most characteristic
hematological anomaly in AIDS is the functional and
quantitative loss of helper/inducer T-lymphocytes
expressing CD4 antigen on the surface thereof. The
immunodeficiency caused by HIV induces various disorders in
the bio-phylactic mechanisms of the infected host.
Subsequently, opportunistic infections frequently occur
such as Pneumocystis carinii pneumonia and rare malignant
CA 02046016 2001-10-26
- 2 -
tumors such as Kaposi's sarcoma. The immunodeficiency
caused by HIV is a progressive and irreversible disease
with a high rate of mortality, and it is considered that
the rate of mortality will reach 100 o within several
years.
Upon initial infection of T-cells with HIV, the
virus particles will first bind to the receptor CD4
antigen. The infection of HIV can also spread via cell-to-
cell infection, when infected cells are fused with non-
infected cells, particularly in organs such as the brain,
lymphonodus, etc., syncytium (macropolycyte) is formed.
The syncytium formation is also observed in experiments
in vitro. It is usually considered that the T-cells
infected with HIV are easily susceptible to the cytopathic
effect of HIV, and this will cause the loss of CD4-positive
cells.
It is also known that HIV infects not only the
helper/inducer T-lymphocytes but also infects monocyte and
macrophages. Furthermore, most monocytes/macrophages and
some T-lymphocytes have resistance to the cytopathic effect
of HIV, and hence these cells retain the virus for a long
period of time and continuously produce the virus.
Moreover, it is known that human blood serum
infected by HIV contains an antibody to HIV, but the
antibody has only a low neutralizing activity (cf. Weiss et
al., Nature, 316, p. 69-72, 1985).
It is well known that the core antigen (gag) and
the envelope antigen of HIV are present as the structural
CA 02046016 2001-10-26
- 3 -
protein antigen of HIV. The HIV viral envelope protein is
expressed as a precursor glycoprotein having a molecular
weight of 160 kilodaltons (gp160) that is proteolytically
cleaved to generate an external envelope glycoprotein
having a molecular weight of 120 kilodaltons (gp120) and a
trans-membrane envelope glycoprotein having a molecular
weight of 41 kilodaltons (gp41). Among these, gp120 is the
most important by the following reasons.
(1) When a test animal is infected with the
gp120 or with a certain fragment derived from the gp120, a
polyclonal neutralizing antibody is produced. This means
that the gp120 is at least one of the target molecules of
an antibody capable of neutralizing the virus (cf. Lasky et
al., Science, 233, p. 209-212, 1986).
(2) At the first step of infection of HIV, gp120
binds to CD4 molecule of virus receptor. This means that
the gp120 is the most important molecule as to the HIV
infection (McDougal et al., Science, 231, p. 382-385,
1986) .
(3) The synoytium formation by HIV, that is cell-
to-cell infection of HIV, is induced by the direct
interaction between the gp120 and the CD4 molecule of non-
infected cells (cf. Lifson et al., Nature, 323, p. 725-728,
1985) .
Various monoclonal antibodies to constructive
proteins of HTLV-III or LAV have been known. Examples
include, an antibody against p24 which is one of core
antigens present within virus (Veronese, F.D., Proc. Natl.
CA 02046016 2001-10-26
- 4 -
Acad. Sci., U.S.A., 82, p. 5199-5202, 1985); an antibody to
a pol gene product encoding a reverse transcriptase of the
virus (Veronese, F.D., Science, 231, p. 1289-1291, 1986);
and an antibody to gp41 which is another structural protein
in the viral envelope (Veronese, F.D., Science, 229,
p. 1402-1405, 1985). However, none of these known
monoclonal antibodies is known to react with the gp120
antigen which is an important factor for the prophylaxis
and treatment of AIDS. In contrast, it is reported that
any monoclonal antibody being capable of effectively
neutralizing the gp120 antigen could not be obtained even
by immunizing animals with a purified LAV (Chassange, J. et
al., J. Immunol., 136, p. 1442-1445, 1985).
There have hitherto been studied various methods
for obtaining a monoclonal antibody being capable of
effectively neutralizing an AIDS related virus and hence
being useful for the prophylaxis, treatment and diagnosis
of AIDS.
