Note: Descriptions are shown in the official language in which they were submitted.
1051GHB25
2 ~
- 1 - 18159Y
TITLE QF T~E INVENTION
THE CLASS II PROTEIN OF T~E OUTER MEMBRANE OF
NEISS~RIA MENIN&ITIDIS ~AVING IMMUNOLOGIC CARRI~R AND
E~HANCEMENT PROPERTIES, AND VACCINES CONTAINING SAME
BACKGROUND OF THE INVENTION
This application is a Continuation in Part
of application USSN 555, 329, f iled on July l9, 1990.
The outer membrane protein complex (OMPC) of
: 20 Neisseri~ is used as an ~mmu~Q.lo~ic
c~ ~.in vacci~es ~or human uæe. OMPC consists of
ve~icles containing a variety of proteins as well as
membranous lipidæ, including lipopolyæaccharide (LPS
or endotoxin).
: OMPC has the property o~ immune enhancement,
and when an antigen is chemically coupled to it, an
increaæed antibody reæponse to:the antigen re ults.
::
105/~HB25 - 2 - 18159IA
OMPC is currently used in vaccines for human infants
against infectious a~ents such as ~aemophilus
influenz~, and renders the infants capable of
mounting an IgG and memory immune response to
polyribosyl ribitol phosphate (PRP) of ~. influenzae.
when PRP is chemically coupled to OMPC.
OMPC is a mixture of a variety of proteins
and lipids, and it was not known which component or
components of OMPC bestows the beneficial immune
enhancing effect to the coupled antigens. ~owever,
some potentially negative aspects of using OMPC in
human vaccines include LPS related reactions such as
fever, endotoxic shock, hypotension, neutropenia,
activation of the alternative complement pathway,
intravascular coagulation, and possibly death.
Furthermore, OMPC-antigen conjugates are
quite heterogeneous in that the antigen may become
conjugated to any of-the protein moieties which make
up OMPC.
OBJE~T~_QF THE INVENTION
It is an object of the present invention to
provide substantially pure Class II, major immuno
2s enhancing protein (MIEP) derived directly from the
outer membrane of Neisser~ia mening~idis, free from
other N~isseria menin~itidis outer membrane
components. It is another object of the present
invention to provide substantially pure recombinant
MIEP of the outer membrane of Nei~seria menin~itidis,
produced in a recombinant host cell, comple~ely free
of all other Neisseri~a menin~idis proteins. A
105/GHB25 - 3 - 18159IA
further object of the present invention is to provide
an efficient immunocarrier protein for the
enhancement of an immune response to antigens,
comprising either MIEP purified directly from the
outer membrane of Nei~seria meningitidis, or
recombinant MIEP of Neisseria meningitidis produced
in a recombinant host cell. Another object of the
present invention is ~o provide a protein which
possesses immune mitogenic activity, comprising
either MIEP purified directly from the outer membrane
Neisseria menin~itidis, or recombinant MIEP of
~eisseria m~ningi~ produced in a recombinant host
cell. An additional object of the present invention
is to provide vaccine compositions containing either
the recombinant MIEP, or MIEP purified directly from
the outer membrane of Neisser~ meningitidis. These
and other objects will be apparent from the following
description.
SUMMARY ~F I~E INVENTION
The present invention relates to the Cla38
II major immuno enhancing protein ~MIEP) of the outer
membrane o~ Neisseria meni~gi~i~is, in substantially
pure form, free from other ~ontaminating N.
m~ningiti~i~ outer membrane proteins and LPS. The
MIEP of the present invention, whether purified
directly ~rom the outer membrane of Neisseria
menigitidi~ cells, or derived from a recombinant host
cell producing recombinant MIFP of Neisseria
meningi~idi~, possesses immunologic carrier and
mitogenic activity. The MIEP of the present
105/G~B25 - 4 - 18~ 3~3
invention, when coupled to an antigen, is capable of
immune enhancement in that the antibody response to
the coupled antigen i8 augmented or the antigen is
transformed to a T-dependent antigen which ensures
that immunoglobulins of the IgG clags are produced.
The antigens which may be eoupled to the MIEP of the
present in~ention include ~iral proteins, bacterial
proteins and polysacharides, synthetic peptides,
other immunogenic antigens, and weak or
non-immunogenic antigens.
~ Q ~
105 /G~IB25 - 5 - 18159IA
D:E5TAILED DESCRIPTION OF THE INVENTION
It is known that certain substances which by
themselves elicit an immune response which consists
of only IgM class antibodies and no memory, can be
transformed into fully immunogenic antigens which
elicit IgM and IgG anitbodies as well as memory, by
chemical coupling to a strongly (T-cell dependent)
antigenic substance. This immunologic phenomenon is
termed the "carrier effect", while the weak or
lo non-immunogenic moiety, and the strongly antigenic
substance are termed llhapten" and "carrier",
respectively.
Injection of the hapten-carrier complex into
an animal will result in the formation of antibodies
by B-lymphocytes, some of which will be specific for,
and bind to the hapten, and others which will be
specific for, and bind to the carrier. An additional
aæpect of the carrier effect is that upon a
subsequent exposure to the hapten-carrier complex, a
vigourous antibody response to the hapten ensues.
This is termed a memory, or anamnestic response.
The carrier effect appears to involve
- functions mediated by certain T-lymphocytes, called
l1helper T-lymphocytes". The carrier moleeule
stimulates the helper T-lymphocytes to assist, in
some way, formation of anti-hapten IgG class
antibody-producing ~-lymphocytes and a memory
response.
Helper T-lymphocytes are normally involved
in the production by B-lymphocytesl of antibodies
specific for a certain type of antigens, termed
~T-dependent" antigens, but not for other antigens
2 ~
105/~HB25 - 6 - 18159IA
termed "T-independent" antigens. A carrier molecule
can convert a T-independent, weak or non-immunogenic
hapten into a T-dependent, strongly antigenic
molecule. Eurthermore, a memory response will follow
a subseguent exposure to the hapten-carrier complex
and will consist primarily of IgG, which is
characteristic of T-dependent antigens and not
T-independent antigens.
The utility of carrier molecules is not
lo limited to use wlth T-independent antigens but can
also be used with T-dependent an~igens. The antibody
response to a T-dependent antigen may be enhanced by
coupling the antigen to a carrier, even if the
antigen can, by itself, elicit an antibody response.
Certain other molecules have the ability to
generally stimulate the overall immune system. These
molecules are termed "mitogens" and include plant
proteins as well as bacterial products. Mitogens
cause T and/or B-lymphocytes to proliferate, and can
broadly enhance many aspecte of the immune response
including increased phagocytosis, increased
resistance to in~ection, augmented tumor-immuni~y,
and increased antibody productlon.
Many infectious di ease causing agents can,
by themselves, elicit protective antibodies which can
bind to and kill, render harmless, or cause to be
killed or rendered harmless, the disease causing
agent and its byproducts. Recuperation from these
diseases usually results in long lasting immunity by
~irtue of protecti~e antibodies generated against the
highly antigenic components of the infectious agent.
,
.. ' ,
~ ~ ~3 3 ~ ~ ~
105/GHB25 - 7 - 18159IA
Protective antibodies are part of the
natural defense mechanism of humans and many other
animals, and are found in the blood as well aæ in
other tissues and bodily fluids. It is the primary
function of most vaccines to elicit protective
antibodies against infectious agents and/or their
byproducts, without causing disea3e.
OMPC from N. menin~iti~iS has been used
successfully to induce antibody respon~es in humans
when OMPC is chemically coupled to T-cell independent
antigens, including bacterial polysaccharides. OMPC
contains severa1 bacterial outer membrane proteins as
well as bacterial lipids. In addition, OMPC has a
vesicular three dimensional structure.
The efficacy of OMPC as an immunologic
carrier was thought to depend on one or more of the
bacterial m~mbrane proteins, bacterial lipids, the
vesicular three dimensional structure, or a
combination of bacterial proteins, lipids, and
vesicular structure. Applicants have discovered that
one of the proteins, MIEP, posse6ses the immunologic
carrier and immune enhancement properties of OMPC
vesicles, and is effective in purified form, free
~rom other N. memingi~idis membrane proteins and
lipidæ, and in a non-vesicular three dimensional
structure. Applicants have al~o discovered that
MIEP, when chemically coupled to bacterial
polysaccharide, functions as well as OMPC in inducing
an antibody response to the polysaccharide.
Applicants have further discovered that MIEP is the
Class II protein of the outer membrane of ~.
mening~ iS. The Class II protein of N.
105/GHB25 - 8 - 18159IA
meningitidis is a porin protein [Murakami, K., et
al. . Sl989). Infection And Immunity, 57,
pp.2318-23]. Porins are found in the outer membrane
of all Gram negative bacteria.
While the present invention is e~emplified
by MIEP of N. meningitidis, it is readily apparent to
those skilled in the art that any outer membrane
protein from any Gram negati~e bacterium, which has
immunologic carrier and immune enhancement activity,
is encompassed by the present invention. Examples of
Gram negative bacteria include but are not limited to
species of the genera Nei~sexia, Escherichia,
Pseud~mona~, Hemophilus, Salmonella, Shigella,
Bordetella, Klebsiella, Serratia, Yer~inia, Vibrio,
and Enterobac~r.
MIEP may be employed to potentiate the
antibody response to highly antigenic, weakly
antigenic, and non-antigenic materials. The term
"antigen" and "antigenic material" which are used
interchangeably herein include ~ne or more
non-viable, immunogenic, weakly immunognic,
non-immunogenic, or desensitizing (antiallergic)
agents of bacterial, viral, or other origin. The
antigen component may consi~t of a dried powder, an
aqueous phase such as an aqueouc solution, or an
aqueous ~uspension and the like, including mixtures
of the same, containing a non-viable, immunogenic,
weakly immunogenic, non-immunogenic, or desensitizing
agent or agent~.
The aqueous phase may conveniently be
comprised of the antigenic material in a parenterally
acceptabIe liquid. For example, t~e aqueous phase
J ~
105/G~B25 - 9 - 18159IA
may be in the form of a vaccine in which the antigen
is dissolved in a balanced salt solution,
physiological saline solution, phosphate buffered
saline solution, tissue culture fluids, or other
media in which an organism may have been grown. The
aqueous phase also may contain preservatives and/or
substances conventionally incorporated in vaccine
preparations. Adjuvant emulsions containing MIEP
conjugated antigen may be prepared employing
techniques well kno~n to the art.
The antigen may be in the form of purified
or partially purified antigen including but not
limited to antigens derived from bacteria, viruses,
mammalian cells, fungi, rickettsia; or the antigen
may be an allergen including but not limited to
pollens, dusts, danders, or extracts of the same; or
the antigen may be in the form of a poison or a venom
including but not li~ited to poisons or venoms
derived from poisonous in~ects or reptiles. The
antigen may also be in the form of a synthetic
peptide, or a fragmçnt of a larger polypeptide, or
any subportion of a molecule or romponent derived
from bacteria, mammalian cell, fungi, viruses,
rickettsia, allergen, poiæon or venom. In all cases,
the antige~æ will be in the form i~ which their toxic
or virulent properties have been reduced or deætroyed
and which when introduced into a suitable host will
either induce active immunity by the production
therein of antibodies against the specific proteins,
peptides, microorganisms, extract, or products of
microorganisms used in the preparation of the
antigen, poisons, venoms, or, in the case of
allergens, they will aid in alleviating the symptoms
of the allergy due to the æpeci~ic allergen.
105/GHB25 - 10 - 1815~IA
The antigens can be used either singly or in
combination, for example, multiple bacterial
antigens, multiple viral antigens, multiple
mycoplasmal antigens, multiple rickettsial anti~ens.
multiple bacterial or viral toxoids, multiple
allergens, multiple proteins, multiple peptides or
combinations of any of the foregoing products can be
conjuga~ed ~o MIEP.
Antigens of particular importance are
lo derived from bacteria including but not limited to _.
pertussis, Leptospira pomona, and
icterQh~emorrhagiae, ~. paratyphi A and B, C.
diphtheriae, . tetani, C. botuliaum, C. perfringens,
~. fes~ri, and other gas gangrene bacteria, B.
anthracla, P. pestis, P. multocida, Y. cholerae,
Nesseria menin~itidis, N. gonorrheae, Hemophilus
influen~ae, Treponema palid~, and the like; from
ma~malian cells incl~1ding but not limited to tumor
cells, virus in$ected cells, genetically engineered
cells, cells grown in culture, cell or tissue
extracts, and the like; from viruses including ~ut
not limited to human T lymphotropic virus (multiple
types), human immunodeficiency virus (multiple
variants and types), polio virus (multiple types),
2s adeno virus (multiple types), parainfluenza virus
(multiple types), measles, mumps, respiratory
syncytial virus, influenza virus (various types),
~hipping fever virus (SF4), Western and Eastern
equine encephalomyelitis virus, Japanese B.
encephalomyelitis, Russian Spring-Summer
encephalomyelitis, hog cholera virus, Newcastle
disea~e virus, fowl pox, rabies, feline and canine
P3,.3
105/GB 25 - 11 - 18159IA
distemper and the like viruses, from rickettsiae
including but not limited to epidemic and endemic
typhus or other members of the spotted fever group,
from various spider and ænake venoms or any of the
known allergens, includin~ but not limited to those
from ragweed, house dust, pollen extracts, grasæ
pollens, and the like.
The polysaccharides of this inven~ion may be
any bacterial polysaccharides with acid groups, but
are not intended to be limited to any particular
types. Examples of æuch bacterial polysaccharides
include Streptococcus pneumoniae (pneumococcal~ types
6A, 6B, lOA, llA, 18C, l9A, 19f, 20, 22F, and 23F,
polysaccharides; Group B Streptococcus types Ia, Ib,
II and III; ~acmophilus in~luenzae serotype b
polysaccharide; Neisseria meningitidis serogroups A,
B, C, X, Y, W135 and 29E polysaccharides; and
Escherichia ~Qli Kl, K12, ~13, K92 and K100
polysaccharides. Particularly preferred
polysaccharides, however, are those capsular
polysaccharides selected from the group consisting of
. influenzae æerotype b polysaccharides, such as
descri~ed in Rosenberg et al., J. ~iol. Chem., 236,
2845-2849 (1961) and Zamenhof et al., J. Biol. Chem.,
203, 695-704 (1953). ~tr~ptoco~cus pne~mQ~iae
(pneumococcal) type 6B or type 6A polysaccharide,
such as described in Robbins et al., Infection and
Immunity, 26, No. 3 1116-1122 (Dec., 1979);
pnemococcal type l9F polysaccharide, such as
described C. J. Lee et al., Reviews of Infectious
~iæeaseæ, 3, No. 2, 323-331 ~1981); and pneumococcal
type 23F poly~accharide, ~uch a6 de~cribed in 0. Larm
et al., Adv. Carbohyd Chem and Biochem., 33, 295-321,
R. S. Tip~on et al., ed., Academic Press 1976.
~3~
105/GHB25 - 12 - 18159IA
MI~P can be purified from OMPC derived from
cultures of N. meningitidis grown in the usual manner
as described in U.S. Patent number 4,459,286 and U.S.
Patent number 4,830,852. OMPC purification can be
done according to the methods described in U.S.
Patent number 4,271,147, 4,459,286, and 4,830,852.
MIEP can also be obtained from recombinant
DNA engineered host cells by expression of
recombinant DNA encoding MIEP. The DNA encoding MIEP
can be obtained from N. meningitidis cells ~Murakami,
K. et al., (1989), Infection And Immunity, 57, pp.
2318], or the DNA can be produced synthetically using
standard DNA synthysis techniques. DNA encoding MIEP
can be expressed in recombi~ant host cells including
but no~ limited to bacteria, yeast, insect, mammalian
or other animal cells, yielding recombinant MI~P,
The preferred methods of the present invention for
obtaining MIEP are purification of MIEP from OMPC and
recombinant DNA expression of DNA encoding MIEP
deri~ed from ~. m~ningi~idis. with purification from
OMPC most preferred.
Purified MIEP was prepared from OMPC -
vesicles by sodium dodecylsulfate (SDS) lysis of the
~ vesicles followed by SDS polyacrylamide gel
2~ electrophoresis (PAGE). The MIEP was eluted from the
gel, dialysed against a high pH buffer and
concentrated. Standard methods o~ polyacrylamide gel
- electrophoresis can be utilized to purify MIEP from
OMPC vesicles. Such methods are described in
Molecular Cloning: A Laboratory Manual, Sambrook, J.
et al., (1989), Cold Spring Harbor Laboratory Press,
New York, and Current Protocols In Molecular Biology,
(19B7) Ausubel F.M. et al., editors, Wiley and Sons,
New ~or~.
2 ~ 3
105/GHB25 - 13 - 18159IA
Standard methods of eluting proteins from
SDS-polyacrylamide gels are described in Eunkapiller,
M.W., and Lujan, E., (1986), Purification Of
Microgram Quantities Of Proteins By Polyacrylamide
Gel Electrophoresis, in Methods of Protein
Microcharacterization (J. Shively editor) Humanna
Press, Clifton N.J., and Current Protocols In
Molecular Biology ~1987), Ausubel, F.M., et al.,
editor~, Wiley and Sons, New York.
lo MIEP prepared in this manner is readily
suitable for conjugation to antigens derived from
bacteria, viruses, mammalian cellæ, rickettsia,
allergens, poisons or venoms, fungi, peptides,
proteins, polysaccharides, or a~y other antigen.
Recombinant MIEP can be prepared by
expression of genomic N. meningitidi~ DNA encoding
MIEP in bacteria, for e~ample E. coli or in yeast,
for eæample ~. cer~vlsiae. To obtain genomic DNA
encoding MI~P, genomic DNA is extracted from N.
menin~itidi~ and prepared for cloning by either
random ~ragmentation of high molecular welght DNA
following the technique of Maniatis, T. et al.,
(1978), Cell, 15, pp. 687, or by cleavage with a
restriction endonuclease by the method of Smithieæ,
2s et al., (1978), Science, ~Q~, pp. 1248. The genomic
DNA is the~ incorporated into an appro~riate cloning
vector, for example lambda phage tsee Sambrook, J. et
al., (1989), Molecular Cloning, A Laboratory Manual.
Cold Spring ~arbor Press, New York]. Alternatively,
3~ the polymerase chain reaction (PCR) technique (Perkin
Elmer) can be used to amplify specific DNA sequences
in the genomic DNA ~Roux, et al., (1989),
r~
105/GHB25 - 14 - 18159IA
Biotechniques, 8, pp. 48]. PCR treatment requires a
DNA oligonucleotide which can hybridize with specific
DNA sequences in the genomic DNA. The DNA seguence
of the DNA oligonucleotides which can hybridize to
MIEP DNA in the N. meningi~ genomic DNA can be
determined $rom the amino acid sequence of MIEP or by
reference to the determined DNA sequence for the
Class II major membrane protein of N. meningiti~s
tMusakami~ k. et al., (1989), Infection and Immunity,
57~ PP- 23l8].
Recombinant MIEP can be separated from other
cellular proteins by use of an affinity colum~ made
with monoclonal or polyclonal antibodies specific for
MIEP. These affinity columns are made by adding the
antibodies to Affigel-10 (~iorad), a gel support
which is pre-activated with N-hydroxysuccinimide
esters such that the antibodies form co~alent
linkages with the agarose gel bead support. The
antibodie3 are then coupled to the gel via amide
bonds with the spacer arm. The remaining activated
esters are then quenched with lM ethanolamine ~Cl ~p~
8). The column is waæhed with water followed by 0.23
M glycine HCl (pH 2.6) to remove any non-conjugated
antibody or extraneous proteln. The column is then
equilibrated in phosphate buffered saline (pH 7.3)
and the cell culture ~upernatants or cell extracts
eontaining MI~P are slowly paæsed through the
column. The column is then washed with phosphate
buffered sali~e until the optical density (A280)
falls to background7 then the protein is eluted with
0.23 M glycine-HCl (pH 2.6). The protein is then
dialyzed against phosphate buffered salihe.
.
105/GHB25 - 15 - - 18159IA
The conjugates of the present invention may
be any stable polysaccharide-MIEP conjugates, coupled
through bigeneric spacers containing a thioether
group and primary amine, which form
hydrolytically-labile covalent bonds with the
polysaccharide and the MIEP. Preferred conjugates
according to this invention, however, are those which
may be represented by the formulae, Ps-A-E-S-B-Pro or
Ps-A'-S-E'-B'-Pro, wherein Ps represents a poly-
lo saccharide; Pro represents the bacterial proteinMIEP; and A-E-S-B and A'-S-E'-B' constitute bigeneric
spacers which contain hydrolytically-stable co~alent
thioether bondæ, and which form co~alent bonds (such
as hydro-lytically-labile ester or amide bonds~ with
the macromolecules, Pro and Ps. In the spacer,
A-E-S-B, S is sulfur; E ~s the transformation product
of a thiophilic ~roup which has been reacted with a
thiol ~roup, and i~ represented by
wherein R is H or CH3, and p is 1 to 3; A is
-Ch(C~Iz)mY~C~2>n-NH-,
J~
105/GHB25 - 16 - 18159IA
wherein W is O or NH, m is O to 4, n is O to 3, and Y
is CH2,0,S,NR~, or CHC02H, where Rl is ~ or Cl- or
C2-alkyl, such that if Y is CH2, then both m and n
cannot equal zero, and if Y is O or S, then m is
greater than 1 and n is ~reater than 1; and B is
~(cH2)pcl~I(c~I2)qD- ~
Z O
wherein q is 0 to 2, Z is NH2, NH~R~, COOH, or H,
where R' and p are as defined above, and D is ~, NR',
H O O
or N-~(CH2)2~. Then in the spacer, A'-S-E'-B', S
W
i~ sulfur; A' is -~N~(CH2)aR"-, wherein a is 1 to
HOY'
4, and R" is CH2, or N~(CH2)p, where Y' is NH2 or
NHCOR', and W, p and R' are as defined above, and E'
is the transformation product of a thiophilic group
which has been reacted ~ith a thiol group, and ~s
R
represented by -~H-~ wherein R is
as defined above, and B' is -~-, or E' is
o
~ N -.
~
o
.
. , .
~.3
105/G~B25 - 17 - 18159IA
B~ is -(~H2)p~-, wherein p is 1 to 3. Further, of
the bigeneric spacers, A-E-S-B and A~-S-E~-B~, the
E-S-B and A'-S-E~ components are determinable and
quantifiable, with this identification reflecting the
covalency of the conjugate bond linking the side of
the thioethersulfur which originates from the
covalently~modified polysaccharide with the ~ide of
the spacer which originates from the functionalized
lo protein
Then the conjugates, Ps-A-E-S-B-Pro, accord-
ing to this invention may contain spacer3 whose com-
ponents include derivati~es of, intçr ~1~: carbon
dioxide, 1,4-butanediamine, and S-carboxymethyl-N-
acetylhomocysteine; carbon dioxide, 1,5-pentanedia-
mine, and S-carboxymethyl-N-acetylhomocyæteine; carbon
dioxide, 3-oxa-1,5-pentanediamine, and S-carboxy-
methyl-N-acetylhomocysteine; carbon dioxide,
1,4-butane-diamine, and S-carboxymethyl-N-acetyl-
cysteine; carbon dioxide, 1,3-propanediamine, and
S-carboxymethyl-N-benzoylhomocysteine; carbon
dioxide, 3-aza-1,5-pentanediamine, and S~carbogy-
methyl-N-acetylcysteine; and carbon dioxide,
1,2-ethanediamine, glycine, and S-(succin-2-yl)-
N-acetylhomocysteine. The conjugates,
Ps-A'-S-E'-B'-Prs, according to this invention, may
contain spacers whose components include derivative~
of, int-~-F~ alia: carbon dioxide and S-carboxy-
methylcy6teamine; carbon dioxide and S-(a-carboxy-
ethyl)cysteamine; carbon dioxide and S-carbo~y-
methylhomocysteaminc; carho~ dio~ide, S-(succin-2-
yl)cy~teamine, and glycine; and carbon dioxide and
S-carboxymethylcy~tei~e.
105/G~B25 - 18 - 18159IA
In the process of the present invention, the
polysaccharide is covalently-modified by (a)
solubilizing it in a non-hydroxylic organic solvent,
then (b) activating it with a bifunGtional reagent,
(c) reacting this activated polysaccharide with a
bis-nucleophile, and finally, if necessary, further
(d) functionalizing this modified polysaccharide by
either reaction, (i) with a reagent generating
electrophilic (e.g., thiolphilic) sites or, (ii) with
lo a reagent generating thiol groups. The protein is
conversely either reacted (i) with a reagent
generating thiol groups or (ii) with a reagent
generating thiolphilic sites, ~hen the covalently- ~
modi~ied polysaccharide and the functionalized
protein are reacted together to form the stable
covalently-bonded conjugate and the final mixture is
purified to remove unreacted polysaccharides and
proteins.
