Note: Descriptions are shown in the official language in which they were submitted.
WO90/1514~ PCT/GB90/00~1
~ 1 --
POLIOVIRUS CHIMAERAS
The present invention relates to cassette vectors
suitable for use in the pr~paration of poliovirus chimaeras.
The icosahedral poliovirus particle is composed of
sixty copies of each of four capsid proteins, VPl - VP4,
which enclose a positive sense single-stranded RNA genome of
approximately 7500 nucleotides. Because of their importance
in protective immunity the antigenic sites on the capsid
10 proteins of the three poliovirus serotypes have been studied
in detail. These studies have revealed the existence of at
least four independent antigenic sites, which induce the
production of neutralising antibodies. Antigenic site 1 is
a continuous epitope, comprised of residues 91 to 102 of
lS capsid protein VPl. Sites 2, 3 and 4 are conformational,
being composed of residues from more than one capsid
protein. These sites can be readily located on the
3-dimensional crystallographic model of the virus where they
form part of the surface topography.
As part of a wider study of poliovirus antigenicity
relevant to the development of new and improved poliovirus
vaccines, we have previously reported the construction of a
- type l/type 3 poliovirus chimaera (Burke et al Nature 332,
81-82, 1988). This virus, which exhibits dual antigenicity,
25 was constructed by the replacement of antigenic site 1 of
- the Sabin type 1 poliovirus vaccine strain by the
corresponding region of a type 3 s~rain using
oligonucleotide-directed mutagenesis (Kramer et al, Nuc.
Acids Res. 12, 9441-9456, 1984) on an infectious full-length
30 Sabin 1 cDNA clone (Stanway et al, J. Virol. 57, 1187-1190,
1986). The virus induced an immune response against both
type 1 and type 3 polioviruses in mice, rabbits and
primates.
The Sabin strain of type 1 poliovirus has an
35 established safety record as a vaccine. This, coupled with
extensive experience of its manufacture and control, make
the Sabin 1 vaccine strain a particularly attractive vector
. .
,
,
. . . - . . -, . . , . ~ :
~:
WO90/t514~ PCT/GB90/00~l
ZC`55~
-- 2 --
for use as a vehicle for the expression of potentially
important epitopes from other pathogens. Since polivoirus
is able to induce a mucosal as well as a systemic immune
5 response the approach may be of considerable value where the
pathogen in question infects via a mucosal surface where
secretory antibodies may play a role in protection from
infection.
The cassette approach to n vitro mutagenesis has
10 been reported before for poliovirus (Kuhn et al, Proc. Natl.
Acad.~Sci. USA 85, 519-523, 1988~. It has been employed in
the construction of antigenic site 1 chimaeras based upon
the neurovirulent Mahoney strain of poliovirus (Martin et
al, EMB0, J. 7, 2839-2847, 1988; Murray et al, Proc. Natl.
15 Acad. Sci USA 85, 3202-3207, 1988). The cassette approach
was also employed in EP-A-0302801 in preparing hybrid type 1
poliovirus in which a heterologous epitope replaces the C3
epitope which is normally exposed on the surface of the
capsid of the poliovirus.
A cassette vector has now been constructed which
allows rapid and extensive modification of antigenic site 1
of the Sabin 1 poliovirus vaccine strain, Pl/LSc 2ab.
~ Unique restriction endonuclease sites flanking antigenic
'! site 1 have been engineered into a full-length infectious
25 Sabin 1 cDNA clone with minimal alteration to the coding
sequence. This facilitates replacement of this region by
oligonucleotides encoding foreign amino acid sequences.
Results indicate that this region is highly flexible in
terms of number and sequence of amino acids which can be
30 acco~modated. The approach has general applicability to any
atter.uated strain of poliovirus type 1.
Accordingly, the present invention provides a
cassette vector suitable for use in constructing poliovirus
chimaeras, which vector comprisès, under t~e control of a
35 promoter, a full length infectious cDNA of an attenuated
strain of type 1 poliovirus having Sal 1 and Dra 1 sites
flanking antigenic site 1 of the poliovirus as follows
:' :
-
WO90/1514~ PCT/GB90/00~1
55~
- 3 -
92 93 102 103
... GTC GAC - X - TTT AAA ...
Sal l Dra l
S where the numbers represent the numbers of amino acids of
the VPl capsid protein and X represents intervening
nucleotides of DNA, present in sufficient numbers to allow
the vector to be digested with both Sal l and Dra l, the
said Sal l and Dra l sites being the only Sal l and Dra l
lO sites in the vector.
This cassette vector can be employed to present
foreign antigenic determinants. Foreign epitopes can be
inserted at antigenic site l to replace VPl amino acid
;~residues 94 to 102, thereby obtaining poliovirus chimaeras
- 15 capable of acting as epitope presentation systems, for
example vaccines. The cassette vector has the additional
advantage that the Sal 1 and D~a 1 sites are unique to the
entire vector, allowing replacement of the region flanked by
~these sites in a single step and thus obviating the need for
-20 subcloning steps in the construction of recombinant cDNAs.
The amino acid change at position 102 from aspartic acid to
;phenylalanine, resulting from the creation of the Dra l
site, does not affect the viability and growth properties of
the vector.
Preferably the cassette vector comprises an
infectious full length cDNA clone of the Sabin strain of
poliovirus type 1 into which the Sal 1 and Dra l sites have
been engineered. In such circumstances, X represents the
codons for amino acid residues 94 to lOl of the VPl capsid
- 30 protein of Sabin type l. A suitable spacer region X is one
which represents a DNA sequence enccding VPl amino acid
residues 94 to lOl of-the attenuated strain of type l
poliovirus being used. X can, however, d~note a DNA
r sequence from which one or more of these codons is missing
; 35 or, indeed, represent a longer sequence. Typically X
~consists of from 6 to 30 nucleotides, for example from 9 to
;:.
. .
; '
.. `, .. .
, .
. - ,
^,~ '. . , - . ' .: . -
WO90/15145 PCT/GB90/00~1
Z(~55~`~3~
24 nucleotides.
The cassette vector is typically a plasmid. The
plasmid generally comprises an origin of replication, so
5 that it is replicable in a host which harbours it.
Typically the host is a microbial host such as a strain of
bacterium e.g. E. coli. The plasmid also generally
comprises a marker gene such as an antibiotic-resistance
gene. A preferred plasmid is pCAS1. E. coli MC1061
10 harbouring pCASl has been deposited at the National
Collection of Industrial and Marine Bacteria, Aberdeen, GB
on 25th May 1989 under accession number NCIMB 40148.
