Note: Descriptions are shown in the official language in which they were submitted.
2 ~
~' ~ 91/~1461 PCT/US91/00~67
.
C4 BINDING PROTEIN FUS.I~ON PROTEINS
TECHNICAL FIELD_OF INVENTION
This invention relates to multimeric and
hetero-mulkimeric C4 binding protein (C4bp~ fusion
proteins and composikions and methods using them. Mor~
particularly, this invention relates to multim~rlc C~bp
fusion protei^ns which are aggregates or ass~mblies o~
C~bp monomers linked to ~unctional moieties. It also
relates to C4bp fusion polypeptides and in particular
CD4-C4bp fusi~n polypeptides comprising an amino acid
sequence for a soluble human CD4 protein fused to a
C4bp monomer having, preferably, four short consensus
repeat regions.
BACKGROUND OF THE INVENTION
In light of rapidly developing
biotechnologies, researchers ara producing novel
delivery and carrier systems ~or pharmaceuticals,
vaccines, diagnostics and other bioartive molecules.
Optimally, these systems enhance the properties of the
molecules they carry, complement those molecules with
characteristics they lack and combine useful
characteristics of diffQrent molecules. O~ partiaular
interest to researchers are khe serum half-life o~
bioactive molecules, their affinity for target
particles and cells, targetability of bioactive
~.
WO91/11461 ~ 49~ PCT/US91/00567
- 2 -
~ .
molecules, bioactivity, immunogenicity and the ability
- to administer or deliver several molecules
simultaneously.
Human C4 binding protein (hC4bp) is a
molecule possessing many attractive characteristics as
a deli~ery vehicle for bioactive molecules. Human C4bp
is involved in the human complement system -- a group
of immune system proteins whose functions include
lysing invading cells, activating phagocytic cells and
facilitating the clearance of foreign substances from
the system. It regulates the action of proteins in
this system, partlcularly C4 protein. Structurally,
hC4bp is a flexible, disulfide-bonded molecule expected
to have long serum hal~-life and the ability to target
bioactive molecules to the lymph nodes. The serum form
of hC~bp has a molecular weight of about ~90 kD. On
reduclng SDS gels, hC4bp produces a strong band at
about 70 kD, indicating a disulfide-bonded multimeric
protein.
In the electron microscope, human C4bp
appears as a structure with seven monomeric tentacles
[B. Dahlback et al., "Visualization of Human C4b-
Binding Protein and Its Complexes with Vitamin K-
Dependent Protein S and Complement Protein C4b", Proc.
25 NatlO Acad. SciUSA, 80, pp 3461-65 (1~83)].
Although investigators have referred to the structure i.
of human C4bp as spider-like, the flexibility of the
tentacles of hC4bp renders that protein "octopus-like".
Solution X-ray scattering experiments have suggested ~;
that in some environments, the tentacles of hC4bp may
not be flayed out and the molecule may assume a compact
shape ~S.J. Perkins et al., "Unusual Ultrastructure of
Complement-Component-C4b-Binding Protein of Human
Complement by Synchroton X-Ray Scattering and
h`~ JO~
9l/ll461 PCT/US91/00567
', ;~
Hydrodynamic Analysis", Biochem._J., 233, pp. 799~807
(1986)].
A cDNA encoding the C4bp monomer has been
cloned and characteriæed [L.P. Chung et al., "Molecular
Cloniny and Characterization of the cDNA Coding for
C~b-Binding Protein of the Classiaal Pathway of the
Human Complement System'~ s~chem. J., 230, pp. 133-41
(1985)]. Chung et al. refers to hC4bp as a polypeptide
of 549 amino acids. The polypeptide predicted f~om the
DNA sequence has a molecular weight of about 61.5 kD,
rather than 70 kD as actually measured on reducing SDS
gels. The di~erence in molecular weight apparently is
due to glycosylation o~ the serum ~orm of the
polypeptide.
The ~irst ~91 amino acid~ ~rom the N-tcrm~nus
o~ the 5~}q~ . se~uence arc divisible into eight
domains called short consensus repeat regions (SCRs) of
about sixty amino acids each. These regions are
designated, from N-terminus to C-terminus, SCR8 to
SCR1. The SCR domains are defined by the amino acids
of Figure 1 of this application as follows: SCR8 - +1
to +61; SCR7 - +62 to +123; SCR6 - +124 to tl87;
SCR5 - +188 to +247; SCR4 - +248 to +313; SCR3 - +314
to ~3~4; SCR2 - +375 to +432; SCR1 - +433 to ~491.
These domains, which share significant se~uence
;homology, each contain four similarly situated cysteine
residues. These cysteine residues form intra-domain
disulfide bonds in a regular pattern [J. Janatova
et al., "Disulfide Bonds Are Localized Within the Short
Consensus Repeat Units of Complement Regulatory
Proteins: C4b-Binding Protein", ~5~ a:, 28, pp. ~75~-
61 (1989)]. Within each SC~ domain, the first cysteine
residue bonds with the third and the second cysteine
residue bonds with the fourth, forming a double-loop
35 amino acid sequence. Thus, the SCRs are connected like ;
'
WO91/11461 ~ PCT/US91/0~567
beads on a string. This pattern o~ intra-domain
disulfide bonding is responsible for the conformatiQnal
flPxibility of the C4bp monomer.
In addition to the eight SCR domains, hC4bp
also has a 58 amino acid sequence at the C-terminus,
the C4bp core, which bears no homology to the other
regions of the protein. This region is responsible for
assembly o~ the molecule into a multimer. According to
one model, the cysteine at position +498 of one C4bp
monomer forms a disulfide bond with the cysteine at
position ~510 of another monomer.
In addition to seven C4bp monomers, human
C4bp contains another subunit, a 45 kD polypeptide
which is linked by disulfide bonds to the C4bp heptamer
core [A. Hillarp and B. Dahlback, "Novel 5ubunit in
C4b-Binding Protein Re~uired for Protein S ~inding",
J. Biol. Chem., 263, pp. l2759-64 (1988)]. This
subunit binds protein S, a protein involved in the
regulation o~ blood clotting. When bound to protein S,
protease C catalyses the transformation of clotting
factors VIII and V ~rom the active to inactive forms.
C4bp also exists in mammals other than
humans. It has been isolated from both mouse and -
guinea pig r s . J. Lintin et al., "Derivation of the ~-
Sequence of the Signal Peptide in Human C4b-protein and
Interspecies Cross-hybridization of the C4bp cDNA
Sequence", FEBS Letters, 232, pp. 328-332 (1988)].
Analysis of mouse C4bp indicates that it contains
contiguous SCRs, as does human C4bp. Mouse C4bp,
however, has only six SCRs within each C4bp monomer and
the multimer is held together by non-covalent bonds.
To date, the structural Eeatures oE C~bp have
not been utilized ~or the 1~ vivo delivery o~
therapeutic or prophylactic agents. Despite advances
in biotechnology, the need still exists for methods and
..
... .. .. . .. .. . . .
2~9~
~091/11461 Pcr/us9l/oo~67
products which optimize the characteristics and
delivery of pharmaceuticals, vaccines, diagnostics and
bioactive molecules -- including polyvalency, affinity
for a single target particle, serum half-life,
bioactivity and, in ~ome cases, immunogenicity.
~UPMU~ E~ E ~VENTION
The present invention solves these problems
by providing multimeric and hetero-multimericfC4bp
fusion proteins. Multimeric C4bp fusion proteins are
aggregates or assemblies of C4bp monomers linked to
functional moieties which may be pharmaceutical agents,
vaccine agents, diagnostic agents or other bioactive
molecules. Hetero-multimeric C4bp fusion proteins
contain combinations o~ di~erent C4bp monomer~,
dif~erent functional moietles, or combinations o~ both.
This lnvèntion also provides multimeric and hetero-
multimeric non-human C4bp fusion proteins.
C4bp ~usion polypeptides comprise C4bp
monomers fused or chemically coupled to a functional
moiety. In particular, this invention provides the
fusion polypeptide CD4(187)-C4bp(SCR4). This invention
also relates to multimeric C4bp fusion proteins ;
comprising monomeric C4bp fusion polypeptides. And
this invention further provides DNA sequences encoding
C4bp fusion polyp~ptides, recombinant DNA molecules
comprising those sequences and unicellular host cells
transformed with those molecules. This invention also
provides methods for producing these fusion
polypeptides by culturing such hosts. This invention
also provides compositions comprising C4bp fusion
polypeptides or proteins that are useful as `~
therapeutic, prophylactic or diagnostic agents,
particularly in diagnosing, preventing and treating
AI~S, ARC and HIV infection.
. .
WO91/11461 9~ P~r/~S91~0567
-- 6 --
The fusion proteins of this invention
advantageously utiliæe various features of hC4bp,
including its multimeric nature, its large size, the
flexibility of its tentacles and its ability to migrate
through the lymph nodes. Consequently, the bioactive
molecules linked to C4bp monomers as functional
moieties in such ~usion proteins are characterized by
one or more of the following: polyvalency, increased
; serum half-life, increased a~finity for target
particles or cells, greater bioactivity or
immunogenicity and targetability.
Depending upon the choice of functio~al
moiety, multimeric and hetero-multimerlc C4bp ~usion
proteins according to this invention have many uses.
Recognition molecules, such as thos~ containlng the
antigen binding site o~ antibodies, viral r~ceptors or
cell receptors, are useful as functional moieties to
target C4bp fusion proteins to particular antigens.
When targeted in this manner, multimeric C4bp fusion
proteins are useful to block the binding of viruses to
cells, thereby preventing viral infection. C4bp fusion
proteins may also be used to inhibit cell to cell
binding such as that which characterizes pathologic
inflammation. Due to the multivalency and ~-
conformational flexibility o~ the ~usion proteins of
this invention, we believe that they possess greater ~
affinity for the target than monovalent or rigid ~ -
multivalent molecules. In one embodiment of this
invention, the functional moiety is the receptor on
human lymphocytes, CD4, which is the target of the HIV
virus -- the causative agent of AIDS and ARC.
When recognition molecules are usad in
conjunction with toxins, anti-retroviral agents or
radionuclides in hetero-multimeric C4bp fusion proteins
according to this invention, those proteins become
: . ,,, . - . ~ . . .. ~, . . . . .
". : .,, , , ~ ~
2~93~
09l/1~46l PCTtUS91/00567
therapeutic agents which isearch out and destroy their
target~ C4bp fusion proteins having recognition
molecules are also use~ul for signal enhancement in
diagnostic assays. As large multimeric molecules, they
present many binding sites for reporter molecules, such
as horseradish peroxidase-conjugated antibodies.
Alternatively, they may take the form of hetero-
mùltimers, possessing both recognition molecules for
the target and multiple reporter groups.
When the functional moiety component of the
C4bp fusion protein is one or more immunogen from
infectious agents, the proteins o~ this invention are
useful in vaccines. And when the functional group is
an enzyme, substrate, or inhibitor, the multimeric C~bp
fusion proteins may function as agents with inarea~ed
bioactivity.
The prQsent in~ention also pro~ides
recombinant human C4bp and processes ~or pr~duction o~
that protein.
BRIEF DESCRIPTION OF T~ DRAWINGS
Figures lA-lC depict the DNA se~uence and
deduced amino acid sequence of human C4bp polypeptide
derived from pJOD.C4bp.3. The negatively numbered
amino acids correspond to the signal sequence, which is
25 absent from the mature polypeptide. Throughout this -
application, references to C4bp by amino acid formula
correspond to the coordinate system set forth in this
figure.
Figure 2 depicts the structure of an SCR
domain. It portrays an amino acid se~uence of a short
consensus repeat (SCR) region connected to adjacent
SCRs. Each amino acid is represented by ~ cirale. As
described, infra, each SCR is held together by two
disulfide bonds between cysteines 1 and 3 and between
WO91/114~1 PCT/US91/00567
- 8 -
cysteines 2 and ~, as depicted in this figure. The
loop is depicted as the amino acid sequence between
cysteines l and 4, inclusive. The ~oints are depicted
as the a~ino acid sequences between two connected
loops.
Figures 3A-3B depict the nucleotide sequence
and deduced amino acid sequence of human CD4 protein.
Nucleotides l to 636 are derived from
pJOD.'sCD4.Yl87.SnaBl. Nucleotides 637 to 1377 are
l0 derived ~rom pl70.2. In this figure, the amino acids ~';
are numbered from -25 to 375. Throughout this ' ';
application, re~erences to CD4 by amino acid ~orm~la
correspond to the coordinate ~ystem o~ this ~igure,
unless otherwise speci~ied.
Figure 4 depicts the domAin structure o~
human CD4 protein. Tha numbered amino acld~ are
cysteine residues involved in disul~ide bonding
according to Figures 3A-3B.
Figures 5A-5B depict the DNA sequences of
oligomers C4bp.1 to C4bp.20, SCR.l, SCR.4, SCR.8,
312.20, 312.21, 3}2.35 and 312.36. In all sequences,
le~'t to right designates 5' to 3'.
Figures 6A-6H depict the construction of
plasmids pJOD.C4bp and pJOD.sCD4.Yl87.SnaBl.
Figure 7 depicts the construction of a
plasmid containing a sequence encoding a CD4-C4bp
fusion polypeptide according to this invention. A
"CD4-C4bp fusion polypeptide" comprises amino acid
se~uences of human CD4 protein and C4bp. The top
strand depicts pJOD.sCD4 including the adenovirus major
late promoter (Ad ~LP); the 5' untranslated sequence
~5' UTS); the ATG initiation codon and signal se~ue~nce
encoding region; the region encoding human CD4 pro~ein
through the codon for tyrosine (TAC(187)); the SnaBI
site (TACGTA); the BqIII site (AGATCT); and the SV40
....... .
~'~'.091/11461 PCT/US91/00567
~ .
_ g _
polyadenylation control sequence. The bottom strand
depicts pJOD.C4bp, including the region encoding SCR8-
SCRl, the core and termination codon and che MIS gene
polyadenylation control sequence.
Figure 8 depicts the results o~ purification
of recombinant human C4bp ~rhC4bp) and the serum form
of human C4bp ~serum) by HPLC.
Figure 9 depicts illustrative embodiments of
C4bp fusion polypeptides and proteins according to this
invention.
Figure lO i5 a table summarizing the
antibodies uséd in E~ISA assays l-9, described herein.
~n order that the invention her~in described
may be more ~ully unders~ood, the ~o~lowlng dotailed
description is SQt forth.
