Note: Descriptions are shown in the official language in which they were submitted.
WO90Jll3nl )~ 3 ~ 3 3 ) PCT/US90/0135
HUMAN MACROPHAGE MIGRATION INHIBITORY FACTOR
The present invention relates generally to a
novel protein factor which is important in controlling a
variety of inflammatory responses. More specifically the
invention discloses a novel human macrophage migration
inhibitory factor. Also provided are processes for
obtaining this factor in homogeneous form and producing
it by recombinant genetic engineering techniques.
Backqround of the Invention
In response to antigenic or mitogenic
stimulation, lymphocytes secrete protein mediators called
lymphokines that play an important role in
immunoregulation, inflammation and effector mechanisms of
cellular immunity [S. Cohen et al, "Biology of the
Lymphokines", New York, Academic Press, pp. 511-576
(1979); and A. Miyajima et al, FASEB J., 38:2462-2473
(1988)]. The first reported lymphokine activity was
observed in culture supernatants of antigenically
sensitized and activated guinea pig lymphocytes. This
activity was named migration inhibitory factor (MIF) for
its ability to prevent the migration of guinea pig
macrophages out of capillary tubes in vitro [B. R. Bloom,
et al, Science, 153:80-82 (1966); and J. R. David, Proc.
Natl. Acad. Sci., 153:72-77 (1966~].
','
. . ~ .
:- . , -
' ~
.
')0/ll30l ~ 3 3 ~ PCT/US90/0135
Since this initial observation of MIF activity,
a large number of publications have reported the
isolation and identification of putative MIF molecules.
See. e.g., P. S. Papageorgiou et al, J. Immunol., 108:494
-504 (1972); R. E. Rocklin et al, Cell. Immunol., 5:435
(1972); T. Yoshida et al, J. Immunol., 117:548-554
(1976); H. G. Remold et al, J. Immunol., 118:2015-2019
(1977); L. H. Block et al, J. Exp. Med., 147:541-553
(1978); G. Pozzanza et al, Science, 205:300-301 (1979);
P. N. Dinh et al, J. Interferon Res., 1:23 (1981); W. Y.
Weiser et al, J. Immunol., 126:1958-1962 (1981); S. Z.
Salahuddin et al, Science, 223:703-707 (1984); W. Y.
Weiser et al, Cell. Immunol., 88:109-122 (1984); W. Y.
Weiser et al, Cell. Immunol., 93:532-540 (1985); D. T.
Umetsu et al, J. Immunol., 140:4211-4216 (1988) and G.
- Zwadlo et al, Clin. Ex~. Immunol., 72:510-515 (1988).
However, other lymphokines, e.g., interferon
gamma and IL-4, which exhibit MIF activity, among other
activities, have only recently been identified [G. B.
Thurman et al, J. Immunol., 134:305-309 (1985); and A.
McInnes et al, J. Exp. Med., 167:598-611 (1988)]. These
; observations that other known lymphokines have 'MIF'
r activity have raised considerable doubt that distinct
novel entities with MIF activity exist.
, . . . . . . . .
- : . , :
,:: ~ ', ,
W090/1130l 2 ~ 3 ~ .~ PCT/US90/0135
The detection of MIF activity is correlated
with a variety of inflammatory responses including
delayed hypersensitivity and cellular immunity [R. E.
Rocklin et al, New Enql. J. Med., 282:1340-1343 (1970);
and J. R. David et al, Proqr. in Allerq. Immunol.,
16:300-449 (1972)]; allograft rejection [S. Al-Askari et
al, Nature, 205:916-917 (1965); and J. T. Harrington,
Cell. Immunol., 30:261-271 (1977)]; and rheumatoid
polyarthritic synovialis [Odink et al, Nature, 330:80-82
(1987)].
There remains a need in the art for
biologically active proteins, such as MIF, that influence
macrophage function for preparing pharmaceutical
compositions useful in stimulating host defense.
Summarv of the Invention
In one aspect the present invention provides a
novel human macrophage migration inhibitory factor (MIF)
which is substantially free from association with other
mammalian proteins. This protein is produced by
recombinant genetic engineering techniques. The
biologically active MIF protein of this invention is
comprised of an approximately 115 amino acid sequence.
Its amino acid sequence is identified below.
- ,
- ', ; ,
, ~
W09()/~ a~033~ PCT/US90/013~5
Active MIF has an apparent molecular weight of
approximately 12 kd as determined by sodium
dodecylsulfate polyacrylamide gel electrophoresis (SDS-
PAGE) of supernatant fluid derived from MIF cDNA
transfected COS-l cells.
The MIF protein of this invention has displayed
biological activities in various assays, which indicate
its role as a general activator of several different
macrophage functions. The MIF of this invention inhibits
the migration of human macrophages in an assay using
human peripheral blood cells. MIF displays biological
activity in this assay of greater than 20% inhibition.
MIF also serves to stimulate the activity of macrophages
in culture measured by several different criteria. MIF-
treated macrophages express higher than normal levels of
IL-l~ and HLA-DR mRNA. MIF alone also stimulates
macrophages to kill the intracellular pathogen,
Leishmania donovani, and also enhances the effects of
interferon-gamma in this system.
Another aspect of the present invention is a
- DNA sequence coding on expression for human MIF protein.
The DNA seguence coding for active MIF is characterized
as comprising the same or substantially the same
nucleotide sequence in Table l or fragments thereof.
'.
.;
- , ., - . : . .
, ~ ., . , . . , : : -
.
Wo90/1130l 2 (~ .3 3 ~ PCT/US90/0135~
The MIF DNA sequence of the present invention encodes a
polypeptide of 115 amino acids which corresponds well
with the molecular weight of a novel protein band
revealed by SDS-PAGE of supernatant fluid derived from
the same MIF-cDNA transfected COS-l cells. When this
protein band was excised from the gel and electroeluted,
it showed strong MIF activity. Analysis of RNA extracted
from Con A-stimulated and unstimulated human peripheral
blood lymphocytes showed that this cDNA hybridized to a
single mRNA species from stimulated but not unstimulated
lymphocytes.
Also provided by the present invention is a
vector con~aining a DNA sequence encoding MIF in
operative association with an expression control
-~ 15 sequence. Host cells transformed with such vectors for
use in producing recombinant MIF are also provided by the
present invention.
The vectors and transformed cells of the
invention are employed in another aspect, a novel process
for producing recombinant human MIF protein, or peptide
fragments thereof. In this process a cell line
transformed with a DNA sequence encoding on expression
MIF protein or a peptide fragment thereof in operative
association with a suitable expression control se~uence
capable of controlling expression of the protein is
,: .