The process of this invention also includes
selection of a nucleophile or bis-nucleophile which
will react with the acti~ated polysaccharide to form
a covalently-modified polysaccharide with pendant
electrophilic æites or pendant thiol groups, thereby
obviating the need to further functionalize the
bis-nucleophile-modified polysaccharide prior to
reacting the covalently-modified polysaccharide with
the covalently-modified protein. Al~o, the
functionalization of the protein to either moiety
form may be accomplished in more than one step
according to the selection of reactants in these
step~.
105/GB 2S - 19 - 18159IA
In the first step toward covalently-
modifying the polysaccharide, the solid poly-
saccharide must be solubilized.
Since the nucleophilic alcoholic hydroxyl
s groups of a polysaccharide cannot compete chemically
for electrophilic reagents with the hydroxyls of
water in an aqueous solution, the polysaccharide
should be dissolved in non-aqueous (non-hydroxylic)
solvents. Suitable solvents include dimethyl-
formamide, dimethylsulfoxide, dimethylacetamide,formamide, N,N~-dimethylimidazolidinone, and other
similar polar, aprotic solvents, preferably
dimethylformamide.
In addition to the use of these solvents,
converting the polysaccharides (e.g., the capsular
polysaccharides of ~. influenzae type b, which are a
ribose-ribitol phosphate polymers), which have acid
hydrogens, such as phosphoric acid mono- and
diesters, into an appropriate salt ~orm, causes the
~; 20 polysaccharides to become readily soluble in the
above solvents. The acidic hydrogens in these macro-
molecules may be replaced by large hydrophobic
cations, such as ~ri- or tetra-(Cl- to C5)alkyl-
a~monium, l-azabicyclo~2.2.2]octane,19 8-diazabicyclo
[5.4.0]undec-7-ene or similar cations, particularly
tri- or tetra-(Cl- to C5)alkylammonium, and the
resultant tri- or tetraalkylammonium or similar salts
of phosphorylated polysaccharides readily dissolve in
the above solvents at about 17-50C, while being
stirred for from one minute to one hour.
,
2 ~ C~
105/GHB25 - 20 - 18159IA
.
Partially-hydrolyzed ~. influenzae serotype
B polysaccharide has been converted into the
tetrabutyl-ammonium salt, then dissolved in
dimethylsulfoxide (Egan et al., 1- Amer. Chem. ~Q~.,
104, 2898 (1982)), but this product is no longer
antigenic, and therefore useless for preparing
vaccines. By contrast, Applicants accomplish the
solubilization of an intact, unhydrolyzed
polysaccharide by passing the polysaccharide through
lo a strong acid cation exchange resin, in the
tetraalkylammonium form, or by careful neutralization
of the polysaccharide with tetraalkyl-ammonium
hydroxide, preferably by the former procedure, and
thereby preserve the viability o~ the ~olysaccharide
for immunogenic vaccine use.
Subæequent steps are then directed to
overcoming the other significant physico-chemical
limitation to making covalent bonds to poly-
saccharides, that being the lack of fu~ctional groups
on the polysaccharideæ, other than hydro~yl groups,
which are reactive enough with reagents commonly or
practically used for functionalization of units with
which bonding is desired. Acti~ation of the
polysaocharide to ~orm an activated polysaccharide,
reaction with bis-nucleophiles to form a
nucleophile-functionalized polysaccharide, and
functionalization with reagents generating either
electrophilic sites or thiol ~roups, are all directed
~o covalently modifying the polysaccharide and
developi~g functional groups on the polysaccharide in
preparation for conjugation.
~;3~5~ 3
105/GHB25 - 21 - 18159IA
In the next step, the solubilized
polysaccharide i3 activated by reaction with a
bifunctional rea~ent at about 0O-50C, while stirring
for ten minutes to one hour, with the crucial weight
ratio of activating agent to poly~accharide in the
range of 1:5 to 1:12. In the past, this activation
has been accomplished by reaction of the
polysaccharide ~ith cyanogen bromide. ~owever,
derivati~ee activated with cyanogen bromide, ~hich
lo has a "proclivi~y~ for vicinal diols, have shown
transient stability during dialysis against a
phosphate buffer. Therefore, while activation with
cyanogen bromide is still possi~le according to the
present invention, this reagent is poorly utilized in
activation of polysaccharides and is not preferred.
Instead, preferred bifunctional reagents for
activating the polysaccharide include carbonic acid
O
derivatives, R2-~-R3, wherein R2 and R3 may
be independently, azolyl, such as imidazolyl;
halides; or phenyl ester~, such as ~-nitrophenyl, or
polyhalophenyl.
Carbonyldiimidazole, a particularly
preferred reagent, ~ill react with the hydroxyl
groups to form imidazolylurethanes of the
polysaccharide, and arylchloroformate~, including,
for example, nitrophenylchloroformate, will produce
mi~ed carbonates of the polysaccharide. In each
case, the resulting activated polysaccharide is very
æuscep~ible to nucleophilic reagentQ, such as amines,
and is thereby transformed into the respective
urethaneæ.
105/GHB25 - 22 - 18159IA
In the next stage, the activated
polysaccharide is reacted with a nucleophilic
reagent, such as an amine, particularly diamines, for
example, HN(CH2)mY(CH2)n- ~ , wherein m is O to 4, n
is O to 3, and Y is C~2, O, S, NR', CHCO2~, where R'
is H or a Cl- or C2-alkyl, such that if Y i8 C~2 -
then both m and n cannot egual zero, and if Y is O or
S, then m is greater than 1, and n is greater than 1,
in a gross excess of amine (i.e., for example, a 50-
to 100-fold molar excess of amine vs. activating
agent used). The reacgion is kept in an ice bath for
from 15 minutes to one hour then kept for 15 minutes
to one hour at about 17 to 40C.
lS An activated polysaccharide, when reacted
with a diamine, e.g., 1,4-butanediamine, would result
in a urethane-form polysaccharide with pendant
amines, which may then be further functionalized by
acylating. Mixed carbonate~ will also readily react
with diamines to re~ult in pendant amine groups.
Alternatively, the activated polysaccharide
may be reacted with a nucleophile, such a~ a
monohaloacetamide of a diaminoalkane, ~or example,
4-bromoacetamidobutylamine (see, W. B. Lawson e~ al.,
Hoppe SeYler's ~ eiol Chem., 349, 251 (1968)), to
generate a covale~tly-modified poly~accharide ~ith
pendant electrophilic ~ites. Or, the activated
polysaccharide may be reacted with an aminothiol,
~uch as cysteamine (aminoethanethiol~ or cysteine,
examples of derivatives of which are well-known in
the art of peptide æynthesis, to produc~ a
polysaccharide with pendant t~iol groups. In both
105/GEB25 - 23 - 18159IA
cases, no additional functionalization is necessary
prior to coupling the covalently-modified
polysaccharide to the modified bacterial "carrier"
protein.
The last step in preparing the
polysaccharide, the ~urther ~unc~ionali~ation, i~
necessary, of the polysaccharide, may take the form
of either reacting the nucleophile-~unctionalized
polysaccharide with a xeagent to generate
electrophilic (i.e., thiophilic) sites, or with a
reagent to generate thiol groups.
Reagents suitable for use in generating
- electophilic sites, include for example, those for
acylating to a-haloacetyl or a-halopropionyl,
~
derivative 3UC~ as X ~X (wherein R is H or CH3; X is
Cl, Br or I; and X' is nitrophenoxy, dinitrophenoxy,
pentachlorophenoxy, penta~luorophenoxy, halide,
0-(N-hydroxysuccinimidyl) or azido), particularly
chloroacetic acid or a-bromcpropionic acid, with the
reaction being run at a pH of 8 ~o 11 (maintained in
this range by the addition o~ base, if necessary) and
at a temperature of about 0 to 35C, for ten minutes
to one hour, An amino-derivatized polysaccharide may
2s be acylated with activated maleimido amino acids
(see, O. Keller et al, ~Ql~. Chim. ~cta., 58, 531
(1975)) to produce maleimido groups,
O ~
--C(CH2)pN
o
105/G~B25 - 24 - 18159IA
wherein p is 1 to 3; with a 2-haloacetyling agent,
such as p-nitrophenylbromoacetate; or with an
a-haloketone carboxylic acid derivative, e.g.,
o
HO2C ~ CH2Br
(Ber., 67~ 1204, (1934)) in order to produce
appropriately functionalized poly3accharides
susceptible to thio substitution.
Reagents suitable for use in generating
thiol groups include, for example, acylating
reagents, such as thiolactones, e.g.,
CH2)p~
2() 0~\
wherein R4 is Cl- to C4-alkyI or mono- or bicyclic
aryl, such as C~H5 or CloHl3, and p is 1 to 3;
NHCoR5
-03SSCH2(CH2)mCH-COX', wherein m is 0 to 4, R5 is Cl-
to C4-alkyl or C6H5, and X' is as defined above,
followed by treatment with HSCH2CH20~; or
N~co~5
C2~5-S-S-CH2(CH2)mC~C0X', wherein m, R5
2 ~ 3
105/G~B25 - 25 - 181~9IA
and X' are as defined immediately above, then treat-
ment with dithiothreitol. Such reactions are carried
out in a nitrogen atmosphere, at about 0~ to 35C
and at a pH of 8 to 11 (with base added, as
necessary, to keep th pH within this range), for one
to twenty-four hours. For example, an amino-
derivatized polysaccharide may be reacted with
~ COCH3
o~
to produce an appropriately-functionalized polysac-
charide.
By the e steps then, covalently-modified
polysaccharides of the forms, Ps-A-~*- or Ps-A'-SH-,
20 wherein E* i8 -CC~X or
/
--C(CH2)pN
~r
O
and A, A', R, X and p are as defined above, are
produced.
105/G~B25 - 26 - 181~" '3
Separate functionalization of the protein to
be coupled to the polysaccharide, involves reaction
of the protein with one or more rea~ents to generate
a thiol group, or reaction o~ the protein with one or
more reagents to generate an electrophilic (i.e.,
thiophilic) center.
In preparation for conjugation with an
electrophilic-functionalized poly3accharide, the
protein is reacted in one or two steps with one or
lo more reagents to generate thiol groups, such as those
acylating reagents used for generating thiol groups
on polysaccharides, aæ discussed on pages 15-17
a~ove. Thiolated proteins may also be prepared by
aminating carboxy-activated proteins, such as those
shown in Atassi et al., Biochem et Biophys. Acta,
670, 300, (1981), with aminothiols, to create the
thiolated protein. A preferred embodiment of this
process step involves the direct acylation of the
pendant amino ~roups (i.e., lysyl groups) of the
protein ~ith N-acetylhomocysteinethiolactone at about
0 to 35C and pH ~-11, for from five minutes to two
hours, using equiweights of reactants.
- When E'B' is
O
~ 11
~ NCCH2)pC,
O
'vi~
105/G~B25 - 27 - 18159IA
the conditions and method of preparing the
functionalized protein are as discussed above for
preparing the counterpart polysaccharide by reaction
with activated maleimido acids.
In preparing for conjugation with a
covalently-modified bacterial polysaccharide with
pendant thiol groups, the protein is acylated with a
reagent generating an electrophilic center, such
acylating agents including, for example,
0 CH3 0
XCH2~-X' and X~ X', ~herein X and Xl are as
defined above; and
~CO\ O
N(CH2)aC--X~
15 CO /
wherein X' is a~ defined above. Suitable proteins
with elec~ophilic centers al80 include1 for e~ample,
those prepared by acylation of the pendant lysyl
amino groups with a reagent, such a~ activated
maleimido acids ~for example,O
~ 1l ~
~ NOC(CH2)n
O
2 ~
105/GHB25 - 28 - 18159IA
or by reacting the carboxy-act~vated protein with
monohaloacetyl derivatives o~ diamines. In both
preparation reactions, the temperature is from 0 to
350C for from five mi~utes to one hour and the pH is
from 8 to 11.
Formation o~ the conjugate is then merely a
matter o~ reacting any of the covalently-modified
polysaccharides havin~ pendant electrophilic centers
with of the bacterial protein MIEP having pendant
thiol groups at a p~ of 7 to 9, in approximate
equiweight ratios, in a nitrogen atmosphere, for from
six to twenty-four hours at from about 17 to 40C,
to give a covalent conjugate. ~xamples of such
reactions include:
OH O N~COCH3
Ps-CNCH2CH2CH2CH2NHCCH2Br + HSCH2CH2CHCO-Pro >
OH O NHCOCH3
Psl~cH2c~I2cH2cH2N~/~cH2scH~cH2~Hcopro '
wherein an activated polysaccharide which has been
reacted with 4-bromoacetamidobutylamine is reacted
with a pro~ein whieh has been reacted with N-acetyl-
homocysteinethiolactone, to form a conjugate, and:
~ Q ~ v ~ si ~
105/GHB25 - 29 - 1815gIA
OH 11
P9 CN~--NCCH2 N
H~;CH2CH2NHCCH2CH2CPro
PsCNH~' NHCCHz- N~3~ ~cH2cHzNHccH2c}l2cpro
O
(where Y" is a C2-C8alkyl radical), wherein an
20 amino-derivatized polysaccharide which has been
reacted with activated maleimido acids is reacted
with a car~oxy-activated protein which ha~ been
: aminated with an aminothiol, to form a conjugate.
Similarly, any of the covalently-modified
2S polysaccharides with pendant thiol groups may be
reacted with the bacterial protein MIEP having
pendant electrophilic centers to give a covalent
conjugate. An example of such a reaction is:
"
~ 3~
1051GHB25 - 30 - 18159IA
O O O ~
Ps~:N}IcH2cH2sH + Pro~cH2cH2~-N(cH2)4N~coc~2Br
OH OE O O
PS~C~2CH2SCH2~(CH2)4NH~c~2cH2~pr
wherein an activated polysaccharide which has been
reacted with a~ aminothiol is reacted with a
carboxy-activated protein which has been reacted with
monohaloacetyl derivatives of a diamine, to form a
1~ conjugate.
Should the electrophilic activity o~ an
excess of haloacetyl groups need to be eliminated,
reaction of the conjugate with a low molecular weight
thiol, such as n-acetylcysteamine5 will accomplish
this purpose. Use of this r@agent,
n acetylcysteamine, also allows confirmation
accounting of ~he haloacetyl moieties used (see
Section D), because the S-carboxymethylcysteamine
which i~ formed may be uniquely detected by the
method of Spackman, Moore and Stein.
These conjugate~ are then centrifuged at
about lOO,OOO x g using a fixed angle rotor for about
two hour~ at about 1 to 20C, or are submitted to
any of a variety of other purification procedures,
including gel permeatio~, ion exclusion
chromatography, gradient centrifugation, or other
differential ad~orption chromatography, to remo~e
non-covalently-bonded polysaccharides and proteins,
using the coYalency assay for the bigeneric spacer
(see belo~) as a method of following the desired
biological activity.
~ ' .
,
c~
105/GXB25 - 31 - 18159IA
The further separation of reagents may be
accomplished by size-exclusion chromatography in a
column, or in the case of very large, non-soluble
proteins, separation may be accomplished by
ultracentrifugation.
Analysis of the conjugate to confirm the
covalency, and hence the stability of the conjugate,
is accomplished by hydrolyzing (preferably with 6N
HCl at 110C for 20 hours) the conjugate, then
quantitatively analyzing for the amino acid of the
hydrol~tically-stable spacer containing the thioether
bond and constituent amino acids of the protein. The
contribution of the amino acids of the protein may be
removed, if necessary, by comparison with the
appropriate amino acid standard for the protein
involved, ~ith the remaining amino acid value
reflecting ~he covalency of the conjugate, or the
amino acid of the sp~cer may be designed to appear
outside the amino acid standard of the protein in the
analysiæ. The covalency aæsay is also useful to
monitor purification procedures to mark the
enhancement of concentration of the
biologicallyacti~e components. In the above
exampleæ, hydrolysis of
~9~ NHCOC~3
Pæ NCH2CH2CH2CH2NH~C~2SCH2CH~COPro results in the
release of S-carboxymethylhomocysteine,
NH2
~92CCH2SCH2CH2~HCO~H; hydrolysis of
" ~
105/GHB25 - 32 ~ 18159IA
o o IJ
" ~ o o
P~CNHY" NHCCH2 N
~ ~ CH2CH2NHCC~aCH2CPro
S
results in the release of the aminodicarboxylic acid,
Ho2cc~2c~sc~2cH2N~2; and hydrolysis of
H02~
OH OH O O
P3~CH2C~2SC~2~(CH2)4NH~CH2CH2~Pro re~ults in the
release of S-carboxymethylcysteamine,
H2NCH2CH2SCH2CO~H by,cleavage of the Ps-A-~-S-B-Pro
molecule at peptide linkages and other
hydrolytically-unstable bonds. Chromatographic
methods, such as those of Spackman, Moore, and Stein,
may then be conveniently applied and the ratio of
amino acid constituents determined.
Optimal production of IgG antibody requires
collaboration of B and T lymphocytes with specificity
: 25 for the antigen of interest. T lymphocytes are
: incapable of reco~nizing polysaccharides but can
provide help for anti-polysaccharide IgG antibody
: responses if the polysaccharide is covalently linked
to a protein which the T cell is capable of
re~ognizing
.
3~
105/G~B25 - 33 - 18159IA
In mice this requirement exists for
secondary, as well as primary, antibody responses and
is carrier-speci~ic, i.e. a secondary antibody
response occurs only if the T helper cells have
previously been eensitized with the carrier protein
used for the secondary immunization. Therefore, the
ability o~ a mouæe to make a secondary antibody
response to a PRP-pro~ein conjugate is dependent on
the presence of primed T lymphocytes with specificity
lo for the carrier pxotein.
Demonstration of the ability of MIEP to
provide carrier priming for anti-PRP antibody
responses was done in mice adoptively primed with PRP
covalently linked to a heterolo~ous carrier,
diphtheria toxoid ~DT). Adoptive transfer was used
in order to determine whether the administration of
lymphocytes primed with MIEP alone was sufficient to
generate effective helper-T cell activity for
anti-PRP antibody formation in response to PRP-OMPC.
Comparable secondary anti-PRP antibody responses were
elicited by PRP-OMPC when lymphocytes primed with
MIEP or OMPC were transferred, indicating that the T
~ cell recognition of OMPC resides in the~MIEP moiety.
~ P~P-MIEP conjugate~ ~ere tested for
: ~25 immunogenicity in mice as well a~ infant Rhesus
monkeys. The immune response in both o~ these animal
: . models~s~are, with infant humans, a dificiency in
their ability to generate antibody responses against
: T-independent antigens such as bacterial
polysaccharides. These animal are commonly used as
model~ for assessment of the immune re~ponse of
infant humans to various antigens.
;
~ 3
1051GHB25 - 34 - lB15~IA
Likewise, MIEP-peptide conjugates, for
example where the peptide is an HIV principal
neutralizing determinant (PND) peptide, may be
prepared. One method of making such conjugates
includes the formation of a bigeneric spacer between
activated MIEP and activated XIV PND peptides as
described and specifically claimed in copending
application USSN _ , _ (Merck case MRL91/125). The
linker may includ~ a polysaccharide moiety, as
lo described in USSN 55~,558 (Merck case 18068).
The novel conjugate of this invention
comprises MIEP, the major immuno enhancing protien of
the outer membrane protei~ complex (OMPC) of
Neisseria m~nin~ b, covalently linked to ~IV
PND peptides.
The conjugates are prepared by the process
of covalently coupling actl~ated peptide to an
activated protein. ~he peptide and protein
components are separately activated to display either
pendant electrophilic or nucleophilic groups so that
co~alent bonds will form be-tween the peptide and the
protein upon contact.
The covalent conjugate immunogens that
result from the æeries o~ reactions described above
may conveniently be thought o~ as a conjugate in
~hich multiple peptide functionalities are built upon
a ~oundation of MIEP.
When the peptide components of the conjugate
are capable of eliciting HIV neutralizin~ immune
responses, the conjugates of this invention may be
administred to mammals in immunologically effective
amountæ, with or without additional i~munomodulatory,
.
2~5~ s~
105/G~B25 - 35 - 18159IA
antiviral, or antibacterial compounds, and are useful
for inducing mammalian immune responses against the
peptidyl portion of the conjugates, for inducing
EIV-neutralizing antibodies in mammals, or for ma~ing
vaccines for administration to humans to prevent
contraction of HIV in~ection or disease including
AIDS, or for administration to humans afflicted with
~IV infection or disease including AIDS.
In a preferred embodiment, the conjugate of
lo the invention has the general structure:
j(PEP-A-)-MIEP
or pharmaceutically acceptable salts thereof, wherein:
PEI is an HIV PND peptide, or a peptide capable o~
raising mammalian immune responses which
recognize HIV PNDs;
MIEP is an immunogenic protein of the outer membrane
protein complex ~OMPC) of Neisseria meningitidis
b either ~ecombinatly produced or purfied from
~MPC;
-A- is a covalent linkage, preferably a bigeneric
spacer;
i is the percentage by mass of peptide in the
: coconjugate, and ic preferably bet~een 1% and
50% of the total protei~ mass in the conjugate.
The conjugate of the lnvention may be
prepared by any of the common methods known in the
art for preparation of peptide-protien conjugates,
such as, ~or example, the bi~eneric chemistry
disclo~ed in U.S. patent 4,695,624 and Marburg et al.
-
~ 3 ~
105/G~B25 - 36 - 181S9IA
J.A.C.S. 108, 5282 (1986), and in Applications USSN
362,179; 55,558; 55~,974; 555,966 and 555,339. In a
preferred embodiment, a process that utilizes the
available nucleophilic functionalities, ~ound in
proteins, such as the amino group of lysine, the
imidazole group of histidine, or the hydroxyl groups
of serine, threonine, or tyrosine is used. In
practical terms, the number of available protien
necleophilic sites may be determined by an
appropriate as~ay which may comprise thiolation with
N-acetyl homocysteine thiolactone, ~ollowed by Ellman
Assay [Ellman, G.L., Arch. B~ochem. Biophys., 82, 70
(1959)] for determination of total free sulfydryl
groups and/or by alkylation with a bromoacetyl amino
acid, assayable by amino acid analysis.
The preferr~d process can be carIied out in
several ways in which the sequence, method of
activation, and reaction of protein and peptide
groups can be varied. The process may compri~e the
~tep~ of:
Proces~_l:
la. reacting the protein nucleophilic groups
with a reagent, for example with N-acetyl
homocysteine thiolactone, which generate~ thiol5 groups on the protein; and
lb. reacting the product of ætep la. with
peptides previously deriva~ized ~o as to append an
electrophilic group prefera~ly comprising moleimide,
on the peptide. A preferred embodiment of this
invention, which may be prepared according to this
process, has the structure:
~'J
lOS/GHB25 - 37 - 18159IA
MIEP -(NH-C-R-~
O ~ N-R-C-N,-PEP)~
R O O H
or pharmaceutically acceptable saltg ~hereof,
~ lo wherein:
:~ : PEP, MIEP, and j, are as defined supra;
: -R- is:
a) -lower al~yl-,
b) -substituted lower alky-,
: : c~ -cycloalkyl-, -
: : d) -substituted cyloalkyl-,
e) -phenyl-;
20 _~1 is:
a) -hydrogen,
; :~ b) -lower alkyl, or
c) -S03E; and
~ 25 -S- is ~ulfur.
: : Li~ewise, a preferred embodiment of the
invention~having the structure:
MIEP-(~DH-C -R : O
O N
O ~ -PEP)~
R1
- ` '
'
~ 33'
105/G~B25 - 38 - 18159IA
wherein all variables are as defined above, may be
prepared by process 2, which comprises the steps of:
~ a. reacting the protein nucleophilic groups
wi~h a bifunctional e~ectrophilic reagent, such as
maleimidoal~anoic acid hydroxysuccinimide ester, so
as to generate an electrophilic protein; and
2b. reacting the product of step 2a. with a
peptide containing a nucleophile, such as a thiol
group.
A highly preferred embodiment o~process 1,
is described in detail below and in Scheme A.