It has been reported that a monoclonal antibody
to the gp120 antigen has been obtained by using a synthetic
peptide as an immunogen and that an epitope recognized by
the antibody is within the region of the amino acid
sequence 503-532 of the HIV envelope (Chanh, T.C. et al.,
Eur. J. Immunol., 16, p. 1455-1468, 1986). However, the
antibody had very weak binding activity as indicated both
in Western blotting and immunofluorescent data. In this
report, no evidence has shown the presence of the
neutralizing activity of the monoclonal antibody disclosed.
CA 02046016 2001-10-26
- 5 -
The present inventors have also previously
obtained a monoclonal antibody (0.5~) being capable of
effectively neutralizing the virus by binding to the gp120
of HTLV-IIIB strain (Matsushita et al., J. Virology, 62, p.
2107-2114, 1988). However, the 0.5~ antibody can
neutralize the HTLV-IIIB strain, but not the HTLV-IIIMN
strain which is more popular in the immunological field.
To date, no monoclonal antibody has been
developed that can bind to gp120 of the HTLV-IIIMN, which
can substantially neutralize the virus.
Brief Description of the Invention
The present inventors have found a monoclonal
antibody which can bind to the envelope antigen of HTLV-
IIIMN: gp120 and can substantially neutralize the virus.
Thus, the present invention in its broadest
aspect relates to a monoclonal antibody being capable of
specifically binding to a glycoprotein antigen having a
molecular weight of about 12 x 109 daltons (gp120) present
in the envelope of human T-lymphotropic virus IIIMN
(HTLV-IIIMN) and capable of substantially neutralizing the
HTLV-IIIMN or fragments thereof.
Brief Description of the Drawings
Fig. 1 shows the reactivity of the monoclonal
antibodies of the invention (u39.1 and u5.5) to the
synthetic peptides of gp120 (amino acid sequence 303-325 or
308-329) derived from the various HIV mutants. An initial
concentration of each antibody is 500 ug/ml.
CA 02046016 2001-10-26
- 6 -
Fig. 2 shows a reactivity of the monoclonal
antibodies of the invention (u39.1 and u5.5) to the
external envelope glycoprotein gp120 derived from the
HTLV-IIIMN-infected cells.
Detailed Description of the Invention
The term "neutralization" in this disclosure
means inhibition of cell free infection of HIV and also
cell-to-cell infection such as syncytium formation which
occurs between HIV-infected cells and non-infected cells by
interaction between the gp120 and CD4.
This invention provides a monoclonal antibody
which can bind to a glycoprotein antigen having a molecular
weight of about 12 x 104 daltons present in the envelope of
HIV and can substantially neutralize the virus, and also
fragments thereof.
The monoclonal antibody of this invention can
recognize the envelope glycoprotein of HTLV-IIIMN strain:
gp120 and can neutralize the virus. The monoclonal
antibody can be prepared by the following method.
A mammal (e. g. mouse, guinea pig, rabbit, etc.)
is immunized with virus particles obtained from an
appropriate HTLV-IIIMN-producing cell or purified envelope
glycoprotein gp120; a recombinant peptide prepared by a
recombinant DNA technology, preferably a recombinant
peptide corresponding to the amino acid sequence 247-370 of
gp120; or a synthetic peptide prepared based on the amino
acid sequence of the virus protein, preferably a synthetic
peptide corresponding to the amino acid sequence 303-325 of
CA 02046016 2001-10-26
- 7 -
gp120. The spleen cells taken out from the thus immunized
mammal are cell-fused with, for example, mouse myeloma
cells to give a hybridoma, from which a purified envelope
glycoprotein gp120 or cells responding to the above
recombinant peptide or synthetic peptide are selected, and
then the cells are cultivated to give the desired
monoclonal antibody.
The above preparation of hybridoma can be carried
out by the method of Kohler and Milstein (Nature, 256,
p. 495, 1975). The virus particles or envelope
glycoprotein gp120 used as the antigen include HTLV-IIIMN-
producing cells prepared by sucrose density-gradient
centrifugation method, e.g. derived from H9/HTLV-IIIMN; a
recombinant peptide prepared by recombinant DNA technology;
or a synthetic peptide prepared based on the amino acid
sequence of the virus protein; and further any other
immunogen prepared by a conventional method. The mouse to
be immunized may include a BALB/c mouse, F1 mouse of BALB/c
mouse and other mouse, and the like. Immunization is
carried out by using an antigen of 20 to 200 ~g per mouse
(4 to 8 week age, weighing 20 to 30 g), wherein the antigen
is administered 3 to 6 times for every 2 to 3 weeks. The
feeding of mouse and the collection of spleen cells from
the immunized mouse are carried out in a conventional
manner.