.
W09(~/ll301 ~ ~ 0 3 ~ ~ PCT/US90/Ot3~5
cultured. This claimed process may employ a number of
known cells as host cells for expression of the protein.
Presently preferred cell lines for preparing MIF are
mammalian cell lines and bacterial cells.
Another aspect of this invention provides
pharmaceutical compositions containing a therapeutically
effective amount of recombinant MIF or of one or morP
peptide fragments thereof. These pharmaceutical
compositions may be employed in methods for treating
lo disease states or injuries in which the activation of
macrophages plays a ~ey role. For example, MIF protein
or active fragments thereof may be employed in therapies
for cancer, the treatment of infections, acceleration of
wound healing and in stimulating the immune system in
general. MIF may also be used in potentiating the immune
response to certain antigens, particularly vaccines.
; A further aspect of the invention, therefore,
is a method for treating these and/or other pathological
- states by administering to a patient a therapeutically
effective amount of MIF or peptide fragments thereof in a
' suitable pharmaceutical carrier. These therapeutic
methods may include administering simultaneously or
sequentially with MIF or peptide fragments thereof an
effective amount of at least one other cyt~klne,
;
:'
- : : . . . . .
: . . . -
., . .: . ' - :. : ~ '
.
.
~VO90/ll30l ~ ~JJ ~ ~ 3 !) PCT/US90/0135
hematopoietin, interleukin, growth factor, or tumor
specific antibody.
Other aspects and advantages of the present
invention are described further in the following detailed
description of preferred embodiments of the present
invention.
Detailed Description of the Invention
The present invention provides a biologically
active human macrophage migration inhibitory factor (MIF)
in a form substantially free from association with other
mammalian proteins. This protein can be produced via
recombinant techniques to enable large quantity
production of pure, active MIF useful for therapeutic
applications.
The active human MIF of this invention is
characterized by an approximately 115 amino acid protein
sequence illustrated in Table I below. MIF has an
apparent molecular weight of approximately 12 kd, as
determined by SDS-PAGE under reducing conditions.
The DNA sequence of human MIF was initially
cloned from a cDNA library prepared from mRNA derived
from a phytohemagglutinin and PMA-stimulated human T-cell
hybridoma line, T-CEMB [available upon request from W.
Weiser, Brigham and Women's Hospital] according to the
expression cloning method previously described in, e.g.,
.
WO90/tl301 ~ 03 .. ~ PCT/US90/01355
G~ G. Wong et al, Science, 228:810~815 (1985); Y. C. Yang
et al, Cell, 47:3-10 (1986); and A. E. Namen et al,
Nature, 333:571-573 (1988). The library was constructed
in an expression vector which permits the expression of
cDNA inserts in mammalian cells, e.g. C~S-l cells.
Screening of the library was performed by transfecting
COS-l cells with pools of cDNA clones. By assaying the
supernatant fluid for MIF activity, cDNA clones
expressing MIF activity were identified.
mRNA from several cellular sources was examined
for its ability to hybridize with a selected MIF cDNA
clone. Northern blot analysis revealed that the T-cell
line, CEM, and the T-cell hybridoma line, T-CEMB, as well
as lectin-stimulated human peripheral blood lymphocytes
(PBL) synthesized readlly detectable levels o~ mRNA that
hybridized with the MIF clone~ The message, however,
could not be detected in RNA samples from unstimulated
PBL despite prolonged exposure. The presence of RNA
transcript in activated human PBL suggests that the human
MIF gene is expressed as a product of activated
;~ lymphocytes.
The MIF cDNA sequence from this clone, shown in ~
Table I below, encodes the 115 amino acid sequence ;
(single letter code).
lj
. t
:, : ,, ~ - ~ . , :
: ~ - : . , , : .::', ' ' ' ' ` .
.
W090/ll30~ 3~ 3 3 ~ PCT/US90/013S~
Table I
CTCGAGCTGCAGAGCTGCCTCTGCGCGGGTCTCCTGGTCCTTCTGCCATCATGCCGATGT
M P M F
110
TCATCGTAAACACCAACGTGCCCCGCGCCTCCGTGCCGGACGGGTTCCTCTCCGAGCTCA
I V N T N V P R A S V P D G F L S E L T
130 150 170
CCCAGCAGCTGGCGCAGGCCACCGGCAAGCCCCCCCAGTACATCGCGGTGCACGTGGTCC
Q Q L A Q A T G K P P Q Y I A V H V V P
190 210 230
CGGACCAGCTCATGGCCTTCGGCGGCTCCAGCGAGCCGTGCGCGCTCTGCAGCCTGCACA
D Q L M A F G G S S E P C A L C S L H S
~ 250 270 290
: 20GCATCGGCAAGATCGGCGGCGCGCAGAACCGCTCCTACAGCAAGCTGCTGTGCGGCCTGC
I G K I G G A Q N R S Y S K L L C G L L
:~- 310 330 350
~ TGGCCGAGCGCCTGCGCATCAGCCCGGACAGGGTCTACATCAACTATTACGACATGAACG
`~ 25 A E R L R I S P D R V Y I N Y Y D M N A
370 390 410
; CGGCCAGTGTGGGCTGGAACAACTCCACCTTCGCCTAAGAGCCGCAGGGACCCACGCTGT: A S V G W N N S T F A *
430 450 470
CTGCGCTGGCTCCACCCGGGAACCCGCCGCACGCTGTGTTCTAGGCCCGCCCACCCCAAC
490 510
: 35 CTTCTGGTGGGGAGAAATAAACGGTTTAGAGACAGCTCTGCAG
.-- - -.:
-: , " . ' ,
WO~0ill30l ~ ~j 0 3 3 ~ PCT/US90/01355
The cDNA sequence of Table I contains a long
open reading frame of 345 nucleotides, beginning with an
ATG codon at nucleotides 51-53. The ATG is followed 114
codons and a TAA termination triplet at nucleotides 396-
398. The 345 nucleotides encodes a 115 amino acid
polypeptide with a calculated molecular mass of 12,540
which is in agreement with the mass of the MIF-specific
protein band observed by pulse-labeling experiments.
Although MIF has been thought to be a secreted
protein, the DNA sequence does not contain a stretch of
hydrophobic amino acids that resemble conventional
secretory leader sequences [D. Perlman et al, J. Mol.