In the description, the following terms are
employed:
"C4 binding protein" ("C4bp") refers to a
polypeptide having the amino acid sequence depicted in
Figure l from amino acids -32 to +549. It should be
understood that expression of polypeptides often
involves post-translational modifications, such as
cleavage of the signal sequence, intramolecular
disulfide bonding, glycosylation and the like.
Accordingly, the term, C4 binding protein, also
contemplates such modifications to the amino acid
sequence of C4bp. It also encompasses naturally
occurring genetic polymorphisms. The term also
includes C4 binding proteins from natural, recombinant
or synthetic sources.
"Multimeric C4bp fusion proteins" and
"hetero-multimeric C4bp fusion proteins" each comprise
aggregates or assemblies of C4bp fusion polypeptides.
W09~/11461 Pcr/ussl/oos
2 6J~1V~ L~ - lO -
"C4bp fusion polypeptides" comprise a C4bp monomer
bound to a functional moiety. "Functional moieties"
may be polypeptides ("polypeptide moieties") or . ,
chemical compounds ("chemical moieties"). One may
produce multimeric C4bp fusion proteins by genetic
fusion, chemical synthe~is, or chemical coupling
techniques.
When the functional moiety is a polypeptide,
genetic fusion is preferred. This involves, for
example, creating a hybrid DNA sequence encoding the
C4bp fusion polypeptide in which the 3' end o~ a DNA
se~uence encoding the polypeptide is ligated to the 5'
end of a DN~ sequence encoding a C4bp monomer. Upon
expression in an appropriate host, this hybrid DN~
sequence will produce a C~bp ~usion polypeptide that
will assemble into a multimer.
A "C~bp monomer" as used herein is a
polypeptide comprising a C4bp core or, more preferably,
a sequence of at least osle SCR ~used to the N-terminus
o~ a C4bp core. A "C4bp core" encompasses, at a
minimum, amino acids ~498 to +549 of Figure l and,
preferably, amino acids +492 to ~549. As used herein,
an "SCR" is a polypeptide fragment of C4bp. An SCR
comprises, at a minimum, a loop and, at a maximum, a
loop and two joints. A "loop" comprises 'he amino acid
sequence encompassed by the first and fourth cysteines
of the eight SCR domains as defined above. That is,
the Ioops encompass amino acids +2 to +60 of SCR8, +65
to ~122 of SCR7, +127 to +186 of SCR6, +l9l to +246 of
SCR5, +251 to +312 of SCR4, +316 to +375 o~ SCR3, +378
to +432 of SCR2 and +446 to +490 oP SCRl. A "joint"
comprises the amino acid sequences between and (in the
cases of SCR8 and SCRl) outside the loops. ~hus, each
loop is bonded to another loop via a joint. SCRs
having joints are preferable to those that do not have
., .
2 ~
7 ~o 91/1l46~ PCT/US91/OOS67
- joints because it is unlik~ly that two loops bonded
without a joint will be as ~lexible as those bonded
through a joint. Most preferably, an SCR comprises the
amino acid sequence of the SCR domains defined above.
5 It should be understood that one could make minor
alterations in the amino acid sequence of an SCR, for
example by adding a few amino acids to the short loops
of SCR1 and SCR8.
The C4bp monomers of this invention include
10 any sequence of SCRs, including SCRs strung together at
random. However, it is an object of this invention to
produce proteins least likely to evoke an immune
response against the C4bp monomer. Therefore, more
preferably, the amino acid sequence of the C4bp monomer
15 corresponds to at least a ~ragment o~ the amlno ~cid
sequenae of mature C~bp, which is not normally
immunogenic. Thus, the C~bp monomer, C4bp(SCR8)
corresponds to the mature C4bp polypeptide. C4bp(SCR4)
corresponds to amino acids ~248 to ~549 of Figure 1.
C4bptSCRl) corresponds to amino acids +433 to +549 of
Figure 1. The C4bp monomer, C4bp(SC~4), is most
preferable.
According to alternate embodiments of this
invention, C4bp monomers include variable numbers of
SCRs. At a minimum, th~re may be no SCRs. At a
maximum, C4bp monomers may contain about 32 SCRs, about :~
as many as the longest known repeating unit molecule,
CRl, which has 30 domains [L.B. ~lickstein, "Isolation
: of NH2-terminal CR1 (CD35) Clones and Expression of
: ~ 30 Recombinant Human CRl", FASEB J., 2, p. A1832 #8921
(1988)].
A C~bp monomer containing more than eight
SCRs corresponds more preferably to the amino acid
sequence of mature C4bp fused to at least a fragment o~
:
`' .`:
WO91/~1461 PCT/US91/00567
- 12 ~
the same. For example, a sixteen SCR monomer may
- comprisP SCR8-SCRl fused to SCR8-SCRl.
DNA sequences encoding C4bp monomers are
derived from DNA sequences encoding C4bp. Several
methods are available to obtain these DNA sequences.
First, one can chemically synthesize the C4bp gene or a
degenerate version o~ it using a commercially available
chemical synthesizer. We have presented a DNA sequence
for C4bp in Figure l, including the signal sequence
from nucleotides +l to ~96. It confirms the sequences
presented by Sh~1YL~ Bl~, supra, and Lintin et al.,
suPra, except for three silent nucleotide
substitutions. The dif~erences are at the codons
beginning at nucleotides 625, l402 and l45~, which reatt
GGC, TGG and G~G, r~spectively. ÇhYI~LIE~
identifies those codon~ a~ GGT, TGC and GAA.
'~ Second, one can isolate a cDNA sequence
encoding the C4bp polypeptide by screening a cDNA
library. Many screening methods are known to those of
skill in the art. For example, one can screen colonies
by nucleic acid hybridization with oligonucleotide
probes. Probes can be prepared by chemically
synthesiæing an oligonucleotide having part of the
known DNA sequence of C4bp. Alternatively, one can
construct cDNA libraries in expression vectors, such as
~gtll, and screen the colonies with anti-hC4bp
antibodies.
Third, one can isolate a cDNA encoding C4bp
by amplifying mRNA using the polymerase chain reaction
(PCR~. We describe this process in Example I.
The DNA sequence encoding the C4bp monomer
may then be ~used to a D~A sequence enaoding a
functional moiety, such as a polypeptide moiety. DNA
sequences for polypeptides useful in this invention are
available from many sources. These include DNA
91/11461 2 ~ PCT/US~1fO0567
sequences described in the literature and DNA sequences
encoding particular polypeptides obtained by any of
conventional molecular cloning techniques.
This invention also contemplates non-human
C4bp fusion proteins comprising non-human C4bp fusion
polypeptides. In such ~usion polypeptides, the C4bp
monomers comprise C4bp cores and SCRs derived from the
amino acid sequence of a non-human C4bp. Any non-human
C4bp having monomeric units that assemble into a
multimer are useful for this purpose. Such C4bp
multimers exist in the guinea pig and mouse [Lintin
et al., supr~]. Mouse C4bp is preferable, hecause its
amino acid se~uence is known to contain contiguous
SCRs.
A wide array of pol~peptide~ are use~ul to
produce the C4bp ~usion proteins or ~u~ion polypeptides
of this invention. Tho~e most useful include
polypeptides that are advantageously administered in
multimeric form. For example, viral receptors or cell
receptors or ligands are useful, because they typically
bind to particles or cells exhibiting many copies of
the receptor. Fusion proteins containing these ;
polypeptides are useful in therapies that involve
inhibiting viral-cell or cell-cell binding. Useful
viral-cell receptors include ICAMl, a rhinovirus
receptor; the polio Yirus receptor [J. White and D.
Littman, "Viral Receptors of the Immunoglobulin
Superfamily", Cell, 56, ppG 725-28 (1989)] and, most
preferably, CD4, the HIV receptor. Cell-cell receptors
or ligands include members of the vascular cell
adhesion molecule family, such as ICAMl, ~LAMl, and
VCAMl and VCAMlb and their lymphocyte counterparts
(ligands); the lymphoayte associated antigens, LF~l,
LFA2 (CD2) and LFA3, members of the CDll/CDl8 family,
and VLA4. These molecules are involved in pathologic
.~- - .- . ,. ,. , .. ~ . , ,,, . - .
~ . : . . . . ~ . : : .. . .: . . . . .:., , ; . . : . .
W~9t/11461 PCTtUS~]/00567
~L~U
- 14 -
inflammation [M.P. Bevilacqua et al., "Identification
of an Inducible Endothelial-leukocyte Adheslon
Molecule", Proc. Natl._ Acad. S~i. L USA, 84, pp. 9238-
42 ~1987); L. Osborn et al., "Direct Expression Cloning
of Vascular Cell Adhesion Molecule l: A Cytokine-
induced Endothelial Protein that Binds to Lymphocytes,"
Ç~ll, 59, pp. 1203-ll (1989) and Hession et al.,
WO 90/13300].
Bacterial immunogens, parasitic immunogens
and viral immunogens are useful as polypeptide moieties
to create multimeric or hetero-multimeric C4bp fusion
proteins useful as vaccines. Bacterial sources of
these immunogens include thoae responsible for
bacterial pneumonia and pneumocystis pneumonia.
Parasitia sources include malarial parasites, such a~
plasmQq~m~ Viral sources include poxviru~e~, e.g.,
cowpox virus and or~ viru~; herpes viruso5, e.g.,
herpes simplex virus type l and 2, B-virus, varicella-
zoster virus, cytomegalovirus, and Epstein-Barr virus;
adenoviruses, e.g., mastadenovirus; papovaviruses,
e.g., papillomaviruses, and polyomaviruses such as BK
and JC virus; parvoviruses, e.g., adeno-associated
virus; reoviruses, e.g., reoviruses l, 2 and 3;
orbiviruses, e.g., Colorado tick fever; rotaviruses,
25 e.g., human rotaviruses; alphaviruses, e.g., Eastern ~ -
encephalitis virus and Vene~uelan encephalitis virus;
rubi~iruses, e.g., rubella; flaviviruses, e~g., yellow
fever virus, Dengue fever viruses, Japanese
encephalitis virus, Tick-borne encephalitis virus and
hepatitis C virus; coronaviruses, e.g., human
coronaviruses; paramyxoviruses, e.g., parainfluenza l,
2, 3 and 4 and mumps; morbilliviruses, e.g., measles
virus; pneumovirus, e.g., respiratory synGytial virus;
vesiculoviruses, e.g., vesicular stomatitis virus;
lyssaviruses, e.g., rabies virus; orthomyxoviruses,
2 ~
9l~ll4~l PCT/US91/00567
- 15 -
.:
e.g., influenza A and B; bunyaviruses e.g., LaCrosse
virus; phleborviruses, e.g., Rift Valley fever virus;
nairoviruses, e.g., Congo hemorrhagic fever virus;
hepadnaviridae, e.g., hepatitis B; arenaviruses, e.g., `
lcm virus, Lassa virus and Junin virus; retroviruses,
e.g., HTLV I, HTLV II, HIV I and HIV II; enteroviruses,
e.g., polio virus J., 2 and 3, coxsackie viruses,
echoviruses, human enteroviruses, hepatitis A virus
hepatitis E virus, and Norwalk virus; rhinoviruses
e.g., human rhinovirus; and filoviridae, e.g., Marburg
(disease) virus and Ebola virus.
More speci~ically, this invention provides
C4bp fusion polypeptides comprising a polypeptide
moiety comprising viral polypeptidès having hepatitis
virus e antigenicity. A DNA ~equ~nce encoding
hepatitis B virus e antigens ~"~IBeAg") is described in
L. Mimms et al., "Production, Purification, and
Immunological Characterization of a Recombinant DNA-
derived Hepatitis B e Antigen", Viral ~e~atitis and
Liver Disease, pp. 248-251 Alan R. Liss, Inc. (1988).
The amino acids encoded by this sequence correspond to
the amino-terminal 144 amino acids of Hepatitis B Virus
core antigen ("HBcAg") (subtype adw2). Alternatively,
a DNA sequence encoding HBeAg includes the sequence -~
corresponding to amino acids 1 to 144 of HBcAg, as set
forth in M. Pasek et al., I'Hepatitis B Vi-us Genes and
Their Expression in E. coli", Nature, 282, pp. 575-579
(1979). A DNA sequence which encodes HBeAg may also be
obtained according to the processes set forth in Murray
et al., U.S. patent 4,758,507. We shall refer herein
to a DNA sequence encoding, or a polypeptide having,
HBeAg amino acids numbers 2 (Asp) to X as "HBeAg(2-
X)~.
An immunoglobulin or ~ragment thereof that
binds to a target molecule is also useful as a
.. . .
'.. ,~ : :. . :,;~: ':':'' " :- ',. ' ', :, '. ' " ' "' '' : ' ' ' ' ';". .': ., ' , ' '' :
. .. . : . ... : . : . . . . .. ~ . . . .~.~ .
W~9l/l1461 PCTtUS91/00567 ~
2 ~
- 16 -
functional moiety. Immunoglobulin molecules are
bivalent, but immunoglobulin-C4bp fusion pro~eins will
be multivalent and may demonstrate increased a~finity
or avidity for the target. It has been demonstrated
that single domain antibodies (dAbs) are use~ul [E.S.
Ward et al., "Binding Activities of a Repertoire o~
Single Immunoglobulin Variable Domains Secreted from
Escherichia ~li," Nature, 341, pp. 544-46 (1989)].
One can generate monoclonal F~b fragments recognizing
lo specific antigens using the technique of W.D. Huse
et al. and use individual domains as functional
moieties in multimeric or hetero-multimeric C4bp fusion
proteins according to this invention EW.D. Huse et al~,
"Generation o~ a Large Combinatorial Library of the
Immunoglobulin ~epertoire in Ph~ge Lambda," 55L~
246, pp. 1275-81 (lg89)]. ~See al o A. Skerra and
A. Pluckthun, "~ssembly of a Functional Immunoglobulin
Fv Fragment in Escherichia coli", Science, 240,
pp. 1038-43 ~1988)).
One may also produce multimeric C4bp fusion
proteins as agents with increased bioactivity when the
functional moiety is an enzyme, enzyme substrate or
enzyme inhibitor. We expect such agents to exhibit
increased bioactivity because multimers have a higher
density of the moiety and will exhibit increased
turnover rate. For example, a multimeric C4bp fusion
protein with tissue plasminogen activator would have
greater clot-dissolving catalytic activity than its
monovalent counterpart. Multimeric C4bp fusion
proteins with hirudin, C-terminal hirudin peptides
(described in PCT patent application WO 90/03391,
'incorporated herein by re~erence) and molecules based
on hirudin structure (i.e., hirulogs, described in U.S.
patent application 549,388, filed July 6, 1990,
incorporated herein by reference) may display greater
~.,, , . . ~
2 ~
~ 91/11461 PCT/US~1/00567
-~ - 17 -
anti-coagulant activity than monomers of these
polypeptides.