Myeloma cells include MOPC-21NS/1 (Nature, 256,
p. 495, 1975), SP2/0-Agl4 (Nature, 276, p. 269, 1979),
p3X63Ag8-Ul (Eur. J. Immunol., 6, p. 511, 1976), p3X63Ag8
CA 02046016 2001-10-26
g
(Nature, 256, p. 495, 1975), p3X63Ag8.653 (J. Immunol.,
123, p. 1548, 1979), and the like.
The spleen cells and myeloma cells are mixed in a
ratio of 1 . 1 to 10 . 1 by volume, and the cell-fusion is
carried out in a phosphate buffer (pH 7.2 - 7.4) containing
NaCl (about 0.85 wt.o), dimethylsulfoxide (10 - 20 v/v%)
and polyethylene glycol having a molecular weight of 1,000
to 6,000, by incubating the mixture at 35 to 37°C for 1 to
5 minutes. The fused cells (hybridoma) can be collected
from the base medium containing hypoxanthine
(1.3 - 1.4 mg/dl), aminopterin (18 - 20 ug/dl), thymidine
(375 - 4,000 ul/dl), streptomycin (50 - 100 ug/ml),
penicillin
(50 - 100 U/ml), glutamine (3.5 - 4.0 g/1) and fetal bovine
serum (10 - 20 wt.o), wherein the fused cells grow. The
base medium includes any medium which is usually used for
cultivation of animal cells, such as RPMI1640 medium,
Eagle's MEM medium, and the like. Cloning of the fused
cells is repeated at least three times by limiting dilution
method.
The hybridoma is cultivated in the same manner as
usually used in cultivation of animal cells, whereby the
desired monoclonal antibody of this invention is produced
in the medium. For example, when the hybridoma
(2 x 106 - 5 x 106 cells) is cultivated in RPMI1640 medium
(10 - 20 ml) containing streptomycin (50 - 100 ~g/ml),
penicillin (50 - 100 U/ml), glutamine (3.5 - 4.0 g/1) and
fetal bovine serum (10 - 20 wt.o) in the presence of 5 0
CA 02046016 2001-10-26
- 9 -
C02 in a flask at 35 - 37°C for 3 to 7 days, whereby the
antibody is secreted and accumulated in the medium. The
hybridoma may also be grown by injecting intraperitoneally
into a nude mouse or BALB/c mouse treated with PristaneTM,
whereby the antibody is accumulated within the ascites.
That is, Pristane (0.5 - 1 ml) is intraperitoneally
inoculated into the mouse, and two to three weeks after the
inoculation, the hybridoma (5 x 106 - 1 x 10~ cells) is
intraperitoneally transplanted thereto. After 7 to 10
days, accumulated ascites are collected. The monoclonal
antibody contained in the culture medium or the ascites can
be isolated by affinity chromatography with Affigel°
Protein A MAPS-IITM kit (BIO-RAD) or by any other
conventional method.
The monoclonal antibody thus obtained can
recognize an epitope on gp120 derived from HTLV-IIIMN
strain and can effectively neutralize the virus. The
monoclonal antibody has the following characteristics:
(a) immunoglobulin class; IgG, x,
(b) being capable of binding to glycoprotein
antigen having a molecular weight of 12 x 10q daltons
(gp120) of HTLV-IIIMN.
(c) being capable of recognizing at least one
epitope which is present in the range of the amino acid
sequence 303 to 325 (Tyr Asn Lys Arg Lys Arg Ile His Ile
Gly Pro Gly Arg Ala Phe Tyr Thr Thr Lys Asn Ile Ile Gly) of
gp120 of HTLV-IIIMN.