Cassette vectors according to the present invention
are, like pCAS1, generally double-stranded. The nucleotide
15 sequence, and amino acid sequence according to the one
letter code (Eur. J. Biochem. 138, 9-37, 1984), for pCASl
and other type 1 vectors which do not have missing any site
1 codons in the region of antigenic site 1 is:
91 105
T V D N S A S T K N R F K L F
ACCGTCGACAACTCAGCTTCCACCAAGAATAAGTTTAAACTATTT
TGGCAGCTGTTGAGTCGAAGGTGGTTCTTATTCAAATTTGATAAA
SalI PraI
A cassette vector according to the invention may be
25 prepared by first engineering the Sal 1 and Dra 1 sites into
a full length infectious cDNA of an attenuated strain of
type 1 poliovirus. This may be achieved by subcloning a
partial fragment of the cDNA into a single-stranded cloning
vector such as one of the M13 vectors and creating the Sal 1
30 and Dra 1 sites by site-directed mutagenesis using
appropriate oligonucleotides. The modified fragment is then
reintroduced into the cDNA from which it has been derived.
The cDNA ~ay be provided with a promoter, for example a T7
promoter. Alternatively some full length cDNAs are
~ 35 infectious in which case a promoter is not strictly
- necessary. The cDNA is introduced into a vector having no
Sal 1 and Dra 1 sites. The vector may be pFBI 2 (Pharmacia)
which has been modified to remove its three Dra 1 sites.
... .
:, .
.
.
.:
.~ .
. . .
W090/15l45 PCT/GB90/00~1
~55~ ;
,~ . ,
- 5 -
Alternatively, the Sal 1 and Dra 1 sites can be
provided by using a polymerase chain reaction (PCR) method.
The published method of "overlapping PCR" (Recombinant PCR
5 by R. Higuchi in l'PCR Protocols: A guide to methods and
applications", editors Innis, Gelfand, Sninsky and White,
Academic Press, 1990) can be employed. This method
overcomes the use of a single-stranded vector for site-
directed mutagenesis by the application of the PCR to
lO introduce, via degenerate oligonucleotides the Sal 1 and
Dra l~restriction sites.
In order to obtain a cassette vector in which the
spacer region X is modified, i.e. which does not include the
normal codons for VPl amino acid residues 94 to 101, a
15 cassette vector prepared as just described is digested with
Sal 1 and Dra 1 and an appropriate DNA fragment is ligated
with the digested vector. Alternatively, such a vector may
be obtained by site-directed mutagenesis or by the PCR
method.
A modified spacer region X can therefore be
provided by digesting a cassette vector according to the
invention with Sal 1 and Dra 1 and ligating a double-
stranded DNA fragment comprising the desired nucleotide
- sequence X into the digested vector such that the Sal 1 and
25 Dra l sites of the vector are retained. Alternatively, the
region separating the Sal 1 and Dra 1 sites may be
engineered into a full length infectious cDNA of an
attenuated strain of type 1 poliovirus. The cDNA is
provided with a promoter, for example a T7 promoter, and is
30 introduced into a vector having no Sal 1 and Dra 1 sites.
Where it is wished that X comprises one or more further
restriction sites unique to the cassette vector, the vector
into which the cDNA is introduced must not also cont~in
these sites.
A cassette vector according to the invention is
preferably an expression vector. The full length infectious
poliovirus cDNA is therefore generally provided in a vector
with a promoter and other transcriptional and translational
.
:' .
.. . . . ... .
. . - -
.. . .. .
W090/15145 PCT/GB90/00841
2~;5~
-- 6 --
control sequences required for expression. The vector into
which a cDNA is cloned may be the plasmid pJM1 or a similar
vector based on pAT153 from which the gene encoding
5 tetracycline resistance has been removed and replaced by a
gene cassette encoding kanamycin resistance. This gene -
cassette may be from the transposon Tn 903. The plasmid
therefore carried both kanamycin and ampicillin resistance
genes. The latter gene is totally removed and replaced by
10 the poliovirus cDNA above. The extreme 3' end of the vector
may be provided with a Mlu 1 restriction site.
A cassette vector can be constructed in which X
represents a nucleotide sequence which results in a
frameshift for the downstream poliovirus coding sequence.
15 This prevents the recovery of virus in which the region
between the Sal 1 and Dra 1 sites has not been modified by
the provision of a nucleotide sequence which restores the
reading frame.
The nucleotide sequence denoted by X therefore
20 contains 3n-1 or 3n-2 nucleotides, in which n is an integer
of at least 1. Typically n is an integer from 2 to 10, for
; example from 3 to 8. A suitable vector is provided in
- particular when n is 4. X may denote any nucleotide
sequence provided the result is a frameshift in the
- 25 downstream poliovirus coding sequence.
A cassette vector can also be constructed in which
X includes at least one restriction site, such as a Sst II,
~; Not I or Mlu 1 site. The or each restriction site should be
the only site of that type in the vector or at least in the
30 poliovirus coding sequence. The provision of a unique
restriction site within the spacer region X allows the
digestion of the ligation reaction (vector plus
oligonucleotide/restriction fragment insert). Self re-
~ ligated vector is digested by the restriction enzyme for
: 35 which a site is provided within the spacer region X. The
; recovery of self re-ligated vector can therefore be
~ significantly reduced, if not prevented altogether.
. .
,
.. ~ :, , : .,. -
., - ,,. , , ... ' , : ' , ,, ~ .
.: , , , . , , . ~ , :
WO90~1514~ PCT/~B90/00~1
~ 2~55~3
-- 7 --
A cassette vector can further be constructed in
which a stop codon is provided in the spacer region X. This
ensures that the protein encoded by the cassette vector is
5 prematurely terminated and can not be recovered. The stop
codon can be introduced in conjunction with a frameshift by
providing a nucleotide sequence X having a length of 3n-2
nucleotides. The nucleotides of the Dra 1 site then provide
the stop codon as follows.
*
TT TAA A
where * denotes the stop codon. A cassette vector can be
provided which incorporates within the spacer region X any
combination of a frameshift, a unique restriction site and a
15 stop codon. A particularly preferred plasmid in which all
three are present is pCAS7, which is double-stranded. E.
coli MC1061 harbouring pCAS7 were deposited at the National
Collection of Industrial and Marine Bacteria, Aberdeen, GB
on 18 April 1990 under accession number NCIMB 40277. The
20 nucleotide sequence, and amino acid sequence according to
the one letter code, for pCAS7 is shown in the accompanying
Figure in which:
(a) shows the Sst2 and Mlul sites and * denotes a
~i stop codon;
~b) shows the Sall and Dral sites (underlined) and
* denotes the stop codon;
(c) shows how the poliovirus coding sequence can be
restored to the correct reading frame: and
(d) shows the provi~ion of a Mlul site at the
30 extreme 3' end of the poliovirus coding sequence.
The cassette vectors of the invention can be
~ employed to present foreign antigenic determinants. Foreign
- epitopes can be inserted at antigenic site 1 to replace VPl
amino acid residues 94 to 102, thereby obtaining poliovirus
35 chimaeras capable of acting as epitope presentation systems,
e.g. vaccines.