According to the scheme, the immu~ogenic protein is
the class II protein of the outer membrane protein.
complex (OMPC) of Neisserla meningi~idis b, either
purified from the bacterial membrane or produced by
recombinant means. The process comprises the s~eps
of:
a.i. reacting MIEP (I), having nucleophilic groups,
including free amino groups due to the presence of
lysineæ or protein amino-termini, with a thiolatin~
agent, preferably N-acetyl homocy~teine thiolactone,
to generate MIEP (II) having "m" moles of ~ulfhydryl
groups available for reaction with a thiophile; a.ii.
quantitating the number of available sulfhydryl3
appended to MIEP in step la.i. to determine the value
of ~m", preferably by Ellman assay ~Ellman, &.L.,
Ar~h. Biochem. Biochem. Biophy~., 8~, 70 (19~9)]; and
b contactin~ the product of step a. ~ith an exces~,
(>m), of an HIV PND ~hich has been previously
derivatized so as to append an electrophilic group,
preferably w;th a maleimido-al~anoic acid, and moæt
preferably with maleimido-propionic acid (this
J ~
105/G~B25 - 39 - 18159IA
derivatization is acnieved by N-protecting all amino
groups on the peptide that should not be derivatized,
and reacting the free peptide amino groups with a
bifunctional reagent, preferably
maleimidoalkanoyloxysuccinimide, and most preferably
maleimidopropionyloxysuccinimide), to generate the
conjugate of this invention (III).
The conjugate product may be purified by,
for example, dialysis in a buffer having an ionic
strength between O.OOlM and l~ and a pH between 4 and
11, and most preferably in an agueous medium having
an ionic strength of between 0.01 and O.lM and a pH
of between 6 and 10.
.
.,,
, . ~
2 ~
105/GHB25 - 40 - 18159IA
SCHEME A
EP
NH- COC~33
0~ .
II.
Ml EP-( NH C~/S~ m
O NH-COCH3
[R J$~ I>m
. O
: ::
: ::
~ :
OC~
MIEP~ C--f
~ ~ ~ 0 ~ ~ CH2] 2- s~
:: ~ 3 D R1 4~1 I Nl PDP~ m
~ O
:
.
7 ; :` '
':
' . : ,
" ' ' ' ' ' '~ '' , '" ~ ' :
:
,
105/G~B25 - 41 - 18159IA
The process described above and depicted in
Scheme A may be modified so that MIEP is derivatized
so a~ to be covalently linked to a thiophiIe, such as
a derivative of maleimide, while the peptide is
activated so as to be covalently linked to free
sulfhydryls. This and other alternate processes,
naturally fall within the scope of this disclosure,
including variations on these processes, such ~s
variations of sequence of reaction of activated
lo species, or ratios of reactants.
The process for making the conjugates of
this invention may be applied to making any conjugate
wherein a peptide-protein conju~ate is desired and is
particularly significant where enhanced
immunogenicity of the peptide is required.
The conjugates herein described may be
included in compositions containing an inert carrier
and are useful when appropriately ~ormulated as a
vaccine. This may include prior adsorption onto alum
or combination with emulsifieræ or adjuvants known in
the art of vaccine formulation. Methods of using the
covalent conjugate immunogens of thi~ invention
include: (a) uBe as a laboratory tool to characterize -
~IV PND peptide structure-function relationships; (b~
use as a~ immunogen to rais ~IV-neutralizing
antibodies in a mammal which antibodies may be
isolated and administered to a human so as to preven~
infection by HIV, or to limit HIV proliferation
post-infection, or to treat humans afflicted by ~IV
in~ection or disease including AIDS. (c) use as a
vaccine to immunize humanY against infection by HIV
or to treat humans po~t-infection, or to boost an
HIV-neutralizing immune response in a human a~flicted
with HIV infection or disea~e including AID~.
,
105/G~B25 - 42 - 18159IA
As a laboratory tool, the conjugate is
useful when adminiætered to a mammal in an
immunologically effective amount, to generate
anti-PND peptide, anti-HIV, or HIV-neutralizing
immune responses. The mammal may be boosted with
additional conjugate to elevate the immune response.
Antiserum is obtained from such a mammal by bleeding
the mammal, centriPuging the blood to separate the
cellular component from the serum, and isolating
lo antibody proteins from the serum if necessary,
according to methods known in the art. Such
antiserum or antibody preparations may be used to
characterize the efficacy of an HIV PND peptide in a
conjugate in raising mammalian anti-PND peptide,
anti-HIV, or HIV-neutralizing antibodies in a
mammal. ELISA assays using the unconjugated peptide
and the antiserum are useful in Yi~ro assays for
measurin~ the elicit~tion of anti-peptide
antibodies. An in vitro assay for measuring th~
~IV-neutralizing ability of antiserum comprises
incubating a preparation of live ~IV with a
preparation of the antiserumt then incubating the
antiserum-treated ~IV preparation with CD4 receptor
bearing cells, and measuring the extent of cellular
2~ protection afforded by the antiserum. These assays
and the characteristics of antiserum produced by a
given conjugate may be used to study ~he PND peptide
stucture-function relationship.
The conjugate is useful for inducing
mammalian antibody responses as described in the
previous paragraph, and such antibodies may be used
to passively immu~ize humans to prevent ~IV
infection, or to limit HIV proliferation
post-infection, or to treat humans aiflicted with HIV
infection or di~ease including AIDS.
~ ~ ~,7
105/G~B25 - 43 - 18159IA
The conjugate is useful as a vaccine which
may be administered to humans to prevent ~IV
infection or proliferation, or to humans suffering
from ~IV disease of HIV infection, including AIDS and
related complexes, or to humans testing seropositive
for the ~IV virus. The conjugate may be administered
in conjunction with other anti-HIV compounds, such as
AZT, or more general anti-viral compounds, or in
conjunction with other vaccines, antibiotics, or
immunomodulators (see Table I below).
The form of the immunogen within the vaccine
takes various molecular configurations. A single
molecular species of the antigenic conjugate III will
often suffice as a use~ul and suitable antigen for
the prevention or treatment of ~IV disease including
AIDS or ARC. Other antigens in the form of cocktails
are also advantageous, and consist of a mixture of
conjugateæ that differ by, for example, the mass
ratio of peptide to total protein. In addition, the
conjugates in a mixture may differ in the amino acid
se~uence of the PND.
An immunological vector, carrier or adjuvant
may be added as an immunological vehicle according to
conventional immunological testin~ or practice.
Adju~ants may or may not be added during the
preparation o~ the vaccines of this invention. Alum
is t~e typical and preferred adjuvan~ in human
vaccines, especially in the form of a thixotropic,
viscous, and h~mogeneows aluminum hydroxide gel. For
example, one embodiment of the present invention is
the prophylactic vaccination of patients with a
suspension of alum adjuvant as ~ehicle and a cocktail
of conjugates a8 the selected set of immunogens or
antigens.
.
105/G~B25 - 44 - 18159IA
The vaccines of this invention may be
effectively administered, whether at periods of
pre-exposure or post-exposure, in combination with
effective amounts of the AIDS antivirals, immuno-
modulators, antibiotics, or vaccines of Table I
~source: Market Letter, No~. 30, 1987, p. 26-27;
Genetic En~ineering News, Jan. 1988, Vol. 8, p. 23.]
TABL~ Il
A. Antivirals
Drug Name Manufacturer Indication
AL-721 Ethigen ARC, PGL
BETASERON Triton Biosciences AIDS, ARC, KS
(interferon beta)
CARRISYN Carrington Labs ~RC --
(polymannoacetate)
CYTOVENE Syntex CMV
~ganciclovir)
25 DDC Hoffmann-La Roche AIDS, ARC
~dideoxycytidine)
FOSCARNET Astra AB HIV inf, CMV
(triæodium retinitis
phosphonoformate)
~PA-23 Rhone-Poulenc Sante ~IV infection
~ J~s~
105/G~B25 - 45 - 18159IA
__________________________________ ___________________
lAbbreviations: AIDS (Acquired Immune Deficiency
Syndrome); ARC (AIDS related complex); CMV (Cytomegalo-
virus, which causes an opportunistic infection resulting
in blindness or death in AIDS patients); ~IV (~uman
Immunodeficiency Virus, previously known as LAV, ~TLV-III
or ARV); KS (Kaposi's sarcoma); PCP (Pneumonocystis
carinii pneumonia, an opportunistic infection); PGL
(persistent generalized lymphadenopathy).
Drug Name ~anufac~urer Indication
ORNIDYL Merrell Dow PCP
(eflornithine)
PEPTIDE T Peninsula Labs AIDS
(octapeptide
sequence)
RETICULOSE Advanced Viral AIDS, ARC
(nucleophospho- Research
protein)
25 IR Burroughs Wellcome AIDS, advanced
(zidovudine; ARC
AZT) pediatrlc AIDS,
gS, asympt ~IV,
less severe ~IV,
neurological in-
volvement.
~ ~ ~S tJ ~,3 ~j r5_~
105/GHB25 - 46 - 18159IA
RIFABUTIN Adria Labs ARC
(ansamycin LM 427)
(trimetrexate) Warner-Lambert PCP
UAOOl Ueno Fine Chem AIDS, ARC
Industry
VIRAZOLF. Viratek/ICN AIDS, ARC, KS
(ribavirin)
~ELLFERONBurroughs Wellcome KS, EIV, in comb
(alfa interferon) with RETROVIR
15 ZOVIRAXBurroughs Wellcome AIDS, ARC, in
(acyclovir)comb with
RETROVIR
20 B. Immunomodulatoræ
Drug Name ~n~lB~ Indica~iQp
ABPP Upjohn Advanced AIDS, KS
(~ropirimine)
AMPLIG~N DuPont ARC, PGL
(mismatched RNA~ ~EM Re~earch
(Anti-human alpha Advanced Biotherapy AIDS, ARC, KS
3D interferon Concepts
antibody)
J .f c~
105/GHB25 - 47 - 18159IA
Colony Stimulating Sandoz Genetics AIDS, ARC, HIV,
Factor ~GM-CSF) Institute KS
CL246,738 American Cynamid AIDS
~CL246,738)
IMREG-l Imreg AIDS, ARC, PGL,
KS
10 IMREG-2 Imreg AIDS, ARC, PGL,
KS
IMUIHIOL Merieux Institute AIDS, ARC
(diethyl dithio
carbamate)
IL-2 Cetus AIDS, KS
(interleukin-2)
20 Drug Name ` Ma~ufa~t~ Indication
IL-2 Hoffmann-La Roche AIDS, KS
(interleukin-2) Immunex
INTRON-A Schering-Plough KS
(intexfersn alfa)
ISOPRINOSIN~ Newport ARC, PGL, EIV
(inosine pranobex) Pharmaceuticals seropositive
patients
(methionine TNI AIDS, ARC
enkephalin) Pharmaceuticals
105/GHB25 - 48 - 18159IA
MTP-PE Ciba-Geigy KS
(muramyl-tripep-
tide)
THYMOPENTIN (TP-5) Ortho HIV infection
(thymic compound) Pharmaceuticals
ROF~RON ~offmann-La Roche KS
(interferon alfa)
(recombinant Ortho severe anemia
erythropoietin) Pharmaceuticals as~oc with AIDS
& RETROVIR
therapy
TREXAN DuPont AIDS, ARC
(naltrexone)
TNF (tumor Genentech ARC, in combination
20 necrosis factor) inter~eron gamma
C. Antlbi,Qtics
PENTAM 300 LyphoMed PCP
(pentamidine
iæethionate~
D. Vaccine~
30 Gag Merck AIDS,ARC
, v
105/G~B25 - 49 - 18159IA
It will be understood that the scope of
combinations of the vaccines of this invention with
AIDS antivirals, immunomodulators, antibiotics or
vaccines is not limited to the list in the above
Table, but includes in principle any combination with
any pharmaceutical composition useful for the
treatment of AIDS. The AIDS or HIV vaccines of this
invention include vaccines to be used pre- or
post-exposure to prevent or treat HIV infection or
disease t and are capable of producing an immune
respo~se specific for the immunogen.
The conjugates of this invention, when used
as a vaccine, are to be administered in
immunologically ef~ective amounts. Dosages of
between 1 ~g and 500 ~g of conjugate protein, and
preferably between 50 ~g and 300 ~g of conjugate
protein are to be ad~inistered to a mammal to induce
anti-peptide, anti-HIV, or HIV-neutraliæing immune
responses. About two weeks after the initial
administration, a booster dose may be administered,
and then again whenever serum antibody titers
diminiæh. The conjugate should be administered
intramuscularly or by any other convenient or
efficaciou route, at a concentratio~ of between 10
~g/ml and 1 mg/ml, and preferably between 50 and 500
~g/ml, in a volume sufficient to make up the total
required for immunological efficacy. The conjugate
may be preadsorbed to aluminum hydroxide gel or to
the Ribi adjuvant (GB 2220211A, US priority document
Z12,919 filed 29/06/1988) and suspended in a sterile
physiological ~aline solution prior to injection.
105/G~B25 - 50 - - 18159IA
The protein moiety should behave as an
immune enhancer. It is desirable, in the choice of
protein, to avoid those that result in non-specific
activation of the recipient's immune response
(reactogenicity). In U.S. Patent 4,695,624, Marburg
et al. used the outer membrane protein complex (OMPC)
derived from Neisseria meningitidis to prepare
polysaccharide-protein conjugates. OMPC has proven
to ~e suitable though other immunogenic proteins may
lo be used. The instant invention utiliæes the Class II
major immune enhancing protein (MIEP) of OMPC.
Various methods of purifying OMPC from the
gram-negative bacteria have been devieed tFrasch et
al., J. E~p. Med. 140, 87 <1974); Frasch et al., J.
Exp. Med. 147, 6~9 (1978)i Zollinger et al., US
Patent 4,707,543 (1987); ~elting ~ al., Acta Path.
Microbiol. Scand. Sect. C. 89, 69 (1981); Helting et
al., US Patent 4,271;147]. OMPC may be used herein
essentially according to the Helting proces3, from
which MIEP may be further purified [Murakami, K., et
al., Infection and I~m~nitv. 57, 2318 (1989)3, to
provide i~mune enhancement necessary to induce
mammalian immune responses to HIV PND peptides. MIEP
may be derived by diæsociation of the isolated OMPC,
or alternatively, produced through recombinant
e~pr~ssion of the desired immuno~enic portions of
OMPC. Methods of preparing and using an OMPC æubunit
~re disclosed in co-pending US application serial
Nos. 555,329; 555,978; and 555,204 (Merck Case #'s
18159, 18110, and 18160 respectlvely).
.
, .
~ Y~ f~ 3
105/G~B25 - 51 - 18159IA
The HIV PND peptides that may be used for
making species of the conjugate of this invention may
be linear or cyclic peptides. The linear peptides
may be prepared by known solid phase peptide
synthetic chemistry, by recombinant expression of DNA
encoding desireable peptide sequences, or by
fragmentation of isolated ~IV proteins. Cyclic ~IV
PND peptides may be prepared by cyclization of linear
peptides, for example (a) by oxidizing peptides
lo containing at least two cysteines to generate
disulfide bonded cycles; (b) by forming an amide
bonded cycle; (c) by forming a thioether bonded
cycle. Processes for making such peptides are
described herein but this description should not be
construed as being exhaustive or limiting. The
conjugates of this invention are u~eful whe~ever a
component peptide is an ~IV PND ~r i~ capable of
priming mammalian im~une response3 which recognize
HIV PNDs.
PND peptides, both thoæe known in the art
and novel compoundæ disclosed herein and separately
claimed in co-pending U.S. Application Serial Nos.
555,112 and 555,227, (Merck Caæe Nos. 18149, and
18150) and co~iled U.S. application _ , _ (Merck
2s Case Nos. 1806~IB~ are defined as peptidyl ~equence~
capable of inducing an ~IV~neutralizing immune
response in a mammal, including the production of
IV-neutralizing antibodies.
: - :
~ ~ P~J ~
105/GHB25 - 52 - 18159IA
A major problem overcome by the instant
invention is the ~IV interisolate sequence
variability. For example, in the PND which occurs in
the third hypervariable region of gpl20 (see below),
although certain amino acids have been found to occur
at given locations in a great many iæolateæ, no
strictly preserved primary sequence motif exists.
This di~ficulty is surmounted by this invention
because it allows conjugation of a eocktail o~
peptides having PND sequences from as many different
~IV iæolates as necessary to attain broad
protection. Alternatively, a broadly protective
cocktail Qf conjugates may be prepared by mixing
conjugates, each of which is prepared separately with
a peptide moiety providing protection against a
single or several ~IV isolates.
The amino acids found near or between amino
acids 296 and 341 of gpl20 have been shown to meet
the criteria which define a PN~. In the IIIB iæolate
of HIV, a 41-amino-acid sequence has been reported as
follows (SEQ ID~
-Ile Asn Cys Thr Arg Pro Asn Asn Asn Thr Arg Lys Ser
Ile Arg Ile Gln Arg Gly Pro Gly Arg Ala Phe Val Thr
Ile Gly Lys Ile Gly Asn Met Arg Gln Ala ~iæ Cys Asn
Ile Ser-, with the two cysteines being disulfide
bonded to each other to form a loop. The trimer -Gly
Pro Gly- iæ exposed at the PND loop tip. Peptides
from di~ferent HIV isolates from this same region of
gpl20 raise isolate-specific neutralizing antibodies
30 when presented to goat and guinea pig immllne systems
as conjugate with keyhole-limpet hemocyanin. The
major neutralizing epitope within the 41-mer
~3~J~1, ,
105/GHB25 - 53 - 18159IA
sequence, presented above, is comprised by the eight
amino acids æurroundi~g and including the -Gly Pro
Gly- trimer ~Javaherian et al., ~NAS USA 86, 6768
(1989)]. In Table II below a number of linear
peptides of different length and composition that can
be used to prepare the conjugates of this invention
are presented. The name o~ the isolate containing a
peptide having the sequence of the tabulated peptide
is given, along with a name herein ascribed to that
lo peptide for ease of reference. The letter r- on the
left hand side of each peptide represents the
possibility of linking the peptide to an immunogenic
protein, such as the MIEP at that posi~ion. In
addition, marker amino acids, such as norleucine and
ornithine may form part of r-.
TABLE II
LINEAR ~IV P~ e~LDES
HIV SEQ ID
20 Isolate Peptid~ ~equence ~ame N0:
MN r~Tyr Asn Lys Arg Lys Arg PND142 2
Ile His Ile Gly Pro Gly
Arg Ala Phe Tyr Thr Thr
Lys Asn Ile Ile Gly Thr
SC r-Asn Asn Thr Thr Arg Ser PND-SC 3
Ile His Ile Gly Pro Gly Arg
Ala PheTyr Ala Thr Gly Asp
Ile Ile &ly Asp Ile
105/GHB25 - 54 ~ IA
IIIB r-Asn Asn Thr Arg Lys Ser Ile PND135 4
Arg Ile Gln Arg Gly Pro Gly Arg
Ala Phe Val Thr Ile Gly Lys Ile
Gly Asn
S
IIIB r-Arg Ile Gln Arg Gly Pro Gly PND135-18 5
Arg Ala Phe Val Thr Ile Gly Lys
Ile Gly Asn
lO IIIB r-Arg Ile Gln Arg Gly Pro Gly PND135-12 6
Arg Phe Val Thr
MN r-His Ile Gly Pro Gly Arg Ala PND-MN8 7
Phe
1$ MN r-Gly Pro Gly Arg Ala Phe PND-MN6
LAV-l r-Ile Gln Arg Gly Pro Gly Arg PND-LAV-l 9
Ala Phe
20 SF2 r-Ile Tyr Ile Gly Pro Gly Arg PND-SF2 lO
Ala Phe
NY5 r-Ile Ala Ile Gly Pro Gly Arg PND-NY5 11
Thr Leu
2~
CDC4 r-Val Thr Leu Gly Pro Gly Arg PND-CDC4 12
Val Trp
RF r-Ile Thr Lys Gly Pro Gly Arg PND-RF 13
Val Ile
: ,
- ~ . .
,
.
~ ~? ~
105lGHB25 - 55 18159IA
ELI r-Thr Pro Ile Gly Leu Gly Gln PND-ELI 14
Ser Leu
Z6 r-Thr Pro Ile Gly Leu Gly Gln PND-Z6 15
Ala Leu
MAL r-Ile His Phe Gly Pro Gly Gln PND-MAL 16
Ala Leu
lD Z3 r-Ile Arg Ile Gly Pro Gly Lys PND-Z3 17
Val Phe
This liæt is n~t an exhaustive list of
possible PND sequences. Rather, i~ i~ provided as a
suggestive and illustrative guide as to useful PND
primary seguences. Therefore, peptides conjugated as
; herein described to form the immunogen of this
invention are any of the tabulated peptides or
immunologically-equivalent variants on the theme
sugge~ted by these peptidyl sequences. The nature of
the variations is considered next.
The primary sequence of this HIV PND appears
to ha~e a conserved core amino acid sequence,
comprised by the tetramer sequence -Gly Pro Gly Arg-,
(SEQ ID: 18:~ rJith: increaciD~ divergence on either
side of thi~ sequence among ~IV isolates. Some
isolates have ~equence that diverge even within the
tetramer, having -Gly Pro Gly Lys- (SEQ ID: 19:),
-GIy Pro~Gly Gln- (S~Q ID :20::), and even -Gly Leu
Gly Gln- (SEQ ID: 21) core sequences. All of these
possible sequences come within the scope of this
disclosure as bei~g ~eptide ~equences that are
advantageous ~or conjugation according to this
invention.
,
105/GHB25 - 56 - 18159IA
The length of the peptide i~ a significant
factor in promoting cross reactive immune responses.
That is, an immune response raised against a given
peptidyl epitope may recognize similar epitopes from
the same or different EIV isolate based on the number
of amino acids in the epitope over and above the
critical neutralizing epitope. In addition, the
length of the peptide is also responsible for
determining the probability of exposure to the immune
lo system of the determinant responsible for generating
an HIV-neutralizing response.
In order to maximize the probability of
relevant epitope preRentation, chemistry was
developed whereby the PND peptides may be locked into
a given three-dimensional configuration. It is known
that the 41-amino-acid PND o~ the HIV IIIB isolate,
represented above, is configured as a loop by the
presence of the cysteine-to-cysteine disulfide bond.
Diæulfides, however, may be labile under certain
conditions and therefore may allow the loop to open
and the peptide to exi~t in a linear form.
Therefore, in addition to linear peptides,
disulfide-bonded cyclic peptides and novel ~IV PND
peptides havin~ nonlabile cyclic structures disclosed
herein but ~eparately claimed as free peptides in
: co-pending US application æerial NOR, _,_
(co-filed Merck case 18068IB); 555,112 and 555,227,
may all be utilized as the P~P component in the
formation of the conjugates of this invention.
The peptides that may be used in formation
of these conjugates may be derived as fragments of
natural prsteins (gpl20 for example), by recombinant
~;
105/G~B25 - 57 - 18
expression of portions thereof, or by chemical
synthesis according to known methods in the art. In
addition, novel cyclic PNDs may be prepared
synthetically according to the processes herein
described. The sequences may contain both natural
L-amino acids, or unusual or D-amino acids. In
addition, the conjugation chemistry is sufficiently
flexible so that the appropriate choice of peptide
derivatization reagents allows for successful
lo conjugation,
Synthetic peptides have been prepared by a
number o~ strategies conducted either in solution or
on solid support~. Excellent texts covering the
basic principles and techniques are: Principles of
Peptide Synthesis, Bodansæky. M., Springer-Verlag
(1984); Soli~ Phase Peptide Syn~hesis, Stewart J.
M., Young, J. D., Pierce Chemical Çompany (2nd. ed.
1984); and The Peptides, Gross, E., Meienhofer, J.,
Academic Press, Inc., (1979). The processes
described herein, however, are not limited to the
disclosure of these texts.
Synthetic cyclic peptides may be prepared in
two phases. First, the linear peptide may be
synthesized on Milligen 9050 peptide or an A$I 431A
synthesizer using 9-fluorenylmethyloxy-carbonyl
(Fmoc) chemistry and side-chain-protected Fmoc-amino
acid pentafluorophenyl ester~ which are known
reagents or using derivatized Wang resin, Fmoc
chemistry, and ~ide-chain protected Fmoc-amino acid
symmetrical anhyd rid es, prepared in situ, as rea~ents.
:
105/G~B25 - 58 - 18159IA
Second, the linear peptide may be cyclized,
either in solution or with the peptide ~till attached
to the solid phase resin. Cyclization may be
accomplished by any technigue known in the art, which
may comprise, for example: a) incorporating cysteine
residues into the linear peptide on either end of the
sequence which is to form the loop and allowing
disulfide bond formation under oxidizing conditiona
known in the art; b) preparing a cyæteine containing
peptide as in (a) but retaining the cysteines as free
sulfhydryls (or as Acm protected thiols ~hich are
deprotected to the free sulfhydryls) and trea~ing the
peptide with o-xylylene dibromide or similar reagent,
such as the diiodide, dichloride, or a dihalogenated
straight or branched chain lower alkyl having between
two and eight carbon atoms; such reagents react with
the sulfur atoms of the cysteines to form a cyclic
structuxe containing two nonlabile thioether bonds to
the benzene or the alkyl; c) allowing a free group
2~ on one æide of the loop amino acid~ to become amide
bonded to a f ree carboxyl group on the o~her ~ide of
the loop amino acids through DPPA, BOP, or æimilar
reagent mediated peptide bond formation. Each of
these strategies i~ taken up in more detail below,
after presentation of a generalized description of
the cyclic peptide~ produced by theæe methods.