Other useful functional moieties include
polypeptides such as cytokines, including the various
IFN-~'s, particularly ~2~ a5, ~8, IFN-B and IFN-~, the
various interleukins, including IL~l, IL-2, IL-3, IL-4,
IL-5, IL-6, IL-7 and IL-8 and ~he tumor necrosis
factors, TNF-~, and B. In addition, func~ional
moieties include, for example, monocyte colony
stimulating factor (M-CSF), granulocyte colony
stimulating factor (G-CSF), granulocyte macrophage
colony stimulating factor (GM-CSF), erythropoietin,
platelet-derived growth ~actor (PDGF) and human and
animal hormones, including growth hormones and in~ulin.
Accordiny to one emhodimen~ a~ th.is
invention, multimeric C4bp ~usion protein~ compris~
CM -C4bp ~usion polypeptides. CD4 is the receptor on
those white blood cells, T-lymphocytes, which recognize ;
HIV, the causative agent of AIDS and ARC ~P.J. Maddon
et al., "The T4 Gene Encodes the AIDS Virus Receptor
and Is Expressed in the Immune Syskem and the Brain",
Cell, 47, pp. 333-48 (l986)]. Specifically, CD4
recognizes the HIV viral surface protein, gpl20/160.
In these fusion polypeptides, the functional moiety is
a polypeptide moiety comprising CD4 or a fragment
~ thereof, preferably soluble CD4.
`~ The nucleotide sequence and a deduced amino
acid sequence for a DNA that encodes the entire human
CD4 protein have been reported ~P.J. Naddon et al.,
"The Isolation and Nucleotide Sequence o~ a cDNA
Encoding the T Cell Surface Protein T4: A New Member
o~ the Immunoglobulin Gene Family", ~ , 42, pp. 93-
104 (1985); D.R. Littman et al., "Corrected CD4
Sequence", Cell, 55, p. 5~1 (1988)]. Based Upon its
..... .. ; : .: :.. .: .. : .. . : . . : ~ ........... : .. : : . ~ : . i ,
` ' ' ' , '' -. , .. ,.. , :: 1 .; .. , . ~ ; i
WO9l/11461 p~r/uss1/oos67
- 18 -
deduced primary structure, the CD4 protei~l is divided
into functional domains as follows:
Amino Acid
Coordinates
5 Structure/Proposed Location In Figures 3A-3B
Hydrophobic/Secretory Signal -25 to -1
First Immunoglobulin-related +1 to +107
domain/Extracellular
Second Immunoglobulin-related +108 to +177
10 domain/Extracellular
Third Immunoglobulin-related +178 to +293
domain/Extracellular
Fourth Immunoglobulin-related
domain/Extracellular ~294 to ~370
Hydrophobic/Transmembrane ~371 to -~391
Sequence
Very Hydrophilic/ +392 to -~431
Intracytoplasmic
The first immunoglobulin-related domain can be further
resolved into a variable-related (V) region and joint-
related (J) region, beginning at about amino acid +95.
[S.J. Clark et al., "Peptide and Nucleotide Sequences
of Rat CD4 (W3/25) Antigen: Evidence for Derivation
~rom a Structure with Four Immunoglobulin-related
Domains", Proc. Natl. Acad. 5ci. USA, 84, pp. 1649-53
(1987)].
These domains also correspond roughly to
structural domains due to intra-domain disulfide
bonding. Thus, disulfide bonds join amino acids at
positions ~16 and +84 in the first immunoglobulin-
related domain, amino acids +130 and ~159 of the second
immunoglobulin-related domain and amino acids -~303 and
+345 o~ the fourth immunoglobulin-related domain.
Figuxe 4 depicts the domain structure of the human CD4
protein of Figures 3A-3B.
- : . .. ~ . .. . .. .
~ 91/11461 PCT/US91/00567
-- 19 --
Soluble CD4 proteins have been constructed by
truncating the full length CD4 protein at amino acid
+375, to eliminate the transmembrane and cytoplasmic
domains. Such proteins have been produced by
recombinant DNA techniques and are referred to as
recombinant soluble CD4 (rsCD4) [R.A. Fisher et al.,
I'HIV Infection Is Blocked In Vitro by Recombinant
Soluble CD41', Nature, 33l, pp. 76-78 (1988); Fisher
et al., PCT patent application W0 89/01940
(incorporated herein by reference)]. These soluble CD4
proteins advantageously interfere with the CD4+
lymphocyte/HIV interaction by blocking or competitive
binding mechanisms which inhibit HIV infection of cells
expressing the CD4 protein. The ~irst immunoglobulin-
15 related domain is sufficient to bind gpl20/160. By
acting as soluble virus receptors, soluble CD~ proteins
are use~ul a~ anti~iral therapeutics to inhibit HIV
binding to CD4~ lymphocytes and virally induced
syncytia formation.
The CD4 polypeptides useful in this invention
include all CD4 polypeptides which bind to or otherwise
inhibit gpl20tl60. These include fragments of CD4
lacking the transmembrane domain, amino acids +371 to
-~391 of Figures 3A-3B. Such fragments ma-~ be truncated
forms of CD4 or may be fusion proteins in which the
fourth immunoglobulin-related domain is joined directly `
to the hydrophilic cytoplasmic domain. Because the
secondary structure of a polypeptide is important to
it5 function, soluble CD4 proteins preferably will
contain enough of a domain to allow an intra-domain
disulfide bond but not enough to include _he first
cysteine of the next immunoglobulin domain. Within
this range, certain amino acid sequences bind gpl60/120
with greater af~inity than others. We shall refer
herein to a CD4 polypeptide which includes amino acids
' :'.' ,.,: '; ."' ', . ' :" ' `,` ' '" ': "' ' ,, ..: . ' "; , : ; .':,, ,:
, WO9ltll46~ PCT/US9l/00567 ~
2 ~ 3 ~ J~ ~ -- 20
+1 to +X of Figures 3A-3B, and optionally including an
N-terminal methionine, as "CD4(X)".
For example, referring now to Figures 3A-3B,
a soluble CD4 protein containing the first
immunoglobulin-like domain preferably will contain at
least amino acids ~1 to ~84 and at most amino acids +1
to ~129. Most preferably, a soluble CD4 protein
comprises amino acids +1 to ~111 [CD4~111)], A soluble
CD4 protein containing the first two immunoglobulin-
like domains pre~erably will include at least aminoacids ~-1 to +159 and at most amino acids ~1 to +302.
More preferably, a soluble CD4 protein will include at .
least amino acids +1 to ~175 and at most amino acids ~:l
to ~19O. Most preferably, a soluble C~4 protein will
include amino acids ~1 to ~181 ~CM ~181)J, ~mino acids
+1 to ~183 ~CD4~183)J, or amino acids ~1 to ~187
~CD4~1~7)]. A soluble CD~ protcin which ~nalude~ th~
first ~our immunoglobulin-like domains pre~erably will
include at least amino acids +l to +345 and at most
amino acids ~1 to +375 ~CD4~375)]. Any of these
molecules may optionally include the CD4 signal
sequence, amino acids -25 to -1 of Figures 3A-3B.
Also, these molecules may have a methionine residue
optionally preceding amino acid +1 of Figures 3A-3B.
Soluble CD4 proteins useful in the fusion
polypeptides and methods of this invention may be
produced in a variety of ways. We have depicted in
Figures 3A-3B the nucleotide sequence of full-length
CD4 cDNA obtained from pJOD.sCD4.Y187 and pl70.2 and
the amino acid sequence deduced therefrom. According
to the coordinate system in Figures 3A-3B, the amino
terminal amino acid of mature CD4 protein isolated from
T cells is lysine, located at nucleotide 136 of
Figure 3 ~D.R. Littman et al., supra~. Soluble CM
proteins also include those in which amino acid +62 is
: . ,; :.: .. .. . : : :::, .... ~ .. .. : :.. . .
..... ...
~ ~ 91/11461 2~ J9~l1 P~-r/U~91/00567
- 21 - ~
, ~
arginine, encoded by CGG, and thosa in which amino acid
+229 is phenylalanine, encoded by TTT. There~ore, when
we refer to CD4, we intend to include amino ~cid
sequences including one or both of these substitutions.
Soluble CD4 polypeptides may be produced by
conventional techniques of oligonucleotide directed
mutagenesis and restriction digestion, ~ollowed by
insertion of linkers, or by digesting full-length CD4
protein with enzymes.
Soluble CD4 proteins include those produced
by recombinant techniques according to the processes
set forth in copending, commonly assigned United Stakes
patent applications Serial No. Og~,322, ~iled
September 4, 1987, Serial No. 141,649, ~iled January 7,
1988 and Serial No. 351,945, Piled May 24, 1989 and PCT
patent application Serial No. pcT/us~a/o2g4o~ filed
September 1, 1988, and published as PCT patent
application WO 89/01940, the disclosures of which are
hereby incorporated by re~erence.
~icroorganisms and recombinant DNA molecules
characterized by DNA sequences coding for soluble CD4
proteins are exempli~ied by cultures described in PCT
patent application WO 89/01940. They were deposited in
the En Vitro International, Inc. culture collection, in
Linthicum, Maryland, USA on September 2, 1987 and
identified as:
EClO0: E.coli JM83/p~C100 - IVI 10146
BG377: E.coli MC1061/pBG377 - IVI 10147
BG380: E.coli MC1061/pBG380 - IVI 10148
BG381: E.coli MC1061/pBG381 - IVI 10149.
Such microorganisms and recombinant DNA molecules are
also exempli~ied by cultures deposited in the In Vitro
International, }nc. culture collection on January 6,
1988 and identified as:
BG-391: E.coli MC1061/pBG391 - IVI 10151
WO91/l14fi1 PCT/US9l/00$67 ~
æ~
- 22 -
BG-392: E.coli MC1061/pBG3s2 - IVI 10152
BG-393: E.coli MC1061/pBG393 - IVI 10153
BG-394: E.coli MC1061/pBG394 - IVI 10154
BG-396: E.coli MC1061/pBG396 - IVI 10155
203-5 : E.coli SG936/p203-5 - IVI 101560
Additionally, such microorganisms and
recombinant DNA molecules are exemplified by cultures
deposited in the In Vitro International, Inc. culture
collection on August 24, 1988 and identified as:
211-11: E.coli A89/pBG211-11 - IVI 10183
214-10: E.col~ A89/pBG214-10 - IVI 10184
215-7 : E.col~ A89/pBG215-7 - IVI 10185.
Multimeric C4bp fusion proteins comprising
CD4-C~bp fusion polypeptides are use~ul in a variety o~
pharmaceutical compositions and methods. CD~-C~bp
fusion proteins advantageously inhibit HIV binding to
T4~ lymphocytes by virtuc o~ their competiti~e binding
characteristics. And they actively destroy HIV
infected cells expressing the gpl20/160 protein and
producing HIV. Accordingly, the CD4-C4bp fusion
proteins may be used in pharmaceutical compositions and
methods to treat humans having AIDS, ARC, HIV
infection, or antibodies to HIV. They are also useful
to lessen the immuno~compromising effects of HIV
infection or to prevent incidence and spread of HIV
infection. In addition, these CD4-C4bp fusion proteins
land methods may be used for treating AIDS-like diseases
; caused by retroviruses, such as simian immunodeficiency
viruses, in mammals, including humans. ;
DNA sequences encoding C4bp fusion
polypeptides are useful for producin~ multimeric ~4bp
fusion proteins. The pre~erred process involves
expresæing such DNA sequenceæ in a hosk that will
properly assemble the expressed polypeptides into a
multimer.
2 ~
~O9l/l14Sl pcr/us9l/oo567
~ c~
- 23 -
As is well known in the art, for expression
of the DNA sequences of this invention, the DNA ~-
sequence should be operatively linked to an expression
control sequence in an appropriate expression vector
and employed in that expression vector to transform an
appropriate unicellular host. Such operative linking
of a DNA sequence o~ this invention to an expression
control sequence, of course, includes the provision o~
a translation start signal in the correct reading frame
upstream of the DNA sequence. If a particular DNA
sequence being expressed does not begin with a
methionine, the start signal will result in an
additional amino acid -- methionine -- being located at
the N~terminus o~ the product. While such a methion~l-
containing product may be emplo~ed directly in th~compositions and methods o~ this invention, it li~
usually more desirable to remove the methionine be~ore
use. Methods are known to those of skill in the art to
remove such N-terminal methionines ~rom polypeptides
expressed with them. For example, certain hosts and
~ermentation conditions permit removal of substantially
all of the N-terminal methionine ln vivo. Other hosts
require in vitro removal of the N-terminal methionine.
However, such in vivo and in vitro methods are well
known in the art.
A wide variety of host/expression vector
combinations may be emp~oyed in expressing the DNA
~e~uences of this invention. Useful expression
vectors, for example, may consist of segments of
chromosomal, non-chromosomal and syntheti~ DNA
sequences, such as various known derivatives of SV40
and known bacterial plasmids, e.g., plasmids ~rom
including ~olE1, pC~1, pBR322, pMB9 and their
derivatives, wider host range plasmids, e.g., RP4;
phage DNAs, e.g., the numerous derivatives of phage ~,
.
, . ~ .. .,, .. ~, . . ... . . . . . .
~:,~ , . . . ; , , . . ~ . . ,- ; . ,.
W~ 61 PCT/VS91/0~67 ~
J
- 24 -
e.g., NM~3s~ and other DNA phages, e.g., ~13 and
~ilamentous single stranded DNA phages; yeast plasmids,
such as the 2~ plasmid or derivatives thereof; and
vectors derived from combinations of plasmids and phage
DNAs, such as plasmids which have been modi~ied to
employ phage DNA or other expression control sequences.
In addition, any o~ a wide variety of
expression control sequences -- sequences that control ~-
the expression of a DNA sequence when operatively
linked to it -- may be used in these vectors to express
the DNA sequences of this invention. Such useful
expression control sequences, include, for example, the
early and late promoters o~ SV~O or adenov~rus, the ~a~
system, the ~ system, the ~_ or ~ system, the
major operator and promoter regions o~ pha~Q ~, the
control regions o~ Pd coat prot~in, tha promoter ~or 3-
phosphoglycerate kinase or other glycolytic enzymes,
the promoters o~ acid phosphatase, e.g., Pho5, the
promoters of the yeast a-mating factors, the polyhedron
promoter o~ the baculovirus system and other sequences
known to control the expression of genes of prokaryotic
or eukaryotic cells or their viruses, and various
combinations thereof.