Poliovirus chimaeras which present a foreign amino
. ' , : . ' .: . '. " ' '., . . ' ' , ' , ''' : : : .": ' . . ,
.: ' : ~. . ' . '. ', .', ', . . ' : .. ' . :
.: . . : . . . , , . , . .: . .
, . . : ,. . . . . . . . .
,. . : , ., :, ... , ,. :
WO90/1~145 PCT/GB90/00~1
~"~ ` ~ ~
acid sequence at antigenic site l are prepared by a process
comprising:
(i) providing a double-stranded DNA fragment which
5 encodes the amino acid sequence and which has a 5'-Sal l
cohesive end and a 3'-blunt end;
(ii) digesting a cassette vector according to the
invention with Sal 1 and Dral and ligating the fragment from
step (i) with the digested vector; and
(iii) obtaining live virus from the modified vector
obtained in step (ii).
Step (i) is generally conducted by constructing a
double-stranded DNA fragment by synthesising complementary
oli~onucleotides and annealing the oligonucleotides. The
l5 oligonucleotides may be boiled together for from 2 to 5
minutes, for example for about 3 minutes, and allowed to
cool to room temperature. Alternatively, a restriction
fragment may be provided.
In step (ii) the DNA fragment, for example the
20 annealed oligonucleotides, is ligated with a cassette vector
which has been digested with Sal l and Dra l to excise the
intervening DNA. E. coli may then be transformed with the
ligation mix. Where the spacer region X contains a site for
a restriction enzyme and the site is unique to the cassette
25 vector, the ligation mix is digested with the restriction
enzyme. This is to prevent recovery of the re-ligated
parental cassette vector. The ligation mix is screened for
- the presence of the recombinant vector.
Live virus is recovered from the modified full
30 length cDNA by production of a positive sense RNA. The
vector incorporating the foreign DNA fragment is cut by a
restriction enzyme outside the Sabin l cDNA. The promoter
- controlling transcription of the cDNA then enables RNA to be
obtained. A T7 promoter is particularly suitable for
35 dire~ting transcription in vitro (van der Werf et al, Proc.
Natl. Acad. Sci. USA 83, 233~-2334, 1986). The recovered
-~ RNA may be applied to tissue cultures by standard techniques
.
. , .
. . -. , . , ~ . . - , -
~ ' ' ' `. , ' . , .
WO90/15145 PCTtGB90/00~1
~ 5 ~
g
tKoch, Curr. Top. Microbiol. Immunol. 61, 89-138, 1973).
For example, the ~NA can be used to transfect Hep2C
monolayers. After 4 to 6 days incubation, virus can be
5 recovered from the supernatant of the tissue culture.
Any foreign amino acid ~equence may be inserted in
this way into antigenic site l of an attenuated strain of
poliovirus type l. The foreign amino acid sequence may be
composed of from 5 to 50 amino acid residues, for example
lO from 6 to 30 residues or from 8 to 20 residues. By
"foreign" is meant that the amino acid sequence is different
from the amino acid sequence of antigenic site l of the
attenuated strain of type l poliovirus being employed.
Typically the foreign amino acid sequence is not an amino
15 acid sequence derived from a poliovirus.
The foreign amino acid sequence comprises an
epitope to which it may be desired to raise monoclonal or
polyclonal antibodies. A monoclonal antibody may be
produced by any known method. For example, a mouse, rat,
20 rabbit or non-human primate is innoculated with the
recombinant virus of the invention. After a sufficient time
has elapsed to allow the host animal to mount an immune
response, antibody producing cells, e.g. the splenocytes are
removed and immortalized by fusion with an immortalizing
25 cell line such as a myeloma cell line. The resulting
fusions are screened for antibodies to the foreign amino
acid sequence. The antibodies may be, for example, of the
IgG or IgM type. Polyclonal antiserum may also be produced
u~ing known methods, using, for example, the animals
30 mentioned above.
The epitope may be flanked by one or more spacer
amino acid residues at either or each end. From l to 4
- spacer residues may be provided at either or each end. The
spacer residues may be A or G residues or a combination of
35 both. Alternatively residues from the original poliovirus
~, sequence may be employed.
; An epitope may be provided to any known or
predicted antigenic determinant which is capable of raising
"
.,
~ ' ', .: ' ' ' , ' ' "" ': . ' ........................ ' : : : .
. : . . ; . . : :
WO90/1514~ PCT/GB9OtO0~1
2~55~3~
-- 10 -- .
neutralising or non-neutralising antibody. The foreign
amino acid sequence may for example comprise an antigenic
determinant capable of raising neutralising antibody to a
5 pathogenic organism. The epitope may be derived from a
virus, bacterium, fungus, yeast or parasite. More
especially, the epitope may be derived from a type of human
immunodeficiency virus (HIV) such as HIV-l or HIV-2,
hepatitis A or B virus, human rhinovirus such as type 2 or
10 type 14, herpes simplex virus, poliovirus type 2 or 3, foot-
and-mQuth disease virus, influenza virus, coxsackie virus,
the cell surface antigen CD4, Chlamydia trachomatis, RSV and
HPV e.g. HPV 16. The epitope may be the CD4 receptor
binding site from HIV, for example from HIV-1 or -2.
15 Examples of specific epitopes are shown in the Examples.
For reasons which are not entirely clear, not all
foreign amino acid sequences enable viable viruses to be
obtained. Whether or not a viable virus presenting a
particular epitope can be obtained can be determined by
20 carrying out the process steps (i) and (ii) and by seeking
to obtain viable virus according to step ~iii). Where a
foreign sequence does not give rise to viable virus, it may
be possible to alter the sequence slightly to that viable
virus i5 produced, e.g. by shortening or lengthening the
25 se~uence or by substituting one or more amino acid residue.
Alternatively, viable chimaeras may be recovered following
the modification of other regions of the particle, for
example surface adjacent residues. A test may therefore
need to be undertaken to see if a particular foreign amino
30 acid sequence will give rise to viable virus.
The poliovirus chimaeras that are obtained can be
used as vaccines. They may therefore be formulated as
pharmaceutical compositions further comprising a
pharmaceutically acceptable carrier or diluent. Any carrier
35 or diluent conventionally used in vaccine preparations may
be employed. For example, the presently used live
attenuated poliovirus strains are stabilised in a solution
of lM MgC12.
..... - . .. , ,. . . . . : . . - -
.. : ,
.,
: : . : . ,
WO90/15145 PCT/GB90/00841
~, 2~S~ 1.3' ' ' '
The poliovirus chimaeras may therefore be used to
prevent infections and/or diseases in a human or animal.