Biol., 167:391-409 (1983)], either at the N-terminus or
' internally. The lack of a very hydrophobic sequence that
` 15 is characteristic of a protein signal peptide is also
observed in the MIF related proteins [K. ~dink et al,
cited above]. The apparent absence of a leader sequence
suggests that the mechanism of MIF secretion is distinct
from that of typical secretory proteins. It is possible
that this MIF may not be actively or efficiently
secreted. Alternatively, cells may export MIF by a
mechanism similar to that of IL-1.
t The cDNA sequence for MIF also encodes two
potential asparagine-linked glycosylation sites at amino
acids 73-75 (Asn-Arg-Ser) and 110-112 (Asn-Asn-Ser) [see,
.
. ,. . -. : : .
: ~ ": ' . , , `
,
: . . : -
,,
WO90/1l30l ~ ~ ' 3 3 3 X PCT/US90/01355
e.g., R. J. Winzler, "The Chemistry of Glycoproteins in
Hormonal Proteins and Peptides", Vol. 1, C. H. Li, ed.
Academic Press, New York, pp. 1 (1973)]. Like beta-
interferon and IL-2, the MIF DNA sequence encodes three
S cysteine residues, located at amino acid positions 56,
59, and 80. These three cysteine residues may account,
at least in part, for the loss of MIF biological activity
upon storage.
The nucleotide sequence of this MIF cDNA of the
invention has been compared with the nucleotide sequences
recorded in Genbank. No significant similarities in
nucleotide sequence were found. Of note, human MIF
shares no sequence similarity with gamma interferon or
IL-4, other cytokines with MIF activity. In addition, no
sequence similarity exists between the MIF cDNA of this
invention and the cDNAs encoding two proteins, MRP-8 and
MRP-14 as reported by Odink et al, cited above. Thus
MIF of this invention is immunologically distinct from
these known factors and proteins.
The cDNA sequences of the present invention
encode biologically active human MIF by detection of the
functional polypeptides produced by mammalian cells. One
cloned sequence in plasmid p7-1 was deposited with the
American Type Culture Collection, 12301 Parklawn Drive,
Rockville, Maryland on March 17, 1989 under No. 40582.
` This deposit meets the requirements of the Budapest
Treaty on the International Recognition of the deposit of
'
:,.' .
~VO90/11301 ~aso33~ PCT/US90~01355
Microorganisms for the Purposes of Patent Procedure and
the ~egulations thereunder (Budapest ~reaty).
The present invention also encompasses these
novel DNA sequences, free of association with DNA
sequences encoding other primate proteins, and coding on
expression for MIF polypeptides. These DNA sequences
include those containing the same or substantially the
same sequence as the above-identified DNA and peptide
sequences and those sequences which hybridize under
stringent hybridization conditions [see, T. Maniatis et
al, Molecular Cloning (A Laboratory Manual~, Cold Spring
Harbor Laboratory (1982), pages 387 to 389] to the DNA
sequence of MIF reported above. An example of one such
stringent hybridization condition is hybridization at ;
4XSSC at 65C, followed by a washing in O.lXSSC at 65C
for an hour. Alternatively an exemplary stringent
` hybridization condition is 50% formamide, 4XSSC at 42C.
DNA sequences which hybridize to the sequences
for MIF or active fragments thereof under relaxed
hybridization conditions and which code on expression for
MIF peptides having MIF biological properties also encode
novel MIF polypeptides. Examples of such non-stringent
hybridization conditions are 4XSSC at 50C or
hybridization with 30-40% formamide at 42C. For
example, a DNA sequence which shares regions of
significant homology, e.g., sites of glycosylation or
:: : . ' - ' -:-::. . . : :: :
woso/ll3ol '~n'~j03 3'~ PCT/US90/0135
disulfide linkages, with the sequences of MIF and encodes
a protein having one or more MIF biological properties
clearly encodes a MIF polypeptide even if such a DNA
sequence would not stringently hybridize to the MIF
sequences.
Similarly, DNA sequences which code for MIF
polypeptides coded for by the sequence of MIF, but which
differ in codon sequence due to the degeneracies of the
genetic code are also encompassed by this invention.
Allelic variations (naturally-occurring base changes in
the species population which may or may not result in an
amino acid change) DNA sequences encoding the MIF protein
sequences and peptide fragments thereof evidencing MIF
biological activity are also included in the presênt
invention as well as analogs or derivatives thereof.
Other variations in the DNA sequence of MIF which are
caused by point mutations or by induced modifications to
- enhance the activity, half-life or production of the
polypeptides encoded thereby are also encompassed in the
invention.
MIF polypeptides may also be produced by known
conventional chemical synthesis. Methods for
constructing the polypeptides of the present invention by
synthetic means are known to those of skill in the art.
~: - . . .. . . .
~09(~!11301 ~ 0 3 3 ~ PCT/US90/01355
14
The synthetically-constructed MIF polypeptide sequences,
by virtue of sharing primary, secondary, or tertiary
structural and conformational characteristics with MIF
polypeptides may possess MIF biological properties in
common therewith. Thus, they may be employed as
biologically active or immunological substitutes for
natural, purified MIF polypeptides in therapeutic and
immunological processes.
Modificatlons in the peptides or DNA sequences
can be made by one skilled in the art using known
techniques. Modifications of interest in the MIF
sequences may lnclude the replacement, insertion or
deletion of a selected amino acid residue in the coding
sequences. Mutagenic techniques for such replacement,
insertion or deletion are well known to one skilled in
the art. [See, e.g., United States patent 4,518,584.~
- Other specific mutations of the sequences of
. the MIF polypeptide described herein may involve
modifications of one or more glycosylation site. The
absence of glycosylation or only partial glycosylation
; results from amino acid substitution or deletion at the
asparagine-linked glycosylation recognition sites or at
any site of the molecule that is modified by addition of
O-linked carbohydrate. An asparagine-linked
glycosylation recognition site comprises a tripeptide
.,
,
'
~; ' '
WO90/113nl ~ ~J~ PCT/US90/0135
sequence which is specifically recognized by appropriate
cellular glycosylation enzymes. These tripeptide
sequences are either asparagine-X-threonine or
asparagine-X-serine, where X is usually any amino acid.
A variety of amino acid substitutions or
deletions at one or both of the first or third amino acid
positions of a glycosylation recognition site (and/or
amino acid deletion at the second position) results in
non-glycosylation at the modified tripeptide sequence.
Expression of such altered nucleotide sequences produces
variants which are not glycosylated at that site.
Other analogs and derivatives of the sequence
of MIF which would be expected to retain MIF activity in
whole or in part may also be easily made by one of skill
in the art given the disclosures herein. One such
modification may be the attachment of polyethylene glycol
onto existing lysine residues in the MIF sequence or the
insertion of a lysine residue into the sequence by
conventional techniques to enable the attachment. Such
modifications are believed to be encompassed by this
invention.