A wide variety of unicellular host cells are
also useful in expressing the DNA sequences of this
invention. These hosts include well known eukaryotic
and prokaryotic hosts, such as strains of E.coli,
Pseudomonas, Bacillus, Streptomyces, fungi, such as
yeasts, and animal cells, such as CHO and mouse cells,
African green monkey cells, such as COS-l, COS-7,
BSC l, BSC 40, and BMT l0, insect cells, and human
cells and plant cells in tissUe culture~ For animal
cell expression, we pre~er CHO cells and COS-7 cells.
It should o~ course be understood that not
all vectors and expression control sequen~es will
~D91/11461 2 ~ 5 ~ PCT/US91/00567
- Z5 -
function equally well to express the DNA sequences of
this invention. Neither will all hosts function
equally well with the same expression system. However,
one of skill in the art may make a selection among
these vectors, expression control sequences, and hosts
without undue experimentation and without departing
from the scope o~ this invention. For example, in
selecting a vector, the host must be considered because
the vector must replicate in it. The vector's copy
number, the ability to control that copy number, and
the expression of any other proteins encoded by the
vector, such as antibiotic markers, should al~o be
considered.
In selecting an expression control sequence,
a variety of factors should also be considered. These
include, for example, the relative streng~h o~ ~he
system, its controllability and its compatibility with
the particular DNA sequence oE this invention,
particularly as regards potential secondary structures.
Unicellular hosts should be selected by consideration
of their compatibility with the chosen vector, the
toxicity of the product coded for on expression by the
DNA sequences of this invention to them, their
secretion characteristics, their ability to fold
proteins correctly, their fermentation requirements and
the ease of purification of the products coded on
expression by the DNA sequences of this invention.
Within these parameters, one of skill in the ;~
art may select various vector/expression control
systemthost combinations that will express the DNA
sequences oE this invention on fermentation or in large
scale animal culture, e.g., CHO cells or C0S-7 cells.
According to one embodiment of Lhls
invention, a DNA sequence encoding a CD4-C4bp fusion `
polypeptide inserted into plasmid pJOD-S (described
.. ..
. .
,~
Wo91/11461 PCT/US9~/00567
~ 26 -
herein) and expressed in COS-7 or CHO cells produces
fusion polypeptides which naturally assemble into
heptameric CD4-C4bp fusion proteins.
The polypeptides and proteins produced on
expression of the DNA siequences of this invention may
be isolated from fermentation or animal cell cultures
and purified using any o~ a variety o~ conventional
methods. One o~ skill in the art may select the most
appropriate isolation and purification techniques
without departing from the scope of this invention.
One can a}so produce C4bp fusion polypeptides ;
by chemical synthesis using conv~ntional peptide
synthesis techniques, such as sGiid phase synthesis
~R.B. Merrifield, "Solid Phase Peptide Synthesis. I.
The Synthesis 0~ A Te~rap~ptide", ;,~ " ~ 9~,,
83, pp. 2l49~54 ~l963)~. Multimeria C4bp ~usion
proteins may then be produced ~n ~ Q by ~orming
intra- and inter-C4bp ~usion polypeptide disulfide
bonds.
Another method useful ~or producing
multimeric C4bp fusion proteins, in addition to genetic
fusion and chemical synthesis, is by chemically
coupling a functional moiety to the C4bp monomer. This
method is useful for both chemical moieties or
polypeptide moieties. One may couple the functional
moiety to individual C4bp monomers or to C4bp monomers
already assembled into a multimer, for example, hC4bp
itself or multimeric recombinant hC4bp.
Several methods may be used for chemical
coupling. These include, for example, methods using
glutaraldehyde rM. Reichlin, "Use of Glutaraldehyde as
a Coupling Agent for Proteins and Peptides", ~ethods In
Enzy~o~o~, 70, pp. 159-65 ~l9i~0)J, N~ethyl-N'-(3-
dimethylaminopropyl)-carbodiimide rT.L. Good~riend
et al., "Antibodies to Bradykinin and Angiotensin: A
~J3~
91/11461 PCT/US91/0~567
- 27 -
Use of Carbodiimides in Immunology", $cience, l~,
pp. 1344-46 (1964)] or a mixture of N-ethyl-N'-(3-
dimethylaminopropyl)-carbodiimide and a succinylated
carrier [M.H. Klapper and I.M. Klotz, "Acylation with
Dicarboxylic Acid Anhydrides", Methods In Enzy~olo~y,
25, pp. 531-36 (1972)~ or those heterobifunctional or
homobifunctional cross-linking agents described in the
Pierce Chemical Company Catalog. Since chemical
coupling is not limited to one site on the C4bp
monomer, it is possible to couple more than one
functional moiety to each C4bp monomer. One can also
couple the ~unctional moiety to a glycan on the protein
using the sodium periodate procedure ~P.K. Nakane and
A. Kawaoi, 'IPexoxidase-labeled Antibody: A New Method
of Conjuyation", ~L~I~.e~YM~L~l~LL1hh ~ , pp- l0~4-
9l ~198~)]~ :
Hetero-multimeri C~bp fusion protéins
comprise combinations of different C4bp monomers,
different ~unctional moieties, or combinations of both.
For example, hetero-multimeric C4bp fusion proteins may
comprise combinations of more than one C4bp monomer
(i.e., C4bp.SCR4 and C4bp.SCR8) with one _ype of
functional moiety, one type of C4bp monom~r with
combinations of more than one type of functional moiety
~i.e., a recognition molecule and a reporter group),
combinations of more than one type of C4bp monomer with
combinations of more than one type of functional moiety
and combinations in which not all of the C4bp monomers
are fused or chemically coupled to functional moieties.
A hetero-multimeric C4bp ~usion protein
comprising two dif~erent polypeptide moieties may
advantageously be produced by expressing DNA sequences
encoding the two different polypeptides in a single
host. Upon expression in an appropriate system, the
polypeptides will assemble into multimer~c fusion
:
'
2131~ Pcr/usgl/on567~
~ 28 -
proteins containing more than one type of functional
moiety.
According to an alternate embodiment of this
invention, hetero-multimers characterized by
5 polypeptide and chemical moieties, or two different
chemical moieties, may also be produced. As described
above, a moiety may be chemically coupled to
polypeptides before or after assembly.
Hetero-multimeric C4bp ~usion proteins are
10 especially useful when the properties of the different
moieties complement one another. For example, it is
possible to combine receptors that bind to a particular
target particle or cell and toxins or anti-retroviral
J agents in fusion proteins according to this invention
15 to produce targeted toxic or anti-retro~iral agents.
Polypeptidos use~ul a~ toxin~ includ~, bu~ are not
limited to, ricin, abrln, angiogenin, ~k~Q~Qn~ Exo-
toxin A, pokeweed antiviral protein, saporin, gelonin
and diptheria toxin, or toxic portions thereof. Useful
20 anti-retroviral agents include suramin, azidothymidine
~AZT), dideoxycytidine and glucosidase inhibitors such
as castanospermine, deoxynojirimycin and derivatives
thereof.
Hetero-multimeric C4bp fusion proteins
25 according to this invention are also useful as
diagnostic agents to identify the presence of a target
mol~cule in a sample or i vivo. Such proteins
comprise one functional moiety which is a recognition
molecule, such as an immunoglobulin or a fragment
30 thereof (Fab, dAb) that binds to the target molecule
[See Ward et al., supra] and a second functional moiety
which is a reporter group, such as a radionuclide, an
enzyme (such as horseradish peroxidase) or a
~luorescent or chemiluminescent marker. Because
35 multimeric C4bp is large, many reporter groups may be
~0 91~11461 2 ~ L~ ~ 3 ~ ~ PCT/US9t/00567
_ ~9 _ - ,
coupled to it, thereby enhancing the signal. These
hetero-multimers may be used, for example, to replace
antibodies as recognition molecules that contact the
sample in ELISA-type assays, or as ln vivo imaging
agents.
Hetero-multimeric C4bp fusion proteins
according to this invention may also be used as multi-
vaccines. For example, such fusion proteins may be
constructed using several di~ferent antigenic
lQ determinants from the same infective agent. Also, one
can produce fusion proteins comprising antigenic
determinants from several infective agents, such as
polio, measles, mumps and others used ~or ~hildhood
vaccination, thus creating a multi-vaccine.
Multimeric C4bp ~usion proteins a~cording ~o
this invention also include the normally as~ociat~d
protein S-binding subunit o~ human C~bp. Such protein~
are produced upon transPormation of a host with a first
DNA sequence encoding a C4bp fusion polypeptide and a
second DNA se~uence encoding the protein S-binding
subunit. Upon expression of these DNA sequences, the
C4bp polypeptides will assemble into a multimer
associated with the protein S-binding sub~nit.
It should be understood that while C4bp ;
polypeptides normally assemble into a heptamer (not
including the protein S-binding subunit) it is possible
that if the monomer polypeptides are either smaller or
larger than normal, they may assemble into octamers or
hexamers, for example. Therefore, the multimeric C4bp
fusion proteins referred to in this application include
those other than heptameric C4bp fusion proteins.
The pharmaceutical compositions o~ this
invention typically comprise a pharmaceutically ~`
ef~ective amount o~ a C~bp ~usion protein of this
invention and a pharmaceutically acceptable carrier.
- . . . : ~ : .~ : . . , -
7 W09~ 461 PCT/VS91/00567 ~
2 ~
- 30 -
Therapeutic methods of this invention comprise the step
of treating patients in a pharmaceutically acceptable
manner with those compositions. These compositions may
be used to treat any mammal, including humans.
The pharmaceutical compositions of this
invention may be in a variety o~ forms. These include,
~or example, solid, semi-solid and liquid dosage forms,
such as tablets, pills, powders, liquid solutions or
suspensions, liposomes, suppositories, injectable and
lo infusable solutions and sustained release ~orms. The
pre~erred form depends on the intended mode of
administra~ion and therapeutic application. The
compositions al80 preferably include conventional
pharmaceutically acceptable c~rriers and ad~uvants
which are known to those of skill in tho ar~.
Generally, the pharmaceutiQal compositlons o~
the present invention may be ~ormulated and
administered using methods and compositions similar to
those used ~or pharmaceutically important polypeptides
such as, for example, alpha interferon. Thus, the
fusion proteins of this invention may be stored in
lyophilized form, reconstituted with sterile water just
prior to administration, and administered by
conventional routes of administration such as
parenteral, subcutaneous, intravenous, intramuscular or
intralesional routes. An effective dosage may be in
the range of about 10-100 ~g/kg body weight/day, it
being recognized that lower and higher doses may also
be useful. It will be understood that conventional
doses will vary depending upon the particular molecular
moiety involved.
In addition, one may use DNA sequences
encoding C~bp ~usion polypeptides in somatic gene
therapy. This involves, for example, inserting DNA
sequences into retroviral-based vectors suitable for
9l/1l46~ PCT/US~1/00567
- 31 -
infection of human somatic cells [A. Kasid et al.,
"Human Gene Transfer: Characterization of Human Tumor-
infiltrating Lymphocytes as Vehicles ~or Retroviral-
mediated Gene Transfer", Proc. Natl. Acad. Sci.. USA,
87, pp. 473-77 (1990~]. For example, patients with
AIDS or ARC could be treated as follows. First, one
would prepare a retrovirus characterized by a DNA
sequence encoding a CD4-C4bp fusion polypeptide. Then,
one would isolate T cells from the patient and infect
them, in Yitro~ with the retrovirus. one would then
reintroduce these cells into the patient, where the ' '
vector will express and the cell will secrete CD4-C4bp
polypeptide.
In order that this invention may b~ better
understood, the ~ollowing examples are set ~orth.
These examples are for the purposes o~ illustration
only, and are not to be construed as limiting the scope
of the invention in any manner.
In the examples that follow, the molecular
biology techniques employed, such as cloning, cutting
with restriction enzymes, isolating DNA fragments,
filling out with Klenow enzyme and deoxyribonucleotides
triphosphate (dXTP), ligating, transforming E.coli and
the like are conventional protocols exemplified and
further described in J. Sambrook et al., Molecular
Cloning, A Laboratory Manual, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York (1989). ' ;'
EXAMPLE I -- CLONING O~ C4 BINDING PROTEIN
We isolated a cDNA sequence encoding human C4
binding protein in the following manner. We obtained
human hepatocytes ~Hep G2) ~rom the American Type
Culture Collection, Rockville, Maryland, WSA, ATCC HB
8065. We isolated polyadenylated mRNA from these cells
using the guanidinium isothiocyanate/oligo dT cellulose
- - ;,.
: : . ~ , : ,, .,, ;, .; . . : ~, .
.. .. . . . . . . .. . . .
W~91tll4~ s~ PCT/USgl/00567
- 32 -
procedure tSambrook et al., supra, pp. 7.19-7.22].
Using 5 ~g polyadenylated mRNA, Mo-MLV reverse
transcriptase and a primer, C4bp.3, we synthesized
antisense C4bp single-stranded cDNA. (The DNA
sequences of all oligonucleotide primers and splint
probes are given in Figures 5~-5B.) We then
synthesized the second strand cDN~ using the Gubler-
Hof~man technique ~U. Gubler and B.J. Hoffman, "A
Simple and Very Efficient Method for Generating cDNA
Libraries", Gene, 25, pp. 263-69 (1983)].
We amplified cDNA sequences for C4bp using
PCR [Sambrook et al., supra, Chapter 14]. We carried
out all ampli~ications using ~3~ DN~ polymerase and
primers pre-phosphorylated with T4 polynucleotide
kinase and ATP. We used the oligonucleotid~ C~bp.l as
the sense primer (which hybridized to tho antisense
strand) and C~bp.2 as the antisense primer. We filled
out the amplified fragments with Klenow enzyme and
dXTP. This produced a 1746 bp fragment encoding C4bp
and bordered by transcriptional start and stop signals.
We verified the identity of this fragment by digestion
with SnaBI and with PstI. As predicted by the DNA
sequence of C4bp, SnaBI digestion produced a 1436 bp
fragment and SnaBI/PstI digestion produced a 1047 bp
fraqment.
Then we inserted the C4bp-encoding fragment
into the animal expression vector, pJOD-S, which was
created as follows. (See Figures 6B-6C).
First we obtained pJOD-10. As described in
European patent application 343,783, pJOD-10 may be
prepared as follows. Pl~smid pSV2-DHFR, (ATCC 37146,
from the American Type Culture Collection) ~S.
Subramani et al., "Expression o~ the Mouse
Dihydrofolate Reductase Complementary Deoxyribonucleic
Acid in Simian Virus 40 Vectors", Molec. 5e11t Biol.,
.