The chimaeras may also be administered for therapeutic
5 reasons. For this purpose, they may be administered
orally, as a nasal spray or parenterally, for example by
subcutaneous or intramuscular injection. A dose
corresponding to the amount administered for a conventional
live poliovirus vaccine, such as from 105 to l06-5TCID50,
lO may be given although the dose will depend upon a variety of
factors including the viability and replicative capacity of
the poliovirus chimaera.
The ~ollowing Examples illustrate the invention.
ExamDle l: Construction of casse~e vector ~CASl
- 15 Taking advantage of codon degeneracy, the
nucleotide sequence of Sabin l cDN~ in the region 2740-2800
was searched for sequences at which restriction endonuclease
sites unique to the cDNA could be introduced with minimal
alteration to the amino acid sequence. It was observed that
; 20 a Sal l site at nucleotide 2753 could be created without
alteration to the amino acid sequence and that this site
would be unique within the virus ~eguence. Similarly a
~; unique Dra l site could be created at position 2783
; resulting in the replacement of aspartic acid tVPl residue
25 102) by phenylalanine.
The synthetic oligonucleotides
5'-GGAAGCTGAGTTTCGACGGTTATAATGG-3' and
5'-CACTGTAAATAGTTTA _ CTTATTCTTGG-3' (bases inducing changes
~ underlined) were used to create Sal l and Dra l restriction
.'~,
" . . . ~ . . . . ........................ . . . ......... . . ..; . ~ . . ... . . . . . . . .....
W O 90/1514S PC~r/GB90/00841
r ~ `; ~;;
2C~S~ 3
sites at positions 2753 and 27B3 respectively on a 3.6kb
~pn 1 partial fragment (nucleotides 66-3660) of an
infectious Sabin 1 cDNA (Stanway et al, J. Virol. 57,
1187-1190 1986) subcloned in M13mpl8, using the
gapped-duplex mutagenesis technique (Rramer et al, Nuc.
Acids Res. 12, 9441-9456, 1984). The alterations made to
the antigenic site were confirmed by dideoxy cha~n
termination sequencing.
The nucleotide and amino acid equence of poliovirus
Sabin 1 illustrating changes introduced in the con~truction
of pCAS1 are shown below. Nucleotides 27S0-2794 of the cDNA
sequence of the viral sense strand are shown, together with
the location of the introduced restriction sites. The
resulting amino acid change to phenylalanine from aspartic
acid at position 102 is shown in parenthesis.
ANTIGENIC SITE 1
91 (F) 105
T V D N S A S ~ X N R D K L F
ACC GTG GAT AAC TCA GCT TCC ACC AAG AAC AAG GAT AAG CTA TTT
GTC GAC TT~ AAA
Sal 1 Dra 1
The mutated fragment was introduced into a full-
length 1 cDNA of Sabin type 1 onto which a T7 promoter had
previously been engineered at the extreme 5~ end. This
full-length clone was subsequently transferred into vector
pF3I 2 (Pharmacia), which had been modified to remove its 3
Dra 1 sites at positions 2052, 2071 and 2763, by insertion
.
'~
SUBSTITUTE SHEET
` . , , -. .. .,, . ~ .,~ . ,
,. , ~ :. .: ' . .
. . .: ~
, ~ ' ~.' .. .
,, .
WO90/15145 PCT/GB90/00~1
2(~5~.5~.3
- 13 -
of an Eco R1 linker following Dra 1 digestion. An Eco R1 -
Sal 1 fragment carrying this ~odified full-length poliovirus
clone was ligated into Eco R1-Xho 1 digested pFBI 2-derived
vector thereby destroying this Sal 1 site. The re~ulting
plasmid, pCASl, therefore contained a full-length Sabin 1
cDNA under the control of a T7 promoter ~nd in which the
introduced Sal 1 and Dra 1 sites were unique.
~ Recovery of infectious virus from Nael linearised
pCAS1 was achieved following transfection of Hep 2C
monolayers with transcripts produced in vitro by T7 RNA
polymerase (Stratagene) as previously described (van der
Werf et al, Proc. Natl. ~cad. Sci. USA B3, 2330-2334, l9B6).
The genomic sequence of recovered virus was verified by
primer extension sequencing of viral RNA (Rico-Hesse et al,
Virology, 160, 311-322, 1987). The single substitution of
aspartic acid for phenylalanine at residue 102 had no
apparent effect on virus viability. Furthermore the design
of the cassette was such that the altered amino acid would
be lost upon insertion of replacement sequences.
.
Example 2- Construction of a chimaeric poliovirus containinq
- residues 735-752 of the transmembrane ~lycoprotein qp41 of
.
HTLV-IIIB
The residue numbers 735-752 are those as defined by
Kennedy et al, Science 231, 1556-1559, 1986. 100 n~ each of
~; complementary oligonucleotides encoding the HIV-1 sequence
of choice were boiled for three minutes and allowed to cool
;' .
. .
~'''
SUBSTITUTE SHEET
. . . ....... .
: '~ "`'. '.' ' . '
'.'' ' " ;'''~,...... ' "''' : '" '
" ' . ' . : .
WO90/t~145 PCT/GB90/00~1
Z ~ ~ 5 ~ 4 ~;
to room temperature. The oligonucleotides were:
TCGACCGCCCTGA~GGCATCGAGGAAGAGGGCGGTGAGCGCGATCGTGATCGTTCG;
and
GGCGGGACTCCC~TAGCTCC~TCTCCCGCCACTCGCGCTAGCACTAGCAAGC.
Aliquots of this annealed mix were then ligated with
Sal l - Dra 1 digested pCAS1. Competent E. coli were
transformed with the ligation mix ~nd screened for the
pres~ence of a recombinant plasmid containing the HIV
sequence inserted. The resulting recombinant pla~mid,
pS1/env/3 was linearised with NaeI, which cuts within vector
sequences of the construct, and used as a template in a T7
transcription reaction (van der Werf et al, Proc. Natl.
Acad. sci. USA 80, 5080-5084, 1983) prior to transfection of
sub-confluent Hep2C monolayers.
After three to four days a cytopathic effect was
observed. The RNA sequence of approximately 200 bp spanning
antigenic site 1 of the recovered chimaeric virus S1/env/3
was confirmed by primer directed ch~in termination
sequencing. The nucleotide and amino acid sequence of the
region of antiqenic site 1 of pC~S1 and of the corresponding
region of pSl/env/3 are shown below. Bql 1 and Pvu 1
~estriction sites, introduced into pS1/env/3 to aid in the
screening of recombinant plasmids, are shown underlined as
are the Sal 1 and Dra 1 sites in pCAS1.
. .
.. ' .
... .
~ T ~ E.