(d) being capable of binding to the surface of
CA 02046016 2001-10-26
- 10 -
HTLV-IIIMN viral particles and thereby inhibiting the
infection of the virus particles to CD4-positive cells, and
(e) being capable of binding to the surface of
cells infected with HTLV-IIIMN and thereby inhibiting the
syncytium formation induced by interaction between the
infected cells and uninfected cells.
Thus, the monoclonal antibody of this invention
can clearly inhibit the cell-to-cell infection such as
syncytium formation and/or cell-free virus infection such
as infection with HTLV-IIIMN. Accordingly, the monoclonal
antibody can be used for the prophylaxis and treatment of
AIDS. Moreover, the monoclonal antibody of this invention
is also useful for the inhibition of growth of AIDS-related
viruses in a human host. Since the monoclonal antibody of
this invention has a strong neutralizing activity against
HTLV-IIIM~, it is also effective for the prevention of
infection of the virus to uninfected T-cells.
A representative example of the hybridoma being
capable of producing the monoclonal antibody of this
invention has been deposited to Fermentation Research
Institute, Agency of Industrial Science and Technology,
Tsukuba, Japan under the Budapest Treaty as Accession No.
FERM BP-3402, deposited on February 10, 1990.
This invention is illustrated by the following
Examples but should not be construed to be limited thereto.
Example 1
Preparation of monoclonal antibody:
Preparation of antigen
CA 02046016 2001-10-26
- 11 -
(1) A synthetic peptide:
A synthetic peptide corresponding to the amino
acid sequence 303 to 325 of the envelope glycoprotein gp120
of HTLV-IIIMN (Tyr Asn Lys Arg Lys Arg Ile His Ile Gly Pro
Gly Arg Ala Phe Tyr Thr Thr Lys Asn Ile Ile Gly) is used as
an immunogen and an antigen for assay.
The above peptide is prepared with ABI430A
Peptide Synthesizer (Applied Biosystem). The crude peptide
thus prepared is removed from the substrate resin by TFMSA
method (Yanaihara, C., Experimental Medicine, 6, No. 10,
p. 141-148, 1988) and purified by reverse phase high
performance liquid chromatography (HPLC). The purification
by reverse phase HPLC is repeated three times and the
fractions containing the product are collected, and the
product is subjected to amino acid analysis, by which it is
confirmed that the amino acid sequence of the product
corresponds well to that of HTLV-IIIMN strain, and thereby
it is concluded that the product is a synthetic peptide of
gp120 of HTLV-IIIMN strain.
The thus-obtained synthetic peptide (designated
"SP-1") is lyophilized, and then is bound to an
immunization carrier, KLH (Keyhole Limpet Hemocyanin) to
give a peptide-KLH conjugate in the following manner.
The above peptide SP-1 (10 mg) is dissolved in
10 mM phosphate buffered saline (PBS, pH 7.0, 2 ml),
thereto is added a solution of MBS crosslinking agent in
dimethylformamide (40 mg/100 u1), and the mixture is
stirred at room temperature for 30 minutes. The reaction
CA 02046016 2001-10-26
- 12 -
mixture is washed with dichloromethane (2 ml) three times,
and the aqueous layer (designated Absolution A") is
separated.
Separately, KLH (20 mg) is dissolved in
0.2 M Tris-HCl buffer (pH 8.6, 8 M urea, 5 ml) thereto is
added dithiothreitol (DTT), and the mixture is stirred at
room temperature for one hour. To the reaction mixture is
added 10 o trichloroacetic acid (3 ml), the resulting
precipitate is separated by filtration with suction, washed
with distilled water (2 ml) and then dissolved in 20 mM
sodium phosphate buffer (NaPB, pH 7.0, 0.6 M urea, 5 ml) to
give a solution (Solution B).
The above Solution A and Solution B are mixed and
stirred at room temperature for 3 hours, and the reaction
product is dialyzed and lyophilized.
The synthetic peptide of gp120 of HTLV-IIIMN
strain and peptide-KLH conjugate prepared above are used as
an immunogen and antigen for assay.