The present invention also provides a method
for producing MIF polypeptides. The method of the
present invention involves culturin~ a suitable cell or
cell line, which has been transformed with a DNA sequence
,
. ; , '
.: . . :
. . , ~ .
W090/11301 ~ 0 ~ 3 ~ PCT/US90/01355
16
coding on expression for an MIF polypeptide or an active
fragment thereof, under the control of known regulatory
sequences. Suitable cells or cell lines may be mammalian
cells, such as Chinese hamster ovary cells (CHO) or 3T3
cells. The selection of suitable mammalian host cells
and methods for transformation, culture, amplification,
screening and product production and purification are
known in the art. See, e.g., Gething and Sambrook,
Nature, 293:620-625 (1981), or alternatively, Xaufman et
al, Mol. Cell. Biol., 5(7):l750-l75g (1985) or Howley et
al, U. S. Patent 4,419,446. Other suitable mammalian
cell lines, are the monkey COS-l cell line, and the CV-l
cell line.
Similarly useful as host cells suitable for the
present invention are bacterial cells. For example, the
various strains of E. coli (e.g., HBlOl, MCl061 and
strains used in the following examples) are well-known as
host cells in the field of biotechnology. Various
strains of B. sùbtilis, Pseudomonas, other bacilll and
the like may also be employed in this method.
Many strains of yeast cells known to those
skilled in the art are also available as host cells for
expression of the polypeptides of the present invention.
:.
:: . .. . .. .
WO9~/11301 ,~ rj ~ ~ 3 ~ PCT/US90/0135
Additionally, where desired, insect cells may be utilized
as host cells in the method of the present invention.
See, e.g. Miller et al, Genetic Enqineerin, 8:277-298
(Plenum Press 1986) and references cited therein.
S The present invention also provides vectors for
use in the method of expression of novel MIF
polypeptides. These vectors contain the novel MIF DNA
sequences which code for MIF polypeptides of the
invention. Alternatively, vectors incorporating modified
sequences as described above are also embodiments of the
present invention and useful in the production of MIF
polypeptides. The vector employed in the method also
contains selected regulatory sequences in operative
association with the DNA coding sequences of the
invention and capable of directing the replication and
expression thereof in selected host cells.
Thus, MIF, produced recombinantly or
synthetically, may be used in a pharmaceutical
preparation to treat diseases that may be responsive to
; 20 macrophage activation. It may also be possible to employ
an active peptide fragment of MIF in such pharmaceutical
formulations. One therapeutic use for pharmaceutical
compositions containing the MIF or fragment thereof is in
the treatment of cancer. For example, activated
macrophages alone or in combination with specific anti-
~, :
- ~ . . . .
~ ~ ~ o 3 ~ ~ PCT/US90/01355
18 .
tumor monoclonal antibodies have considerable tumoricidal
capacity. MIF's ability to activate macrophages indicate
its use alone or in combination with other therapeutic
agents as a potent anti-tumor agent for treatment of
S cancer patients.
Similarly, the ability of MIF to promote
macrophage-mediated killing of certain pathogens
indicates the use of this molecule in treating various
infections by a number of pathogens including, for
example, Leishmania donovani.
In addition, the ability of MIF to prevent the
migration of macrophages may be exploited in a
therapeutic agent for treating wounds. Local application
of MIF protein at the site of injury may result in
increased numbers of activated macrophages concentrated
.:
within the wound, thereby increasing the rate of healing
of the wound.
In addition, MIF may be used as a general
immune stimulus and, in particular, may be used to
increase the immunity generated against specific
vaccines. The ability of MIF to enhance macrophage IL-l~
and HLA-DR expression indicates that this molecule
enhances the ability of macrophages to present antigens
to T cells. Therefore MIF has utility in potentiating
the immune response to different antigens. This property
. . .
,
' , ' ' ' ~
WO90~11301 ~ 3 3 ~ PCT/US90/0135
of MIF indicates its usefulness as a general immune
stimulus. More particularly, MIF has utility in
potentiating the immune response to particular vaccines.
This is extremely important in cases, such as the human
immunodeficiency viruses, where vaccine development has
been particularly problematic.
The MIF protein or fragments thereof of this
invention may also be employed, alone or in combination
with other cytokines, hematopoietins, interleukins,
growth factors, interferons or antibodies to treat a
variety of infections, cancer, and perhaps tissue
injuries, as described above. In particular c~-
administration of MIF with IFN gamma, M-CSF or GM-CSF is
expected to provide enhanced therapeutic benefit for the
conditions described above.
Other uses for these novel polypeptides are in
the development of monoclonal and polyclonal antibodies
generated by standard methods for diagnostic or
therapeutic use.
Therefore, as yet another aspect of the
invention are methods and therapeutic compositions for
treating the conditions referred to above. Such
compositions comprise a therapeutically effective amount
of the MIF protein or therapeutically effective fragment
thereof of the present invention in admixture with a
., .
-
. - ,. .
' ' "
W~9~/ll3nl ~ ) 3 ~, PCT/US90/0135~
pharmaceutically acceptable carrier. This composition
can be systemically administered parenterally.
Alternatively, the composition may be administered
intravenously. If desirable, the composition may be
administered subcutaneously. For use in tissue healing,
the MIF of this invention would be in a pharmaceutical
preparation suitable for local or topical application.
When systematically administered, the
therapeutic composition for use in this invention is in
the form of a pyrogen-free, parenterally acceptable
aqueous solution. The preparation of such a
pharmaceutically acceptable protein solution, having due
regard to pH, isotonicity, stability and the like, is
within the skill of the art.
The dosage regimen involved in a method for
treating the above-described conditions will be
determined by the attending physician considering various
factors which modify the action of drugs, e.g. the
condition, body weight, sex and diet of the patient, the
severity of any injury or infection, time of
administration and other clinical factors. Generally,
the daily regimen should be in the range of 1-1000
micrograms of MIF protein or 50 to 5000 units (i.e., one
unit per ml being the concentration of protein which
: '
'
wo go/1 l3n~ 3 ~ PCS/US90/01355
21
leads to half maximal inhibition in the MIF assay) of
protein per kilogram of body weight.
The therapeutic method and compositions of the
present invention may also include co-administration with
other human factors. Exemplary cytokines or
hematopoietins for such use include the known factors IL-
l, IL-2, IL-3, IL-4, IL-6, G-CSF, CSF-l, GM-CSF, M-CSF,
the interferons, or erythropoietin. More particularly,
MIF in combination with IFN gamma, or M-CSF or GM-CSF is
expected to provide enhanced therapeutic activity for
treatment of the conditions described above. The dosage
recited above would be adjusted to compensate for such
additional components in the therapeutic composition.