Thus, without limiting the conjugate
invention to the following peptides or methods of
producing them, the PND peptides which may be
conjugated after removal of appropriate protecting
groups aæ nece~sary, according to this invention
include those represented by the structure PEP, which
includes the linear peptides of Table II above and
cyclic peptides:
105/G~IB25 - 59 18159IA
~Pr o -Gly
Rl ~ R8 1~ ~ /2 Y h3-R4-R5
R6_______________R7
wherein:
r is the position of linkage ~etween PEP and
MIEP, optionally comprising a marker
1~ amino acid, if Rl i5 not a marker amino
acid;
.
Rl is:
a) a bond, or
b) a peptide of 1 to 5 amino acids,
optionally including a marker ami~o
acid which migrates at a positio~ in
the amino acid analysis spectrum which - -
is isolated ~rom the ~ignal of the 20
naturally occuring amino acids;
- preferably norleucine,:gamma
aminobutyric acid, ~-alanine, or
ornithine;~
2s ~2 i~ ~
~: a) either a bond or a peptide of up to 17
amino acids if R3 i s ~a peptide O:e at
:: 1 east 2 amino acids, or~ :
b) a pe~tide o~ between 2 to 17 amino
acids, if R3 is a bond;
.
:
'' :
105/GHB25 - 60 - 18159IA
R3 is:
a) either a bond or a pep~ide of up to 17
amino acids if R2 is a peptide of at
least 2 amino aclds, or
b) a peptide of between 2 to 17 amino
acids, if R2 is a bond;
R4 is:
a) -NH-~H-CO-, with R7 bonded to the methine
carbon, if R7 is R8, or
b) a bond from R3 to R7 and R5, if R7 is
carbonyl or -COCH2CH2CH~CONE2)N~CO-;
R5 is:
a) a peptide of one to five amino acids,
optionally including a marker amino
acid,
b) -OH,
c) -COOH,
d) -CON~2~
e) -NH2~ or
f) -absent;
R~ is:
` a~ an amino acid side rhain, selected from
the æide chain of any of the common L
or ~ amino acids, (see table of~
Definitios and Abbre~iations), if the
optional bond (~ -- ) to R7 i~
absent,
b) -R8-S-S-, or -R8-S-R~-R9-R~-S-, if R7
is R8, or
.
p~
105iGHB25 - 61 - 18159IA
c~ ~8_NH_ i~ R7 is
-C-O, OR -C-CH2-C~2-\~-NH-C=O;
CONH~
R7 is:
a) -R8_,
b) -C=O, or
c) -I~-CH2-CH2-CH-NH-C=O;
~OM~2
R8 is a bond or lower alkyl of between one and eight
carbons;
R9 is:
a) R10 or
b) xylylene
~10 is:
a) lower alkyl, or
b) -~2--~2-; and
every occurrence of a variable is independent of
every other occurrence of the same variable. When a
peptide haæ been synthesized with a protected amino
terminal amino acid, the amino termi~al pro~ecting
group:such as benzylo~y carbonyl (Z) for protecting
amines, or acetamidomethyl (Acm~: for protecting
sulfhydryls, may be removed~according to methods
known in the art and exemplified herein. The
deprotected group thus revealed may be utilized in
co~alent bond formation, through the linker r, ~o the
immunogenic protein.
' ~ .
. " . '~
n ~, .v
105/G~B25 - 62 - 18159IA
Hereinafter, amino acids -R2-Gly Pro Gly
Arg-R3-, which form the "core" of the PND peptides,
and go toward formation of the loop of a cyclic
peptide, will be referred to as loop or core amino
acids. When the optional bond between R6 and R7 i~
ab~ent however, the structure, P~P, is linear, and
encompasses all of the linear peptides of Table II.
Whether the peptide is linear or cyclic, the
amino acid sequences comprising R2 and R3 of PEP may
be any combination of amino acids, including
sequences surrounding the core -Gly Pro Gly Arg-
tetramer in any of the sequences of Table II. Thus,
the core amino acids represented by -R2-Gly Pro Gly
Arg-R3- may be further defined as having the core
15 amino acid structure:
-xnxlX2-Gly Pro Gly Arg~X3~4~m~
wherein:
Xl is a constituent of R2 selected from:
a) serine,
b) proline,
c) arginine,
d) histidine,
e) glutaminej or
f) threonine;
X2 is a constituent of R2 selected from:
a) isoleucine,
b) arginine,
c) valine, or
d) methio~ine;
~ ~ r.~ ~ _, ,., r,,
105/GHB25 - 63 - 18159IA
Xn is is a constituent ~f R2 and is either a bond or
a peptide of up to 15 amino acids;
X3 is a constituent of R3 selected from:
a) alanine~
b) arginine, or
c) valine;
X4 is a constituent o~ ~3 and is selected from:
lo a) phenylalanine,
b) isoleucine,
c) valine, or
d) leucine;
Xm is a constituent of R3 and is a bond or a peptide
f up to 15 amino acids.
The cyclic peptides may be disulfide bonded
structureæ OI a cycle formed through a nonlabile bond
or structure. The term "nonlabile bond" means a
covalent linXage, other than a disulfide bond.
Examples of such nonlabile bonds are amide and
thioether bonds as disclosed in co-pending
applications USSN 555,112 and 555,227. These
covalent linkages may be through a bridge structure,
2~ ~ueh as xylylene, through a lower alkyl, through
-C~2-0-C~2, or through an ami~o acid amide bonded
bridge. By altering the bridge structure and/or the
number and eombination of aminQ aeids included in the
peptide, the con~ormation of the loop structure o~
the cycle may be optimized, allowing for fine-tuning
of the PND epitope presented to ~he immune ~ys~em.
: For example, use of an o xylylene bridge generate~ a
; ~ . . ~ ' ' ,
' ' '
.~ ,, J, - ,~
105/G~B25 - 64 - 18159IA
"tighter" loop structure than when, for example, an
eight carbon strai~ht chain lower alkyl i8 used as
the bridge. Thus, the conjugates of this invention
are useul both as reagentæ to analyze the
structure-~unction relationship of the PND epitope in
raising anti-peptide, anti-HIV, HIV-neutralizing, and
anti-AIDS immune reæponses in mammals, and as
components for formulation of anti-~IV disease,
including AIDS, vacclnes.
lo Synthetic products obtained may be
characterized by fast-atom-bombardment mass
spectrometry [FAB-MS~, reverse phase ~PLC, amlno acid
analysis, or nuclear magnetic resonance spectroscopy
(NMR) .
a. Cyclic Peptides through Disulfide-Bonded
~vsteines:
Peptides containing cysteine residues on
either side of the loop amino acids may be cyclized
under oxidizing conditions to the d;sulfide-bonded
cycles. Method~ for achievin~ disulfide bonding are
known in the art. An example of disul~ide bonded
peptides uæeful in this invention is given infra in
~xample 10, wherein cPND4 is produced and Example 18
wherein cPND33 is produced. In Example lO, a process
utilizing the Acm derivative o~ cysteine to generate
disulfide bonded cPNDs is used, ~ut other processes
are equally applicable. In ~xample 18, the peptide
containg two sulfhydryls is oxidized in dilute acid.
The di~ulfide bonded peptides are preferred in the
instant învention.
105/G~B25 - 65 - 18159IA
Thus, in a preferred embodiment of this
invention, the peptide has the structure (SEQ ID:
18:~:
Pro - Gly
H H oGly Arg H H O
r-Rl-N-C-C-RZ R3-N-C-C-R5
RB ~___-R~
or pharmaceutically acceptable saltY thereof, wherein:
r is:
a) hydrogen,
b~
o
-co
o
:
wherein W is preferably -~CH2)2~ or
-(CE2)3- or R6, where R6 i~
-
. ~ or
R7 R
~ 'J~ i fr ~"~
105/G~B25 - 66 - 18159IA
wherein R7 is lower alkyl, lower alkoxy, or
halo;
Rl is:
a) a bond, or
b) a peptide o~ 1 to 5 amino acids,
optionally including a marker amino
acid;
R2 is : a peptide of 3 to 10 amino acids
R3 is: a peptide of 3 to 10 amino acids
R5 i3:
a~ -0~,
b~ a peptide of 1 to 5 amino acids,
optionally including a marker amino
acid, or
c) -N~2;
R8 is lower alkyl of between one and eight
carbons.
Lower alkyl con~ists of straight or branched
chain al~yl~ having ~rom one to eight carbons unless
otherwi~e specified. ~ereinaftes; amino acids
_R2 Gly Pro Gly Arg-R3-, which go t~ward formation of
the loop of a cyclic peptide, will be re~erred to as
loop amino acid~.
In o~e embodime~t o~ the invention, t~e0 cyclic peptide haYing the structure ~SEQ ID: 18:~:
~ '' .f't~ ~
105/G~B25 - 67 - 18159IA
Pro --Gly
H H 0 Gly Arg H H 0
H-Nle-N-C-C-X X1X2 X3X4Xm-N-C-C-R5
R8. ~ _ R9 /
i~ prepared by cyclizing a linear peptide having the
structure:
Pro--Cly
H H O Cl y Ar g H H O
H- Nl ~ - N- C - C- XnX1 X2 X3 X~ Xm N- C- C- }~5
I g
SH 6H
wherein:
Xl is a constituent of R2 selected from:
a~ serine,
b) proline,
c) arginine,
d) histidinc,
: ~ 25 e) glutamine, which i~ preferr~d, or
f) threonine;
:
X2 i8 a con~tituent o~ R2 selected from:
a) isoleuc;ne, which is most preferred,
0 b) arginine, which is preferred,
c) valine~ or
d) methionine;
105/GHB25 - 68 - -181~gIA
Xn is a constituent of R2 and is an amino acid or a
peptide of up to 8 amino acids;
X3 is a constituent of R3 selected from:
a) alanine~
b) arginine, or
c) valine;
X4 is a constituent of R3 and is selected ~rom:
lo a) phenylalanine,
b) isoleucine,
c) vali~e, or
d) leucine;
Xm is a constituent of R3 and is an amino acid or a
peptide of up to 8 amino acids.
~2 is preferably Isoleucine.
The novel disulfide bonded cyclic peptides
used in this invention (and separately claimed in
co-filed Merck cage 18068IB, USSN _ , _ ) may be
- prepared in essentially two phases: First the linear
peptide is æynthesized on a Milligen 9050 or an
2S ABI-431A peptide ~ynthesizer using
9-fluorenyl-methyloxycarbonyl (Fmoc) chemistry and
appropriately slde-chain protccted Fmoc-amino acid
: pentafluoro-phenyl esters as reagents or using
derivatiz~d Wang resin, Fmoc chemistry, and
~ide-chain protected Fmoc-amino acid symmetrical
anhydrides, prepared in situ, as reagents.
} ~ ~; 7~
105/G~B25 - 69 - 1~159IA
Second, the linear peptide is cyclized,
either in solution or with the peptide still attached
to the solid phase resin by incorporating cysteine
residues into the linear peptide at either end of the
sequence which is to form the loop, and oxidizing
these to the disulfide. In a preferred embodiment,
cyclization is accomplished by exposure of the
peptide to ~a) ~22~ (b) atmospheric oxygen, (c)
aqueous C~3CN containing about 0.1 - 0.5% TFA, or (d)
lo about O.lM ferricyanide. The preferred method is
exposure to atmospheric oxygen.
Products obtained may be characterized by
faæt atom bombardment-mass spectrometry [FAB-MS],
reverse phase ~PLC, amino acid analysis or nuclear
magnetic resonance spectroscopy (NMR).
Thus, the peptides useful in this inven~ion
may be prepared as further described below in (i) and
(ii ):
i. Peptide Cvclization in the Solid S~ate: A linear
peptide containing Cl and c2 on either side of the
loop amino acids, where Cl and c2 are both cysteine
or another amino acid containing free sulfhydryl
groups in the side chai~, is prepared according to
known synthetic procedures (~ee discussion supra).
In the completed cyclic PND, the sul~hydryl containing
side chains, (~RB-S~), go to~ard making up the -R8-S-
groupæ of the completed cyclic HIV PND structure
show~ above. Amino acids to be incorporated which
have reactive: side chains (R groups) are used in an
appropriately R-group protected form. For example,
hiætidine i~ triphenylmethyl (Trt), or Boc protected,
and arginine is 4-methoxy-2,3,6-trimethylphenyl
sulfonyl (Mtr) protected.
. .. .
$<~
105/G~B25 - 70 - lB159IA
Preferably, a resin is purchased with c2 in
its Acm protected form already attached to the resin,
for example, Fmoc-L-Cys(Acm)-O-Wang resin. The
cysteine incorporated at the amino terminal side of
the loop amino acids, Cl, may also be the Acm
derivative. Either Cl or c2 may be bound to
addi~ional amino acids, R~ or R~ respectively, which
may be utilized in the formation of conjugates with
carrier molecules or may serve as marker amino acids
for subsequent amino acid analysis, such as when
norleucine or ornithine is used.
The sulfur of the acetamidomethylated
cysteines are reacted, at room temperature for about
15 hours in a solvent compatible with the resin, as a
1-50% concentration of an organic acid, preferably
about 10% acetic acid in anhydrous dimethylformamide
(DMF), with about a four fold molar excess of a hea~y
metal salt, ~uch as mercuric acetate [~g(OAc)2~ for
each Acm group. The resulting heavy metal thioether,
for example the mercuric acetate thioether of the
peptide, PEP(S-HgOAc), is then washed and dried.
Addition of excess hydrogen sulfide in ~ME yields
insoluble metal sulfide, e.g. mercuric sulfide ~gS),
and the peptide with free ~ulfhydryl groups. The
free æulfhydryls are then oxidized by one of the
aforementioned methodæ. Alternatively, the Acm
protected thiols may be converted directly to the
cyclic disulfide by treatment ~ith iodine in a
methanol/DMF solvent.
ii. Cyclization Q~ Peptides in Solutisn:
Essentially the same process described abo~e
~ j~ rJ ~ ~ ~. r~
105/G~B25 - 71 - 18159Ih
for solid state cyclization applieæ with two main
variants: I~ the peptide is cleaved (95% TFA/4a/o
ethanedithiol/1% thioanisole) from a pepsyn KA resin,
acid labile side chain protecting group~ are also
removed, including Cys(Trt) which provides the
necessary free -SH function. If however, Cys(Acm)
protection is used, then mercuric acetate/hydrogen
sulfide cleavage to the free -S~ group is reguired as
an independent procedure, with the linear peptide
lo either on or off the resin.
One method however, i8 the use of Cys(Acm)
protection and Sasrin or Pepsyn K~ resin, and
cleavage of the linear, fully protected peptide from
the resin with 1/~ TFA/CH2C12. Mercuric acetatel
hydrogen sulphide then selectively converts Cys(Acm)
to the free -SH group, and cyclization is effected on
the other~ise protected peptide. At this point, the
peptide may be maleimidated in situ , selectively on
the N-terminus. Acid labile side chain protecting
groups are c1eaved with 98% TFA/2% thioanisole, and
the cyclic peptide is isolated by HPLC. The
preferred method, however, is to cleave the peptide
from the resin, and allow cyclization by one of the
aforementioned methods. The most preferred method is
to allow air oxidation for about one to fifty hours
of between 1~ and 40C.
Thus, in a particularly prefexred embodiment
of this invention, a peptide (CPND 33) ha~ing the
ætructure (SEQ ID: 22:):
~ 'S~ '~t~,J
105/GHB25 - 72 - 18159IA
H-Nle Cys Tyr Asn Lys Arg Lys Arg Ile His Ile Gly Pro
¦ Gly Arg Ala Phe Tyr Thr Thr Lys Asn
~CH2 Ile Ile Gly Cys-OH
S S-C~2
is conju~ated to MIEP through either the amino
terminal Nle or one of the internal lysines to
generate one or a mixture of all of the ætructures:
.
~ . ~
lOS/G~B25 - 73 - 18159IA
o-1)
1 o ~[ ~F~cn~ C.I.. ~ Jn L~ ~rg LyJ ~rg 21~ sly n;
~o~Cy~ O~y 11-- Il- n L~ Thr Sh~ Tyr n~ Ar9
..
l 5 ~-z)
H D.~.Ar9 L~ Ar~ Oly Pro 011 ~r~ Al- ~h-
~3.- . ~j~c ~ c~ \ 8 o, 11 ¦ T~r
~S ~Cl~ -C-Y-tCH~ . 1 3Jn Srr ~ C1~ Aon L~ Thr Thr
: 25
: : ~
3 0
:
': . , :
.
..
,
,
13 0 / GHB -- 7 4 -- 1 g 1~ 92 r~ 3
e-3)
H O.C-~rg Tl- H~- Il- Ol~ Pro OIJ arg ~ Ph- ~yr ~hr
tn~ H-Cj~CHI C*.c4-o \ J~ O H ¦ mr
O IIHCOC4 l~--tcb)~-c~ tc*)~-c~ r9 Ly~ ~n Sy~ C~ -C-C~ olg 11- ~ ~n L~ . os
o H 11 Ill- COOH
~ o c ~ n 11~ Oly C~ -Cy- Srr ~n L7~ Jlr~ Ly-
Sl-Cj,C~CH,-C*~ O H ¦ ~rg
l c 4 ~--tc*j~-c-N-tc4~-C-~hr mr Slrr Ph al- llrg 011 Pro Olr 11- H'-
~: :
~ 20
~: :
: ~ : 25
,
~ : :
; 30
~: :
:: :
~: :
'
2 ~
130/G~B ~ 75 - 18159IA
wherein ~ is the percentage by mass of peptide in the
conjugate, and is preferably between 11 and 50% of
the total protein mass in the conjugate.
b. Cyclic Peptides through Thioether Linkage to
o-Xvlylene or Lower Alkyls:
i. Peptide Cyclization in the Solid State: A linear
peptide containing Cl and c2 on either side o~ the
lo loop amino acids, where Cl and c2 are both cysteine
or another sulfhydryl containing amino acid, is
prepared according to ~nown synthetic procedures t ee
discussion supra). In the completed cylic PN~, Cl
and c2 become part of the R6 and R7 groups of the PEP
structure sho~n above. Amino acids to ~e
incorporated which have reac~ive side chains (R
groups) are used in an appropriately R-group-
protected form. For e~ample, histidine is
triphenylmethyl- (Trt) protected, arginine may be
4-methoxy-~,3,6-trimethylphenyl sulfonyl (Mtr)
protected. [Principle~ of Pçptide Syn~hesis,
Bodanszky. M., Springer-Verlag ~1984); $ol-id Phase
Peptide Synthesis, Stewart J. M.i Young, J. D.,
~ Pierce Chemical 50mpany (2nd ed. 1984); and Th~
Peptides, Gross, E., Meienhofer, J., Academic Press~
Inc., (1979)~.
Preferably,~ a resin is purchased with C~ in
its Acm-protected form already attached to the resin,
~or example, Fmoc-L-Cys(Acm)-0-Wang resin. The
cysteine incorporated at the amino terminal side of
the loop amino acids, Cl, may also be the Acm
derivati~e. Either Cl or c2 may be bound to
additional amino acids, Rl or RS respectively, which
130/GHB - 76 - 18159IA
.
may be utilized in the formation of conjugates with
carrier molecules or may serve as marker amino acids
for subsequent amino acid analysis, such as when
norleucine or ornithine is used.
The sulfur of the acetamidomethylated
cysteines is reacted, at room temperature for about
15 hours in a ~olvent compatible with the resin, such
as 10% acetic acid in anhydrous dimethylformamide
(DMF), with about a four-fold molar excess o~ a heavy
lo metal salt, such as mercuric acetate [Hg(OAc)2] for
each Acm group. The resulting heavy metal thioether,
for example the mercuric acetate thioether of the
peptide, PEP(S-HgOAc~, is then washed and dried.
Addition of excess hydrogen sulfide in DMF yields
insoluble metal sulfide, e.g., mercuric æulfide
(HgS), and the peptide with free sul~hydryl groups.
A mixture of about an equimolar amount, as
comp~red with peptide, of o-xylylene dibromide or
dichloride, a dibrominated or dichlorinated lower
alkyl, 1,3-dihalogenenated -C~-O-CH-, or similar
reagent which will provide a desirable bridge leng~h,
is added to the derivatized resin. A large excess of
tertiary amine, preferably triethylamine (NEt3) in
DMF is added slowly. The reaction with the
bis-sulfhydryl peptide moiety is allowed to proceed
for about sixtee~ hours at room tempera~ure, yielding
the bridge group derivatized cyclic peptide bound to
resin. Deprotection of acid sensitive side chain
protecting groups and cleavage from the resin is
achieved by treatment with 95% trifluoroacetic acid
(TFA) in the pre~ence of 4V/~ 1,2-ethanedithiol and 1%
thioanisole. The dissolved cyclic peptide may then
'
r~
130/GHB - 77 - 18159IA
be separated from the resin by filtration. The
filtrate is evaporated and the crude residual product
is purified by high performance liquid chromatography
(EPLC) according to known methods, for example by
reverse phase HPLC.
ii. Cycliza~ion of Peptides in Solution:
Essentially the ~ame process described above
for solid state cyclization applies with ~wo main
lo variants: If the peptide is cleaved ~95% TFA/4%
ethanedithiol/1% ~hioanisole) from a pepsyn KA resin,
acid labile side chain protecting groups are also
removed, including Cys(Trt) which provides the
necessary ~ree -S~ function. If however, Cys(Acm)
protection is used, then mercuric acetate/hydrogen
sulfide cleavage to the free -SH group is required as
an independent procedure, with the linear peptide
either on or off the resin.
The preferred method ho~cver, is the use of
Cys(Acm) protection and Sasrin or Pepsyn KH resin,
and cleavage of the linear, fully protected peptide
from the resin with 1% TFA/CH2C12.. Mercuric
acetate/hydrogen sulphide then æelectively converts
Cys(Acm) to the ~ree -SH group, and cyclization is
e~fected on the otherwise protected peptide. Acid
labile ~ide chain prstecti~g groups are cleaved with
95% TFA/4% ethanedithiolll% thioanisole, and the
cyclic peptide is isolated by HPLÇ.
Removal of excess reagents, such as
unreacted xylylene dibromide, prior to acid cleavage
of the protecting groups is conveniently achieved by,
for example, a step gradient rever~e pha~e HPLC run
prior to more selective gradient elut~on.
130/GHB - 78 - 1815~IR
Cyclic HIV PND peptides prepared according
to the method of this subsection include, but are not
limited to, the sample cPNDs represented below. The
methods of this subsection are generally applicable
to small peptides, and particularly applicable to
peptides of between 5 and 30 amino acids. An optimal
ring size may include between 5 and 10 amino acids,
including the -Gly-Pro-Gly- trimer, and this ring
size i~ easily maintained by production of cycles
from linear peptides ha~lng the appropriate number
and combination of amino acids.
Representative peptides resulting from the
process described in this subsection k. parts (i).
and (ii) are disclosed inapplication U.S.S.N.
555,227. The conjugate invention ~hould, however,
not be construed as being limited to use those
particular embodiments of HIV cyclic PND peptides.
Other linear ~IV PND peptide sequences may be
cycli ed in essentially the same fashion used to
provide those peptides. Series of peptides having
divergent primary sequences could be generated and
would be beneficial in ~his invention as long as they
continue to elicit an anti-peptide, anti-HIV, or
EIV-neutralizing immune response.
c. CyclizatiQn through Amide Bond FQrmation;
Novel amide bonded cyclic ~IV PND peptides
may be prepared for conjugation in essentially two
phases: First, the linear peptide is prepared, for
example on an ABI-431A peptide synthesizer, by known
solid phase peptide synthetic chemistry, for example
using Fmoc chemi~try and appropriately ~ide-chain
proteeted Fmoc-amino acids as reagents.
.,
130/GHB - 79 - 181591A
Second, the linear peptide is cleaved from
the resin and cyclized in solution by allowing the
free amino terminus of the peptide, the free amino
group of an amino terminal isoglutamine, or a free
~-amino or a-amino group of a lysine on one side of
the loop amino acids to be amide bonded to a free
carboxyl group on the carboxy-terminal side of the
loop amino acids through DPPA, BOP, or similar
reagent mediated peptide bond formation.