(2) Cultivation of HTLV-IIIMN-producing cells and
preparation of HTLV-IIIMN particles:
The H9/HTLV-IIIMN strain is used as HTLV-IIIMN-
producing cells. A culture medium is RPMI1640 supplemented
with 20 o FCS and 2 mM L-glutamine to be used in a 50 L
scale. The H9/HTLV-IIIMN strain is cultivated in said
culture medium in a 36 liter SpinnerTM flask with a
cultivation controller (manufactured by Wakenyaku Kogyo
K.K.) and the resulting cells-floating mixture is
centrifuged at 3,000 r.p.m. for 5 minutes to separate the
CA 02046016 2001-10-26
- 13 -
culture supernatant. The culture supernatant is subjected
to sucrose density-gradient centrifugation (25 0, 50 0,
discontinuing, 89,000 x g, 20 hrs.) with a continuous
rotater (RPC35TTM, manufactured by Hitachi Ltd.) at a rate
of 2 liter/hr. to separate viral particles, wherein the
viral particles are collected in 30 - 45 % sucrose layer.
The viral particles thus-obtained are used as an immunogen
and an antigen for assay.
Purified gp120 is prepared by collecting the
cells from the above H9/HTLV-IIIMN culture broth by
centrifugation, lysing the cells with 1 o TritonGX-100,
centrifuging the mixture and then purifying the supernatant
by affinity chromatography with ConA - Sepharose°4B column.
The eluted solution is further purified by affinity
chromatography with HIV antibody (IgG) - Sepharose 4B
column. The purified gp120 thus obtained is used as an
immunogen and an antigen for assay.
(3) Preparation of recombinant expression
peptide of HTLV-IIIMN gp120 V3 domain:
H9/HTLV-IIIMN cells (106 - 10' cells) are floated
in 1 x RSB buffer and thereto are added sodium dodecyl
sulfate (SDS, at final concentration of 1 0) and Proteinase
K (at final concentration of 1 mg/ml), and the mixture is
incubated at 37°C for 2 hours. The resulting mixture is
repeatedly subjected to extraction with phenol and
precipitation with ethanol to give a high molecular weight
DNA (genomic DNA). HTLV-IIIMN gp120 V3 domain (amino acid
247 - 370) is amplified by conventional PCR method by using
CA 02046016 2001-10-26
- 14 -
a template of the above high molecular weight DNA and the
following A primer and C primer:
A primer: (5')TGTACACATGGAATTAGGCCAG(3')
C primer: (3')GAAGTCCTCCCCTGGGTCTTTA(5')
The amplification is carried out with Taq polymerase for 30
to 35 cycles.
The amplified DNA fragment is cloned with pUCl8
plasmid, and the cloned DNA fragment is inserted into pUEX2
expression vector (manufactured by Amersham, Code No.
RPN1515; Bressan, G. and Stanley, Y., Nucleic Acid
Research, 15, p. 10056, 1987). Escherichia coli are
transfected with the expression vector and then subjected
to heat induction at 42°C to express the peptide. The
expressed HTLV-IIIMN gp120 V3 domain (amino acid 247 - 370)
is a fusion protein with I~-galactosidase, which is then
purified in the form of E. coli-inclusion body as follows.
After expression, E. coli are fractured with
glass beads and treated with lysozyme (final concentration,
0.1 mg/ml) at 4°C. The resulting precipitate separated by
centrifugation is treated with Triton X-100 (final
concentration, 0.5 0). The precipitate is solubilized with
8 M urea and is used as an immunogen and an antigen for
assay.
Immuno-sensitization of mouse
An example of immuno-sensitization of mouse with
the synthetic peptides prepared hereinabove is illustrated
below.
BALB/c mice (4 - 8 weeks age) are inoculated with
CA 02046016 2001-10-26
- 15 -
the synthetic peptide and synthetic peptide-KLH conjugated
antigen mixture (each 100 ug) three times via an
intraperitoneal route and one time via an intravenous
route, on the first day i.p. in the presence of Freund's
complete adjuvant, on 14th day i.p. in the presence of
Freund's incomplete adjuvant, on 28th day i.p. in the
presence of Freund's incomplete adjuvant, and on 42nd day
i.v. in the absence of an adjuvant.
Cell fusion and cultivation of hybridoma
Three days after the immunization, the spleen
cells are collected from the mice in a usual manner.