Progress of the treated patient can be monitored by
; 15 conventional methods.
The following examples illustratively describe
the cloning, expression and production of human MIF and
` other methods and products of the present invention.
These examples are for illustration and do not limit the
scope of the present invention.
;~ Exam~le l - Isolation of mRNA and Construction of cDNA
Library
A human T-cell hybridoma line, T-CEMB, found to
elaborate significant MIF activity but barely detectable
amounts of IFN-gamma message, was chosen as the source of
.. . .
: . . : -
- ` -
:, , .
:. . :
-,
.. . ...
W09~)/ll301 ~ r? 3 ~ PCT/US90/0135
RNA extraction. This cell line was generated by fusion
of an HAT-sensitive T-lymphoblastoid line CEMWH4 with Con
A-stimulated human peripheral blood T-cells according to
W. Y. Weiser et al, Cell. Immunol., 90:167-178 (1985).
The cells are maintained in medium consisting of RPMI
1640, 10% heat inactivated fetal calf serum (FCS), 2 mM
L-glutamine and 50 ug/ml Gentamicin. Total RNA was
extracted according to the method of Chirgwin et al,
Biochemistrv, 18:5294-5299 (1979) from T-CEMB cells that
have been stimulated with PHA (1%) and PMA (10 ng/ml) for
18 hours.
mRNA was prepared by oligo(dT)-cellulose
~` chromatography [H. Aviv et al, Proc. Natl. Acad. Sci.
USA, 69:1408-1412 (1972)~. Five micrograms of mRNA was
used to synthesize double-stranded cDNA as described by
- Wong et al, cited above, with DNA polymerase I in the
second strand reaction and removal of the hairpin loop by
SI nuclease digest [T. Maniatis et al, cited above]. The
double-stranded DNA was blunted and ligated to 5-fold
excess of synthetic semi-Xho adapters [Yang et al, Cell,
47:3-10 (1986)]. The semi-Xho adapted cDNA was size
fractionated by agarose gel electrophoresis. The region
of the gel containing cDNA larger than 500 base pairs was
excised. These semi-Xho adapted cDNA fragments were
isolated by adherence to glass powder [B. Vogelstein et
'
W091)/1~ 1 2-~t3 3 .3~ PCT/US90/01355
al, Proc. Natl. Acad. Sci. USA, 76:615-619 (1979)] and
subsequent elution with low salt buffer [5 mM Tris, 0.5
mM ethylene diaminetetraacetic acid (EDTA)].
The COS-l rell expression vector pXM [Y. C.
Yang et al, cited above~ was linearized at the unique Xho
I site and ligated to equimolar amounts of the semi-Xho
adapted cDNA. The ligation reaction was used to
transform competent Escherichia coli strain HB101 [Y. C.
Yang et al, cited above] to generate a library of
10 approximate 60,000 ampicillin-resistant colonies.
Exam~le 2 - DNA PreParation and COS-l Cell Transfection
The expression cloning system previously
described by G. G. Wong et al, clted above, was employed
to isolate a cDNA encoding the MIF activity as follows.
15 Bacterial colonies from the above-described
cDNA library were replicated onto nitrocellulose filters.
Colonies from each filter were scraped into L-broth and
plasmid DNA was isolated by previously described methods
[J. A. Meyers et al, J. Bacteriol., 127:1529-1536
(1976)]. Each primary DNA sample was prepared from a
pool of 200-500 colonies.
Five micrograms of each plasmid DNA was used to
transfect COS-l cells by DEAE-dextran-mediated DNA
; transfection, with the addition of a 0.1 mM chloroquine
treatment [L. M. Sompayrac et al, Proc. Natl. Acad. Sci.
-
'. ' '. . : ,. .
' ~
, . ,
W090t1130l 4) 0 ~ O ~ 3 ~ PCT/US90/0135i
24
USA, 78:7575-7578 (1981) and H. Luthman at al, Nucl.
Acids Res., 11:1295-1308 (1983)]. Culture supernatant
fluid from transfected COS-l cells was harvested 72
hours after transfection and assayed for MIF activity
according to the assay described below in Example 7.
Plasmid DNA from the positive pools was re-
transfected into COS-l cells and transfected supernatants
were re-screened for MIF activity. To minimize the
chance of false positives, each sample was tested at
least five times using cells from different blood donors.
These samples were then subdivided to contain fewer
clones until individual clones were isolated. Of the 100
~ supernatants for the initial COS-l cell transfections of
-~ the primary pools, two samples showed the best overall
MIF activity.
The pools with the highest MIF activity were
selected and subdivided to contain fewer number of
7 clones, their DNAs were prepared, transfected, and the
transfected supernatants were examined for MIF activity
until single clones expressing MIF activity were
obtained.
one clone which consistently demonstrated the
best MIF activity was re~examined in the MIF assay of
-~ Example 7. The biological activity of this clone was
; ~5 also examined with peritoneal macrophages of guinea pig
,
,: :. ~ - .: . : : - ::::: :
,:- . .: . .. : . -
~,: - : '
. . .. . . . - . .. .
W~ 9(~ PCT/US90/0135~
and mouse. Inhi~ition of 38% and 31% was found
respectively from a 5-fold dilution of the crude
supernatant of transfected COS-l cells. The MIF activity
from this clone was also compared with other cytokines
(IL-2, TNF-~, TNF-~, IL-3 and IFN-gamma). The MIF
supernatant showed greater MIF activity in a bioassay
than all of these cytokines. However, fairly strong MIF
activity was displayed by TNF-~ and IFN-gamma.
Example 3 - Protein AnalYsis
The polypeptide encoded by the cDNA of p7-1 was
identified using pulse-labeling experiments. SDS-PAGE of
proteins secreted by COS-l cells transfected with p7-1
DNA revealed the presence of a 12 kd polypeptide which
was absent in a mock transfected control. This novel
. 15 band was excised from the polyacrylamide gel and
electroeluted at six watts for two hours in elution
buffer containing 50 mM NH4HC03 and 200 ng/ml of human
serum albumin. The latter was added to prevent
nonspecific stlcking. As controls, gels with the same
molecular weight from mock-transfected supernatant were
also excised and subjected to electroelution. The eluant
was reconstituted with medium and examined for MIF
activity.
~: . ~- , . . . - . : ,
.: . . : ~
- ~:- .
~090/11301 ~0~1033 ~ PCT/US90/01355
26
Strong MIF activity was found in the eluant.