Products obtained may be characterized by
fast atom bombardment-mass spectrometry [FAB-MS],
reverse phase ~PLC, amino acid analysis, or nuclear
magnetic resonance spectroscopy (MMR).
Thus, highly preferred embodiments of this
invention are conjugates having covalent linkages
from MIEP to an amide bonded cyclic HIV PND, prepared
as de~cribed hereinabo~e. Where the PND is from a
predominant isolate, such as the ~IV IIIB or the ~IV
MN isolate, a conjugate vaccine, or a mixture of such
conjugate vaccines is highly ad~antageous for
prophylaxis or treatment of AIDS or ARC. ~xamples o~
such preferred embodiments having the structure:
s ~ ~ ~
130/GHB - 80 ~ 18159IA
~ r~
Ml~ N-C-Cl~-CH~-C}~ O I I H O
O NHCOCH3 l ,,N-C~C~-C-N-Nl~-N~CH~)~-C-C- Hl~-Ile-Gly-Pro-~:ly-~g-Alll-Ph~
~ O H-N--C~ (CH~)~ c7 N-C-o
b) ~ H
~EP-- I~-C-C~C~-cq~-s O I I H O
L NHOOC~ N-CN~CH~-C-N-Nl~-~C-C-Gln-Arg-Cly-Pro-Cly-Arg
( CH~)s, Ala
( ~) N--C ~?he _
~0
or pharmaceutically acceptable ~al~s thereof, wherein:
j is the percentage by mass of peptide in the
conjugate, and is preferably between 1% and 50%
of the total protein mass in the conjugate;
are useful for inducing anti-peptide immune responses
in mammal~, ~or inducing ~IV-neutralizing antibodies
in mammals, for formulating ~accines to prevent
: ~IV-di~eaæe or infection, or ~or treating human~
afflicted with ~IV-disease or infection, including
AIDS and ARC.
,
J ~t "'~
130/G~B - 81 - 1~159IA
One or more of the conju~ate vaccines of
this invention may be used in mammalian species for
either active or passive protec~ion prophylactically
or ~herapeutically against infectious agents such as,
in the preferred embodiment of this invention,
Haemophilus influenzae serotype B, or human
immunodeficiency virus induced diseases. Active
protection may be accomplished by injecting an
effective quantity capable of producing measurable
amounts of antibodies (e.g., about 1 microgram to
about 50 ~g, depending on the antigen) of an antigen
(e.g. PRP, HIV PND peptides) in the MI$P-conjugate
form of each of the conjugates being administered per
dose. The use of an adjuvant (e g., alum) is al30
intended to be within the ~cope of this invention.
Passive protection may be accomplished by in~ecting
whole antiserum obtained from animals previously
dosed with the MIEP-conjugate or conjugate~, or
globulin or other antibody-eontaining fractions of
said antisera, with or without a
pharmaceutically-acceptable carrier, ~uch aæ sterile
saline solution. Such globulin is obtained from
whole antiserum by chromatography, salt or alcohol
fractionation or electrophore i~. Pa~sive pro~ection
may be accomplished by ~tandard monoclonal antibody
procedures or by immunizing suitable mammalian hosts.
In a preferred embodiment of this inventlon,
the conjugate iæ used for active immunogenic
vaccination of humans, especially infants, children,
or immu~ocompromised individuals. For additional
stability, these conjugates may also be lyophilized
in the pre~ence of lacto~e (for example, a~ 20 ~g/mL
of P~P/4 mg/mL lactose) prior to u~e.
.
130/GHB - 82 - 18159IA
A preferred dosage level is an amount of
e~ch of the MIEP-conjugates, or derivative thereof to
be administered, corresponding to between
approximately 2 to 20 ~g of PRP, or about 1 microgram
to 5 milligarams of peptide in the MIEP-conjugate
form for conjugates of ~ influenzae serotype B
polysaccharide, or ~IV PND peptide, in a single
administration. If necessary, an additional one or
two doses of the MIEP-conjugate, or derivative
lo thereof, in a dosage comparable to that described
above.
The invention is further defined by
reference to the following examples, which are
intended to be illustrative and not limiting.
E~AMPL~ 1
Preparation of ~eisseria meningitidis Bll Serotype 2
O~IPC - -
A. Fer~entation
1. ~ciaLçsi~ menin~idis GIOUP B11
A tube containing the lyophilized culture of
Neisseria meningi~idis (obtained from Dr. ~.
Artenstein, Walter Reed Army Institute of Research
(WRAIR), Washington, D.C.~ was opened and Eugonbroth
(BBL) waæ added. The culture was streaked onto
Mueller ~inton agar slants and incubated at 37C with
5% C0~ for 36 hours, at which time the growth was
harvested into 10~/~ sklm milk medium ~Difco), and
aliguots were frozen at 70C. The identity of the
~ ~, r~
130/G~B - 83 - 181~9IA
organism was confirmed by agglutinatiqn with specif;.c
antiserum supplied by WRAIR, and typing serum
supplied by Difco.
A vial of the culture from the second
passage was thawed and streaked onto 10 Columbia
Sheep ~lood agar plates (CBAB-BBL). The plates were
incubated at 37~C with 5% C02 for 18 hours after
which time the growth was harvested into 100 mL of
10% skim milk medium, aliquots were taXen in 0.5 mL
amounts and ~rozen at -70C. The organism was
positively identified by agglutination with specific
antiserum, sugar fermentation and gram stain.
A vial of the culture from this passage wa~
thawed, diluted with Mueller-Hinton Broth and
streaked onto 40 Mueller-Hinton agar plates. The
plates were incuba~ed at 37C with 6% C02 for 18
hours after which time the growth harvested into 17
mL of 10% skim milk medium, aliquotted in 0.3 mL
amou~ts and frozen at -70C. The organi~m was
positi~ely identified by Gram stain, agglutination
with specific antiserum and oxidase test.
2. Fermentation and collection of cell paste
a. Inoculum Development- The inoculum was
grown ~rom one frozen vial of Neisseria memingitidis
2S Group B, B~ll from above (passage 4). Ten
Mueller-~inton agar slants were inoculated, and ~ix
were harvested approximately 18 hours later, and used
as an inoculum for 3 250 mL flasks of Gotschlich's
yeast dialysate medium at pX 6.35. The O.D.660 was
adjusted to 0.18 and incubated until the OD660 was
between 1 and 1.8. 1 mL of thi~ culture waæ used to
inoculate each of 5 2L. Erlenmeyer ~la~k~ (each
containing 1 liter of medium; see beIow) and
incubated at 37DC in a shaker at 200 rpm. The O.D.
~ i ~ s ~ ~ ~
130/GHB - 84 - 18159IA
was monitored at hourly intervals following
inoculation. 4 liters of broth culture, at an
O.D.660 of 1.28 resulted.
70 Liter Seed Fermenter- Approximately 4
liters of seed culture was used to inoculate a
sterile 70-liter fermenter containing about 40
liters of complete production medium (see below).
The conditions for the 70-liter fermentation included
37C, 185 rpm with 10 liters/minute air sparging and
lo constant p~ control at about p~ 7.0 for about 2
hours. For this ba~ch, ~he final O.D.660 was 0.732
after 2 hours.
800-Liter Production Fermenter
Approximately 40 liters of seed culture were
u~ed to inoculate a sterile 800 liter fermenter
containing 568.2 liters of complete production medium
(see below). The batch was incubated at 37C, 100
rpm with 60 liters/minute air ~parging and constant
pH control at p~ 7Ø For this batch, the final O.D.
was 5.58 thirteen hours after inoculation.
3. Complete Medium for Erlenmeyer flasks
and 70-and 800-liter fermenters
:
- Fractio~ A
25 L-glutamiC acld ~ 1.5 ~/liter
NaCl 6.0 g/liter
Na2~P04.anhydrous 2.5 g/liter
N~4C1 1.25 g/liter
KCl 0.09 g/liter
L-cysteine ~Cl 0.02 g/liter
. .
,
.
:
,
~ ,
130/GHB - 85 - 18159IA
~ractio~ B (Gotschlich's Yea~t Dialysate~: -
1280 g of Difco Yeast Extract was dissolved
in 6.4 liters of distilled water. The solution was
dialyzed in 2 Amicon DC- 30 hollow fiber dialysis
units with three HlOSM cartridges. 384 g MgSO4.7-H2O
and 3200 g dextrose were dissolved in the dialysate
and the total volume brou~ht to 15 liters with
distilled water. The p~ wa~ adjusted to 7.4 with
NaOH, sterilized by passage throu~h a 0.22 ~ filter,
and transferred to the fermenter containing Fraction
A.
For the ~rlenmeyer flasks: l liter of
Fraction A and 25 mL of Fraction B were added and the
p~ was adjustcd to 7.0-7.2 with NaOH.
For the 70 liter fermenter: 41.8 liters of
Fraction A and 900 mL of Fraction B were added and
the pH was adjusted to 7.0-7.~ with NaO~.
For the 800 liter fermenter: 553 liters of
Fraction A a~d 15.0 liters of Fraction B were added
and the pH was adjusted to 7.1-7.2 with NaOH.
d. ~arvest and Inactivation
After the fermentation was completed, phenol
was added in a separate vessel, to which the cell
broth was then transferred, yielding a final phenol
concentration of about 0.5%. The material was held a
room temperature with gentle stirri~g until the
culture was no longer viable (about 24 hours).
e. Centrifugation
After about 24 hours at 4C, the 614.4
liters of inactivated culture fluid ~as centrifuged
through Sharples continuous flow centrifuge~. The
weight of the cell paste after phenol treatment was
3.875 kg.
130/G~B - 86 - l
B. OMPC Isolation
S~E~1. Concentration and diafiltration
The phenol inactivated culture was
concentrated to about 30 liters and dia~iltered in
~terile distilled water using O.L micro-hollow fiber
filters (ENKA).
.xtraction
An equal volume of 2X TED buffer [0.1 M TRIS
0.01 ~ EDTA Buffer, p~ 8.5, with 0.5~tO sodium
deoxycholate~ was added to the concentrated
diafiltered cells. The suspension was transferred to
a temperature regulated tank for OMPC extraction at
56 C with a~itation for 30 minutes.
The extract was centrifuged at about 18,000
rpm in a Sharples continuous flow centrifuge at a
flow rate o~ about 80 mL/minute, at about 4C, The
viscou~ supernatant ~as then collected and stored at
4C. The e~tracted cell pellets were reextracted in
TED buffer as descri~ed above. The supernatants were
pooled and stored at 4C.
Concentration by Ultrafiltration
The pooled extract ~as transferred to a
temperature regulated vessel attached to AG~Tech 0.1
micron polysulfone filters. The temperature of the
extract was held at 25C in the vessel ~hroughout the
concentration process. The sample was concentrated
tenfold at an average transmembrane pressure of
between 11 and 24 psi.
f~ J~ 6 ~ f ,rJ~
130/G~B - 87 - 18159IA
C~llection and Washing of khe OMPC
The retentate from Step 3 was centrifuged at
about 160,000 x g (35,000 rpm) at about 70C in a
continuous flow centrifuge at a flow rate between 300
to 500 mL/minute, and the supernatant was discarded.
The OMPC pellet was suspended in TED Buffer
(190 mL buffer; 20 mL/g pellet) Step 2 and Step 4
were repeated twice (skipping Step 3).
Ste~ ~. Reco~ery of OMPC Product
The washed pellets from Step 4 were
suspended in 100 mL distilled water with a glass rod
and a Dounce homogenizer to insure complete
suspension. The aqueous OMPC suspension was the~
filter s~erilized by passage through a 0.22 ~ filter,
and the TED buf~er was replaced with water by
diafiltration against sterile distilled water using a
0.1 ~ hollow fiber filter.
EXAMPLE 2
Preparation of ~ Influenzae Type b Capsular
Polysa~chari~e ~PRP~
I~oculu~ a~d Seed De~elopme~t
A Stage: A lyophilized tube of Haemophilus
influenzae type b, (cultured from Ross 768, received
from State University of New York) was suspended in 1
mL of sterile ~aemophilus inoculum medium Ssee below)
and this ~uspension was spread on 9 Chocolate Agar
130/G~B - ~8 - 18159IA
slants (BBL). The pH of the inoculum medium was
adjusted to 7.2 + 0.1 (a typical value was pH 7~23)
and the medium solution was sterilized prior to use
by autoclaving at 121C for 25 minutes. After 20
hours incubation at 37C in a candle jar, the growth
from each plate was resuspended in 1-2 mL ~aemophilus
inoculum medium, and pairs of slants were pooled.
Haemophilus Inoculum Medium
Soy Peptone 10
gm/liter-
NaCl 5
gm/liter
NaH2P04 3.1
gm/liter
2D
Na2~P04 13.7
gm/liter
K2HP04 2.5
gm/liter
.
Distilled Water To Volume
~1 r~ ~, r~
130/GHB - 89 - 18159IA
The resuspended cells from each pair of
slants was inoculated into three 250 mL Erlenmeyer
flasks containing about lO0 mL of Haemophilus Seed
and Production medium. The 250 mL flasks were
incubated at 37C for about 3 hours until an OD660 of
about 1.3 was reached. These cultures were used to
inoculate the 2 liter flasks (below).
B Stage: 2 Liter non-baffled Erlenmeyer
flasks- 5 mL of culture from "A stage" ~above) were
lo used to inoculate each of ~ive two-liter flasks, each
containing about 1.0 liter of complete ~aemophilus
eed and production medium (see below). The fla~ks
were then incubated at 37C on a rotary shaker at
about 200 rpm for about 3 hours. A typical OD660
1~ value at the end of the incubation period was about
1Ø
Complete Haemophilus Seed And Production Medium
Per liter
NaH2P04 3.1 glL
Na2HP04 13 . 7 gl L
Soy Peptone 10 g/L
Yeast extract diàfiltrate (1) 10 glL
K2~P04 2.5 glL
NaCl 5.0 g/L
~lucose (2) 5.0 g/L
Nicotinamide adenine 2 mglL
dinucleotide (NAD~ (3)
Hemin (4) 5 mglL
'
7J r~
130/GHB - 90 - 18159IA
The salts and soy peptone were dissolved in
small vo.umcs of hot, pyrogen-free water and brought
to correct final volume with additional hot,
pyrogen-free water. The fermenters or flasks were
then sterilized by autoclaving for about 25 minutes
at 121C, and after coolin~ yeast extract diafiltrate
(1), glucose (2), NAD (3), and hemin (4) were added
aseptically to the flasks or fermenters prior to
inoculation.
(1) Yeast extract diafiltrate: 100 g
brewers' yeast extract (Amber) was dissolved in 1
liter distilled water and ultrafiltered usin~ an
Amicon DC-30 hollow ~iber unit with H10 x 50
cartridges with a 50 kd cutoff. The filtrate was
collected and sterilized by passage through a 0.22
filter.
(2) Glucose was prepared as a s~erile 25%
solution in distilled water.
(3) A stock solution of NAD containing 20
20 mg/mL was sterilized by paæsage through a (0.22 ~ -
filter) and added aseptically just prior to
inoculation.
(4) A stock ~olution of Hemin 3X was
~ prepared by dissolving 200 mg in 10 mL of 0.1 M NaOH
2~ and the ~olume adjusted with distilled, sterilized
water to 100 mL. The solution was sterilized ~or 20
: minutes at 121C and added asep~ically to the final
medium prior to inoculation.
,
;.
130/GHB 91 - 18159IA
C Stage: 7Q Liter Seed Fermenter- Three liter~
of the product o~ B Stage was used ~o inoculate a
fermenter containing about 40 liters of Complete
~aemophilus Seed And Production medium (prepared as
described above) and 17 mL UCON B625 antifoam agent.
The p~ at inoculation was 7.4.
D Stage: 800 Liter Product;on Fermenter-
Appro~imately 40 liters of the product of "C Stage"
was used to inoculate an 800 liter fermenter
lo containing 570 liters of Haemophilus Seed and
Production medium ~prepared as described above),
scaled to the necessary volume, and 72 mL of UC~N
LB625 antifoam agent was added.
The fermentation was maintained at 37C with
100 rpm agitation, with the O.D.660 and p~ levels
measured about every t~o hours until the O.D.660 was
stable during a two-hour period, at which time the
fermentation was terminated (a typical final O.D.660
was about 1.2 after about 20 hours).
~ARVEST AND INACTIVATION
Approximately 600 liters of ~he ba~ch was
inactivated by harvesting into a "kill tank"
containing i2 liters of 1% thimerosal.
CLARIFICATION
After 18 hours of inactivation at 4C, the
batch was centrifuged in a 4-inch bowl Sharples
contiuous flow centrifuge at a flow rate adjusted to
maintain product clarity (variable between 1.3 and
3.0 liter~ per minute). The supernatant obtained
after centrifu~ation (lS,000 rpm) was used for
product recovery.
," ~ ,.~
1301&HB - 92 - 1815~IA
ISOLATION AND CONCENTRATION BY ULTRAEILTRATION
The supernatant from two production
fermentations was pooled and concentrated at 2 to 8~C
in a Romicon XM-50 ultrafiltration unit with twenty
50 kd cut-off hollow fiber cartridges (4.5 m2
membrane area; 2.0 Lpm air flow and 20 psi>.
Concentration was ~uch that after approximately 4.5
hours, about 1,900 liter~ had been concentrated to
57.4 liters. The filtrate was discarded.
48% AND 61% ETHANOL PRECIPITATION
To the 57 . 4 ~ iters of ultrafiltration
rctentate, 53 liters of 95% ethanol was added
dropwise over 1 hour with stirring at 4C to a final
concentration of 48% ethanol by volume. The mixture
was stirred two additional hours at 4C to insure
complete precipitation, and the superna~ant was
collected following passage through a single 4-inch
Sharples continuous flow centrifuge at 15,000 rpm at
a ~low rate of about 0.4 liters per minute. The
pellet was di3carded and the clarified fluid was
brou~ht to 82% ethanol with the addition of 40.7
liters of 95% ethanol over a one hour period. The
mi~ture was stirred for three additional hours to
2s insure complete precipitation.
RECOVERY OF THE S~COND PELLET
The resulting 48% ethanol-soluble-82%
ethanol-insoluble precipitate was collected by
centrifugation in a 4 inch Sharples continuous flow
centri~uge at 15,000 rpm with a flow rate of about
0.24 liters per minute and the 82% ethanol
supernatant wa3 disc~rded. The crude product yield
was about 1.4 kg of wet paste.
J ~ , " ~ ~
130/GXB - 93 - 18159IA
CALCIUM CHLORIDE EXTRACTION
The 1.4 kg grams of 82% ethanol-insoluble
m~terial, was mixed in a Daymax dispersion vessel
2-80C with 24.3 liters of cold, distilled water. To
this mixture, 24.3 liters of cold 2M CaC12.2H20 was
added, and the mixture was incubated at 4C for 15
minutes. The vessel was then rinsed with 2 liters of
1 M CaC12.2H20, resulting in about 50 liters final
volume.
23% ET~IANOL PRECIPITATION
The 50 liters of CaC12 extract was brought
to 25% ethanol by adding 16.7 liters of 95~tO etha~ol
dropwise, with stirring, at 4C over 30 minutes.
After additional stirring for 17 hours, the mixture
was collected by passage through a Sharples
continuous ~1GW centrifuge at 4C. The supernatant
was collected and the pellet was discarded.
38% ET~ANOL PRECIPITATION AND
COLLECTION OF CRUDE PRODUCT PASTE
The 257/o ethanol-soluble ~upernatant was
brought to 38% ethanol by the addition of 13.9 liters
of 95% ethanol, dropwise with stirring, over a 30
minute period. The mi~ture was then allowed to ætand
with agitation for one hour, then without agitation
for 14 hours, to insure complete precipitation. The
resulting mixture was then centrifuged in a 4 inch
Sharples continuous flow centrifuge at 15,000 rpm
(flow rate of 0.2 liters per minute) to collect the
precipitated crude ~. influenæae polysaccharide.
~ , ~s, 3
130/GHB - 94 - 18159IA
TRITURATION
The pellet from the centrifugation was
transferred to a 1 gallon Waring Blender containing 2
to 3 liters o~ absolute ethanol and blended for 30
seconds at the highest speed. Blending was continued
for 30 seconds on, and 30 seconds off, until a hard
white powder resulted. The powder was collected on a
Buchner funnel with a teflon filter disc and washed
sequentially, in sit~, with two 1 liter portions of
absolute ethanol and two 2 lites portions of
acetone. The material was then dried, in vacuo, at
4OC for 24 hours, resulting in about 337 g (dry
weight) of product.
P~ENOL EXTRACTION
About 168 grams o~ the dry material ~rom the
trituration step (about half of the total) was
resuspended in 12 liters of 0.488 M sodium acetate,
pH 6.9, with the aid of a Daymax dispersion vessel.
The ~odium acetate solution was immediately extracted
with 4.48 liters of a fresh aqueous phenol solution
made as follows: 590 mL of 0.488 M sodium acetate, pH
6.9, was added to each of eight 1.5 kg bottles of
phenol (Mallinckrodt crystalline~ in a 20 liter
pressure vessel and mi~ed into ~uspension. Each
phenol extract was centri~uged for 2.5 hours at
30,000 rpm and 4C in the K2 Ultracentrifuge
(Electronucleonics). The agueous effluent was
extracted three additional times with fresh aqueous
phenol solution as described above. The phenol
phases were discarded.
~,
130/G~B - 95 18159IA
ULTRAFILTRATION
The aqueous phase from the first phenol
extraction above (12.2 liters) was diluted with 300
liters of cold, distilled water and diafiltered at
4C on an Amicon DC-30 ultrafiltration apparatus
using 3 HlOP10, 10 kd cutoff cartridges, to remove
the carryover phenol. The Amicon unit was rinsed and
the rinse added to the retentate, such that the final
volume was 31.5 liters. The ultrafiltrate was
lo discarded.
67% ETHANOL PRECIPITATION
0.81 liters of 2.0 M CaC12 was added to the
31.5 liters of dialysate from the previous step
(final CaC12 concentration was 0.05 M~ and the
solution was brought to 82% ethanol with dropwise
addition and rapid stirring over one hour, of 48.5
liters of 95% ethanol. After 4 hours of agitation,
then standing for 12 hour~ at 4C, the supernatant
was siphoned off and the precipitate was collected by
centri~ugation in a 4 inch Sharples continuous flow
centrifuge (lS,OOO rpm), at 4C for 45 minutes. The
resulting polysaccharide pellet was triturated in a 1
gallon Waring blender using 30 second pulses with 2
liters of absolute ethanol, eollected on a Buchner
funnel fitted with a teflon filter disc, and washed,
in ~i~, with four 1 liter portions of absolute
ethanol followed by two 1 liter portions of acetone.
The sample was then dried in a tared dlsh, in va~uo,
at 4C for 20 hours. The yield was about 102 grams
of dry powder. The yield from all phenol extractions
was pooled resulting in a total of 212.6 grams of dry
powder.
~, v, s~ f,l
130/G~B - 96 - 18159IA
ULTRACENTRIFUGATION IN 29% ETHA~OL
AND COLLECTION OF FINAL PRODUCT
The 212.6 grams of dry powder from above was
dissolved in 82.9 liters of distilled water, to which
was added 2.13 liters of 2 M CaC12.2~20, (0.05M
CaC12), 2.5 mg polysaccharide/mL), and the mixture
was brought 29% ethanol wi~h the dropwise addition of
29.86 liters of 95% ethanol over 30 minutes. The
mi~ture was clarified immediately by centri~ugation
lo in a K2 Ultracentrifuge containing a K3 titanium bowl
and a Kll Noryl core (30 9 000 rpm and 150 mL per
minute flow rate) at 4~C. The pellet waæ discarded
and the supernatant was brought to 38% ethanol by the
: addition of 17.22 liters o~ 95% ethanol over 30
- 15 minutes with stirring. After stirring 30 additional
minutes the mixture was allowed too stand without
agitation at 4C for 17 hours and the precipitate was
collected using a 4 inch Sharples continuous flow
centrifuge at 15,000 rpm (45 minutes was required).
The resulting paste wa~ transferred to a
l-gallon Waring blender containing 2 liters of
absolute ethanol and blended at the highest speed by
4 or 5 cycles of 30 seconds on, 30 seconds off, until
a hard, white powder ~ormed. Thiæ powder was
collected on a Buchner funnel fitted with a Zitex
teflon`disc and rinsed sequentially, in ~, with
two fresh 0.5 liter portions and one 1 liter portions
of absolute ethanol, and with two 1 liter portion of
acetone. The product was removed from the funnel and
transferred to a tared dish for drying, in vacu3, at
4C (for 25 hours). The final yield of the product
was 79.1 grams dry weight.