The spleen cells are mixed with myeloma cells
p3X63Ag8-Ul in a ratio of cells of 1 . 5, and the mixture
is centrifuged (1,200 r.p.m./5 minutes) to remove the
supernatant. The precipitated mass of cells is well
untangled and is added to a mixture (1 ml) of polyethylene
glycol-4000 (2 g), minimum essential medium (MEM) (2 ml)
and dimethylsulfoxide, and the mixture is incubated at 37°C
for 5 minutes, and thereto is slowly added further MEM to a
total volume of 50 ml. The mixture is centrifuged
(900 r.p.m./5 minutes) to remove the supernatant fluid and
the cells are untangled mildly. To the cells is added a
normal medium (RPMI1640 medium with 10 o FCS) (100 ml), and
the cells are gradually suspended therein with a measuring
pipette.
The suspension is poured into each well of a
24-well culture plate (1 ml/well) and the plate is
incubated in an incubator containing 5 o COz at 37°C for 24
CA 02046016 2001-10-26
- 16 -
hours. Then, 1 ml/well of HAT medium [a normal medium
supplemented with hypoxanthine (1 x 10-9 M), thymidine (1.5
x 10-3 M) and aminopterin (4 x 10-' M) ] is added and the
plate is incubated for an additional 24 hours. The culture
is continued for 10 to 14 days in the same manner while
exchanging the culture supernatant (1 ml) with the same
volume of a HT medium (HAT medium depleted with
aminopterin) every 24 hours for 2 days.
Each well with the fused cells (about 300 cells
per well) growing in a colonial shape is selected. The
culture supernatant (1 ml) of the selected well is
exchanged with the same volume of the HT medium and then
the exchange is repeated every 24 hours for 2 days.
After 3 to 4 days culture with the HT medium, a
part of the culture supernatant is collected and used for
selection of the desired hybridoma by screening method as
described below.
Screening of hybridoma
The desired hybridoma is selected by a
combination of enzyme immunoassay (EIA), immunofluorescence
and Western blotting methods. The thus selected clone is
measured for its neutralizing activity.
(1) EIA:
To each well of a 96-well microtest plate is
added 100 ul/well of the synthetic peptide antigen,
purified gp120 antigen, or recombinant peptide (protein
concentration: 2 ug/ml), prepared as mentioned above, and
the plate is incubated at 4°C overnight for immobilization.
CA 02046016 2001-10-26
- 17 -
Then, 2 o bovine serum albumin (BSA) solution (100 u1) is
added to each well and the plate is incubated in the same
manner for masking. To each well of the thus prepared
antigen-immobilized plate are added the hybridomas obtained
by the cell fusion and the culture supernatant of
hybridomas after cloning, and the plate is incubated at
37°C for 2 hours. The plate is washed with 0.1 0
Tween~'20/PBS three times and 100 ul/well of a solution of
peroxidase-labelled anti-mouse immunoglobulin (manufactured
by Cappel, x 5,000 dilution). After incubation at 37°C for
1 hour, the plate is washed with 0.1 o Tween 20/PBS five
times. Then, a substrate solution of 3,3',5,5'-
tetramethylbenzidine (TMBZ) is added to each well for color
development and an optical density is measured at 450 nm.
A hybridoma clone is thus selected which strongly reacts
only with the synthetic peptide derived from HTLV-IIIMN but
not with the synthetic peptide derived from HTLV-IIIB.
(2) Immunofluorescence:
H9/HTLV-IIIMN cells or uninfected H9 cells
(5 x 105 cells) suspended in the culture supernatant to be
tested (100 ~1) are cultured at 4°C for 30 minutes. The
cultured cells are washed twice with a PBS solution
containing BSA (2 0) and azide (0.1 0) (PBS-BSA-Az). After
washing, 100 u1 of anti-mouse IgG labelled with
fluorescein-isothiocyanate (FITC) (manufactured by Sigma,
diluted to 1 . 40 with PBS-BSA-Az) and the mixture is
reacted at 4°C for 30 minutes. The reaction mixture is
washed with PBS-BSA-Az three times and then fixed with PBS
CA 02046016 2001-10-26
- 18 -
containing 0.1 o paraformaldehyde.
Using laser flow-cytometry (Spectrum III°
manufactured by Ortho Diagnostics), the reactivity of the
antibody is measured based on the strength of fluorescence.