,
,: . : . .. . .. .. . . . .
~0 91/11461 ~ r~ î~ 9 ~ PCT/US91/00567
1, pp. 854-64 (1981~] was digested with A~aI and EcoRI
and the 4429 bp fragment was isolated. Then, a
synthetic double stranded DNA sequence having an ApaI
overhang, a DNA sequence encoding nucleotides ~190 to
+233 of the human gastrin gene [K. Sato et al., "A
Specific DNA Se~uence Controls Termination of
Transcription in the Gastrin Gene~, Molec. Cell. Biol.,
6, pp. 1032-43 ~1986) Figure 4], an XhoI site, and an
EcoRI overhang was produced. This oligonucleotide was
ligated with the 4420 bp fragment obtained from pSV2-
DHFR and the resulting plasmid was called pDT4.
Plasmid pDT4 was then digested with ~3~II and XhoI and
the ~391 bp ~ragment was isolated. The ~ullerian
inhibiting substance expression ~ector pD1 ~R.L. Cate
et al., "Isolation o~ the ~ovine and Human Gen~s ~or
Mullerian Inhibiting Sub~tance and Expres~ion o~ the
Human Gene in Animal Cell~l~, Ç~ll, g5, pp. 685-96
(1986)] was then digested with ~atII and SalI and the
resulting 5462 bp fragment was isolated. This fragment
was ligated with the 4391 bp fragment pDT4 to produce
pJOD-10. ;
We digested pJOD-10 with HindIII and BstEII
and isolated the large fragment which did not encode
Mullerian inhibiting substance. We blunt-ended the
fragment, ligated SalI linXers to the ends and self
ligated the vector. This produced pJOD-S.
We then prepared pJOD-S for insertion o~ the
C4bp-encoding fragment. We linearized the plasmid at
the unique SalI site by digestion with SalI and filled
it out with Klenow enzyme and dXTP. We then ligated
the C4bp-encoding fragment to it using T4 DNA ligase
and ATP. We introduced the ligation mixture into
E~coli HB101 by electroporation. We performed
electroporation at 25 ~FD, 2.5 kV, 200 ohms usinq a
BioRad GENE PULSER~ according to the protocol supplied
,.--" - ; ... .. ... .......... . .
.,, ,.. . " , . ., .. .. .. . , , , . ",, , , , ., , , , ,,, " , , , , , ~, ,,
~091/11461 , ~ PCT/US91/00567
- 34 -
with the instrument [Biorad_Catalog, "Bacterial
Electro-transformation and Pulse Controller Instrument
Manual", #165-2098, version 2-89]. Then we identified
plasmids containing the insert in the proper
orientation by hybridizing with 32P~labelled synthetic
oligonucleotide splint probes C4bp.9 and C4bp.l0.
Splint probes are 30 base long synthetic
oligonucleotides that hybridize across the point of
fusion between an insert and a vector. We ca]led the
resulting plasmid pJOD.C4bp. We have deposited one
isolate of this plasmid, pJOD.C4bp.3.
EXAMPLE II -- EXPRESSION 0~ ~ C~aæ~ a~ER
We introduced supercoiled plasmid DN~ from
~ive isolates o~ p30D.C~bp into COS-7 cells b~
electroporation to tcst them ~or ~xpres~ion Q~
recombinant human C~hp (rhC~bp). We perPorm~d
electroporation at 280 V and 960 ~FD using l x 107
cells in 800 ~l of 20 mM HEPES, pH 7.05, 137 mM NaCl,
5 mM XCl, 0.7 mM Na2HP04 and 6 mM dextrose with 20 ~g
~0 supercoiled plasmid and 380 ~g sonicated salmon sperm
DNA. As a control, we used plasmids containing the
C4bp fragment inserted backwards into the vector, so
that they would not produce C4bp at all.
We plated the transformed cells in l00 mm
dishes or T75 tissue culture flasks in DMEM medium
containing 10% FBS, 4 mM glutamine, 20 mM HEPES
(pH 6.8) at 37C and 5% C02. We then assayed the
culture fluid after seventy-two hours for rhC4bp and
characterized the product using three methods:
immunoprecipitation, gel filtration and immunodetection
on Western blots. In these assays, we comparQd the
rhC4bp produced to the naturally occurring ~orm in
human serum, hC4bp. our results indicated that the
transfected COS-7 cells produced a heptameric C4bp
'3~
91/1l461 PCT/USg1/00567
-- 35 -
protein with properly folded SCRs resemhl~.ng naturally
occurring hC4bp in molecular weight and possessing
epitopes recognized by anti-hC4bp antisera.
Recombinant human C4bp differs from the serum form in
that it lacks a protein S-binding subunit.
A. Immunoprç~çipi~tion of rhC~bp
In the first assay, we immunoprecipitated
both rhC4bp and hC4bp using two different hC4bp-
specific antisera and compared the size of the
precipitated proteins be~ore and after reduction of
disulfide bonds by means of standard sodium dodecyl
sulfate polyacrylamide gel electrophoresis (SDS-PAGE).
A comparison of rhC~bp and hC4bp isolated by
immunoprecipitation showed that rhC4bp produced in COS-
7 cells assembled properly into a heptameric C~bp
protein via disul~id~ bonds. ~ ~;
We performed immunoprecipitation on humanserum ~Gibco, Grand Island, New York) and CoS-7 culture
~luid as follows. The sample had been pretreated by
adding to 1 ml of serum a 0.05 ml suspension of
immobilized Protein G (Gibco, Rockford, Illinois) and
agitating the mixture for 30 minutes at room
temperature. Then we pelleted the Protein G particles
in a centrifuge and used the supernatant for the -
25 immunoprecipitation. We incubated the supernatant with ~;
0.05 ml of either polyclonal rabbit anti-hC4bp
antiserum tCalbiochem Corp., San Diego/La Jolla,
California) or polyclonal sheep anti-hC4bp antiserum
(Biodesign International, Kennebunkport, Maine) and
incubated for 1 hour at room temperature. We then
added 0.05 ml of Protein G suspension and incubated ~or
1 hour at room temperature. The pellet was aentri~uged
and resuspended in 50 mM tris hydroxy amino-methane (pH
8.0) tTris, Sigma Chemical Corp., St. Louis, Missouri)
.. . .
.. .. .. . ., . .. .. .. . ...... . ..... , . : .,. .. : . . . ; : .
.. , ~ .. .. :. : :
.
WO91/11461 PCT/US~1/00~67
9 g~ - 36 -
containing lO0 mM NaCl and 1% Tween 20 (Pierce). We .
centrifuged the solution again and removed the
supernatant. We repeated this procedure twice with the
same bu~fer and with ~0 mM Tris, pH 7.4. Finally, we
resuspended the pellet in 0.15 ml standard Laemmli
sample buf~er and heated the solution in a boiling
water bath f'or 5 minutes. Then we determined the
molecular weights of the precipitated proteins by 5% or
12~ SDS-PAGE.
Human serum C4bp produced a band o~ about
530 kD, representing a C4bp heptamer bound to the 45 kD
protein S-binding subunit. The rhC4bp produced a band
o~ about 490 kD, the predicted molecular weight o~ a
heptameric C~bp protein not includ~ng the
protein S-binding subunit. The control ~ample, with
the DNA insert in the non-expressing orientation, did
not produce a band.
To veri~y that the precipitated rhC4bp was a
heptamer, we performed SDS-PAGE on the immunoprecipi-
tated proteins using the reducing agent, 2-
mercaptoethanol, which breaks disulfide-bonded proteins
into their po'lypeptide subunits. We found that both
hC4bp and rhC4bp produced bands of 70 kD, the size of
C4bp polypeptide.
We also carried out immunoprecipitation on
rhC4hp which had been expressed in COs-7 cells in the
presence of 35S-labelled cysteine (New England Nuclear,
Boston, Massachusetts). We pxecipitated the resulting
35S-labelled protein using the above mentioned rabbit
anti-hC4bp serum and analyzed it on 4%-20% gradient
SDS-PAGE. Under non-reducing conditions we detected on
an autoradiograph a high molecular weight band
equivalent to the above-described`490 kD protein.
Af'ter reduction, this band disappeared and gave rise to
a band o~ about 70 kd. Both bands were absent in the
, ,, . ` . :, , .~,'.,` ' , . . , `- ,:.
2 ~
91/114fi1 PCT/US91/005S7
- 37 -
negative control sampla. This con~irmed that th~ C4bp
polypeptides were assembling into a heptamer.
B. Immunodetection of rC4bp on Western blot
We next precipitated rhC4bp and hC4bp
unsele~tively with trichloroacetic acid (TCA) and
identi~ied the proteins on Western blot using three
dif~erent hC4bp-speci~ic antisera. Immunodetection of
rhC4bp and hC4bp on Western blot under non-reducing and
reducing conditions suggested that COS-7 cells produced -;
lO a rhC4bp with properly folded disulfide bonds. ;~
We precipitated rhC4bp from lO-fold
concentrated cell culture ~luid (aoncentrated via
ultra~iltration, CENT~IPREP 30~, Amicon) and hC~bp ~rom
serum by addition o~ 12~ w/v TCA A~ter on~ hour in
the icc bath, the proteins were pelleted by
centri~ugation in an EPP~NDO~F~ centri~uge (~ppendor~)
at lO,000 g ~or lO min at ~C. The pellet was
resuspended in l ml of cold acetone (-20C) and was
immediately repelleted under the above conditions. We
repeated this wash step once. Finally, we dissolved
the protein pellet in standard Laemmli sample buffer
and heated the solution in a boiling water bath for 5
minutes. We then separated the proteins on a 5%
acrylamide gel (SDS-PAGE) under non-xeducing and
reducing conditions (using 2-mercaptoethanol). We
transferred these proteins on nitrocellulose using
standard immunoblotting techniques. Then we examined
the blots by immunodetection.
:~
We blocked non-specific binding on these
blots by incuba~ing them in Dulbecco's PBS with 5% non-
fat dry milk (Carnation, Los An~eles, California).
Next, we incubated the blot in a 5~ milk solut~on
conta~ning a primary an~ibody at a dilution o~ l:500.
As primary antibody, we used polyclonal rabbit anti-
.
: ,
,, . . ::- : . , :., , . . ; , . - . ,
WO91/11461 PCr/US91/00567
~ 38 -
hC4bp antiserum (Calbiochem), polyclonal sheep anti-
hC4bp antiserum ~Biodesiyn) or a monoclonal ~urine
anti-hC4bp antibody (Quidel, San Diego, California).
After one hour at room temperature, we washed the blot
three times with 0.05% Tween-20 in PBS. Then we
incubated the blot with the secondary antibody at a
~ilution o~ l:lO00 in the 5% milk solution. As
secondary antibody, we used commercially available
horseradish peroxidase conjugated antibodies clirected
to rabbit IgG, sheep IgG or mouse IgG, respectively
(Amersham Corp., Arlington Heights, Illinois or
Calbiochem). After an incubation period of one hour at
room temperature, we repeated the above described wash
procedure. We visualized antibody-antigen complexes by
incubation with the horseradish peroxidase substrates
4-chloro-l-naphthol (0.02~, w/v, Sigma) and hydrogen
peroxide (0.03%, Sigma) in PBS.
In the case o~ rhC4bp, we detected a single ~`
band at a molecular weiyht of ca. 490 kD. In the case
of the human serum, the band had been shifted to
slightly higher molecular weight (ca. 530 kD) which may
re~lect the presence of the additional 45 kD protein S
binding subunit. We detected no proteins in a negative
control. These results again demonstrated that the
recombinant form of rhC4bp had assembled into a
heptamer which was recognized by anti-hC4bp antisera
and which resembled in molecular weight the naturally i~
occurring form minus the pro~ein S binding subunit.
After reduction and separation of the proteins on a 12%
acrylamide gel (SDS-PAGE), we did not detect any
protein in any case using the above antisera. Thus,
the antisera used had only recognized hC4bp having
correctly folded disul~ide bridges. This provided
additional evidence that the recombinant form of hC4bp
which had been well detected with the antisera under
?~ ~
91/11461 PCTtUS91/00567
_ 39 _
. ;
nonreducing conditions, was similar or identical to the
naturally occurring form of that protein without the
protein S binding subunit.
C. Gel Permeation Chromatography and
Identification o~ hC4bp- and
rhC4bp-containing Fractions via a
~ _ -.',
We also separated rhC4bp and hC4bp according
to size, under conditions that preserved the nati~e
structure of the protein, using a high performance
liquid chromatography (HPLC) gel permeation technique.
Subseguently, we identified the peak positions and thus
the approximate molecular weight o~ the proteins by
subjecting fractions to a hC4bp-speci~ic enzyme llnked
immunosorbent a~ay (ELISA).
~ PLC o~ rC~bp and hC~bp supportqd our
previ~us results, indicating that COS-7 cells produced
rC4bp in heptameric ~orm. It also suggested that hC4bp
exists bound to a natural ligand, such as protein S or
C4b (a fragment o~ C4).
We equilibrated a TSK-4000SWXL~ HPLC-gel ~`
permeation column (300 x 7.8 mm, Toyo Soda, TOSOM
Corp., Japan) in 50 mM phosphate buffer, pH 7.0, l00 mM
sodium chloride. We calibrated the column using the -~
molecular weight markers thyroglobulin (ca. 670 kD),
ferritin ~(ca. 440 kD~ and catalase (ca. 230 kD~ (all ~-
from Pharmacia-LKB) and detected the eluted peaks using
a W detector at 280 nm. We loaded human serum (0.05
ml diluted to 0.5 ml with PBS) or a lO-~old
concentrated cell culture supernatant (0.5 ml)
containing the expressed rhC~bp onto this calumn. We
eluted the proteins from the column with e~uilibration
bu~er at a linear flow rate o~ l mljmin, collecting
0.5 ml fractions.
.