6~,rS ?~
130/GHB - 97 - 1815gIA
EXAMPLE 3
Cloning of Genomic DNA Encoding MIEP.
About 0.1 g of the phenol inactivated N.
meningitidis cells (see Example 1) was placed in a
fresh tube. The phenol inactivated cells were
resuspended in 567 ~L of TE buffer tlOmM TRIS-HCl,
lmM EDTA, pH 8.0]. To the resuspended cells was
added 30 ~L of 10~/o SDS, and 3 ~L of 20 mg/mL
proteinase K (Sigma). The cells were mixed and
incubated at 37C for about 1 hour, after which 100
~L of 5 M NaCl was added and mixed thoroughly. 80 ~L
of 1% cetyltrimethylamonium bromide (CTAB) in 0.7 M
NaCl was then added, mixed thoroughly, and incubated
at 65C for 10 minutes. An equal ~olume (about 0.7
to 0.8 mL) of chloroform/isoamyl alcohol (at a ratio
of 24:1, respectively) was added, mixed thoroughly
and centrifuged at about 10,000 x g for about 5
minutes. The aqueous (upper) p~ase was trans~erred
to a new tube and the organic phase was diecarded.
An equal volume of phenol/chloroform/isoamyl alcohol
(at a ratio of 25:24:1, respectively) wa added to
the aqueous phase, mixed thoroughly, and centrifuged
at 10,000 x g for about 5 minutes. The aqueous phase
(upper) was transferred to a ne~ tube and 0.6 yolumes
(about 420 ~L) of isopropyl alcohol was added, mixed
thoroughly, and the precipitated DNA was pelletted by
centrifugation at 10,000 x g for 10 minute~. The
supernatant was discarded, and the pellet was washed
with 70X ethanol. The DNA pellet was dried and
resuspended in 100 ~L of TE buffer, and represents N.
meningitidis genomic DNA.
7' ~: ~ ^"-.
" "i ~,; "",;
130/GHB - 98 - 18159IA
Two DNA oligonucleotides were synthesized
which correspond to the 5~ end of the MIEP gene and
to the 3' end of the MIEP gene [Murakami, E.C. et
al., (1989), Infection and Immunity, 57,
pp.2318-23]. The sequence of the DNA oligonucleotide
specific for the 5' end of the MIEP gene was:
5~-ACTAGTTGC MTGAAAAAATCCCTG-3~; and for the 3~ end
of the MIEP gene was: S'-GAATTCAGATTAGG M TTTGTT-3'.
These DNA oligonucleo~ides were used as primers for
l-o polymerase chain reaction (PCR) amplification of the
MIEP ~ene using 10 nanograms of N. meningi~idis
genomic DNA. The PCR amplification step was
performed according to the procedures supplied by the
manufacturer (Perkin Elmer~.
The amplified MIEP DNA was then digested
with the restriction endonucleases ~1 and ~coRI.
The 1.3 kilobase (kb) DNA fragment, containing the
complete coding region of MIEP, was isolated by
electrophoreæis on a 1.5% agarose gel, and reco~ered
from the gel by e~ectroelution ~Current Protocols in
Molecular Biology, (1987), Ausubel, R.M., Brent, R.,
gingston, R.E., Moore, D.D., Smith, J.A., Seidman,
J.G. and Struhl, K., eds., Greene Publishing Assoc.~
The plasmid vector p~C-19 was digested with
~QI and E~Q~I. The gel puri$ied ~QI-EcoRI MIEP DNA
was ligated into the SpeI-E~oRI pUC-19 vector and was
u~ed to transform E. coli strain D~5. Transformants
containing the p~C-19 vector with the 1.3 kbp MIEP
DNA were identi~ied by restriction endonuclease
mapping, and the MIEP DNA was seguenced to ensure its
identity.
~ J~ -~
130/GHB - 99 - 18159IA
~ XAMPLE 4
Construction of the pcl/l.GallOp(B~ADHlt vector.
The Gal 10 promoter was isolated from
plasmid YEp52 [Broach, et al., (1983) in Experimental
Manipulation of Gene Expression, Inouye, M(Ed)
Academic Press pp. 83-117J by gel purifying the 0.5
kilobase pair (Kbp) fragment obtained after cleavage
with Sau 3A and Hind III. The A~Hl terminater was
isolated from vector pGAP.tADH2 ~Kniskern, et al.,
91986), Gene, 46, pp. 135-141] by gel purifying the
0.35 Kbp fragment obtained by clea~age with Hind III
and SpeI, The two fragments were ligated with T4 DNA
ligase to the gel purified pucl3~Hind III vector
(the ind III site ~as eliminated by digesting pUC18
with Hind III, blunt-ending with the Klenow fragment
of E. ~oli DNA polymerase I, and ligating with T4 DNA
ligase) which had been digested with Bam~I and S~hI
to create the parental ~ector pGallo-tADHl. This has
a unique Hind III cloning æite at the GallOp.AD~lt
junction.
The unique ind III cloning site of
pGallO.tAD~l was changed to a unique Bam~I cloning
site by digesting pGallO.tADHl with ~ind III, gel
purifying the cut DNA, and ligating, using T4 DNA
liga~e, to the following El~ am~I linker:
5'-AGCTCGGATCCG-3'
3'-GCCTAGGCTCGA-5'.
The resulting plasmid, pGallO(B)t~DHl, has
deleted the ~in~_~lI site and generated a uni~ue
BamHI cloning site.
130/G~B - 100 - ~5 ,$~
The GallOp.tADHl fragment was isolated from
pGallO(B)tAD~l by digestion with SmaI and SphI,
blunt-ended with T4 DNA polymerase, and gel
purified. The yeast shuttle vector pCl/l ~Brake et
al., (1984), Proc. Nat~l. Acad. Sci. USA, 81 ,
pp.4642-4646] was digested with SphI, blunt-ended
with T4 DNA polymerase, anpurified. This fragment
~as ligated to the vector with T4 DNA ligase. The
ligation reaction mixture was then used to transform
E. coli HB101 cells to ampicil~in resistance, and
transformants were screened by hybridization to a
single strand of the 32P-labelled HindIII BamXI
linker. The new vector construction,
pcill.GallOp(B)AD~lt was confirmed by digestion with
~indIII and Ba~HI.
;~XA~
Construction of a Yeast MIEP Expression Vector with
MI~P + L~d~r DN~ Sequen~es _ _
A DNA fragment containi~g the complete
coding region of MIEP was generated by digestion of
pUC19.MIEP #7 with SpeI and coRI, gel purification
of the MIEP DNA, and blunt-ended with T4 DNA
polymeraæe.
The yeast internal expression vector
pCl/l.GallOp(B)AD~lt wa~ disgested with Bam ~I,
dephosphorylated with calf intestinal alkaline
phosphatase, and blunt-ended with T4 DNA polymerase.
The DNA was gel purified to remove uncut vector.
~. '
130/GHB - 101 ~ s, ,
The 1.1 Kbp blunt-ended fragment of MIEP was
ligated to the blunt-ended pcl/l.GallOp(B)ADHlt
vector, and the ligation reaction mixture was used to
transform competent ~. coli D~5 cells to ampicillin
resistance. Transformants were screened by
hybridization to a 32P-labelled DNA oilgoncleotide:
5'... AAGCTCGGATCCTAGTT&CAATG...3', which
was designed to be homologous with se~uences
overlapping the MIEP vector junction. Preparations
f DNA were made from hybridization positive
transformants and digested with ~LI and SalI to
verify that the MIEP fragment was in the correct
orientation for expression ~rom the GallO promoter.
Further confirmation of the DNA conætruction was -
obtained by dideoxy 3equencing from the GallO
promoter into the MIEP coding re~ion.
Expression of MIEP by the transformants was
detected by Western blot analysis. Recombinant MIEP
produced in the transformants comigrated on
polyacrylamide gels with MIEP purified from OMPC
vesicles, and was immunologically reactive wi~h
antibodies specific for MIEP.
EXAMPLE 6
Construction of yeast MIEP expression vector with a
5'-~odified MI~p DNA Se~nee. ~ _
A DNA oligonucleotide containing a HindIII
site, a conserved yeast 5' nontranslated leader
(NTL), a methionine start codon ~ATG), the first 89
codons of the mature MIEP (beginning with Asp at
position +20) and a ~1 site (at position +89) was
~, :
130/GHB - 102 - 18159IA J
generated using the polymerase chain reaction (PCR)
technique. The PCR was performed as specified by the
manufacturer (Perkin Elmer Cetus) using the plasmid
pUC19MIEP42#7 as the template and the following DNA
oligomers as primers:
5 CTAAGCTTAACAAAATGGACGTTACCTTGTACGGTACAATT3 , and
5 ACGGTACCGM GCCGCCTTTCAAG3 .
To remove the 5' region of the MIEP clone,
plasmid pUC19MIEP42#7 was digested with ~al and
lo ~indIII and the 3.4 Kbp vector fragment was agarose
gel purified. The 280 bp PCR fragment was digested
with ~al and HindIII, agarose gel purified, and
ligated with the 3.4 Kbp vector fragment.
Transformants of E. coli HBlOl (BRL) were screened.by
DNA oilgonucleotide hybridization and the DNA from
positive transformants was analyzed by restriction
enzyme digestion. To ensure that no mutations were
introduced during the PCR step, the 280 bp PCR
generated DNA of the positive transformants ~as
sequenced. The resulting plasmid containæ a ~indIII
- EcoRI insert consisting of a yeast NTL, ATG codon,
and the entire open reading frame (ORF) of MIEP
~eginning at the Asp codon (amino acid ~20).
The yeast MIEP expression vectors were
constructed as follows. The pGAL10/pcl/l and
pGAP/pCl/l vectors ~Vlasuk, G.P., et al., (1989~
J.B.C., ~64, pp.l2,106-12,112] were digested with
BamXI, flush-ended with the Klenow fragment of DNA
polymerase I, and dephosphorylated wlth calf
intestinal alkaline phosphatase. These linear
vectors were ligated with the Klenow treated and gel
puri~ied ~indIII - ~nRI fragment described above,
which contains the yeast NTL, ATG and ORF of MIEP are
forming pGallO/pcl/MIEP and p&AP/pGAP/pCl/MI~P.
l30/GHB - 103 - 18159IA
Saccharomyces cerevisiae strain U9
(gallOpgal4-) were transformed with plasmid
pGallO/p/pCl/MIEP. Recombinant clones were isolated
and examined for expression of MI~P. Clones were
grown at 37C with shaking in synthetic medium (leu-)
containing 2% glucose (w/v) to an O.D.660 of about
6Ø Galactose was then added to 2% (w/v) to induce
expression of MIEP from the GallO promoter. The
cells were grown for an additional 45 hours following
galactose induction to an O.D.600 of about 9Ø The
cells were then harvested by centrifugation. The
cell pellet was washed wi~h distilled water and
frozen.
Western ~lot For Reeombinant ~IEP:
To determine whether the yeast was
expressing MIEP, Western blot analysis was done.
Twelve percent, 1 mm, lO to 15 well Novex Laemmli
gels are u~ed. The yeast cells were broken in ~2
using glass beads (sodium dodecylsulfate (SDS) may be
used at 2% during the breakin~ process). Cell debris
was removed by centrifugation for l minute at lO,OOO
x g.
The supernatant was mixed with sample
running buffer, as described for polyacrylamide gel
purification o MIEP. The samples were run at 3S mA,
- using OMPC as a reference control, until the dye part
l~aves the gel.
Proteins were transferred onto 0.45 ~ pore
size ~itrocellulose paper, using a NOV~X transfer
apparatus. After transfer the nitrocellulose paper
was blocked with 5% bovine serum albumin in phosphate
~ ,rl i~ r, r. ~
130/GHB - 104 - 18159IA
buffered saline for 1 hour, after which 15 mL of a
1:1000 dilution of rabbit anti-MIEP (generated from
gel purified MIEP using standard procedures) was
added. After overnight incubation at room
temperature 15 mL of a 1:1000 of alkaline phosphatase
conju~ated goat anti-rabbit IgG was added. After 2
hours incubation the blot was developed using FAST
RED TR SALT (Sigma) and Naphthol-AS-MX phosphate
(Sigma).
~XAMPLE 7
Bact~rial Expression Of RecQm~inant MIEP
Plasmid pUCl9-MIEP containing the 1.3
kilobase pair MIEP gene insert, was digested with
restriction endonucleases SpeI and ~coRI. The l.l~bp
fragment was isolated and purified on an agarose gel
using standard techniques known in the art. Plasmid
pTACSD, containing the two cistron TAC promoter and a
unique ECORI site, was digested with ~ORI. Blunt
ends were formed on both the 1.3 kbp MIEP DNA and the
pTACSD vector, using T4 DNA polymerase (Boehringer
Mannheim) according to the manufacturer's
directions. The blunt ended 1.3 kbp MIEP DNA was
ligated into the blunt ended vector using T4 DNA
ligase (Boehringer Mannheim) according to the
manufacturer's direction~. The ligated DNA was used
- to transform E. coli strain DH5aIQMAX (BRL) according
to the manufacturer's directions. Transformed cells
were plated onto agar plates containing 25 ug
kantamycinlmL and 50 ug penicillin/mL, and incubated
for about 15 hours at 37 C. A DNA oligonucleotide
,
- 130/GHB - 105 - 18159IA
with a sequence homologous with MIF.P was labelled
with 32p and used to screen nitrocellulose filters
containin~ lysed denatured colonies from the plates
of tranæformants using standard DNA hybridization
technigues. Colonies which were positive by
hybridization were mapped using restriction
endonucleases to determine the orientation of the
MIEP gene.
Expression of MIEP by the transformants was
lo detected by Western blot analysis. Recombinant MIEP
produced in the transformants comigrated on
polyacrylamide gels with MIEP purified from OMPC
vesicles, and was immunologically reactive with
antibodies specific for MIEP.
EXAMPLE 8
Preparation of Purified MIEP from OMPC Vesicles or
From Recombinant Cells by Polyacrylamide Gel
Electrop~oresis _ _
Acrylamide/BIS (37.5:1) gels, 18 x 14 cm, 3
mm thick were used. The stacking gel was 4Z
polyacrylamide and the æeparating gel was 12%
polyacrylamide. Approximately 5 ~g of vesicle
2s protein, or recombinant host cell protein, was used
per gel. To 1 mL of OMPC ~eæicles was added 0.~ mL
of sample buffer (4% glycerol, 300 mM DTT,- 100 mM
TRIS, O. OOl~/o Bromophenol blue, pH 7.0). The mixture
was heated to 105C for 20 minutes and allowed to
cool to room temperature be~ore loading onto the
gel. The gel wa~ run at 200 400 milliamps, with
cooling, until t~e Bromophenol blue reached the
.
J ~, J
130/GHB - 106 - 18159IA
bottom of the gel. A verticle strip of the gel was
cut out (about 1-2 cm wide) and stained with
Coomassie/cupric acetate (0.1%). The strip was
destained until the MIEP band (about 38 Kd) became
visible. The strip was then placed into its original
gel position and the MIEP area was excised from the
remainder of the gel using a scalpel.
The excised area was cut into cubes (about 5
mm) and eluted with 0.01 M TRIS-buffer, pH 0.1.
After 2 cycles of elution the eluate was evaluated
for purity by SDS-PAG~. The eluate was combined with
a common pool of eluates and dialysed against
borate-buffer (0.1 M boric acid, pH 11.5). Af~er
dialysis the eluted protein was concentrated using an
1~ Amicon stirred cell with YM10 membranes (10,090
molecular weight cutoff). The material was further
purified by passage through a PD10 sizing column
(Pharmacia, Piscataway, NJ), and waæ stored at room
temperature in borate buffer.
EXAMPL~ 9
Carrier activi~ Q~ MIEP in covalent PRP-O~C
conju~a~
Immunizations: Male C3~1HeN mice (Charles
River, Wilming~on, MA) were im~unized
intraperi~oneally (IP) with PRP covalently linked to
OMPC (PRP-OMPC; comprising 2.5 ~g PRP and 17 ~g OMPC)
or PRP coupled to DT ~PRP-DT; containing 2.5-7.5 ~g
PRP and 1.8-5.4 ~g DT) (Connaught Laboratories,
Willowdale, ONT), ~uspended in O.5 mL of O.01 M
pho~phate-buf~ered saline (PBS). A ~econd group of
130/GHB - 107 ~ 18159IA
male C3~-HeN mice, received either 17 ~g of MIEP, 17
~g of OMPC, or OMPC-IAA (OMPC derivatized with
N-acetyl homocysteine thiolactone, and capped with
iodoacetamide). Cell donors for adoptive transfer
experiments were twice immunized IP, 21 days apart,
and spleen cells were collected 10 dayæ after the
second immunization. Adoptive transfer recipients
were male C3H/HeN mice given 500R total body
gamma-irradiation ~rom a 137cs source and immediately
lo reconstituted by intravenous injection of 8 x 107
spleen cells from each of two syngeneic donors
separately primed with PRP-DT, and OMPC, MIEP, or
OMPC-IAA. Control mice received 8 x 107 spleen cells
from one donor mouse primed with PRP-OMPC and an
equal number of spleen cells from an unprimed donor
mouse.
ELI~A for anti-P~P anti~Q~y: Reactive
amines were introduced into purified ~ fluenzae
PRP by treatment with carbonyldiimidazole and
reaction with butanediamine a~ described by Marburg
et al., U.S. Patent 4,882,317. This derivatized PRP
was chromatographed on Sephadex G-25 in O.lM sodium
bicarbonate buffer, p~ 8.4.
N-hydroxysuccinimidobiotin (Pierce Chemical,
Rockford, IL) in dimethylsulfoxide was added to the
eluate to a final concentration of 0.3 mg/mL and
reacted in the dark for 4 hours at ambient
temperature (about 25-28OC). Unreacted
N-hydroxysuccinimido-biotin was removed by gel
filtration over Sephadex G-25 in PBS. Costar
(Cambridge, MA) polyvinyl chloride ELISA plates were
coated with 50 ~g/well of avidin ~Pierce Chemical) at
'
130/GHB - 198 - 18159IA
10 ~g/mL in 0.1 M sodium bicarbonate buffer, p~ 9.5,
overnight at ambient temperature and 100% humidity.
Plates were washed 3 times with 0.05 M TRIS-buf~ered
saline, pH 8.5, containing 0.05% Tween-20 (TBS-T),
and blocked with TBS-T plus 0.1% gelatin (blocking
buffer) at ambient temperature and 100% humidity for
1 hour. Plates were blotted without waæhing, 50
~g/well PRP-biotin in PBS at 15-40 ~g/mL was added,
and the plates were incubated for 1 hour. Plates
lo were ~ashed 3 ~imes with T~S-T prior to sample
addition. Samples were added in two-fold serial
dilutions in blocking bu~fer, and incubated for 2
hours at ambient temperature and 100% humidity. The
- plates were then washed 3 timeæ with TBS-T, and
appropriate al~aline-phosphatase conjugated
anti-immunoglobulins diluted in blocking buffer were
added. The an~ibodies used were goat anti-mouse IgM
(Jackson Immunoresearch, West Grove, PA), IgG ~Fc)
(Jackson Immunoresearch), IgGl (gamma) (BRL,
2~ Gaithersburg, MD), IgG2a (g~mma) (BRL), IgG2b (gamma)
(Southern Biotechnology Associates, Birmingham, AL),
IgG3 (gamma) (Southern Biotechnology Associates), and
goat anti-rabbit IgG (Jackson ImmuDoresearch).
Plates were incubated for 2 hours at ambient
temperature and 100% humidity, washed with blocking
buffer, and ~u~strate de~elopment was carried out
using p-nitrophenyl phosphate (1 mg/mL in 1 M
diethanolamine, Kirkegaard and Perry, Gaithersburg,
MD~. Dilutions were considered positive if the
sample absorbance exceeded the mean absorbance plus 3
times the standard deviation of 8 reagent blanks, and
the difference in absorbance bet~een successive
dilutions was 0.01 or greater. Endpoint titers were
defined as the reciprocal of the highest dilution
130/GHB - 109 - 18159IA
which gave a positive reaction in the ELISA as
described above. Logarithms of reciprocal titers
were compared between treatment groups by two-way
analysis of variance [Lindeman, R.H. et al., (1980),
Introduction to Bi~ariate and Multivariate Analysis,
Scott Foresman (pub.), New York].
RIA for anti-PRP antibodv ~uantitation:
The experimental samples of serum to be
tested for the amount of an~i-PRP antibodies were
diluted 1:2, 1:5, and 1:20, using fetal calf serum as
the diluent. 25 ~L of each diluted sexum sample was
transferred, in duplicate, to 0.5 mL RIA vials
(Sarstedt). A solution of PRP labelled with 125I was
diluted to yield between 300 and 800 counts per
minute (cpm) per 50 ~L, using phosphate buffered
saline as the diluent. 50 ~L of diluted 125I-PRP was
transferred to each RIA vial, mixed thoroughly and
incubated for about 15 hours at 4C. 75 ~L of a
saturated solution of ammonium sulfate at 4C was
added to each RlA vial, mixed thoroughly and
incubated at 4C for 1 hour. The RIA vials were then
centrifuged for 10 minutes at 10,000 x g, the
supernatant was discarded and the cpm in the pellet
was measured in a gamma eounter (LKB).
A standard curve consisting of serial
two-fo~d dilutions o~ an antiserum containing a known
quantity of anti-PRP antibodies was prepared as
described above and were assayed concomitantly with
the experimental serum samples. The quantity of
anti-PRP antibodies in the standard curve was between
14 ~g/mL a~ the highest quantity of antibodie~ and
0.056 ~g/mL as the lowe~t quantity of antibodies.
amples were run in duplicate.
130/GHB - 110 - 18159 ~ ~r~~
The average CPM of the duplicate samples was
compared with the standard curve to calculate the
amount of anti-PRP antibodies present in the
experimental serum 6amples.
Antibody_~çs~ona~~ of adoptive transfer
L~cipients; Antibody responses of ad~pt~ve transfer
rec1pient~ receiving spleen cells primed separat~ly
with PRP-Dr and MIEP, or OMPC, or IAA-OMPC, were mea-
sured by ELISA and RIA in blood samples taken on ~he
indicated days post-immunization with PRP-OMP~. Rec~- -
pients of spleen cells primed separately with PRP-DT,
and eith~r MIEP or OMPC or IAA-OMPC, responded to im-
munization with PRP-OMPC by production of equivalent
amounts of serum IgGl and IgG2a anti-PRP antibody
w~thin ~ d~y~. Irradiated mice reconstituted with ~pleen
cell~ whieh were carrier-primed with MIEP or 0MPC or
IAA-0MPC, had ~ignificantly higher IgG1 (p<0.001) and
IgG2a (p<0.04) anti-PRP antibody titer~ after
immunization with PRP-OMPC than control mice, given
PRP-DT-primed but not OMPC-primed ~pleen cells. The
serum antibody re~pon~e~ to immunization with
PRP-0MPC in mice given ~pleen cell~ prim2d 8eparately
with PRP-DT a~d eit~er ~IEP or OMPC or IAA-OMPC were
comparable to those in mice given ~pleen eell~ primed
2s with PRP-OMPC (p~0.12 for Ig&l antibody o~ day~ 6-13.
and p>0.5 Ior IgG2a antibody on day~ 9-13). ~o
antibody re~pvn~e was ~een when irradiated n~ice
reconætituted with PRP-DT-primed and eitber MIEP or
ûMPC~primed splecn cell~ were immunized with PRP
without a protei~ carrier. Sta~icial a~aly~i~ was
done by two-wa8 analysis of variance (ANOVA)
~Lindeman, ~.~. et al., Introduction to Bivariate and
Mul'ciYariate Analysis, (1980), Scott Foresmall, New
Yo~
These results demonstrate that MIEP
functioned i~ mice as wcll as OKPC ~o induce a
carrier T helper cell recponse for t~e generation of
a~ti-~P IgG antibodies.