A hybridoma showing a maximum binding ability to the
surface of H9/HTLV-IIIMN cells is selected and cloned by
limiting dilution method. The hybridoma clone after cloning
is also selected in the same manner.
(3) Western blotting:
Western blotting is carried out in accordance
with Towbin et al. [Proc. Natl. Acad. Sci. U.S.A., 76,
p. 4350 (1979) ] .
A purified HTLV-IIIMN virus is prepared by the
method described in the literature [Science, 224, p. 497
(1984)] and electrophoresed by 12 o sodium dodecyl sulfate-
polyacrylamide gel electrophoresis (SDS-PAGE). The gel is
then transferred to nitrocellulose membrane to transfer the
virus to the membrane and the membrane is cut into strips
with 0.4 to 0.5 cm width. Each strip is immersed in a
hybridoma culture supernatant and incubated at room
temperature overnight. After washing with PBS three times,
each strip is warmed in a solution of biotin-labelled anti-
mouse IgG (manufactured by TACO) diluted to 1 . 750. After
washing with PBS three times, each strip is immersed in a
solution of horseradish peroxidase-conjugated avidin
(manufactured by Sigma) diluted to 1 . 1,000 and warmed for
1 hour. After washing with PBS three times, a coloring
reagent containing 4-chloro-1-naphthol (manufactured by
CA 02046016 2001-10-26
- 19 -
BIO-RAD) is used for color development. A hybridoma
showing a colored band of HTLV-IIIMN gp120 is selected and
cloned. The hybridoma clone after cloning is also selected
in the same manner.
(4) Measurement of neutralizing activity:
The culture supernatant of H9/HTLV-IIIMN is used
as an original viral solution (104'5 to 105 TCIDSO) .
The viral solution adjusted to 10 TCIDSO/50 u1 and
50 u1 of the hybridoma clone culture supernatant or
purified ascites, which are diluted in series, are
inoculated into each well of a 96-well flat-bottomed plate
and the plate is incubated at 37°C for 1 hour. Then, MT4
cells are added to each well at 10q cells/100 u1/well, said
cells being floated in RPMI1640 medium supplemented with
10 o FCS, L-glutamine (3.5 to 4.0 g/1), penicillin
(50 U/ml) and streptomycin (50 ug/ml), and cultured at 37°C
for 5 days.
The neutralizing activity is evaluated based on
an ability of the antibody to inhibit the syncytium
formation observed during infection. The neutralization
titer is expressed as a minimum effective concentration of
the antibody showing 100 o inhibition of syncitium
formation.
The above selection procedure provides hybridomas
(u39.1 and X5.5) capable of producing the desired
monoclonal antibody.
Preparation of monoclonal antibodies with
hybridomas u39.1 and u5.5:
CA 02046016 2001-10-26
- 20 -
Each 5 x 106 cells/animal of the hybridoma u39.1
or u5.5 obtained above is intraperitoneally administered to
Pristane-treated female BALB/c mice (8 weeks age). After
10 to 21 days, ascites cancer is induced. Ascites are
taken out from the mice and centrifuged at 3,000 r.p.m. for
5 minutes to remove solid components. Then, the antibody
is purified by subjecting the supernatant to affinity
chromatography using Affigel Protein A MAPS-II kit
(manufactured by BIO-RAD).
Example 2
Analysis of monoclonal antibodies u39.1 and u5.5
(1) Reactivity to gp120 synthetic peptide derived
from various HIV mutants:
Synthetic peptides of gp120 (amino acid sequence
303-325 or 308-329) derived from HTLV-IIIMN, HTLV-IIIB,
HTLV-IIIRF and HIV-2 are employed. The reactivity is
tested in the same manner as described in the above
Screening of hybridoma, (1) EIA.
As shown in Fig. l, it is clear that the control
0.5f~ antibody strongly reacts with the peptide derived from
HTLV-IIIB but not with the peptide derived from HTLV-IIIMN
at a lower concentration, although it cross-reacts with the
peptide derived from HTLV-IIIMN at a higher concentration.
On the other hand, it is seen that the monoclonal
antibody, u39.1 is a HTLV-IIIMN-specific antibody, which
strongly reacts with the peptide derived from HTLV-IIIMN.