.. . . . . . :
WO90/lS145 PCT/GB90/00~1
~``'"` 2~55~3~
`,, ,
- 15 -
pCASl
91 105
T V D N S A S T K N K F K L F
ACCGTCGACAACTCAGCTTCCACCAAGAATAAGTTTAAACTATTT
SalI DraI
pS1/env/3
T V D R P E G I E E E G G E R D R D R
10 ACCGTCGACCGCCCTGAGGGCATCGAGGAAGAGGGCGGTGAGCGCGATCGTGATCGT
TGGCAGCTGGCGGGACTCCCGTAGCTCCTTCTCCCGCCACTCGCGCTAGCACTAGCA
`:
Bqll Pvul
S K L F
` TCGAAACTATTT
15 AGCTTTGATAAA
Example 3: Characterisation of Sl/env/3
The antigenic properties of S1/env/3 were
investi~ated. The virus was neutralized by poliovirus type
1 polyclonal antisera, and by monoclonal antibodies directed
; 20 against antigenic sites 2 and 3 of the Sabin 1 strain (data
not shown). However monoclonal antibodies specific for
antigenic site 1 of Sabin 1 did not neutralize the chimaeric
virus. The monoclonal antibodies failed to recognize the
chimaera in antigen blocking tests (data not shown), thus
25 confirming that this site was altered in the chimaera.
The recent observation that the structure of
antigenic site 1 may influence poliovirus host range
prompted us to investigate the interaction of S1/env/3 with
the poliovirus receptor. Sl/env/3 infection of Hep2C
.:: .
30 monolayers was blocked by a MAb ~pecific for the receptor
(Minor et al, Virus Res. 1, 203-212, 1984), thus
demonstrating that the chimaera still used the normal
~ .
.
..
- .
:~,
~, , ' .`. '~ ~' '.: .. .. '
WO90/t5145 PCT/GB90/00~1
s ;., ~ '
~ - _ 16 -
poliovirus ce ~u~ar receptor for attachment and entry into
cells.
The ability of S1/env/3 to absorb out the HI
neutralizing activity of antipeptide monoclonal antibodies
or of human immune sera was investigated. Preincubation o~
antibodies with sucrose cushion purified S1/env/3 abrogated
the neutralization of ~TLV-IIIB by the IgM monoclonal
antibodies ~Mab) ED6 and LA9 which were raised against the
corresponding qp41 peptide, amino acids 735-752 (as defined
above). Preincu~ation with S1/env/3 also reduced the
neutralization of HTLV-IIIB by five of six human immune
sera. In contrast the neutralization of HTLV-IIIB by ~n
IgG1 MAb ~110.3), mapping to the type specific loop in the
second conserved region of env (amino acids 307-321) was not
inhibited by S1/env/3. Moreover, preincubation with Sabin
type 1 poliovirus had no effect on the neutralization of
HTLV-IIIB by ED6, LA9, 110.3 or the human immune cera.
; - The results are ~hown in Table 1 below, where they
are expressed as the reciprocal of the serum dilution giving
>90% reduction in ~IV titre 5Weiss et al, Nature 324,
572-575, 1986) followin~ pre-incubation of the MAbs or human
$mmune sera with culture medium (Mock), Sabin 1 or S1/env/3.
Human immune sera numbered 1-6 represent anonymous HIV+
blood donors. 5xlO~ TCIDso units of sucrose purified
Sl/env/3 or Sabin 1 were preincubated with a 1:10 dilution
^~. of the ED6, ~A9, a 1:100 dilution of 110.3 and a 1:1
~ dilution of each human serum for 1 hour at 37C. Residual
.~ .
,',- . .:'' ' '''., ' ', ',. . ,.', . . ~ . ; ~ . ::
WO90/15145 PCT/GB90/00~1 .
2~e;S~3
.. , . ~ ,
~ ;, i`
- 17 - 4, ~
HIY-neutralizing activity was determined by incubating
dilutions of the antibody/virus mixture with 103 infectious
units ~TCIDso) of HTLV-IIIB for 1 hour at 37C. 100 ~1 of
medium containing 2xlO-~ C816~ cells were added, and the
presence of syncytia recorded after 4~ hours a~ an
indication of HIV infection.
Table 1: Sl/env/3 inhi~ition of HTLV-IIIB neutralization
~TLV-IIIB neutr~lization titre - pre-inc~bation with
Mock Sabin 1 S1/env/3
: Monoclonal Antibodies
ED6 640 640 0
LA9 640 640 0
i 110.3 1000 1000 1000
-`~ Human Sera
~"~5 1 160 160 20
2 40 40 10
3 40 40 10
. ,.
`. 4 B0 60 20
320 160 40
i 6 ao 80 80
The immunogenic potential of S1/env/3 was
investigated by raising antisera in rabbits. Neutralizing
activity against HIV-1 was determined by infectivity
~:'
, .
. . ~ . .
,, :
. .
SUB JTITUTE SHEET
.
-~ . , . . .. . .: . :
' ''
WO90/1514~ PCT/GB90/00~1
2~55i3 18 -
inhibition and plaque reduction assays. All ~ntisera showed
neutralising activity against RTLV-IIIB confirming that the
chimaera has immunogenic potential. Antiserum Rl which
contained the highest ~nti-poliovirus activity wa~ further
tested ~gain~t a range of HIV-l isolate~. This antiserum
neutralized the entire test panel at various titres,
including the African isolates CBL4 (Tanzania) and Z84
(Zaire). The neutralizing titres observed in both
neutralization assays used were in good agreement.
Antisera R7 and R8 also neutralized the HIV-l
isolates tested (HTLV-IIIRF or Z84), though the titres
observed were lower against both HIV-l and Sl/env/3.
Pre-immune sera and hyperimmune Sabin l rabbit antisera
displayed negligible neutralizing activity against any of
the HIV-l isolates. The HIV-l neutralizing activity of
antiserum Rl was absorbed out by pre-incubation with the
chimaera, but not with Sabin l, confirming that the ~ctivity
was induced by ~he gp41 epitope and not by a chan~e cross-
reactive polioviru6 epitope. Antiserum Rl was also tested
for its ability to inhibit early syncytial formation in a
mixture of HTLV-I~I9 p~oducing cells and uninfected C8166
cells, a T cell line sensitive to ~IV-mediated fusion.
Antiserum ~1 was found to inhibit HIV-induced cell fusion,
though at lower titre than that determined by virus
inhibition (data not ~hown).
Table 2 below shows the results of neutralization of
HIV-l infectivity and inhibition of syncytium formation by
~ .
,~
~ ~'7T ~
. .: . . ~ . ,
.. . , . . . : -. ~
WOgO/IS145 ~PCT/GB90/00~1
~ 9 _ 2c~5~si3`'' ~
S1/env/3 antisera. Rabbit R1 was imm`unised intradermally
with O.lml tapprox. 10~ TCIDso ml ') of sucrose purified
S1/env/3 in complete Freunds adjuvant, and boosted
subcutaneously at two week intervals with the same virus
preparation in incomplete Freunds adjuvant. Rabbits R7-R9
(S1/env/3) and R19-R21 (Sabin 1) were immunised
intramuscularly with O.Sml of tissue culture fluid ~approx.