6 -",'~ n ~? i
130/G~B ~ 18159IA
EXAMPLE 1 0
Mitogeni~ Activitv of MIEP
MIEP purified from N. menin~itidis OMPC was
tested for mitogenic activity in a lymphocyte
- 5 proliferation assay. Murine splenic lymphocytes were
obtained from C3H/HeN, C3H/FeJ, C3E/HeJl or Balb/c
mice. The mice were either naive or had previously
been vaccinated with PRP-OMPC. The spleen cells were
passed through a sterile, fine me~h screen to remove
the stromal debris, and suspended in K medium [RPMI
1640 (GIBCO) plus 10% fetal calf serum (Armour>, 2 ~M
Glutamine (GI3CO), 10 mM ~epes (GIBCO), 100 u/mL
penicillin/100/~g/mL streptomycin (GIBCO), and 50 ~M
~-mercaptoethanol (Biorad)]. Following pipetting to
disrupt clumps of cells, the ~uspension was
centrifuged at 300 x g for 5 minutes, and the pellet
was resuspended in red blood cell lysis buffer [90%
0.16 M ~H4Cl (Fisher3, 10% 0.7 TRIS-XCl (Sigma), pH
7.2] at room temperature, 0.1 mL cells/mL buffer ~or
two mi~utes. Cells were underlayered with 5 mL of
~etal calf serum and centrifuged at 4,000 x g for 10
minutes, then washed with K medium t~o times and
resuspended in K medium at 5 x 106 cells/mL. These
cells were plated (100 ~L/well3 into 96 well plates
along with 100 ~L of proteiIl or peptide sample, in
triplicate.
The MIEP of N. menin~itidis was purified as
previously described in E~ample 7. Control proteins
included bovine serum albumin, PRP-OMPC and OMPC
itself, and lipopolysaccharide (endotoxin). All
samples ~ere diluted in K medium to concentrations of
1, ~.5, 13 9 26 7 52, 105l and 130 ~gjmL, then plated
::
:
rJ ~
130/GHB - 112 - 181591A
as described above such tha~ their final
concentrations were one-half of their original
concentrations. Triplicate wells were al~o incubated
for each type o~ cell suspended in K medium only, to
determine the baseline of cell proliferation.
On day 3, 5, or 7 in culture, the wells were
pul~ed with 25 ~L of 3H-thymidine (Amer~ham)
containing 1 mCi/25 ~L. The We11B were harYeRted
16-18 hour~ later on a Skatron harve~ter, and counts
per minute (CPM) was measured ;n a liquid
scintillation counte~. The net change in cpm wa~
calculated by ~ubtracting the mean numbe~ of cpm
: ~aken up per well by cells î~ ~ ~edium alone, ~rom
the mean of the e~perimental cpm. The stimulation.
index was determined by divid~ng the mean
experimental cpm by the mean cpm of the control wells.
Lymphocyte proliferation as~ay for ~itogenic
activity of MIEP, in vitro. The increase in 3H-
thymidine incorporation into cellular DNA wa~ measured
20 following exposure of the cells to bovine seru~n
albumin (BSA), PP~P-OMPC, OMPC, ~IEP, or CNBr. HIEP as
well as ONPC and PRP-O~IPC vaccine resulted in
proliferation of lymphocytes from previously
vaccinated mice. Th~s ~itogenic act~vity did ~ot
appear to be due to lipopolysaccharlde (LPS) ~ince the
~IEP was free of detectable L~S, measured by rabbit
pyrogenicity assays, and the proliferatiYe effact was
greater than that which could hav2 been caused by LPS
present in amounts below the level of detectability on
silYer stained polyacrylamide gels.
130/G~B - 113 - 18159IA
EXAMPLE 11
Conjugation of ~. influenzae type-b PRP
polvsa~charide to N. meningitidis MI~P
Chemical conjugations were conducted
according to the method disclosed in U.S. Patent
number 4,882,317.
10 mg of MIEP in 3 mL of 0.1 M borate
buffer, pH 11.5, was mixed with 10 mg of
ethylenediamine tetraace~ic acid disodium salt (EDTA,
lo Sigma chemicals) and 4 mg of dithiothreitol (Sigma
Chemicals). The protein solution was flushed
thoroughly with N2 125 mg of
N-acetylhomocystei~ethiolactone (Aldrich Chemicals)
was added to the MIEP ~olution, and the mixture was
incubated at room temperature for 16 hours. It was
then twice dialyzed under N2 against 2 L of 0.1 M
borate buffer, p~ 9.5, containing 4 mM EDTA, for 24
hours at room temperature. The thiolated protein was
then a~sayed for thiol content by Ellman's reagent
(Sigma Chemicals) and the proteln concentration was
determined by Bradf~rd reagent (Pierce Chemicals).
For conjugation of MIEP to P~P, a 1.5 fold excess
(wt/w~) of bromoacetylated ~. influenzae serotype b
PRP was added to the MIEP olution and the pE was
adjusted ts 9 - 9.5 with 1 N NaO~. The mixture was
allowed to incubate under N2 for 6 to 8 hour~ at room
temperature. At the end of the reaction time, 25 ~L
of N-acetylcysteamine (Chemical Dynamics) was added
to the mixture, and was allowed to stand for 18 hours
under N2 at room temperature. The conjugate solution
was acidified to between pH 3 to 4 with 1 N HCl, and
centrifuged at lO,OGO x g for 10 minutes. l mL of
~ ~ C;'~ '7 ~
130/G~B - 114 - 18159IA
the supernatant wa~ applied directly onto a column of
FPLC Superose 6B (1.6 x 50 c~, Pharmacia) and the
conjugate was eluted with PBS. The void volume peak
which contains the polysaccharide-protein conjugate
~PRP-MIEP), was pooled. The conjugate solution was
then filtered through a 0.22 ~ filter ~or
sterilization.
~XAMP~ 12
Demo~trat~on ~f Immun~g~nici~y of PR~IEP c~nj~te~
Immunizations: Male Balb/c mice (Charle
River, Wilmington, MA) were immunized IP with PRP
co~alently conjugated to ~I~P a~ de~c~ibed in Example
11, using 2.5 ~g PRP in 0.5 mL o~ preformed alum.
Control mice were immunized with equivalent amou~ts
~ PRP given a6 PRP-CRM (2.5 ~g P~P16.2~ ~g C~M; 1/4
of the human do~e), ~P-DT (2.5 ~g PRP/1.8 ~g DT;
1/10 of the human dose), and PR~-OMPC (2.5 ~g PRP/35
~g OMPC; l/4 of the human dose~.
Infant ~hesu~ monkeys, 6-13.5 week~ of age,
were immunized with PRP-MI~P conjugates adsorbed onto
alum. Each ~onkey receivet 0.25 mL of conjugate at
t~o different 8ite6 of injection, ~or a total dose of
0. 5 ~L. The mon~eys were immunized on day 0, 28, and
56, and blood ~ample6 were taken every two to fou~
wee~s.
Antibody re~ponseR were mea~ured by the
ELISA de~cribed in Example 9, which di~tingui~hes the
cla~s and ~ubcla~s of the immuno~lobulin response.
An RIA which quantitateæ the total anti-PRP antlbody
(see Example 9) was also used to evaluate the monkey
re~ponse. PRP-MIEP conjugates were tested for immu-
nogenicity in mice as well as infant rhesus monkeys.
Antibody responses were measured by ELISA and ~IA.
130/GHB - 115 - 18159IA
The results show that PRP-MIEP conjugates
are capable of generating an immune response in
infant Rhesus monkeys and mice, consisting of IgG
anti-PRP antibody and a memory response. This is in
contrast to the PRP-CRM and PRP-DT which do not elict
measurable anti-PRP antibody. Thus, MIEP functions
as an immunologic carrier protein for PRP and is
capable of engendering an anti-PRP antibody response
when covalently conjugated to the PRP antigen.
Purified MIEP is therefore an effective immunologic
carrier protein replacing the heterogeneous OMPC in
construction of bacterial polysaccharide conjugate
vaccines.
E~AMPLE 13
PREPARATION OF MIEP - cPND15 CONJUGATE: -
To 10.5 mL of a MIEP solution (1.85 mg/mL,
19.4 mg total) contained in a 50 mL flask ~as added
2O6 mL of a 0.1 M, pH 11 borate buffer. The pH was
20 adjusted to 10.8 with 5N NaO~ after addition of 37 mg
EDTA and 11 mg dithiothreitol. Then 34~ mg of
N-acetylhomocysteine thiolactone was added and the p~
again adjusted to 11 with 5N NaO~. Thiæ solution was
- degassed, the air replaced with nitrogen and the
solution aged for 23 hours under an atmosphere of
~itrogen.
The sample was then dialized against 4L of
p~9.5 borate containing 10 mL, EDTA for 7 hr; against
a fresh 4L for 22 hrs and finally against a pH 9.5
O.OlM borate buffer containing 1.9 mg DTT for 16
hr~. This treatment afforded a ~olution that
contained a total of 4.84 ~moles o~ thiol (by Ellman
assay). This equates to 249 nanomoles S~/mg protein.
~Z~ 3~
130/GHB - 116 - 18159IA
A 10 mg sample of maleimidated cPND15 from
Example 13 was dissolved in 1 mL of H20 and 50 ~L of
this was used for a maleimide assay by the reverse
Ellman method, to reveal 5.4 ~moles (total) of
maleimide. A 0.~ mL (4.88 ~moles) ali~uot of the
solution was added to the thiolated MIEP solution (pH
9.~), which immediately became turbid and after 3 hrs
and 40 minutes no thiol titer ~by Ellman assay)
remained.
lo The solution (14 mL) was dialyzed twice ~s
4L of a pH 9.5, 0.01M borate buffer for Z7.5 and 38
hrs respectively. An assay on 100 ~L for amino acid
composition gave the following reæults:
nanàmoles/0.1 mL sample: norleucine 1~.9
~-alanine 13.7
lysine 48.8
A Bradford protein assay on 100 ~L showed 0.95
mg/mL. Using a molecular weight of 1111, this
translates as 176.7 ~g/mL of peptide. Thus the
peptide to protein loading was 18.67..
E~AMPLE 14
PREPA~ATI~ OF MI~P-cPND31 ~NJUGAT~:
To 6.5 mL of a MIEP solution (1.7 mg/mL) was
added 1.5 mL of a p~ 11, 0.1 M borate buffer and the
pH adjusted to 11 with 5 ~L of 5N NaOH. To this was
~dded 21 mg of EDTA and 6.5 mg of DTT and solution
was effected by tumbling for 15 min~ Then 200 mg of
N-acetylhomocysteine thiolactone was added, the
solution degassed and the air replaced by N2. After
,
,
J ~j1
130/G~B - 117 - 18159IA
aging in the N2 box for 1.5 hrs., the pH was adjusted
to 10.66 with 5N NaO~, the degassing process
repeated, and ageing continued for 20.5 hrs.
The solution was dialyzed vs 4L of 0.lM
pH9.5 borate con~aining 0.01 M EDTA for 6.5 hr
followed by 4L of 0.1~ pH 9.6 borate, 10 mM EDTA
containing 1 mg dithiolthreitol for 17 hr. An Ellman
assay indicated 2.27 ~moles (total) of thiol which i6
equivalent to 205 nanomoles S~/mg protein.
To this thiolated protein solution was added
O.55 mL of maleimidated cPND31 from Example 14 (3.77
~moles/mg, by reverse Ellman assay, 2.07 ~moles
total). An instant turbidity was ~oted. ~n
additional 0.5 mg of maleimidated cPND31 was added
and the mixture was aged for 1 hour.
To remove unconjugated peptide, the mixture
was dialyzed in dialysis tubing, having a molecular
weight exclusion limit of 12,000-14,000, vs 4L of pH
9.48 0.1M b~rate for ~.25 houræ and ~s 4L of pH 9.68
0.01M borate for 66 hrs. A total of 8 m~ of solution
remained from which 200 ~L was removed for amino acid
analysis:
norleucine 22.8 nanomoles/200 ~L .
lysine 85.9 nanomoles/200 ~L.
The solution was then dialyzed vs 200 mL of
p~ 7.07 0.1 M phosphate buffer which was 5 M in urea,
affording a final volume of 6.5 mL. A Bradford
protein assay revealed 1.26 mg protein/mL (8.2 mg
total). Thus, 0.912 ~moles peptide (8 mL X 22.8
nanomoles/0.2 mL) at a molecular weight of 1204 a 1.1
mg of peptide (total). Therefore, in thi~ case, a
peptide to protein loadi~g of 13% was achieved.
~ 3 ~ f.
130/GHB - 118 - 18159IA
EXAMPLE 15
Solid Sta~ç_Svnthesis of Di~lfide-~onded cPND4:
A linear PND peptide was prepared on Wang
resin using an ABI-431A peptide synthesizer, starting
from Fmoc-L-Cys~Acm)-0-Wang resin (0.61 meq/gram).
Fmoc chemistry and Fmoc-Amino Acid symmetrical
anhydrides (4X excess, prepared in situ) were used as
reagents on a 0.25 mmole scale to generate 745 mg of
the peptide:
Acm ~tr
Fmoc-Nle-Cys-Hi~-Ile-Gly-Pro-Gly-Arg-Ala-Phe-Cys-O-Wang Re~in.
Trt Acm
A solution of iodine in 5% methanol/anhydrous
DME (1 ml) was added to the dried, derivatized Wang
resin shown above and stirred at room temperature for
4 hours. The resin was filtered, washed with
anhydrous DMF (5 ~ 2 ml), and finally resuspended in
DMF (2 ml). Two drops of a 0.1 M solution of sodium
thioæulphate in water were added, and stirred for a
: 2~ few æeconds. The resin was washed with aqueous 95%
DMF (3 ~ 2 ml), anhydrous DMY ~2 ml), methylene
chloride (3 x 2 ml), ether (3 ~ 2 ml) and dried.
The Fmoe and other protecting groups were
: remo~ed by treatment with 20V/o piperidine in DME over
20 minutes, and the resin was washed and dried. The
resin was cleaved from the diæulfide bonded cyclic
peptide by treatment with 95% TFA/4~b ethane
dithiol/1% thioanisole (1 ml) at room temperature ~or
6 hours. The solution ~as filtered, the resin washed
with additional 100% TFA (3 x 1 ml), and the combined
filtrate dried. Material that waæ insoluble in ether
was removed by extraction (3 x 2 ml) and the solution
redried.
,
,' -: ~ ,
:
,
.
~ ~ f `s ~ J r~
,_
130/GHB - 119 - 18159IA
Preparative ~PLC using two 2.12 x 25 cm
Vydac C18 reverse phase columns in series and a
gradient elution of 20 to 24% C~3CN over 90~ allowed
isolation of a sharp peak eluting at 36.~6' under
these conditions. Analytical HPLC yielded a single
peak upon co-chromatography of a known disulfide
bonded cyclic standard with ~he product obtained from
preparative HPLC. FAB-MS gave a [M+H]~ of 1171,
which is consistent with the the disulfide bonded
cyclic structure cPND4 (SEQ ID: 23:):
H-Nle-~ys-~is-Ile-Gly-Pro-Gly~Arg-Ala-~he-Cys-COOH
S C~2
EXAMPLE 16
1. Solution Synthe~i~ of Peptide ~onded cP~D15._
The linear peptide
Cbz-Nle-Lys(Boc)-Gln-Arg(Mtr) Gly-Pro-Gly-Arg(Mtr)-Ala
-Phe was synthesized following solid-phase methods on
an ABI 431A peptide synthesizer using 373 milligrams
(O.1 mmole~) of commercially available
Fmoc-Phenylalanyl-p- alkoxybenzyl alcohol resin.
With the e~cepticn of norleucine, which was purchased
in the benzylo~ycarbonyl ~Cbz) protected form,
L-amino acids used were the fluorenylmethoxycarbonyl
(Fmoc) derivatives having the a~propriate acid-la~ile
side chain protecting groups. The
polypeptide-derivatized resin product was transferred
to a sintered glass funnel, washed with
dichloromethane, and dried, to yield 0.6 g of
polypeptide-re~in product.
rJ, ~
130/GHB - 120 - 18159IA
The peptide was cleaved from the resin by
treatment with 6 ml of a 95:2:3 mixture of.TFA:1,2
ethanediol:anisole for 16 hours. The reaction
mixture was filtered through a sintered glass funnel,
the resin washed with 10 ml TFA, and the filtrates
combined. Following conce~tration to about 1 to 2 ml
of yellow oil, the linear peptide was recovered by
trituration with 400 ml of diethyl ether, in 50 ml
portions, and filtration on a sintered glass funnel.
Dissolution with 100 ml 1% TFA followed by
lyophiliza~ion yielded 298 mg of linear pep~ide.
The peptide powder wa~ dissolved in 800 ml
DMF, neutralized with 0.42 ml diisopropylethylamine,
and treated with 0.077 ml diphenylphosphorylazide.
The solution was stirred in the dark for 70 hours at
4OC to allow formation of the cyclic lactam. After
quenching by addition of 3 ml glacial acetic acid,
the react~.on mixture was concentrated to about 1 to 2
ml of oil, dissolved in 10% aqueous acetic acid~ and
lyophilized.
The cyclic peptide was purified by G-15 size
exclusion chromatography using 5% acetic acid as the
mobile phase. Fractions, monitored by W detection,
cont~ining the peptide were pooled a~d lyophilized to
yield 135 mg of dry cyclic peptide. All result3
obtained were consistent with the structure ePND15:
D ~
Z-Nle-C-N-L\ys-Gln-Arg-Gly-Pro~Gly-Arg-Ala-Phe
(OC)C\ 2 ~=
H2C ,N~I -
- - C ( )
~3[2 ~2
,, ,
130/GHB - 121 - 18159IA
which may also be represented as:
Z-Nle-Lys-Gln-Arg-Gly-Pro-Gly-Arg-Ala-~he
(C~2)4 N C=0
¦ ()
2. Deprotection Qf cPND15 to yield the hydrogen ~orm:
Deprotection of cPND15 was achieved by
dissolving the cyclic peptide in 20 ml of 30% aqueous
acetic acid and hydrogenation at 40 pæi for 16 hours
o~er 100 mg of 10% palladium o~ carbon. The reaction
mixture was filtered over celite to remove the
catalyst, and the filtrate was lyophilized. Reverse
phase HPLC using a Vydac C~8 semi-prep column was
utilized to obtain ~.5 mg of pure deprotected cyclic
peptide. This method of deprotection is-applicable
to all peptides æynthesized as the b~nzylo~ycarbonyl
N-protected peptide, to yield the fre@ hydrogen form
f the peptide which may now be acti~ated at the
amino terminus ln preparation ~or conjugation. The
structure of the product wa~ confirmed by FAB-MS,
analytical ~PLC and amino acid analysis, and all
results were consistent with the structure cPND15:
O ~ ~
H-Nle~ -Lys-Gln-Arg-Gly-Pro-Gly~Arg-Ala-~he
(a)~2: );~=0
~2C
2 ~2
130/GHB - 122 - 18159IA
which may also be represented as:
H-Nle-L ~ ln-Arg-Gly-Pro-Gly-Ar~-Ala-Phe
(CH2~ =0
H
~ XAMPLE 17
Synthesis of cPND31:
Two grams ~0.6 meq/gram) of Fmoc-Phe-~a~
resin was loaded on an ABI 431A synthesizer. Fmoc
: single coupling protocols were used to add Fmoc-Ala,
Fmoc-Arg(Tos)~ Fmoc-Pro, Fmoc-Ile, Fmoc-His(Trt),
: Boc-Lys(Fmoc), and Cbz-Nle to produce 3.7 grams of
linear peptide resin:ha~ing the sequence:
Boc-Lys(N~-Z-Nle)-Hi~(Trt)-Ile-Gly-Pro-Gly-
Arg(Tos)-Ala-Phe.
The peptide was cleaved from the resin by
treating with 95Vb TFA, 5% water for two hour~. The
2~ resin was removed by fil~ration, the TFA removed from
the filtrate by evaporation in vacuo, and the residue
was-triturated with diethyl ether. The precipitate
wa3 recovered by ~iltration and drying to yield 1.7
grams of linear peptide having the sequence:
H-Lys(NE-Z-Nle)-~i6-Ile~Gly-Pro-Gly-Arg(Tos)-Ala-Phe.
The peptide was treated with
Bo~-isoglutamine-ONp (0.71 grams, 2 nmoles,) and DIEA ..
(0.35 ml, 2 mmoles) in~DMF (10 ml) overnight at room
temperature. The DME was evaporated, and the residue
treated with diethyl ether. The precipitate was
recovered by filtration and ~ashed wi~h ethyl
acetate. The dried peptide (l.9 gramg) was treated
rl ~ ~
1301GHB - 123 - 18159IA
with TFA (lO0 ml) for 0.5 hours. The TFA was
evaporated in vacuo, the residue triturated with
diethyl ether and the precipitate was reco~ered by
filtration and dried.
The peptide was desalted on Sephadex G-lO in
10% aqueous acetic acid as the eluent. Peptide
fractions were lyophilized to yield 1.2 grams (0.79
mmoles) of:
H-isoGln-Lys(NE-Z-Nle)-His-Ile-Gly- Pro-Gly-
Arg(Tos)-Ala-Phe
Two batches (0.55 gm, 0.36 mmoles) of the
peptide were separately dissolved in lO00 mL ice cold
DMF and DIEA (0.16 mL, 0.9 mmoles) and DPPA (0.12 mL
were added and the solutions were stirred overnight
at room temperature. The DME ~as evaporated in vacuo
and the residues combined and solubilized in CHCl3.
The organic fraction was washed with 5% aqueous
citric acid, then dried over MgSo4 and evaporated to
yield 0.78 gm of crude cyclic peptide. This material
was treated with liquid ~F (lO mL) containing anisole
(l mL) ~or two hours at 0C. The ~F was evaporated
and the residue was purified by graidien elution on
reveresed phase HPLC (Vydac C l8, 0-50% CH3CN, over
50 minutes using O.l % aqueous TFA as the buffer~ to
give 250 mg of pure cPND31 (M~=1204).
H ~ 0
~-Nle-N(CH2)~ ~C-His-Ile-Gly-Pro-Gly-Arg-Ala-Phe
(~) H~C~C~ CH2C~N C=O
~) 2~NOC k
130/G~B - 124 - 18159IA
EXAMPLE 18
Pr~paration of MaleimidQPropion~l-cPND15:
10 milligrams of cPND15 trifluoroacetate
salt was dissolved in 0.3 ml of a 1:2 mixture of
H20:MeCN. The solution was cooled in an ice bath and
then 100 ~L of 0.345 M NaHC03 solution, followed by
3.5 mg of maleimidopropionic acid
N-hydroxysuccinimide eæter, was added. The reaction
was allowed ~o proceed with stirring for one hour,
lo followed by quenching with 3 ~L of tri$1uroacetic
acid. The reaction mixtur was fil~ered ~hrough a
0.2 micron filter, and the filter was washed with 0.2
ml of wate~. The combined filtrates were injected
onto a 2.15 X 25 cm Vydac C18 reverse phase column.
: 15 The column was eluted i~ocratically for 10 minutes at
a flow rate of 10 ml/min. with 25% MeCN/0.1% TFA,
followed by gradient elution from 25 to 40% MeCN/0.1%
TFA, over 20 minutes. The product eluting between 20
and 32 min was concentrated and lyophilized, yielding
7 mg of the trifluoroacetate salt of
maleimidopropionyl-cPND15 aæ a white amorphous
powder. FAB-MS revealed a major ion (M+H) at 1262.
Titration for maleimide by Ellman assay ~uenching
gave a concentration of 0.54 ~moles per mg o~ the
2s maleimidopropionyl-cPND15.
EXAMPLE 19
Preparation of Maleimidopropionyl cPND31:
Following the procedure o~ ~xample 13, 37.6
mg of the trif luoroacetate ~aIt of cPND31 waæ reacted
wi~h 8.3 mg of maleimidopropionyl N-hydroxy-
,7
130/GHB - 125 - 18159IA
succinimide ester in 0.4 ml of a 0.322 M NaHC03
solution and 1.2 ml of 1:2 H20:MeCN, followed by
quenching with 10.5 ~1 of TFA. Preparative HPLC (30%
MeCN/0.1% TFA isocratic for 10 minutes followed by
gradient elution from 30-50% MeCN over 5 min gave a
product peak eluting between 18-25 min. The
lyophilized product weighed 26 mg, and the maleimide
titer was 0,57 ~M/mg. FAB-MS gave a major ion (M+H)
at 1356. Amino acid analy~iæ gave Nle=460,
lo ~-alanine=420 and Lys=460 nmoles/mg.
NMR analysis ga~e a singlet at 6.93 ppm (maleimide H).
EXAMPLE 20
Protocol for Inoculation of Animals with the MIEP-
cPND15 and MIEP-cPND31 conju~ate of thi~ InventiQn:
Alum was used as an adjuvant during the
inoculation series. The inoculum was prepared by
dissolving the conjugate in phy~iolo~ic saline at a
final conjugate concentration of 300 ~g/ml.
Preformed alum ~aluminum hydroxide gel) was added to
the solution to a flnal level o$ 500 ~g/ml aluminum.