It is also seen that the u39.1 monoclonal antibody reacts
neither with the synthetic peptides derived from HTLV-IIIRe
CA 02046016 2001-10-26
- 21 -
nor with those from HIV-2 (data is not shown in Fig. 1).
The reactivity of the monoclonal antibody u5.5 is
completely the same as that of X39.1, i.e. this monoclonal
antibody is a HTLV-IIIMN-specific antibody which strongly
reacts only with the peptide derived from HTLV-IIIMN.
(2) Reactivity to gp120 derived from infected
cells (Western blotting):
In order to determine the reactivity of the
monoclonal antibodies u39.1 and u5.5 to the external
envelope glycoprotein gp120 derived from infected cells,
Western blotting was carried out of H9/HTLV-IIIMN cell
lysate. The procedure is the same as that described for
"Screening of hybridoma, (3) Western blotting".
As shown in Fig. 2, strip A is a positive control
in which HIV antibody positive human serum is employed,
wherein a gp120 band is observed. The monoclonal antibody
0.513 does not react with gp120 derived from HTLV-IIIMN
(strip B) while the monoclonal antibodies u39.1 and X5.5
recognize gp120 derived from HTLV-IIIMN (strips C and D).
It is also found that the reactivity of the monoclonal
antibody X5.5 is stronger than that of the monoclonal
antibody X39.1 as shown in Fig. 2.
(3) Neutralizing property of monoclonal
antibodies u39.1 and u5.5:
The neutralizing property of the monoclonal
antibodies u39.1 and u5.5 is examined according to the
procedure described in the above "Screening of hybridoma,
CA 02046016 2001-10-26
- 22 -
(4) measurement of neutralizing activity". The
results are shown in the following Table 1.
m~rio ,
Inhibitory activity Virus-neutralizing
on cell-to-cell activityz
infect. by infected
cellsl
MoAb u5.5 u39.1 0.513 H5.5 u39.1 0.513
Virus
IIIMN 16 63 >500 1 63 >500
IIIB/LAV >500 >500 31 >500 >500 4
IIIRE >500 >500 >500 >500 >500 >500
(Note): 1. Minimum effective concentration (ug/ml) of the
antibody showing 80 % inhibition of cell-to-cell infection
by infected cells
2. Minimum effective concentration (~g/ml) of the
antibody showing 100 o inhibition of viral infection
The right column in Table 1 shows a minimum
effective concentration of the antibody showing 100 0
inhibition of infection of each variant viral species. The
control monoclonal antibody 0.513 shows a neutralizing
activity specific to HTLV-IIIB/LAV. On the other hand, the
monoclonal antibody u39.1 is a monoclonal antibody capable
of specifically neutralizing HTLV-IIIMN which completely
inhibits the infection of HTLV-IIIMN at a concentration of
63 ug/ml, but not the infection of the other HTLV strains
IIIB and IIIRE. The monoclonal antibody u5.5, likewise
u39.1, shows a neutralizing activity specific to the strain
IIIMN. It is seen that the neutralizing activity of the
monoclonal antibody u5.5 is more than 50 times higher than
that of u39.1 and is a strong neutralizing antibody which
CA 02046016 2001-10-26
- 23 -
can completely inhibit the infection of the strain IIIMN at
a concentration of 1 ug/ml.
The left column of Table 1 indicates a minimum
effective concentration of the antibody showing 80 0
inhibition of cell-to-cell infection by infected cells.
The control monoclonal antibody 0.513 shows a neutralizing
activity specific to IIIB/LAV infected cells. On the other
hand, the monoclonal antibody u39.1 inhibits the cell-to-
cell infection by IIIMN infected cells at a concentration
of 63 ug/ml but not the infection by IIIB or IIIRF infected
cells. That is, it is found that the monoclonal antibody
u39.1 is a neutralizing antibody specific to the strain
IIIMN in the cell-to-cell infection by the infected cells.
The monoclonal antibody u5.5, likewise X39.1,
also shows a neutralizing activity specific to the strain
IIIMN. It is seen that the neutralizing activity of the
monoclonal antibody u5.5 is more than about 4 times higher
than that of X39.1 and is a strong neutralizing antibody
which inhibits the cell-to-cell infection by the infected
cells at a concentration of 16 ~g/ml.