10~ TCID50 ml~1~ in complete ~reunds adjuvant, And boosted
at t~wo week intervals in a similar manner. Neutralization
titres were determined by incubatin~ 1 of heat
inactivated antiserum with 40~1 of virus supernatant
containing 103 infectious units of HIV-1 at 37C for 1 hour.
Residual HIV-1 infectivity was measured by the
infectivity inhibition assay (Weiss et al, 1986) described
in relation to Table 1. Antiserum R1 was also tested for
~IV-1 neutralising ac~ivity in a plaque reduction assay
~Harada et al, Science 229, 563-565, 1985) on the sensitive
~T4 cell line. The results obtained by this independent
assay are shown in brackets. Results are expressed as the
reciprocal of the serum dilution giving >90% reduction in
HIV infectivity or plaque formation. Also shown is the
reciprocal neutralisation titre of Sl/env/3 antisera with
,;
100 TCID~o units of the homolo~ous virus. nt - not tested.
.
.: .
: .
',
: - .
.:
': .~ . . .
, '. ~. .
'~; . , ~ '': . . .: :
.. . . .
'. . '
'
,: . . . , . . : '
2~55~ PCT/GB90/00~1 .
"~ 20 - ~ ;
~able 2: Neutralization of ~IV-1 ~nfectivit~ and inhibition
of syncytium form~tion bY Sl/env/3 antiser~
Reciprocal neutralization titre
Virus strain
Antiserum
Rl IIIB IIIRF SF2 SF33 C~L4 Z84 Sl/env/3
pre-immune ~10 <10 <10 C10 <10 <10 <10
final bleed 80 80 80 40 10 40 ~28960
(40) (40) (160) (40) (80) (40)
R7
pre-immune <10 <10 nt nt nt <10 <10
final bleed 20 40 nt nt nt 40 >2560
R8
pre-immune <10 <10 nt nt nt nt <10
final bleed 40 20 n~ nt nt nt >2560
R9
::: pre-immune <10 <10 nt nt nt nt <10
: final bleed 40 10 nt nt nt nt 1280
R19, R20 and R21
pre-immune ~10
post-immune <10
Monoclonal antibodies were raised against S1/env/3,
and their reactivity with S1/env/3 but not the parental
Sabin 1 was demonstrated in anti~en blocking tests (data not
shown). Four MAbs specific for S1/env/3 were characterized
in terms cf their rea~tion with several HIV-1 isolates. One
MAb ~1577) displayed neutralizing activity against all ~IV-1
isolates tested, including the three African strains CBL4,
Z84 and Z129. Monoclonal antibodies lS75 and 1583 displayed
a more restricted respone neutralizing only ~ome of the .
isolates, suggesting that.they recognize a defined epi~ope
':',
-:
.''
,
,: - - . . . . . . . .
WO90/t5145 PCT/GB90/00~1
Z~i~3`
- 21 -
within the qp41 735-782 region, that is less well conserved.
Monoclonal antibody 1578 displayed no ~IV-l neutralizing
activity, suggesting that it recognised an epitope formed
from both ~IV-1 and poliovirus amino acids.
The neutralization of RIV-1 infecti~ity by S1/env/3
monoclonal antibodies ~s shown in T~bl~ 3. Murine
monoclonal antibodies were raised as descr$bed by Fergusson
_ al, J. ~en. Vir~l, 65, 197-201 (1984), and screened
aga~nst S1/env/3 and Sabin 1 in ~ntigen bloc~ing tests~ The
S1/env/3 and HIV-1 neutralizing activity of the ascites from
four hybridomas was determined. Results are expressed as
the reciprocal of the MAb ascitic fluid dilution giving >90
reduction in HIV-1 titre, or neutralizing 100 TCID~o units
of Sl/env/3.
,
Table 3: Neutralization of HIV-1 infectivitv by S1/env~3
monoclonal antibodies
Monoclonal Antibody - ~eciprocal Neutralization titre
Virus Strain
Mab IIIB IIIRF SF33 CBL4 Z84 Z129 S1/env/3
1575 40 20 40 10 lO <10 2560
1577 40 160 80 20 20 1~ 640
1578 <10 <10 <10 <10 <10 <10 640
1583 40 40 20 <10 <10 <10 >28960
The specificity of the ~IV-1 immune response to
i~ S1/env/3 was demonstrated by Western blotting and by a
. - .
,
SUBSTITUTE SHEET
~,; . , ' . ~ :. , . : -
WO90/t5145 PCT/GB90/00~1
$~i~;3`
;y~ 22 -
peptide binding assay. Antiserum R1 reacted with the
envelope glycoprotein precursor gpl60 and gp41 in Western
blots whereas pre-immune ~era was negative. All the rabbit
antisera bound specif~cally to a linear synthetic peptide
corresponding to the ~T~V-III3 epitope prei~ient on the
SI/env/3 chimaera whereas they falled to bind to a 15 amino
acid pept~de derived from the type spec~fic neutralization
epit~ope on gp~20 (residues 307-321). Pre-immune sera and
control rabbit hyperimmune Sabin 1 antisera (R19, 20, 21)
displayed no specific binding to either the gp41 or gpl20
derived peptides. The three SI/env/3 monoclonal antibodies
which neutralized ~IV-1 (1575, 1577, 1583) also reacted with
the gp41 735-752 peptide in peptide binding assays (data not
shown).
Example 4: Construction of chimaeric polioviruses containinq
amino acid sequences from hepat_tis A virus, rhinovirus
tvpes 2 and 14 and coxsackie B4 virus
Short sequences of hydrophilic amino acids, as chown
in Table 4, from the capsid protein VP1 of Hepatitls A
virus (Najaran et al, Proc. Natl. ~cad. Sci. USA
82,2627-2631, 1985), which might constitute potential
antigenic sites, were inserted into the Sal 1-Dra 1 digested
pCASl vector accordinq to the procedure described in Example
2. Appropriate oligonucleotides were annealed by boiling -
and allowing to cool to room temperature prior to ligation
into Sal l-Dra 1 digested pCASl. T7 transcripts prepared
. ., ~
.
,
. .,
,,;
WO90/15145 PCT/GB90/00~1
- 23 _ 2 ~
from the resulting recombinant plasmids were used to
transfect Hep 2C monolayers (van der Werf et al, 1986). All
plasmids containing the Hepatitis A virus inserts gave rise
to viable virus 24-36 hours post-transfectlon. The sequence
of each recovered v1rus was confirmed by sequencing viral
RNA (Rico-Hesse et al, 1987).