W~91/11461 PCT/US91/00567
L ~
-- 40 --
We assayed the collected fractions using a
hC4bp-speci~ic sandwich ELISA (ELISA 9). (See
Figure l0 for a summary of the ELISA assays described
in this specification.) More specifically, we coated a
96 well standard ELISA plate (Immulon II, Dynatech
Laboratories) with a polyclonal sheep anti-hC4bp
antibody (Bioflesign) at a protein concentration of
0.005 ~g/ml in 0.05 M bicarbonate buffer, pH 9Ø We
incubated the plate at 4C overnight. We blocked the
non-specific sites in the wells by the addition of 2%
milk in PBS and incubated it ~or at least 30 minutes at
room temperature. We washed the ELISA plate three
times with 0.05% Tween-20 in PBS and added 0.05 ml ``
aliquots o~ each fraction ~rom the HPLC-column diluted
l:2 or l:l0 in PBS con~aining 2~; non~a~ dry milk . Th~n
we incubated the plates ~or 3 hour~ at room t~mperature
and washed them a~ descrlbed above. We added 0.05 ml
of a polyclonal rabbit anti-hC4bp serum (~albiochem),
optimally diluted (l:3000) in Pss containing 2% milk,
to each well. We incubated the plate for l hour at
room temperature and then washed it as above. Finally,
we added 0.05 ml horseradish peroxidase
(HRP)-conjugated goat anti-rabbit IgG (Organon Teknika
Corp., West Chester, Pennsylvania), appropriately
25 diluted in PBS containing 2~ milk and incubated the -~
plate for l hour at room temperature. After washing
the plate we added OPD* (o-phenylenediamine)
(Calbiochem) as the substrate for HRP in order to ~ -
detect colorimetrically the amount of HRP-antibody
bound. We quantitated the results by reading the
absorbance of each well at 490 nm.
* This is a potential carcinogen which should be
detoxified before disposal using a solution of: 50g
K2CrO7, 25 ml ION H2S0~, l45 ml H2O.
91/114~1 PCT/US91/00~67
- 41 -
;~
~ e then plotted the results against the
fraction numbers as shown in Figure 8. As demonstrated
; in that figure, the elution profile of rhC4bp peaked at
about 490 kD, consistent with other results that
indicate that the rhC4bp which had been expressed in
COS-7 cells was present as a heptamer exposing
correctly ~olded immune epitopes. However, the elution
profile of hC4bp peaked somewhat higher than 700 kD, in
contrast to the expected 530 kD. This may have
resulted from non-covalent binding of the molecule to
its natural ligands, C4 and protein S. We have also
observed the presence o~ protein S in these fractions
(data not shown).
We next produc~d p~OD.sCD4.Yl87.SnaBl, a
plasmid characterized by a DNA sequence which encodes
rsCD4(187). We began with pJODsCD4, described in PCT
application WO 89tOl949, which may be prepared as
follows (see Figure 6G). Plasmid pBG39l (IVI 10149)
was digested with BamHI and ~lII and filled out with
Klenow enzyme and dXTP. Double stranded XhoI linkers,
having the sequence 5' CCTCGAGG were ligated to the
ends with T4 DNA ligase. The mixture was digested with
XhoI and the 1407 bp fragment encoding rs~D4 was
isolated. Then pJOD-S, described in Example I, was
digested with SalI and phosphorylated with alkaline
phosphatase. The resulting 1407 bp fragment was
ligated into the SalI-digested pJOD-S with T4 DNA
ligase. This produced pJODsCD4.
We then modi~ied pJODsCD4 to create a SnaBI
cloning site (see Figure 6H). We introduced the ~BI
cleavage site directly a~ter the sequence encoding the
tyrosine residue at position 187 of CD4 as follows. We
created a NheItBqlII linker containing the unique ~BI
. . . - . . . ~ .
WO91~11461 PCT/US91/00567 ~
i3 ~ 42
site by hybridizing prephosphorylated C4bp.7 with
prephosphorylated C4bp.8. We then digested pJODsCD4
completely with NheI and partially with B~lII. We
added the linker to this digestion mixture and ligated
the ~ragments with T4 DNA ligase. Then we
electroporated the ligation mixture into E.coli HBlOl
using the method o~ Example I. We identified plasmids
conkaining the synthetic ~ragment bordering the correct
BqlII site of the large digestion fragment by
hybridization with the 32P-labelled splint probe
C4bp. 1~ . We called such plasmids pJOD. sCD4 . Y187 . SnaBl.
EXAMPLE IV -- CLONING CM -cg bp_FUSXON _POLYPI:Pl~ S
We next constructed three clones that
expre~,sed CD4-C4bp ~usion proteins (~ee Figure 7).
This involved inserting a DN~ sa~uence encodlng C~bp,
or a ~ragment thereo~, into the Sna~X site of
pJOD. sCD4 . Yl87.SnaBl. We used three DNA sequences
encoding, respectively, SCR8-SCRl and the C4bp core,
SCR4-SCRl and the C4bp core, or SCRl and the C4bp core.
We generated the DNA sequences by PCR, as follows.
We produced a l648 bp fragment of C4bp
encoding SCR8~SCRl and the C4bp core by performing PCR
with pJOD.C4bp.3 linearized with NotI. We used the
prephosphorylated sense primer SCR.8 and the prephos-
phorylated antisense primer C4bp.2 (Figures 5A-5B). We
then repaired the ends of the PCR products with Klenow
enæyme and dXTP. We ligated the resulting fragment
with pJOD.sCD4.Yl87.SnaBl which had beén previously
linearized with SnaBI. We electroporated the ligation
mixture in~o E.co_ll HBl0l. Then we identified plasmids
in which the t~rosine-encoding sequence bordered SCR8
by hybridlzation to the 3~P-~labelled oligonucleotide
splint probe C4bp.12. We named such plasmids
pJOD.sCD4.Yl87.SCR8. We called the ~usion polypeptide
: . .. .. . :.. . ~. . . ~ . ..
91/l1461 2 ~ PCT/US91/~0567
- ~3 -
expressed by such plasmids, CD4(187)-C4bp(SCR8). We
obtained isolates of those plasmids,
pJOD.sCD4.Y187.SCR8.2 and pJOD.sCD4.Y187.SCR8.3.
We produced a 1089 bp fragment of C4bp
encoding SCR5-SCRl and the C4bp core as above, except
that we used the sense primer 312.21 instead of SCR.8.
Then we ligated the fra~ment with pJOD.sCD4.Y187.SnaBl,
which had been previously linearized with SnaBI. We
electroporated the ligation mixture into E~coli HB101.
Then we identifie~ plasmids in which the tyrosine-
enc~ding sequence bordered SCR5 by hybridization to the
32P-labelled oligonucleotide splint probe 312.36. We
named such plasmids pJOD.sCD4.Y187.SC~5. We called the
~usion polypeptide expressed by such plasmids,
CD~(187)-C~bp~SCR5). We obtained two i~olates of th~se
plasmids, p~OD.sCD4.Y187.SCR5.1 and
p~OD. sCD4 . Y187.SCR5.2
We produced a 90~ bp fragment of C4bp
encoding SCR4-SCR1 and the C4bp core as above, except
that we used the sense primer SCR.4 instead of SCR.8.
Then we ligated the fragment with p~OD.sCD4.Y187.SnaB1,
which had been previously linearized with SnaBI. We
electroporated the ligation mixture into E.coli HB101.
Then we identified plasmids in which the tyrosine- -
encoding sequence bordered SCR4 by hybridization to the
32P-labelled oligonucleotide splint probe C4~p.13. We
named such plasmids pJOD.sCD4.Y187.SCR4. We called the
fusion polypeptide expresssd by such plasmids,
CD4(187)-C4bp(SCR4). We obtained two isolates of those
plasmids, pJOD.sCD4.Y187. SCR4 . 2 and
pJOD. sCD4 . Y187.SCR4.3.
We produced a 711 bp fragment of C~bp
encoding SCR3-SCR1 and ~he C4bp core as above, except
that we used the sense primer 312 . 20 instead of SCR.8.
Then we ligated the ~ragment with pJOD.sCD4.Y187.SnaBl,
..
.
.. . ... .... .
Wo91/~1461 PCT/US91/00567
'
- 44 -
which had been previously linearized with SnaBI. We
electroporated the ligation mixture into E.coli H~lO1.
Then we identi~ied plasmids in which the tyrosine-
encoding seq~ence bordered SCR3 by hybridization to the
32P-labelled oligonucleotide splint prohe 312.35. We
named such plasmids pJOD.sCD4.Y187.SCR3. We called the
fusion polypeptide expressed by such plasmids,
CD4~187)-C4bp(SCR3). We obtained two isolat~s of those
plasmids, pJOD.sCD4.Y187.SCR3.2 and
pJOD.sCD4.Y187.SCR3.3.
We produced a 353 bp fragment of C~bp
encoding SCR1 and the C4bp core as above, except that
we used the sense primer SCR.1, instead of SCR.8~ Then
we ligated the ~ragment with pJOD.sCD4.Y187.SnaB1,
which had been previously linearized with ~n~X. W~
electroporaked the ligation mixture lnto ~Ql~ HBl01.
Then we ~denti~ied plasmlds in which the tyrosine-
encoding sequence bordered SCR1 by hybridization to the
32P-labelled oligonucleotide splint probe C4bp.17. We
named such plasmids pJOD.sCD4.Y187.SCR1~ We called the
fusion polypeptide expressed by such plasmids,
CD4(187)-C4bp(SCR1). We obtained three isolates of
those plasmids, pJOD.sCD4.Y187.SCR1.1,
pJOD.sCD4.Y187.SCR1.2 and pJOD.sCD4.Y187.SCR1.3.
EXAMP~E V -- EXPRESSION AND PURIFICATION OF
CD4-C4bp MULTIMERIC FUSION PROTEINS -~ .
We transformed COS-7 cells, as previously
described, with all the isolates described in Example
IV and tested the cultures ~or the expression of CD4-
C4bp multimeric fusion proteins. Specifically, weelectroporated supercoiled plasmid DNA from each of the
isolates into COS-7 cells. A~ter 72 hours o~
expression, culture ~luids were a~sayed by several
' :'. . :, , . ' ~ '.~ ' ' ': ' ' : ' ' ' ' : ' " ' ' ' ' ' ' ' ' ' '
2 ~
91/11461 PCTtUS91/OQS67
different ELISAs. Our results showed that the calls
expressed CD4-C4bp multimeric ~usion proteins.
A. Expression of CD4(l87)-C4bp(SCR4)
We tested the conditioned medium o~
trans~ormed cells ~or the expression o~ CD4(l87)-
C4bp(SCR4) by both immunodetection on Western blots and
by ELISA assay. The results indicated that these cells
expressed CD4(187)-C4bp(SCR4) and that the polypeptides
expressed had assembled into a heptamer.
l. ELISA Assays
We performed two ELISA assays that together
demonstrated the production o~ a multimeric CD~(187)-
C4bp(SCR~) polypeptide. ~n all ELISA a~say~ described
herein, we washed the platas between step~ wlth 0.05
TWEEN 20 ln PBS.
We performed the two ELISA assays as follows.
We coated Immulon II plates with either rabbit anti-
hC4bp (ELISA l) or the anti-CM monoc}onal 6C6 (a gift
of Biogen, Inc., Cambridge, Massachusetts) ~ELISA 2) by
adding 50 ~l/well of a 5 ~g/ml solution of either
antibody in sodium bicarbonate buffer pH 9.0 and
incubating the plates overnight at 4C. After removing
the coating solution, we blocked non-specific binding
by adding 200 ~l/well of 2~ non-fat dry milk in PBS and
incubating for at least 30 minutes at room temperature.
Then, we removed the blocking solution and added 50
~l/well of sample (conditioned medium or condit~oned
medium diluted in 2% non-fat dry milk) in PBS and
incubated for three hours at room temperature. We
removed this liquid and added 50 ~ltwell o~ the
detector antihody, optimally diluted ~l:lOOO) ~P-
conjugated 6C6. 6C6 is an anti-human CD4 murine
monoclonal that blocks CD4-gpl20 binding. (Another
WO9l/ll461 PCT/US91/00~67 ~
3~ - 46 - ;
antibody that blocks CD4 binding to gpl20, which may be
used in place of 6C6, is anti-Leu-3a, available ~rom
Becton Dickinson, Mountain View, California). We
incubated the plates for 1 hour at room temperature.
We removed this solution and added OPD. We again
incubated the plates for 20 to 30 minutes at room
temperature and stopped the color reaction with lN
sulfuric acid. Then we measured the O.D. at 490 nm.
Both assays gave positive resultsO The assay ~`
in which we coated the plate with anti-hC4bp antibody
detected the presence of polypeptides which contained
both hC4bp and CD4 epitopes. The assay in which we
coated the plate with the 6C6 monoclonal con~irmed the
presence of multimers because only multimers poss~ss
multiple binding sites able to bind simultaneously to
more than one copy oE 6C6.
2. Immunodetection on Western blot
Immunodetection of the conditioned-media on
Western blot confirmed that the transformed cells had
produced CD4(187)-C4bp(SCR4) and further indicated that
the polypeptides had assembled into heptamers. We
carried out immunoprecipitation on two samples of
conditioned msdia as described in Example II. On the
first sample, we used a polyclonal rabbit anti-hC4bp ~;
antiserum (Calbiochem). On the second sample, we used
6C6 antibody. We separated the immunopre~ipitated
proteins in each sample on 5% SDS-PAGE and then
transferred the proteins onto nitrocellulose under
standard e}ectroblotting conditions. We probed the
resulting Western blots with each of two antisera. The
first was polyclonal sheep anti-hC4bp antiserum
~Biodesign). The second was polyclonal anti-hC~4
antiserum (a gift of Biogen, Inc.). We carried out
immunodetection as described in Example I. ~oth the
`;i"'"~ '.'',' ",'.'''`,'".'''~ '''' ;;';
i~ 2 ~
9l/l1461 PCTtU~91/00567
- 47 -
anti-hC4bp antiserum and the anti-hCD4 monoclonal
detected a protein on both blots with the expected
molecular weight of the heptameric ~orm of
CD4(187)-C4bp(SCR4), i.e., 400 kD - 500 kD.
We performed the same immunodetection
procedure using controls -- rhC4bp and human serum. In
this case, anti-hC4bp also dQtected a high molecular
weight form of protein. However, the anti-hCD4
monoclonal failed to detect any protein in the control
samples.
The fact that the same protein was
precipitated from conditioned medium by both the anti-
hCD4 and the anti-hC4bp antiserum demonstrated that
CD4(187)-C4bp(SCR4) actually had been expressed as a
fusion polypeptide and assembled to a heptameric form.
We also carried out an immunoprecipitation on
CD4~187)-C4bp~SCR~) which had b~en expressed in COS-7
cells in the presence of 35S-labelled cysteine (New
England Nuclear). We precipitated the resulting 35S- ,
labelled protein using the above mentioned rabbit anti-
hC4bp serum and analyzed it on 4%-20~ gradient SDS-
PAGE. Under non-reducing conditions, we detected on an
autoradiograph a high molecular weight band at 400 kD -
500 kD. A~ter reduction, this band disappeared and
gave rise to a band of 53.5 kD. Both bands were absent
in the negative control sample. This con~irmed our
previous results that CD4(187)-C4bp(SCR4) had been
expressed and assembled into a heptamer.