However, no MIF activity was detected in mock gels
excised from the same ~olecular weight region. When
bands with 30 kd were removed from the same gels
containing active MIF-polypeptide and subjected to
electroelution, the eluants from the 30 kd band enhanced
migration. This 30 kd protein could be an inhibitor of
MIF which antagonizes and/or decreases MIF activity in
the crude supernatant.
Forty-eight hours after chloroquine treatment,
culture supernatant from COS-l cells transfected with
recombinant DNA of MIF-positive clones was removed and
cells were pulse-labelled with 0.5 mCi [35S]methionine in
0.5 ml of DMEM for 4 hours at 37C. Radiolabelled
supernatant was collected and subjected to a 15% SDS-PAGE
[U. K. Laemmli, Nature, 227:680-685 (1970)]. After
electrophoresis, the yel was immersed in a fluorography
enhancing solution (Enhance; New England Nuclear, Boston,
MA), dried, and exposed to X-ray film.
Example 4 - RNA Analysis
; Twenty micrograms of total cellular RNA from
; PHA/PMA-stimulated or unstimulated T-CEMB cells, Con A-
stimulated or unstimulated human PBL, or CEM cells was
electrophoresed through l.2~ agarose gel containing 2.2 M
formaldehyde ~H. Lehrach et al, 3iochemistrv, 16:4743
. -
~ ' ., -~ '
: ' : : : ,
WO9~ 0l ~ 0 3 3 ~ PCT/US90/0135
(1977)]. The formaldehyde-denatured RNA was transferred
to nylon filter (Zetabind; cuno, Meriden, CT) as
described [E. M. Southern, J. Mol. Biol., 98:503-517
(1975)].
cDNA probe was made by cleaving cDNA inserts
from the vector with Xho I restriction enzyme and
labelled the inserts with 32p using random
oligonucleotides as primers in the presence of the large
fragment of DNA polymerase I [A. P. Feinberg et al,
Analv. BiochemistrY~ 132:6-13 (1983)]. The nylon filter
was prehybridized for 4 hours at 43C, hybridized with
32P-labelled cDNA probe in hybridization solution
consisted of 6x SSC, 0.5% SDS 5x Denhardt's solution and
lO0 ug/ml denatured salmon sperm DNA for 16 hours at
43C.
After hybridization, the filter was washed two
times with post-wash solution I (10 mM sodium phosphate,
0.1% SDS, 1 mM EDTA and 1 X SSC) for 30 minutes at room
temperature and two times with post-wash solution II (10
mM sodium phosphate, 0~1% SDS, 1 mM EDTA and 0.2 X SSC)
for 15 minutes at 68C, dried and appl~ to X-ray film.
This Northern blot analysis revealed that T-
cell line, CEM and T-cell hybridoma line, T-CEMB, as well
as lectin-stimulated human PBL synthesized readily
detectable levels of mRNA that hybridized with the MIF
.' ~
.~ ~
- .
W090/ll30l ~ 33 ~, PCT/US90/Ot35
clone. The messenger, however, could not be detected in
RNA samples from unstimulated PBL despite prolonged
exposure to film. The presence of RNA transcript in
activated human PBL suggests that the human MIF gene is
expressed and that MIF is the product of activated
lymphocytes.
Example 5 - DNA Sequence Analvsis
The nucleotide sequence of the cDNA clone of
p7-1 was determined as described [G. G. Wong et al and Y.
C. Yang et al, cited above] by generating ordered sets of
overlapping fragments via Bal 31 nuclease digestion and
; subcloning into M13 vector [M. Poncz et al, Proc. Natl.
Acad. Sci. USA, 79:4298-4302 (1982j; and J. Messing et
al, Gene, 19:269-276 (1982)]. Single-stranded DNA was
prepared, and the nucleotide sequence was determined by
the dideoxynucleotide chain-termination procedure [F.
Sanger et al, Proc. Natl. Acad. Sci. USA, 74:5463-5467
( lg77 ) ] .
Exam~le 6 - Generation of Mutant cDNA Fragment
The relatively efficient secretion of the 12 kd
protein with MIF activity from p7-1-transfected COS cells
despite the lack of a clear signal peptide in the coding
; se~uence raised the possibility that the molecularly
cloned protein is not MIF but an inducer of endogenous
MIF expression by the COS cells. To test this
.'' ' ~ ~ :
' . ' ' : ~
WO~(~/1l30l ~i~v i? , :3 ~ PCT/US90/01355
29
possibility, two insertional mutations of the coding
region of the p7-1 cDNA were constructed as follows.
Although the MIF cDNA clone, p7-1 contained a
single Pst I site, the Pst I sites in the adapters
flanking the insert rendered this site unsuitable for
mutational analysis of the MIF cDNA. The two flanking
Pst I sites were removed by treating the p7-1 insert that
was isolated after partial digestion of the plasmid with
Pst I with T4 DNA polymerase then ligating Eco RI
adapters to the resulting flush ends. This adapted
fragment was subcloned into the unique Eco RI site of a
derivative of pXM designated pXMT4 which has no Pst I
sites. A clone, p7-1-24 with the cDNA in the correct
orientation was selected for mutational analysis.
Two insertional mutants of MIF were
constructed. The first mutant (p7-1-24B2) was generated
.
by insertin~ a 14-base oligodeoxynucleotide, 5'
TGTAATTACATGCA 3', at the unique Pst I site of p7-1-24.
This sequence was designed such that the MIF coding
region would be interrupted by a termination codon (TAA)
regardless of the orientation of insertion.
The second insertional mutant (p7-1-24232) was
constructed by inserting a 99-base oligodeoxynucleotide
into the Pst I site of p7-1-24. The sequence was
designed to add 33 amino acids to the MIF coding region
.,
- . -. , ~, ~ .. .. :
,:. . , ; :
, . , : - ~
,. ' , - '
.
WOsl)~l1301 ~ a ~ ~ 3 3 ~ PCT/US90~0135
when inserted in either orientation into the Pst I site
of p7-1-24.
Clones containing the 14-base oligonucleotide
or the 99-base oligonucleotide were identified by
hybridization using 32P-labelled 14-base oligomer or 99-
base oligomer as probes. Each of these plasmids was
tested for the ability to induce the secretion of the 12
kd protein observed with the original p7-1 plasmid as
well as MIF activity when transfected into COS cells.
Neither the 12 kd protein nor MIF activity was
detected in the supernatants from the COs cells
transfected with the truncated form of MIF (p7-1-24B2).
Transfection of COS cells with the mutant having the
extended coding region (p7-1-24232) also failed to yield
detectable levels of MIF activity or 12 kd protein.