Similarly oligonucleotides corresponding to known or
predicted epitopes from human rhinovirus (HRV) serotypes 2
(Skern et al, Nuc. Acids Res. 13, 2111-2126, 1985) ~nd 14
(Stanway et al, NUC. Acids Res. 12, 7~59-7875, 1984) ~nd
from the capsid protein VPl of Coxsackie B4 virus (Jenkins
et al, J. Gen. Virol. 6~, lB35-1848, 1987) were ligated into
pCAS1. Resultinq plasmids were tested for viability as
above. Sequence analysis of genomic ~NA confirmed that
recovered viruses had the expected modifications of
antigenic site 1. In one case, however, a recombinant
; plasmid containing an insert sequence tmarked *) from
Coxsackie B4 virus did not produce viable virus upon
repeated transfection although the DNA sequence of the
engineered site was correct.
.
:
:
~,
..
:.......................................................................... .
, . .
. , ~ : '., .
:- .. :;.'
:
. ~.: ,:;:
WO90/15145 PCT/GB90/00841
~ .24 -
Table 4: Amino acid sequences inserted into PcAsl and their
origin
Virus Amino acid sequence Location
Sabin 1 NSAST~NRD VP1 94-102
CAS 1 NSASTRNRF VP1 94-102
Sabin 3 NEQPTTRAQ VPl 92-100
~epatitis A (N)EQNPVD(D) VP1 15-20
~DL~GRANRGRMD VPl 29-41
ELRPGESRHTSD VP1 70-81
TFNSNN~EY VP1 99-108
NSNNKEYT~D) VPl 111-118
(N)ATDVDG(KD) VPl 150-155
NTRRTGN(~D) VP1 191-197
(N)G~GDRTDS VPl 217-224
DPRSEEDXRFE VP1 290-300
Rhinovirus 2 ~LEVTLANY VPl 81-89
; 14 ~DATGIDNHREA VPl 85-96
14 (N)MYVPPGAPNP(D) VPl 151-160
~ 14 (N)~LI~AYTPPGARGPQD VP3 126-141
- Coxsackie ~4 (N)SAESNNL(D) VPl 81-87 ~--
IYIKYSSAESNNL~ VPl 75~87
.~ Residues in parenthesis correspond to amino acids
which have been retained from the wild-type Sabin 1
sequence.
Example 5: Construction of further viable poliovirus ::
chimaeras
Following the procedure described in Example 2,
viable poliovirus chimaeras were constructed by inserting
l annealed complementary oligonucleotide encoding the epitopes
;, shown below into the Sal 1 - Dra 1 digested pCAS1.
.~ .
"
. .
SUB~TITUTE SHEET
WO9Otl5145 PCT/GB90/00~1
,~i~, 1
- 25 - ~ 3
HIV-l
Sl/env~1 GGDMRDNWRSELY residues 469-482
Sl/env/4 NMWQEVGRAMYAPPISG residues 423-439
Sl/env/5 AAPRNPRNRA (-ve strand) residue~ 48-57
(Numbering of residues is according to the sequence of the
molecular clone NY5/LAV-l as referenced in "AIDS and ~uman
Retroviruses lg88" compiled by G. Myers, ~os Alamos, US).
` gp41 residues 598-609 according to Gnann et al, J.
Virol. 61, 2639-2641, 1987
(D) L G L W G C S G
TC GAC CTG GGG TTG TGG GGT TGC TCT GGA
L I C T T
AAG CTT ATT TGC ACC ACT
: CD4
Sl/CD4/1 NQGSFLTRGPSR~ND residues 64-78
(Numbering of residues is according to Maddon et al, Cell
42, 93-104, 1986 quoting the unprocessed polypeptide)
Herpes Simplex Virus type 1
e
Sl/HSV/1 LRMADPNRFRGRDL residues (gD) 9-22
~r (Numbering of residues is according to Minson et al, J. Gen.
`~ Vi~ol. 67, 1001, 1986)
-
Influenza Virus
. .
A S;./flu/1 NACRRGPGSGFFS residues ~HA) 137-149
(Numbering of residues is according to the sequence of
Aichi/2/6P~(X-31) reported in Laver et al, Nature 283,
,
:~''," .
., .
~SlJ~ T~ E SHEET
..
" . ~ . , ,
. . .
WO90/15145 PCT/GB90/00~1
: ~2~5~3 - 26 -
., , , . ,~
454-457, 1980).
Haemagglutinin residues lB6-200 (site B) according to
Wiley et al, Nature 289, 373-378, l9B1
(D) S T N Q E Q T S
TC GAC AG~ ACT AAC CAG GAA CAG ACC ~CA
.
L Y V Q A S G
CTG TAC GTG CAG GCA TCA GGA
.
Poliovirus type 2 Sabin strain
S1/2 NDAPTRRAS VP1 residues 94-102
(Numbering of residues is according to Minor et al, J. Gen.
Virol. 67, 1283-1291, 1986)
Chlamydia trachomatis
serovar A MOMP VAG~ERDPVA MOMP A no. 2
, VAGLENDPVA MOMP A no. 1
serovar B MOMP NNFNQTKVSNGAFV MOMP B
serovar C MOMP TRTQSSSFNTAgLI (non-viable)
serovar L2 NENHATVSDS MOMP L2
,
~; (MOMP - major outer membrane protein; epitopes are according
to Baehr et al, Proc. Natl. Acad. Sci. USA 85, 4000-4004).
Foot-and-mouth disease virus
V~1 40-49 VRVTPQNQIN FMDV5/6
. .
*VP 140-160 AVPNLRGDLQVLAQRVARTLP FMDVABCD
-~.
~ VPl 142-153 NLR~D~QVLAQ FMDV1/2
. . .
~ VPl 147-156 DLQVLAQRVA FMDV3/4
,
VP1 200-213 RYKQKIIAPAKQLL FMDV7/8
,
:, . .
, . . , . . . ~ . , ! . ,
.-' " - .' . '. .- ' " ' ' "' '' " '' ". ~. . ' ' ~. ' ' . ', ' ' ' . ''. "' " ' ' '" ' ' '." '.~' ' . ,
WO90/1514~ PCT/GB90/00~1
`.
- 27 ~ ' 2, ~5~13
(Numbering of residues is according to the sequence of lR
strain as reported by Forss et al, Nuc. Acids Res. 12,
6587-6601, 1984 apart from the entry marked * which is an
epitope identified by Bittle et al, Nature 298, 30-33, 1982
and Pfaff et al, EM~O J. l, ~69-874, 1982).
Human Panillomavirus tvne 16 (HPVl6)
, ~
Ll rès~dues 269-284 according to Patel et al, J. Gen. Vi~ol.
70, 69-77, 1989
~D) E N V P D D L Y I
TC GAC GAA AAC GTG CCA GAC GAC TTG TAC ATT
K G S G S T A
AAA GGA TCA GGA TCC ACC GCA
Respiratory Syncytial Virus (RSV)
Fusion glycoprotein (Fl) residues 221-229 according to
Trudel et al, J. Gen Virol. 68, 2273-2280, i987
(D) (N) I E F Q Q K N N R
TC GAC AAC ATT GAA TTC CAG CAG AAA AAC AAC AGA.