B. Purification of Multimeric
CD4(187)-C4bp(SCR4)
By Colum~n Chromatography _
We purified CD4(187)-C~bp(SCR4) using
conventional column chromatography techniqueæ. We
collected 20 l of conditioned medium derived from a
transformed CHO cell line that stably expressed
..
.~.,~. . . ,~ . . . .
I WO91/11461 PCT/US91/00567 ~
2 ~ ~ v ~J ~ '~
- ~8 -
CD4(187)-C4bp(SCR4). We prepared the transformed CHO
cell line by transforming CHO cells with
pJOD.sCD4.Yl87.SCR4.2 by means of electroporation, as
described in U.S. patent 4,956,288 to Barsoum.
Preferably, we purified the CD4-C4bp fusion pro;tein
using thr~e columns sequentially: first, a FAST S~
(Pharmacia) ion-exchange column; second, a Cu chelate
SEPHAROSE~ (Pharmacia) column; and third, a Zn chelate
SEPHAROSE~ (Pharmacia) column. However, the fusion
protein may be partially purified on FAST S~ alone.
To perform FAST S~ chromatography, we
adjusted the conditioned medium to pH 8.0 with sodium
hydroxide and fil~ered it through a 5 ~m pr~filter and
a 0.45 ~m filter. We loaded ~he ~ilterod m~dium on a
300 ml ~ID 50 mm) ~8T Q~ ion-~xchange ¢olumn at 3
mltcm2hr. W~ wash~d the column with 5 column volumes
of 50 mM ~EPES buf~er, p~ 8.0, containing 200 mM NaCl.
We then eluted the CD4-C4bp fusion protein with 50 mM
HEPES, pH 8.0, containing 250 mM NaCl.
We further purified the eluate using Cu and
Zn chelate columns (40 ml, ID 25 mm) sequentially. We
carried out all procedures on these columns at 4C and
at a flow rate of 0.4 ml/cm2hr. Each wash, as we
describe, was carried out with 80 ml of buffer.
We prepared the Cu chelate column by loading
chelating SEP~AROSE~ with Cu ions using an aqueous 50
mM CuC12 solution. We washed the column twice, first
with 500 mM Tris, 500 mM NaCl, pH 8.0, followed by with
10 mM Tris, 500 mM NaCl, pH 8Ø
Then we loaded the eluate from the FAST Q~
column on the Cu chelate column. We washed the column
three times, first with 500 mM Tris, 500 mM NaCl, p}l
8.0; second, with l0 mM Tris, pH 8.0; and third, with
10 mM Tris, l00 mM imidazole, pH 8Ø Then we eluted ?
the CD4-C4bp fusion protein with l0 1~M Tris, 50 mM
,. .,, . ", , ~ !, , .~ . " ., ., ." , ., ' "., ,, . ' ; '
~ ~ 91/1i461 2~ ~Yo'1 PCT/US91/U0567
_ 49 _
EDTA, pH 8Ø The eluate was dialyzed into 10 mM Tris,
500 mM NaCl, pH 8Ø
Then we prepared a Zn chelate SEP~L~ROSE~
column similarly to the Cu chelate column but used
ZnS04 instead of CuC12.
We loaded the dialyzed eluate ~rom the Cu
chelate column onto the Zn chelate column. A~ter the
sample was loaded, we washed the column three times, as
before, first with 500 mM Tris, 500 mM NaCl, pH 8.0;
second with 10 mM Tris, pH 8.0, and third with 10 mM
Tris, 100 mM imidazole, pH 8Ø Then we eluted the
CD~-C4bp fusion protein with 10 mM Tris, 25 mM
imidazole, 500 mM NaCl, pH 8Ø
We stored the protein in 20 mM H~PES, pH 8.0,
containing 500 mM ~aCl. Thi~ procedure r~ultod in a
signi~icant concentration and puri~ication O.e CD~87)~
C4bp(SCR4), as determined by SDS-P~GE.
We then examined the purified CD4(187)-
C4bp(SCR4) by electron microscopy. To do this, we
mixed the CD4-C4bp fusion protein with glycerol,
sprayed it on a carbon-coated grid and rotary shadowed
it with platinum using conventional techniques. At
high magnification, the molecule appeared to have a
"spider-like" shape, with multiple rod-like arms
extending from its center.
C. Affinity Purification of
CD4(187~-C4bp(4SCR)
As an alternative to the column
chromatography purification described above, we also
purified CD4(187)-C4bp(SCR4) as follows. We
concentrated conditioned media from CHO cells producing
the CD4(187)-C4bp(SCR4) multimeric protein 50-60 ~old
at 4C using a SlOY300 spiral cartridge (~micon,
Danvers, Massachusetts). We passed the concentrated
media through a ~D7-CNBr SEP~ROSE~ affinity column
wosl/l146l PCTtU~9lJ~0567
2 ~ t~
- 50 -
equilibrated in PBS, calcium and magnesium free, at
approximately one column volum2thour at 4OC. lD7 is a
monoclonal antibody that binds to the second
immunoglobulin-related domain of CD4 (lD7 was a gift
from Patricia Chisholm of Biogen, Inc.). It was
produced ~y immunizing a mouse with transfected CHO
cells that expressed ~ull-length CD4 protein. We have
deposited a hybridoma line that produces lD7,
designated Monoclonal Antibody lD7.Gll, with the In
Vitro International, Inc. culture collection. CNBr
SEPHAROSE~ was purchased from Sigma Chemical Corp., St.
Louis, Missouri.) lD7 was coupled to the resin at a
density o~ 0.5 mg/ml, essen~ially ~ollowing the
manu~acture's instructions. Generally, ~he antibody
concentration on the re~in ~hould be kept a~ close to
0.5 mg/ml as po~sible to achieve maxi~um bind~ng ~nct
elution of the ~usion protein.
We washed the loaded column with 3-5 column
volumes of PBS, followed by PBS with 0.5 M NaCl and PBS
again. We eluted the bound protein with 20 mM
triethylamine pH 11.5 (Pierce, Rockford, Illinois), 0.5
M NaCl. We immediately neutralized the fractions with
l/50 volume of lM HEPES pH 6.8 and stored them at 4OC.
SDS-PAGE analysis revealed substantially pure CD4(187)-
C4bp(SCR4) protein. To exchange the buffer to PBS andremove the remaining impurities, we concentrated the
preparations to about 2 mg/ml by ultrafiltration on a
YM30~ membrane (Amicon, Danvers, Massachusetts). We
applied the concentrate to a l.6 x 50 cm SUPEROSE-6
size exclusion column (preparative grade,
Pharmacia/LKB, Piscataway, New Jersey) e~uilibrated in
PBS. The fractions containing the fusion protein were
identified by SDS PAGE and Coomassie stain, and pooled
and steri}e filtered through a 0.22 ~ NILLEX-GV~ ~ilter
tMillipore, Bedford, Massachusetts). By amino acid
i.,.. ,,.. : .: ,.: . .. ,, .,. :, " , . ,: , , , ~ , " , . .. , ;., .
91/1l46l ~v 9~ PCT/US91/~5~7
- 51 -
analysis, we determined the extinction coefficient at
280 nm of CD4(187)-C4bp(SCR4) to be 1.44 A280 units/mg~
ml in a 1 cm light path cuvette. We stored the final
material at 4C until use. For maximum activity, the
fusion protein should be used within 3-5 days after
purification.
EXAMPLE VI -- BIOLOGICAL ACTIVITY OF CD4-C4bp
FUSION PROTEINS
A. Bindin~ of CD4(187L-C4bp~SCR4) to pl20
We demonstrated the ability of CD4(187)-
C4bp(SCR4) to bind to gpl20 of the HIV virus by means
o~ two types o~ a~says: ELISA assays and a syncytia
blocking assay~
1. ~
We performed an ELIS~ as~y ~EL~SA 3) that
demonstrated the ability of CD4~187)-C4bp(SCR4) to bind
gpl20. We coated Immulon II plates with gpl20 by
adding 50 ~l/well of a 5 ~g/ml solution of gpl O
~commercially available from American Bio-
Technologies, Inc., Cambridge, Massachusetts) in PBS
and incubating the plates overnight at 4C. After
removing the coating solution, we blocked non-specific
binding by adding 200 ~l/well of 2~ non-fat dry milk in
PBS and incubated the plates for at least 30 minutes at
room temperature. Then we removed the blocking
solution and added 50 ~l/well of sample (conditioned
medium or conditioned medium diluted in 2% non-fat dry
milk in PBS) and incubated the plates for three hours
at room temperature. We then removed the liquid and
added the detector antibody, rabbit anti-h~4bp
(Calbiochem) optimally diluted (1:3333). We again
incubated the plates ~or 1 hour at room temperature.
Then we ramoved this solution and added 50 ~l/well of
W091/11461 PCT/US91/00567
- 52 -
optimally diluted (l:lOOO) HRP-conjugated goat anti-
rabbit-IgG (Organon Teknika~. We incubated the plates
~or l hour at room temperature, then removed the
solution, added OPD and again incubated the plates for
20 to 30 minutes at room temperature. We stopped the
color reaction with lN sulfuric acid. We measured 0. D.
at 490 nm. This assay gave positive results,
indicating that the CD4 (187)-C4~p(SCR4) ~usion
polypeptide bound to gpl20.
We per~ormed another assay (ELISA 4)
confirming these results and also demonstrating that
CD4~l87)-C4bp(SCR4) had assembled into a multimer. We
coated Immulon II plates with gpl20 by adding 50
~l/well o~ a 5 ~g/ml solution o~ gp~20 in PBS and
incubating the plates overnight at ~CO ~t~r removing
the coating solution, we block~d non-sp~ci~l~ binding
by adding 200 ~l/well of ~% non~~at dry milk in PBS and
incubating for at least 30 minutes at room temperature.
then we removed the blocking solution and added 50
~l/well of sample (conditioned medium or conditioned
medium diluted in 2% non-fat dry milk in PBS) and
incubated for three hours at room temperature. We
removed this liquid, added 50- ~l/well of optimally
diluted (l:lOOO) HRP-conjugated 6C6 and incubated the
plate~ for l hour at room temperature. We removed this
solution and added OPD. We incubated for 20 to 30
minutes at room temperature and stopped the color
reaction with lN sulfuric acid. We measured the O.D.
at 490 nm. This second assay confirmed the presence of
multimers because only multimers possess multiple
binding sites capable of binding simultaneously to
gpl20 and the 6C6 monoclonal.
.,
.:.. . . ... : . . ,.. , ,. ,. . .. .. ., . . . ~ .
9l/11q61 ~ PCT/US91~00567
- 53 -
2. Svncytia blockina assay
HIV-infected cells, which express gpl20 on
their surface, fuse with CD4-expressing cells to Porm
multinucleate cells (syncytia). Molecules khat bind to
gp120 tend to block the formation of syncytia.
We carried out a C8166 cell fusion assay as
described in B.D. Walker et al., "Inhibition of Human
Immunode~iciency Virus Syncy~ium Formation and Virus
Replication by Castanospermine", Proc. Natl. Acad.__c
USA, 84, pp. 8120-24 (1987). We incubated 5 x 103 H9
cells chronically infected with ~ITLV-IIIB in 100 ~l
RPMI 1640 medium containing 10 mM HEPES, pH 6.8, 2 mM
glutamine and supplemented with 20~ fetal bovine sexum
for 30 minutes at 37C in 5~ C02 with varlou~
concentrations of CD4(187)-C4bp(SC~ 9 cell~ are
available ~rom the AID9 ~e~earch and Referenae ~eagent
Program, N~H, Bethesda, Maryland.) We then added 15 x
103 C8166 cells (a CD4~ transformed human umbilical cord
blood lymphocyte line) ~J. Sodroski et al., "Role of
HTLV-III/LAV Envelope in Syncytium Formulation and
Cytopathicity", Nature, 322, pp. 470-74 (1986)], in
100 ~1 media to a final volume of 200 ~l in each well
and incubated at 37C in 5% CO~. (C8166 cells were the
gift of Dr. Robert Schooley, Massachusetts General
Hospital, Boston, ~assachusetts). We then counted
total number of syncytia per well at 2 hours and 4
hours after adding the C8166 cells. Parallel co-
cultivatiQns used transient fluid from COS-7 ceIls
transfected with pJOD.C4bp.3 (negative control) or
OKT4A at 25 ~g/ml (positive control). (OKT4A is
available from Ortho Diagnostics Systems, Raritan, New
Jersey). We considered a positive result as a 50~
reduction in syncytia compared to controls. While
fluid from the cells transfected with pJOD.C4bp.3 did
not inhibit syncytia formation, fluid from cells
. .
;.. ,, . ,. . .. ~. ~ , . ... , ., . ,....... , ... ... ~ .
WO91/l1461 PCT/US9i/~0567J~
2 ~
- 54 -
transfected with OKT4A and with CD4~187)-C4bp(SC~4
significantly inhibited syncytia formation. This
indicated that the fusion protein bound to gpl20/160 on
the H9 cell surface.
B. CM (187)-C4bp(SCR4) Blocks
Replication of ~IV-l In Vitro
We tested the ability o~ CD4(187)-C4bp(SCR4)
to block HIV-1 replication ~a vitro in a
microreplication assay, essentially as described in
M. Robert-Guroff et al., Nature, 316, pp. 72-74 (1985),
however we performed the incubation at 37C rather than
4~C as described therein.
More speci~ically, we preincubated HIV-1 (~0
~l; 100 TCID50) (prepared as described in part C, below)
and C8166 cells (10 ~l; 40,000 cell~) with or without
20 ~l aliquot~ of serial dilution~ o~ CD4(187)~
C~bp(SC~4) or recombinant soluble CD~ protein
(RECEPTIN~ brand rsCD~ was the gi~t o~ Biogen, Inc.).
~he rsCD4 that we used was derived from a Chinese
hamster ovary cell line transformed with pBG391
(Example III, supra.) In these assays, we used two
different preparations of CD4(187)-C4bp(SCR4). One
preparation was conditioned cell culture fluid from a
stable CHO cell line (Example V, section B, infra) ~ -
which synthesizes and secretes CD4(187)-C4bp(SCR4).
The other preparation was CD4(187)-C4bp(SCR4),
partially purified from conditioned culture fluid from
a transformed CHO cell linP on a FAST S~ column. After ~ `
infection at 37C for 30 minutes, we added 15 ~l
allquots in triplicate to 200 ~l of RPMI-20% FCS in
microtiter plates. We incubated the plates at 37C in
5~ C2 and examined them 4 to 8 days late.r for syncytia
~ormation, a signal for active in~ection.