However, the COS cell supernatant was found to contain a
novel species with apparent molecular weight of
approximately 15,500, consistent with the expected size
of the extended coding region of the insertion~l mutant
p7-1-24232.
These experiments indicated that the induced 12
kd species from p7-1-transfected COS cells is directly
encoded by the cDNA insert of p7-1 plasmid and that this
protein has MIF activity.
~ ' , ' , .
,'
'
W(~90/~1301 ~ 3 ~ PCT/US90/0135
Exam~le 7 - MIF Biological Activities
A. MIF Assay
The MIF assay was performed according to
previously described procedures [W. Y. Weiser et al,
cited above; and J. T. Harrington et al, J. Immunol.,
ll0:752 (1973)], employing human peripheral blood
monocytes as indicator cells in an agarose droplet assay
system.
Human peripheral blood mononuclear cells
obtained by Ficoll-Hypaque centrifugation were washed two
times with buffered salt solution (HBSS) and mixed with
0.2% agarose in minimal essential medium (MEM). One
` microliter of cells in the agarose mixture was dispensed
into the center of microtiter wells using a 50 ul
`~ 15 repeating dispenser (Hamilton Co., Reno, Nev). Samples
to be tested were added to wells at l00 ul per well. The
,' size of each agarose droplet was measured. After
overnight incubation at 37C, the total area of migration
including the original agarose droplet was again
measured.
The area of migration was calculated by the
- formula where migration = (diameter of total
area/diameter of agarose droplet)2-l. The percentage of
inhibition (~ I) of each sample was derived as follows:
:-, . . ........ . , .
.. .. . . ~ . : ~ :
~ . . -, .
.. : i .
wo 9o~ll3nl `~ O ~ 0 3 3 ~ PCT/US90/01355
% I = 100-(Average migration of test samples~Average
migration of control samples)xlO0. Inhibition of 20% or
greater was considered to be significant [W. Y. Weiser et
al, cited above].
B. MIF Enhancement of Macrophage IL-l~ and
HLA-DR Gene Expression
Monocyte derived macrophages obtained by seven
days culture of isolated blood monocytes were incubated
with crude recombinant MIF of the present invention or
supernatant from mock-transfected cells for 6 or 24
hours. Total RNA from these cells was extracted
according to the method of Chirgwin et al, Biochem.,
18:5294 (1979), and slze fractionated by electrophoresis
through 1.2% agarose gels containing 2.2M formaldehyde.
The RNA was transferred to nylon filters. cDNA inserts
of IL-l-beta and HLA-DR were cleaved from their
respective vectors, isolated, radio-labelled with 32p by
random priming [Feinberg et al, Analy. Biochem., 132:6
(1983)] and hybridized with the filters.
The rMIF supernatants, but not the mock
supernatants, induced IL-l-beta mRNA expression. rMIF of
this invention induced a rapid and long-lasting increase
of HLA-DR mRNA, whereas macrophages incubated with mock
supernatant demonstrated no enhanced level of HLA-DR
mRNA.
.: ~ - , - .
WO9~ v~ .3 ~ PCT~US90/0135
C. Activation of Human Macrophages to Release
Hydrogen Peroxide
The capacity to release hydrogen peroxide is a
close biochemical correlate of macrophage activation due
to the prominent involvement of reactive oxygen
intermediates in their anti-microbial function [S~e,
e.g., Nathan, Trans. R. Soc. TroP. Med. Hyq., 77:620
(1983)]. The ability of rMIF to activate macrophages for
hydrogen peroxide was determined as follows.
Human monocyte derived macrophages were
incubated for approximately 48 hours in medium containing
2 to lO00 fold diluted rMIF supernatant of this invention
or mock supernatant. Triggered by PMA, hydrogen peroxide
release from these cells was measured by oxidation of
^ 15 scopoletin in the presence of horseradish peroxidase.
- Macrophages incubated with 2, 20 and 50 fold
diluted rMIF supernatant, but not mock supernatant,
showed 2 to 3.6 fold enhanced release of hydrogen
peroxide.
D. MIF Activation of Macrophage Leishmania
; donovani Killing
- To determine whether rMIF of this invention
- could induce killing of the intracellular parasite, L.
donovani, which is known to be sensitive to oxygen-
dependent killing mechanisms [Murray et al, J. Clin.
.,
.
.
:'; ~ , . , .,: ~ ,
:, ' ' ~. ,' ~ ,
'' : . ' '~ . ' . :
~090/l 13nt ) ~3 ~ ~3 ~ ~,; pCT/US90/01355
34
Invest., 72:32 (1983)], the following assay was
conducted.
Monocyte derived macrophages were incubated
with rMIF supernatant for approximately 48 hours. Pro-
mastigotes of L. donovani at a parasite to cell ratio of10:1 were added to the incubated cells. The number of
intracellular parasites/100 macrophages at 2, 24, 48, and
72 hours post infection were enumerated in stained
preparations of coverslips.
An increase of greater than about 22% in
;~ antileishmanial capability of cells treated with rMIF of
this invention was observed. Parallel experiments
combining rMIF with interferon gamma are expected to
produced enhanced killing of this parasite.
Example 8. Ex~ression of Recombinant Human MIF
To produce MIF, the cDNA encoding it is
transferred into an appropriate expression vector, of
which numerous types are known in the art for mammalian,
insect, yeast, fungal and bacterial expression, by
standard molecular biology techniques. One such vector
for mammalian cells is pXM [Y. C. Yang et al, Cell, 47:3-
10 (1986)]. This vector contains the SV40 origin of
replication and enhancer, the adenovirus major late
promoter, a cDNA copy of the adenovirus tripartite leader
sequence, a small hybrid intervening sequence, an SV40
'.. , -- `
.
W090/113()1 ~ a~ J~ PCl/US90/0135
polyadenylation signal and the adenovirus VA I gene, in
appropriate relationships to direct the high level
expression of the deslred cDNA in mammalian cells [See,
e.g., Kaufman, ProcO Natl. Acad Sci. USA, 82:689-693
(1985)]. The pXM vector is linearized with the
endonuclease enzyme XhoI and subsequently ligated in
equimolar amount separately to the cDNA encoding MIF that
was previously modified by addition of synthetic
oligonucleotides [Collaborative Research, Lexington, MA]
that generate Xho I complementary ends to generate
construc~s for expression. These constructs can be
expressed in various hosts with appropriate vectors.
a. Mammalian Cell Expression
To obtain expression of the MIF protein
for use in the assay described below, the pXM construct
containing the cDNA for MIF is transfected into COS
cells, as described in Example 5. The conditioned medium
from the transfected COS cells contains MIF biological
activity as measured in the MIF assay.