The conjugate was allowed to adsorb onto the alum gel
for two hours at room temperature. Follo~i~g
adsorption, the gel with the conjugate was washed
twice with physiologic saline and resuspended in
saline tG a protein concentration of 300 ~g/ml.
A~rican green monkeys were individually
inoculated with three 300 ~g doses or three 100 ~
doses of the conjugate adsorbed onto alum. Each dose
was injected intramuscularly. The doses were
delivered one month apart ~week 0, 4, 8, 28). The
~, ~" ,,, " ,,-, ~
130/GHB - 126 - 18159IA
animals ~-ere bled at intervals of two weeks. Serum
samples were prepared from each bleed to assay for
the development of specific antibodies as described
in the subsequen~ examples.
~ XAMPLE 21
Analysis of Sera.for ~nti-Peptide IgG Anti~odies:
Each serum sample is analyzed by
enzyme-linked immunoadsorbent assay (ELISA).
Polystyrene microtiter plates were coated ~ith 0.5 ~g
per well of the synthetic peptide (not conjugated to
MIEP) in phosphate-buffered physiological saline
(PBS) at 4C. Each well was then washed with PBS
containing O.05% TWEEN-20 (PBS-T). Test serum,
diluted serially in PBS-T, was added to the
peptide-containing wellæ and allowed to react with
the adsorbed peptide for one hour at 36C. After
~ ~ashing with PBS-T, alkaline pho~phatase-conjugated
goat anti-human IgG was added to the test well~ and
was allowed to react ~or one hour at 36C. The ~ells
were then washed extensively in PBS-T. Each well
received 0.1% p-nitrophenyl phosphate in 10%
- diethanolamine, p~ 9.8, containing 0.~ mM
MgC1~6H20. The ensuing reaction was allowed to
proceed at room temperature ~or 30 minute~, at ~hich
time it was terminated by the addition of 3.0 N NaOH.
The greater the inteIaction of antibodies in
~he test serum with the peptide substrate, the
greater is the amount of alkaline phosphatase bound
onto the well. The pho~phatase enzyme mediates the
breakdown of p-nitrophenyl phosphate into a molecular
130/GHB - 127 - 18159IA
substance which a~sorbs light at a wavelength of 40
nm. Hence, there exists a direct relationship
between the absorbance at 405 nm of light at the end
of the ELISA reaction and the amount of peptide-bound
antibody.
All the monkeys inoculated with the
maleimidopropionyl-cPND15-MIEP and malemidopropinyl
cPND31-MIEP conjugates developed anti~odies
specifically capable of binding the peptide.
EXAMPLE 22
Analysis of Sera for Acti~ity which Specifically
Neutralizes ~IV Inf~Gtivity: _ -
Virus-neu~ralizing activity is determined
with an assay described by Robertson et al., J.
Virol. Methods 20: 195-202 (1988). The assay
mea~ures specific HIV-neutralizing activity in test
serum. The assay is based on the observation that
MT-4 cells, a human T~lymphoid cell line, are readily
suscepti~le to in~ec~ion with ~I~ and, after a period
of virus replication, are killed as a reæult of the
infection.
The test serum is treated at 56C for 60
minutes prior to the aæsay. This treatment is
required to eliminate non-specific inhibitors of HIV
replication. Heat treated serum, serially diluted in
RPMI-1640 cell culture medium, i8 mi~ed with a
standard infection dose of HIV. The dose is
determined priox to the assay as containing the
smallest quantity of virus required to kill all the
MT-4 cells in the assay culture after a period of 7-8
days. The ~erum-virus mi~ture is allowed to interact
~ r~ ~
130/GHB - 128 - i8159IA
for one hour at 37C. It then is added to l.O x 105
MT-4 cells suspended in RPMI-1640 growth medium
supplemented with 10% fetal bovine serum. The
eultures are incubated at 37C in a 5% CO2 atmosphere
~or 7 days.
At the end of the incubation period, a
metabolic dye, DTT, iB added to each culture. This
dye is yellow in color upon visual inspection. In
the presence of live cells, the dye is metabolically
processed to a molecular species which yields a blue
visual color. Neutralized HIV cannot replicate in
the target MT-4 cells and there~ore does not kill the
cells. Hence, positi~e neutralization is asseseed by
the development of blue color following addition of
the metabolic dye.
E~ LE 23
Preparation of a cyclic disulfide for conjugation: ~
1. PREPARATION OF c~ND3~ (SEQ ID: 22:~:
H Nle Cys Tyr Asn Lys Arg Lys Arg Ile His Ile Gly Pro
Gly Arg Ala Phe Tyr Thr Thr Lys Asn Xle
2s Ile Gly Cys-O~ (Cl3s~220N42O33s2
formula wei~ht = ~P2
The 26mer was assembled on the Milligen ~
9050 synthesizer, ~tarting from partially racemised
Fmoc-L-Cys(Trt)-OPKA resin (Milligen batch B 090426,
0.081 meq/g), using 2.47 g (0.200 meq). The
theoretical yield i6 604 mg. The resin was mixed
130/G~B - 129 ~ IA
with an equal volume of glass beadæ (Sigma 150-212
~m). The mixture completely filled tWO 1 X 10 cm
columns, connected in series. Reagents were Fmoc-Pfp
ester (except for threonine, which was d~Bt), usin~
four fold molar excess in N-methyl pyrrolidine
solvent. Side chain protection was: Tyr
(tert-butyl); Lys (Boc); Arg (Mtr); His (Boc); Thr
(tert-butyl); Cys (Trt). The protocol was modified
to give double coupling with LYS~; Ile9: Ilell;
Glyl2; prol3; Glyl4; Argl5; Phel7; Tyrl8; Thrl9;
Thr20; Ile23; Ile24. Acylation recycle times were
extended from 30 to 60 mminutes for all units, except
for Glyl4 and Alal6s and to 90 minutes for Ile9 (2x);
Ilell (2x~, Ile23 (2x) and Ile24 (2x). The
derivatized resin was maintained as the free terminal
amine which wa~ washed with C~2C12 and air-dried.
The mixture of dry derivatized resin and
glass beadæ was resuæpended in 95% TFA, 4% ethane
dithiol, 1% CH3SPh (30 mL) at 23C in a sealed flask,
20 with gentle stirring on an oscillating tray for 8
hours. The bright yellow mixture was ~he~ filtered
and the insolubles were thoroughly extracted with
100% TFA ~3 x 20 mL). The combined dark orange
fil~rate~ ~ere evaporated to give a pale tan, oily
gum. On trituration with ether (20 mL~ thi~ material
instantly became a colorless solid, which was
transferred to a filter by triturating with
additional ether (3 x 20 mL). After drying, the
crude product was obtained as a fine colorless powder
(583 mg)-
130/G~B - 130 - 18159IA
Analytical reverse phase HPLC ~aqueous 0.1%
TFA/2~% CH3CN, ~ = 215 nm, A = O.05, 2.0 mL/min.] on
a 0.46 x 25.0 cm Vydac C18 column of about a 50 ~g
sample, dissolved in 50 ~L aqueous 0.1 % TFA/20~/o
CH3CN, 4 ~L injected, revealed a major component
(36.29') and a later eluting minor component. These
were separately collected after injection of a 30 mg
and another 50 mg aliquot of the sample onto two 2.21
x Z5.0 cm preparative Vydac Cl8 columns in series
lo ~linear gradient over 60': 0.1% TFA/23-27% CH3CN, ~ =
215 ~m, A = 3.00, 10 mL/min]. A total of 35.2 mg of
the earlier eluting material (44.45') and 8.2 mg of
the later eluting material was recovered following
lyophilization. FAB-MS of the major product gave a
~M+H]~ = 302?.1 and an tM+Na]~ = 3044.2, which i~
consistent with the calculated mass.
2. PR~PARATION OF T~E CYCLI~ DI~LFIDE: (S~Q ID: 22):
H-Nle ~ys Tyr Asn Lys Arg Lys Arg Ile ~is Ile Gly Pro
/ Gly Arg Ala Phe Tyr Thr Thr Lys Asn
C\2 Ile Ile Gly C~s-OH
. S -- S~2
: 25
The linear 26 mer dithiol compound (35.~ mg~
was disæol~ed in degassed distilled water (38 mL) at
23 C to give a clear colorless solution at pH 2.73.
The pH was adjusted to 8.5 with 0.1 N NH40H, and the
solution was covered with an atmosphere of nitrogen.
An aliquot of the material was immediately run on
: analytical reverse phase ~PLC and found to be
undergoing o~idation as evidenced by the appearance
of an early peak.
,
130/GH3 - - 131 - 18159IA
With magnetic stirring, a freshly prepared
solution of 0.01 M K3Fe(CN)6 was added by power
driven hypodermic syringe at 23O C under nitrogen.
Analysis of a small aliquot by ~PLC revealed total
conversion of starting material to an earlier elution
time. The reaction mixture (pH 8.3) was mixed with
10% aqueous acetic acid and stirred to give a p~ of
4Ø The solution was filtered to remove insoluble
material, and the faintly yellow solution was
evaporated and then lyophilized to give about 27.9 mg
of a pale yellow powder. The material was dissolved
in 0.1% TFA/20~/o C~3CN and gradient eluted on a
preparative ~PLC. A major early eluting peak and a
later eluting peak (4:1) were separately collected
and lyophilized to yield 6.1 mg of the early and 1.5
mg of the late eluting material. FAB-MS analysis of
the early eluting material: tM~H]+ 3019.7; [M~Na]+
3042.5; FAB-MS analysis of the late eluting
material: [M+~]+ 3020.0; [M+Na]~ early material =
3041.5; all of which corresponds to the correct mass
for the cyclized cPND33. The later eluting material
is the D-cysteine carboxy terminu3 diastereomer.
Amino acid analysis of the products gave the
predicted amino acid eompositions for the cyclized
products and confirmed that the later eluting
material is the D-cysteine containing diaætereomer.
b. AIR OXIDATION:
The linear 26 mer prepared in (1) above (86
mg, 28.4 ~mole~) was dissolved in aqueous 0.1%
TFA/20% acetonitrile (284 mL) at 23 C and the
solution was allo~ed to st~nd open to the air.
' rl ~ ~' 6'
130/GHB - 132 - 18159IA
Cyclization was monitorcd by re~erse phase ~PLC and
the sample was found to be almost comple~ely
converted to the early eluting material, with almost
complete dissappearance of starting linear material,
by t = 24 hours. The clear, colorless solution was
evaporated to about 8 mL at which point an additional
10 mg sample prepared in the same way as the 86 mg,
was added. The combined sample was evaporated to
about 9 mL. The cloudy colorless solution uas
lo subjected to HPLC separation, in ~wo separatc runs,
on two 2.12 x 25.0 cm Vydac C18 column~ in series.
Two fraction~ were separately collected, an early
eluting peak and a later eluting peak. Each peak was
separately evaporated and lyophilized to yield 30.1
l~ mg and 9.7 mg of the early and late materials
respectively. The early eluting mat~rial was
combined with other preparatisns of early eluting
cyclized material to yield a total of 47.5 mg of a
faintly bluish fluffy powder. Analytical EPLC of
this material gave a single peak.
3. PR~PARATION OF 3-MALEIMIDOPROPIONIC A~ID AN~YDRIDE
3~Maleimidopropionic acid (226 mg) was
covered with ~ mL of acetic anhydride and the mixture
was heated at 130C for 3.75 hr, and then aged over
night at room temperatue. The solution was
concentrated to an oil and the NMR spectrum (CDC13)
indicated a mixtuxe of the homoanhydride and the
mixed anhydride of acetic and maleimidopropionic
acids. The ~tarting acid shows the methylene
adjacent to the carbonyl as a triplet centered at
130/GHB - 133 - 18159IA
2.68 ppm whereas in the anhydride these resonances
appear at 2.81 ppm. Purification was effected by
fractional sublimation, first at 70C and O.2 mm and
then at 120C and 0.2 mm. The latter fraction was
removed from the apparatus by dissolving in CDC13,
affording 34 mg of pure homoanhydride on evaporation
of the solvent. This was recrystallized from CDC13
and cyclohexane affording material melting at
143-147C.
Calcd. for C14 H12N2O7: C,52,51;H,3.7~;N,~.75-
Found: C,51.73;H3.67;N,8.16. 200 M~z NMR
(CDC13):2.83 (2H,t)3.84 (2H,t~,6.73 ~2H,s).
4. "SELECTIVE" ACYLATION OF ~PND33
cPND33 (22.5 mg; at estimated 70% peptide is
equivalent to 15.75 mg or 5.212 micromoles) was
dissolved in 12.0 mL of a O.lM pH 5.25
morpholinoethane sulfonic acid buffer and cooled in
an ice bath. Analysis of this solution and progress
of the reaction was ~ollowed by HPLC on a 25 cm ODS
column using 25% aqueous acetonitrile:-0.1%
trifluoroacetic acid (TFA) as eluent.
Maleimidopropionic acid anhydride (2.0 mg, 6.25
micromoles) wa dissolYed in 0.600 mL of dry
tetrahydrofuran, and 0.5 mL of this æolution
(corresponding to 5.2 micromoles of anhydride) was
added to the above peptide solution. After 30 sec.,
a 7 microliter aliquot was removed and evaluated by
HPLC. This assay was repeated at O.25, 0.50, 1.25,
2.25 and 3.0 hr. After 3.5 hr the solution was
J r~
130/GHB - 134 - 18159IA
lyophilized. The lyophylizate was dissolved in 2.0
mL of 20% aqueous acetonitrile, filtered through a
0.2 micron filter and preparatively chroma~ographed
in three 0.700 mL runs on a 21.2 mm x 25 cm Zorbax
C-18 column~ The following elution program was used:
flow rate = 10 mL/min; isocratic elution with 25%
aqueous acetonitrile/0.1% TFA (12 min); gradient to
28% acetonitrile (10 min); gradient to 35%
acetonitrile (8 min). The tail fractions were
isolated by co~centration and lyophilization to
afford 8.9 mg of recovered starting material
(penultimate fraction) and 9.6 mg of a product which
had a mass spectrum ~FAB) indicatiing a molecular
weight of 3172 (i.e the mono-maleimidopropionyl
derivative of cPND33).
The product was further characterized by a
sequence analysis looking for the absence of lysine
(the absence of any sequence would imply terminal
amino acylation). The results indicate that most but
not all of the maleimidopropionyl moiety is bonded to
the ly~ine closest to the carboxy terminus.
While the ~oregoing specification teaches
the principles of the present invention, with
examples provided for the purpose of illustration, it
will ~e understood that the practice of the invention
encompasses all the usual variations, adaptations,
modifications, or deletions as come within the scope
of the following claims and its equivalents.
~ ~ ~ g r, rJ r~
130/GHB - 135 - 18159IA
SEQUENCE LISTING
(1) GENERAL INFORMATION:
li) APPLICANT: Oliff, Allen I
Liu, Margaret A
Friedman, Arthur
Tai, Joseph Y
l O Donnelly, John J
(ii) TITLE OF INVENTION: THE CLASS II PROTEIN OF THE OUTER
MEMBRANE OF NEISSERIA MENINGITIDIS HAVING IMMUNOLOGIC
CARRIER AND ENHANCEMENT PROPERTIES, AND VACCINES
l 5 CONTAINING SAME
(;;;~ NUMBER OF SEQUENCES: 24
(;v) CORRESPONDENCE ADORESS:
2 0 (A) ADDRESSEE: Merck & Co., Inc.
(B) STREET: P.O. Box 2000
(C) CITY: Rahway
~D) STATE: New Jersey
(E) COUNTRY: USA
2 5 (F) ZIP: 07065
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
3 0 (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentln Release #l.O, Version #1.25
- ' ~
130/GHB - 136 - 181591A
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Pfeiffer, Hesna J
(B) REGISTRATION NUMBER: 22640
(C) REFERENCE/DOCKET NUMBER: 18159IA
ix) TELECOMMUNICATION INFORM4TION:
(A) TELEPHONE: 908-594-4251
(B) TELEFAX: 908-594-4720
(2) INFORMATION FOR SEQ ID NO:l:
(;) SEQUENCE CHARACTERISTIES:
(A) LENGTH: 41 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: li near
(ii) MOLECULE TYPE: peptide
- 25 (iii) HYPOTHETICAL: NO
~v) FRAGMENT TYPE: interna1
:
30 (ix) FEATURE
~A) NAME/KEY: Disulfide-bond
(B) LOCATION: 3..38
~ ,~ r~ ~ ~" ~, ~,
130/GHB - 137 - 18159IA
(xi ) SEQUENCE DESCRIPTION: SEQ ID NO:1:
Ile Asn Cys Thr Arg Pro Asn Asn Asn Thr Arg Lys Ser Ile Arg Ile
1 5 lO 15
Gln Arg Gly Pro Gly Arg Ala Phe Val Thr Ile Gly Lys Ile Gly Asn
20 Z5 30
Met Arg Gln Ala His Cys Asn Ile Ser
35 40
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A~ LENGTH: 24 amino acids
(~) TYPE: amino acid
( D ) TOPOLOGY: 1 i near
( i i ) MOLECULE TYPE: peptide
~0
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
:
Tyr Asn Lys Arg Lys Arg Ile His I1e Gly Pro Gly Arg Ala Phe Tyr
: l 5 lO 15
Thr Thr Lys Asn Ile Ile Gly Thr
.
130/GHB - 138 ~ 18159IA
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi~ SEQUENCE DESCRIPTION: SEQ ID NO:3:
Asn Asn Thr Thr Arg Ser Ile His Ile Gly Pro Gly Arg Ala Phe Tyr
1 5 1 5 10 15
Ala Thr 61y Asp Ile Ile Gly Asp Ile
2 0 (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 amino ac;ds
(B) TYPE: amino acid
2 5 ID) TOPOLOGY: linear
l;i) MOLECULE TYPE: pept;de
3 0
(xi) SEQUENCE DESCRIPTION: sEq ID NO:4:
Asn Asn Thr Ary Lys Ser Ile Arg Ile Gln Arg Gly Pro Gly Arg Ala
1 5 10 15
Phe Yal Thr Ile Sly Lys Ile Gly Asn
130/GHB - 139 - 18159IA
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
tA) LENGTH: lB amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
lxi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
.
Arg Ile Gln Arg Gly Pro 61y Arg Ala Phe Val Thr Ile Gly Lys Ile
1 5 1 5 10 15
Gly Asn
2 0 (2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 11 am;no acids
(~) TYPE: amino acid
2 5 (D) TOPOLOGY: linear
(ii) MGLECULE TYPE: peptide
:
: 3 0
(xi) SEQUENCE DESCRIPTION: SEO, ID NO:6:
Arg Ile Gln Arg:61y~Pro Gly Arg Phe Val Thr
1 5 10
.
,
: .
.:
. ,
: ` :
J ~ J
130/6HB - 140 - 181591A
(2) INFORMATION FOR SEQ ID NO:7:
(;) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8 amino atids
(B) TYPE: amino acid
~D) TOPOLOGY: li near
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
His Ile Gly Pro Gly Arg Ala Phe
l 5
(2) INFORMATION FOR SEQ ID NO:8:
~i) SEQUENCE CHARACTERISTICS:
2 0 (A) LENSTH: 6 amino acids
(B) TYPE: amino acid
~D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
:
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
3 0 61y Pro Gly Arg Ala Phe
,
130/GHB - 141 - 18159IA
(2) INFORMATION FOR SEQ ID NO:9:
(i) SE~UENCE CHARACTERISTICS:
(A) LENGTH: 9 am;no acids
(8) TYPE: amino acid
(D) TOPOLOGY: linear
(i;) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
Ile Gln Arg Gly Pro Gly Arg Ala Phe
1 5
1 5
(2) INFORMATION FOR SEQ ID NO:10:
(;) sEquENcE CHARACTERISTICS:
~A) LENGTH~ 9 amino acids
2 0
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(;i) MOLECULE TYPE: peptide
2 5
'
(%i) SEQUENCE DESCRIPTION: SEO lD NO:10:
3 0 Ile Tyr Ile Gly Pro Gly Arg Ala Phe
1 5
:..
~ 3
130/GHB - 142 - 18159IA
(2) INFORMATION FOR SEQ ID NO~
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
~xi) SEQUENCE DESCRIPTION: SEQ ID NO:ll:
Ile Ala Ile Gly Pro Gly Arg Thr Leu
l 5
(2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
2 0 (A) LENGTH: 9 amins ac;ds
(B) TYPE: amino acid
(D) TOPOLOGY: linear
: (ii) MOLECULE TYPE: peptide
2 ~
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
3 0 Val Thr Leu Gly Pro Gly Arg Val Trp
1 5
j r~
130/GHB - 143 - 18159IA
(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids
S (B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
Ile Thr Lys Gly Pro Gly Arg Val Ile
1 5 1 5
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
2 0 (A) LENGTH: 9 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: pept;de
2 5
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
3 0 Thr Pro Ile Gly Leu Gly Gln Ser Leu
1 5
130/GHB - 144 - 181591A
(2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids
~B) TYPE: amino acid
~D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(x;) SEQUENCE DESCRIPTION: SEQ ID NO:15:
Thr Pro Ile Gly Leu Gly Gln Ala Leu
l 5
(Z) INFORMATION FOR SEQ ID N0~16:
li) SEQUENCE CHARACTERISTICS:
2 0 (A~ LENGTH: 9 amino acids
(B) TYPE: amino acid
: (D) TOPOLOGY: llnear
: (ii) MOLECULE TYPE: peptide
2 5
: '
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
lle His Phe Gly Pro Gly Gln Ala Leu
- 130/GHB - 145 - . 18159IA ''
~2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(~i) SEQUENCE DESCRIPTION: SEQ ID NO:17:
Ile Arg Ile Gly Pro Gly Lys Val Phe
1 5 1 5
(2) INFORMATION FOR SEQ ID NO:lB:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4 amino acids
2 0
(B) TYPE: am;no acid
(D) TOPOLOGY: b~th
: .
,
: : (ii) MOLECULE TYPE::peptide
~ : 2 5
-: :
xi) SEQUENCE DESCRIPTION: SEQ ID no:l8:
Gly Pro Gly Arg
. 130/GHB - 146 - 18159IA
(2) INFORMATION FOR SEQ ID NO:l9:
(;) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 4 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l9:
Gly Pro Gly Lys
1 5
(2) INFORMATION FOR SEQ ID NO:20:
(i) SEQUENCE CHARACTERISTICS:
2 0 (A) LENGTH: 4 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
2 5
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:
Gly Pro Gly Gln
,-
.
f v of
130/GHB - 147 - 18159IA
(Z) INFORMATION FOR SEQ ID NO:21:
~i) SEQUENCE CHARACTERIST.CS:
(A) LENGTH: 4 amino acids
(B~ TYPE: amino acid
(D) TOPOLOGY: both
~ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:
Gly Leu Gly Gln
(2) INFORMATION FOR SEQ ID NO:22:
(i) SEQUENCE CHARACTERISTICS:
2 0 (A) LENGTH: 26 amino ac;ds
(B) TYPE: amino acid
(D) TOPOLOGY: both
.
(ii) MOLECULE TYPE: peptide
.
(ix) FEATURE:~
(A) NAME/KEY: Mod i f i ed-s i te ~ -
(B) LOCATION: 1
3 0(D) OTHER INFORMATION: /label= Nle
/note= "norleucine"
~ " ~ ~j r~ J
130/GHB - 148 - 18159IA
(ix) FEATURE:
(A) NAME/KEY: D;sulfide-bond
(B) LOCATION: 2..26
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:Z2:
Leu Cys Tyr Asn Lys Arg Lys Arg Ile His Ile Gly Pro Gly Arg Ala
1 5 ~O 15
Phe Tyr Thr Thr Lys Asn Ile Ile Gly Cys
(2) INFORMATION FOR SEQ ID NO:23:
1 5
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 11 amino ac;ds
(B) TYPE: am;no acid
(D) TOPOLOGY: both
2 0
(;;) MOLECULE TYPE: pept;de
(ix) FEATURE:
2 5 (A) NAME/KEY: Modified-s;te
(B) LOCATION: 1
(D) OTHER INFORMATION: /label- Nle
/note= "norleucine"
:
: 3 0
(x;) SEQUENCE DESCRIP7ION: SEQ ID NO:Z3:
Leu Cys His Ile Gly Pro Gly Arg Ala Phe Cys
1 5 lû
130~GHB - 149 - 18159IA
(Z) INFORMATION FOR SEQ ID NO:24:
(;) SEQUENCE CHARACTERISTICS:
(A) LE'JGTH: 4 amino acids
(P) TYPE: amino acid
(D) TOPOLOGY: both
(i;) MOLECULE TYPE: peptide
(x; ) SEQUENCE DESCRIPTION: SEQ ID NO:24:
Gly Pro Gly Val