.,',
091/ll46l ~ PCT/US91/00567
- 55 -
Our results indicated that, on a molar basis,
multimeric CD4(187)-C4bptSCR4) blocked HIV-1 infection
at a concentration 100 times less than the
concentration of recombinant soluble CD4 ~ecessary to
block HIV-1 infection. For example, 300 pM CD4(187)-
C4bp(SCR4) (both partially purified and from cell
culture medium) completely blocked syncytia formation.
About 30 nM recombinant solubla CD4 was necessary to
obtain the same result. There was a falloff in
protection against HIV-1 infection of C8166 cells at
about 100 pM for CD4(187)-C4bp(SCR4) and about 10 nM
for recombinant soluble CM .
C. CD4(1B7)-C4bp(SCR4) Block~
We next carricd out tests which demonstrated
that CD4(187)-C4bp(SCR4) inhibits HIV-1 infeation of
cells. The assay we used measured the ~uantity of
spliced HIV~l mRNA produced when C8166 cells, HIV-1 and
multimeric CD4-C4bp fusion proteins of this invention
Z0 are incubated together.
Recombinant HIV-l was obtained by
transfecting colon carcinoma cell line SW480 with
CaPO4-precipitated pNL4-3. (Both the cell line and the
plasmid are available from the AIDS Research and
~eference Reagent Program, NIH, Bethesda, Maryland.)
We incubated 107 C8166 cells with 103 TCID50 recombinant
HIV-1, alone or with serial dilutions of CD4(187)-
C4bp(SCR4). After 48 hours, we determined the amount
of spliced HIV-1 mRNA in total cellular RNA by nuclease
S1 protection analysis.
We synthesized a 180 nucleotide single
stranded DNA ~ragment probe with AMPLIGASE~ (Epicenter
Technologies), labelled at the 5l end with 32p. The
probe spanned the splice acceptor of all known spliced
.
W09l/~l4SI ll~ PCT/US91/~67
- 56 -
HIV-l mRNA molecules tB. Felber et al., "Feedback
Regulation of Human Immunodeficiency Virus Type 1:
Expression by the Rev Protein", J. Virol., 64,
pp. 3734-41 (1990)]. We added this 180 nucleotide
probe (103 cpm~ to lo ~g of total cellular RNA in 10 ~l
of a buf~er containing 80% formamide, 0.4 M NaCl, ~0 mM
PIPES, pH 6.4, 1 mM EDTA. We carried out the
hybridization overnight at ~8C. A~ter allowing
hybridization, we treated the mixture wit~ S1 nuclease.
Sl nuclease completely digested any unhybridized probe
and partially digested any hybridized probe, yielding a
102 nucleotide protected DNA ~ragment. Tne full length
180 nucleotide DNA fragment was also protected ~rom
digestion by hybridization to unspliced, genomic HIV~1
RN~, produced through replica~ion o~ the Vi~U5 in tha
cells~ We ~ound th~t the amount o~ both th~ 10~
nucleotide DNA ~ragment and the 180 nualeotide ~ragment
decreased with incre~sing amounts o~ C4bp ~usion
protein added as blocker. These results suggested that
the CD4-C4bp fusion protein blocks HIV-1 entry into
cells in concentrations as low as 1-10 ng/ml.
EXAMPLE VII -- PRODUCTION OF CD4tl87)-C4bp(SCR8),
CD4(187)-C4bp~SCR5), CD4(187)-C4bp(SCR3)
AND CD4(187)-C4bp(SCR1)
We performed several ELISA assays to test for
the production of CD4(187)-C4bp(SCR8), CD4(187)-
C4bp(SCR5), CD4(187)-C4bp(SCR3) and CD4(187)-
C4bptSCR1). Our results indicated that COS-7 cells
transformed with pJOD.sCD4.Yl87.SCR8,
30 pJOD.sCD4.Y187.SCR5, pJOD.sCD4.Y187.SCR3 and
pJOD.sCD4.Y187.SCR1 all produced multimeric CD4-C4bp
fusion proteins.
We performed four ELISA assays pracisely as
described previously (ELISAs 1-4) in the examples
35 above, except that we used conditioned medium from `
~J3~
91/11461 PCTJUS91/00~67
- 57 -
COS-7 cells transformed with pJOD.sCD4.Y1~7.SCR8.
ELISAs 1-3 showed strong positiYe r~sults. ELISA 4
~plates coated with gpl20, 6C6 used as detection
antibody) gave a weak positive result.
We performed six assays on conditioned medium
from COS-7 cells transformed with three different
plasmid isolates encoding CD4(187)-C4bp(SCR1). The
isolates were designated, respectively, SCRl.1, SCRlo2
and SCR1.3. The first four assays were performed as
described for ELISAs 1-4, above. We carried out the
fifth assay (ELISA 5) in the same way as ELISA 4,
except that we used the antibody 5A8 as the detection
antibody. Antibody 5A8 does not block CD4 binding to
gpl20 and it recognizes domain 2 of CD~ (see Figure ~).
Another monoclonal antibody having ~uch characteristia~,
might also be useful in this a~say. We p~rformed thc
sixth assay (ELISA 6) a~ in EL~SA 3, except that we
used the anti-C4bp monoclonals 051-198 or 051-28
(Quidel, San Diego, California).
In ELISA 5 (plate coated with gpl20, 5A8 used
as detection antibody) all three isolates ga~e positive
results. This indicates that the cells p~oduced a
protein comprising CD4(187).
In ELISA 1 (plate coated with anti-hC4bp, 6C6
monoclonal used as detection antibody) all isolates
gave negative results. In ELISA 3 (plate coated with
gpl20, anti-C4bp used as detection antibody) SCR1.1
gave a negative result and SCRl.2 and SCRl.3 gave a
borderline positive result. In ELISA 6 (plate coated
with gpl20, 051-198 or 051-28 used as detection
antibody) SCR1.2 and SCR1.3 gave positive results, but
SCR1.1 gave negative results. This indicates tha~ the
cells produced molacules having both C~bp(SCRl) and the
gpl20 binding site of CD4. The reason that C4bp.SCRl
was n~t recognized in ELISA 1 and ELISA 3 is probably
. ~
WO91Jl1461 PCT/US91/0~567
- 58 -
due to the nature o~ the polyclonal antiserum and
antibodies we used. These polyclonals seem to
recognize pre~erentially epitopes on the mature ~orm of
human C4bp.
In ELISA 2 (plate coated with 6C6, 6C6 used
as detection antibody) isolate SCR1.1 gave a negative
result and isolat~s SCR1.2 and SCR1.3 gave positive
results. In ELISA 4 (plate coated with gpl20, 6C6 used
as detection antibody) isolate SCRl.1 gave a negati~e
result and isolates SCRl.2 and SCR1.3 gave positive
results. These results are consistent with our belief
that CD4~187)-C4bp(SCR1) can assemble into a multimer.
We per~ormed another ELISA, ELISA 7, (plates
coated with lD7, 5A8 used as detection antibody) on
conditioned medium ~rom COS-7 cells trans~ormed with
! pJOD.sCU4.Y187.SCR5.1, pJOD.sCD4.Y1~7.SCR5.2~
p~OD.CM .~187.5CR3.2 and p~OD.sCD4.~187.SC~3.3. All
assays gave a strong positive result.
~ ah5_yLII -- CLONING OF DNA ENCODING HBeAg-C4bp
FUSION POLYP~EPTIDES
We have constructed several plasmids
characterized by DNA sequences encoding hepatitis B
virus e antigen-C4bp ("HBeAg-C4bp") fusion
polypeptides. We constructed these plasmids in two
steps. First, we introduced a unique XbaI site into
pJOD.C4bp.2, an isolate of pJOD.C4bp (Example I)
be~ween the DNA sequences encoding the C4bp signal -
sequence and the amino terminus of SCR8 (amino acid +1 -~
of Figure 1). This created a site into which we could
insert DNA sequences encoding HBeAg epitopes.
Alternatively, one could employ this site to insert DNA
se~uences encoding other epitopes. In the second step,
PCR fragments encoding various ~I~eAg sequences were
inserted into the XbaI site to create polypeptides in
35 which HBeAg sequences were sandwiched between the DNA `
~'091/11461 PCT/US91~0567
- 59 -
sequence encoding the signal sequence of C4bp and the
DNA sequence encoding SCR8 of C4bp.
More specifically, in the first step, we
introduced a unique XbaI site into pJOD.C4bp.2 via
gapped mutagenesis as follows. We linearized a first
sample of the plasmid with ~I. Next, we cleaved a
second sample o~ the plasmid with ~hoI and SPeI. We
then denatured the samples and allowed single stranded
DNA from each to hybridize, creating a gap. We
annealed a mutagenic oligomer into the gap. The
oligomer had the sequence:
GAGGACCACAATTCTAGACCAAGAACAGCA.
We repaired the resulting plasmid with Klenow enzyme
and dXPT, electroporated it into HB101 and isolated the
plasmid, pJOD.C4bp.~k~I, which is characterized by a
unique XhaI ~ite and has, ~he ~equence GG~~~AT at
the signa~ junction, with the GGT encoding the last
amino acid of the C4bp signal sequence separated ~rom
the AAT encoding the ~irst amino acid of SCR8 by the
unique XbaI site.
We tested the plasmid as ~ollows. We
linearized pJOD.C4bp.XbaI with XbaI and blunt ended the
fragment with mung bean nuclease. Then we religated
the plasmid (without inserting any DNA) to create
pJOD.C4bp.XbaI.O. 3 n The DNA sequence across the signal
cleavage site thus became GGT AAT, encoding
Gly(-l)Asn(1), as in authentic C4bp. When
electroporated into COS cells, this plasmid expressed
C4bp as efficiently as JOD.C4bp, as measured in a C4bp
EhISA (ELISA 8: plates co~ted with rabbit anti-hC4bp,
sheep anti-hC4bp used as detection antibody).
In the second step, we linearized
pJOD.C4bp.XbaI with ~k~I and blunt ended it with mung
bean nuclease. We ligated PCR products encoding
HBeAg(2-148), HBeAg(2-138), HBeAg(2-100) and HBeAg(2-
i WO91/11461 PCT/US9l/00567
i3~ 60
:
89), respectively, into the resultant vector. W~ used
; plasmid 8.1.5 as a template ~or the PCR fragments.
; Plasmid 8.1.5 is characterized by a DNA ~equence
encoding HBeAg. It is also referred to as pHBV139A
[Pasek et al., su~ra]. (Plasmid 8.1.5 was a gift ofProfessor Kenneth Murray, University of Edinburgh,
Scotland). Alternatively, one may use plasmid pAMG,
ATCC 45020, as a PCR template. Plasmid pAMG is
characterized by a DNA seguence derived ~rom HBV
subculture ADW and encodes HBeAg. We digested plasmid
8.1.5 with StyI, producing a fragment containing the ~-
entire PCR target. We performed PCR on the ~ragment
using the following primers. We used the same 5' sense
primer for all ~our constructs:
5' GACATTGACCCTTATAAAGAATTT.
The 3' anti-sense primers were:
5' AACAACAG~AGTCTCCGG~AGCG~ ~HB~A~(2-1~8)];
5~ AGGGGCATTTGGTGG~CTATA~GC ~HQeAg(2-138)];
5' TAATTGTCTGA~CTTTAGGCCCAC ~HBeAg(2-100)]; and
5' GACATAACTGACTACTAGGTCCCT ~HBeAg(2-89)].
We ligated these PCR ~ragments with ~k~I-
digested, mung bean nuclease-treated p~OD.C4bp.XbaI.
This ligation produced the following plasmids:
pJOD.HBeAg(2-148).C4bp.SCR8;
pJOD.HBeAg(2-138).C4bp.SCR8;
pJOD.HBeAg(2-100)~C4bp.SCR8; and
pJOD.HBeAg(2-89).C4bp.SCR8, respectively.
These pl~smids contained DNA sequences encoding the
follo~-ing fusion polypeptides: HBeAg(2-148)-
C4bp(SCR8); HBeAg~2-138)-C4bp(SCR8); HBeAg(2-100)-
C4bp(SCR8) and HBeAg(2-89)-C4bp(SCR8), respectively.
These constructs may be altered by replacing
the C4bp signal sequence with the hepatitis B virus
precore signal se~uence to insure proper processing o~
35 the primary translation product. ;
.: . , . : : . . ~: .. :. .. , . :: . :,
~ ~ 9~/l1461 ~ V~ PCT/US91/0~567
;'' .
- 61 -
Microorganisms and recombinant DNA molecules
according to this inventi~n are exemplified by cultures
deposited in the In Vitro International, Ina. culture
collection, in Linthicum, Maryland, USA on January 24,
1990, and identified as:
SCR1.1: pJOD.sCD4.Y187.SCR1.1 IVI-10221
SCR1.2: pJOD.sCD4.Y187.SCR1.2 IVI-10222
SCR1.3: pJOD.sCD4.Y187.SCR1.3 IVI-10223
SCR8.2: pJOD.sCD4.Y187.SCR8.2 IVI-10224
SCR8.3: pJOD.sCD4.Y187.SCR8.3 IVI-10225
SCR4.2: pJO~.sCD4.Y187.SCR4.2 IVI-10226
SCR4.3: pJOD.sCD4.Yl87.SCR4.3 IVI-10227
187.SnaB1: pJOD.sCD4.Y187.SnaB1 IVI-10228
pl70.2: pl70.2 I~-10~29
C4bp.3: p~OD.C4bp.3 IVIW10230
We also depos.tted the ~ollowing culture wlth
In Vitro International on ~anuary 26, l99l:
Monoclonal Antibody lD7-G11 IVI-10269
We also deposited the following cultures with
In Vitro International on January 28, 1991:
SCR3.2: pJOD.sCD4.Y187.SCR3.2 IVI-10270
SCR3.3: pJOD.sCD4.Y187.SCR3.3 IVI-10271
SCR5.1: pJOD.sCD4.Y187.SCR5.1 IVI-10272
SCR5.2: pJOD~sCD4.Y187.SCR5.2 IVI-10273
While we have hereinbefore described a number
of embodiments of this invention, it is apparent that
our basic embodiments can be altered to provide other
embodiments which utilize the processes and
compositions of this invention. Therefore, it will be
appreciated that the scope o~ this invention includes
all alternative embodiments and variations which are
de~ined in the foregoing speci~ication and by the
claims appended hereto; and the invention is not to be
limited by the speci~ic embodiments which have been
presented herein by way of example.