The mammalian cell expression vectors
described herein may be synthesized by techniques well
known to those skilled in this art. The components of
the vectors, e.g. replicons, selection genes, enhancers, ~-
promoters, and the like, may be obtained from natural
sources or synthesized by known procedures. See, Kaufman
.. . ~ ~ , .. .. . ..
- . . . : :: : . :
-
~V090/l~30l ~a~03~ PCT/US90/013~5
36
et al, J. Mol._Biol., 159:511-521 (1982); and Kaufman,
Proc. Natl_._Acad. Sci USA, 82:689-693 (1985).
Exemplary mammalian host cells include partlcularly
primate cell lines and rodent cell lines, including
transformed cell lines. Normal diploid cells, cell
strains derived from ln vitro culture of primary tissue,
as well as primary explants, are also suitable.
Candidate cells need not be genotypically deficient in
the selection gene so long as the selection gene is
dominantly acting. For stable integration of the vector
DNAs, and for subsequent amplification of the integrated
vector DNAs, both by conventional methods, CHO cells may
be employed. Alterna~ively, the vector DNA may include
all or part of the bovine papilloma virus genome [Lusky
et al, Cell, 36:391-401 (1984)] and be carried in cell
lines such as C127 mouse cells as a stable episomal
element. Other suitable mammalian cell lines include but
are not limited to, HeLa, COS-1 monkey cells, mouse L-929
cells, 3T3 lines derived from Swiss, Balb-c or NIH mice,
BHK or HaK hamster cell lines.
Stable transformants are then screened for
expression of the product by standard immunological,
biological or enzymatic assays. The presence of the DNA
and mRNA encoding the MIF polypeptides may be detected by
standard procedures such as Southern blotting and RNA
:' :
,, , , , ~ ,.
WO9(~/ll3~ 3 33~ PCT/US90/01355
blotting. Transient expression of the DNA encoding the
polypeptides during the several days after introduction
of the expression vector DNA into suitable host cells,
such as COS-1 monkey cells, is measured without selection
` 5 by activity or immunologic assay of the proteins in the
culture medium.
One skilled in the art can also construct
other mammalian expression vectors comparable to the pXM
vector by, e.g., inserting the DNA sequences of MIF from
the plasmids with appropriate enzymes and employing well-
known recombinant genetic engineering techniques and
other known vectors, such as pJL3 and pJL4 [Gough et al.,
EMBO J., 4:645-653 (1985)] and pMT2 (starting with pMT2-
;~ VWF, ATCC #67122; see PCT application PCT/US87/00033).
The transformation of the vectors with MIF into
appropriate host cells can result in expression of the
`$f MIF polypeptides.
` b. Bacterial Expression SYstems
Similarly, one skilled in the art could
manipulate the sequences encoding MIF by eliminating any
mammalian regulatory sequences flanking the coding
sequences and inserting bacterial regulatory sequences to
. ~
create bacterial vectors for intracellular or
extracellular expression of MIF of the invention by
bacterial cells. The DNA encoding MIF may be further
. :
',' ,
,, :
: . ` '- ~ ;: . - : ~. -
::.,' . : . . : , . ',, ~... ..
: - .:
W09()/11301 " jJ1~ 0~ PCT/US90/0135
38
modified to contain different codons to optimize
bacterial expression as is known in the art. Preferably
the sequence encoding the mature MIF is operatively
linked in-frame to nucleotide sequences encoding a
secretory leader polypeptide permitting bacterial
expression, secretion and processing of the mature MIF
polypeptide, also by methods ~nown in the art. The
expression of MIF in E. coli using such secretion systems
is expected to result in the secretion of the active
polypeptide.
The compounds expressed through either route in
b~cterial host cells may then be recovered, purified,
and/or characterized with respect to physicochemical,
biochemical and/or clinical parameters, all by known
methods.
c. Insect or Yeast Cell Expression
Similar manipulations can be performed for
the construction of an insect vector for expression of
MIF polypeptides in insect cells ~See, e.g., procedures
described in published European patent application
155,476]. The MIF cDNA will be expressed in insect
cells.
Similarly yeast vectors are constructed
employing yeast regulatory sequences to express the cDNA
encoding MIF in yeast cells to yield secreted
,~
~,
'' ' ', ' :' ''' '' ' '' :'. '' ~'
': ':
W090/1l301 ~ .J ~ 3 3 ~ PCT/US90/01355
39
extracellular active MIF. [See, e.g., procedures
described in published PCT application Wo 86/00639 and
European patent application EP 123,289.]
Example 9. Construction of CHO Cell Lines Expressing
Hi~h Le~els of MIF
One method for producing high levels of the MIF
protein of the inventlor, from mammalian cells involves
the construction of cells containing multiple copies of
the cDNA encoding MIF.
The cDNA is co-transfected with an amplifiable
marker, e.g., the DHFR gene for which cells containing
increasing concentrations of methotrexate (MTX) according
to the procedures of Kaufman and Sharp, J. Mol. Biol.,
(1982) supra. This approach can be employed with a
- 15 number of different cell types. ~
For example, the pXM vector containing the MIF ~--
gene in operative association with other plasmid
sequences enabling expression thereof is introduced into
DHFR-deficient CHO cells, DUKX-BII, along with a DHFR
expression plasmid such as pAdD26SVpA3 [Kaufman, Proc.
Natl. Acad. Sci. USA, 82:689-693 (1985)~ by calcium
^ phosphate coprecipitation and transfection. DHFR
expressing transformants are selected for growth in alpha
media with dialyzed fetal calf serum. Transformants are
checked for expression of MIF by bi~assay, immunoassay or
:
.. . .,. ... .. . ~ ,
, : .: . -. , . . . " , -
: - .. . .
WO~0/l130l PCT/VS90/01355
cj ~ ~
RNA blotting and positive pools are subsequently selected
for amplification by growth in increasing concentrations
of MTX (sequential steps in 0.02, 0.2, 1.0 and 5uM MTX)
as described in Kaufman et al., Mol. Cell Biol., 5:1750
(198~). The amplified lines are cloned, and MIF protein
expression is monitored by the MIF assay. MIF expression
is expected to increase with increasing levels of MTX
resistance.
In any of the expression systems described
above, the resulting cell lines can be further amplified
; by appropriate drug selection, resulting cell lines
recloned and the level of expression assessed using the
MIF assay described herein.
Numerous modifications and variations of the
present invention are included in the above-identified
specification and are expected to be obvious to one of
skill in the art. Such modifications and alterations to
the compositions and processes of the present invention
are believed to be encompassed in the scope of the claims
appended hereto.
- . : - : -
- , : '
~- :