,
.,
"
:; .
',',''
.--.
.'~',' .
,o,i
:: .. - . . .. ~ : -
. . , ,, . ., : . : . , . . . : .
.. .. . . . . . . . .
WO 90/15145 PCl'tGB90/00841
~, t~"~ 2~3 - ' I
- 28 -
ExamPle 6: Construction of cassette vector PCAS7
Cassette vector pCAS1 is described in Example 1.
pCAS7 was obtained from pCAS1 as follows:
5(a) The Sall and ~ral sites are maintained in the
same position as pCASl, as is the remainder of the Sabin 1
poliovirus sequence which is unmodified (see point d).
(b) The region separating the Sal 1 and Dra 1
sites has been modified in the following way; 1) The
10 poliovirus sequences have been removed and, 2) replaced with
oligonucleotides containing two restriction sites unique to
Sabin 1 which 3) result in the introduction of a
"frameshift" i.e. the polyprotein reading frame is not
maintained, thereby preventing the recovery of virus in
15 which the region separating the Sal 1 and Dra 1 has not been
modified. To further ensure the latter, we have also
introduced a stop codon that will be read immediately
following the frameshift, therefore prematurely terminating
the polyprotein.
~c) The plas~id vector in which the poliovirus
sequence is cloned has been changed. The new vector is
called pJM1, and is based upon pAT 153, from which the gene
~,~ encoding tetracycline resistance has been removed, and
- replaced with a gene cassette encoding kanamycin resistance
25 (from the transposon Tn903). This vector therefore carries
~oth kanamycin and ampicillin resistance genes, but the
latter is totally removed and replaced with the Sabin l
sequence. This vector has proved to be far more stable than
~; the original one used for pCASl (which was the commercially
` 30 made pF81), and results in faster growing colonies which
contain few, if any, deleted plasmids.
(d) The extreme 3' end of the poliovirus sequence
has been slightly modified by the addition of a Mlul
- restriction site (through since this lies outside the poly-
35 A tail it could be considered a vector restriction site into
which the poly-A tail is cloned). The recognition sequence
of ~lul is A'CGCGT, and cleaves between the A and the C. We
,
;,.'~
.. - .. ,. .. . . - .. - ,. : . , . . - :
, .. . ~ . . . .. , . . - , .
.: - , : . ., , . . . . , ~
- . .. . . . .
. . ,; , . , .. . .. : . , . . - .: :
: : , .. . , .: .. .: .
~. . . , . , . . . . ; . , ..
: ,, . : , ,. : ;
WO90~1~145 PCT/GB90/00~1
- 29 - 2~ 3
therefore cut recombinant (chimaeric) cDNA~s with Mlul prior
to producing runoff transcripts for transfection.
Exam~le 7: Construction of viable Poliovirus chimaeras usinq
CAS7
Following the producedure described in Example 2,
the following constructs have been generated with pCAS7.
All these chimaeras are viable.
Name Sequence amino acid numbers
10 a) Containing sequences derived from HIV-1 gpl20. (Unless
otherwise stated all ~IV-l sequences are based upon the BRU
isolate catalogued by Myers et al., 1989 (AIDS and Human
Retroviruses, 1989. Los Alamos National Laboratory, Los
Alamos USA), and originally sequenced by Wain-Hobson et al
15 1985 Cell 40: 9-17. Some of the chimaeras are variations
upon particular sequences eg. Sl/env/2a. The only
exceptions to this are S1/env/2b which is based upon the MN
. ,~
isolate -~equence, and Sl/env/6 and Sl/env/7 which are
respectively based upon the MAL and ELI isolates. All these
20 isolates are catalogued in the Myers et al 1989 reference).
Sl/env/2a LGIWGCSGKLICTT 598-611
Sl/env/2b LGFWGCSGKLICTT 598-611
:Sl/env/3 DRPEGIEEEGGERDRDRS 735-752
-S1/env/6 NMVAGRKAIYAPPIERN
25 S1/env/7 NTWQGYGQAMYAPPIEG
S1/env/8 NSASQRGPGRAFTRNKF
Sl/env/9 APPISGQISCSSNID 441-455
S1/env/10 LPCRIKQFINMWQEVG 421-436
b) Containing sequences derived from HIV-l nef
,
.~J 30 Sl/nef/l VRERMRRAEPAADG 16-29
~ .
,Sl/nef/2 LEAQEEEEVGFPV 58-70
`~ Sl/nef/3 GLEGLIHSQRRQDILD 97-112
Sl/nef/4 VPVEPDKVEEANKGEN 146-161 --
,
., , ~
: , . , ., .: , : . , . . .:
. :. - , , -: ~. - :
W090/15145 PCT/GB90/00~1 ,
2~5~i13 '~` '
- 30 ~ !
c) Containing sequences derived from HIV-2 gpllO (Based
upon the original sequence by Guyader et al 1986 Nature 326:
662-669, catalogued by Myers et al 1989)
5 Sl/env/ll NTWHKVGRNVYLPPREG
1.
d) Containing sequences derived from SIVmac251 (Based upon
the original sequence by Franchini et al 1987 Nature 328:
539-543, catalogued by Myers et ~1., 1989)
-S1/SIV/1 PVTIMSGLVFHSQPLTD 324-340
10 Sl/SIV/2 NTWHKVGKNVYLPPREG
.'
e) Containing sequences derived from human CD4 (Based upon
the original sequence by ~addon et al 1986, Cell 42: 93-104)
Sl/CD4/3 NQIKILGNQGSFLTKGPSKLNDRAD 32-56
Sl/CD4/3i NQIKILGNQGSFLTRGPSKLNDRAD 32-56
15 f) Containing sequences from Hepatitis A Virus (Originally
sequenced by Emini et al 1985 J. Virol 55: 836-839)
HepA VPl constructs
Sl/H18 VDTPWVEKESALS 166-178
Sl~Hl9 ITLSSTSNPPHGL 111-123
,. .
-20 Exam~le 8: Antiaen chimaera of poliovirus induces antibodies
aaainst HPV16
;;The growth characteristics and antigenicity of the
HPV16 chimaera of Example 5 were investigated. This
chimaera was designated S1/HPV16/Ll. Growth characteristics
,25 were assessed in Hep-2c cells. Confluent Hep-2c monolayers
in 35-mm tissue cultures dishes (Sterilin) were washed twice
with phosphate-buffered saline (P~S) and infected at a
;,multiplicity of infection of 10 PFU per cell. Separate
culture dishes were infected with poliovirus type 1 Sabin
30 strain and S1/HPV16/Ll.
Virus was adsorbed for 13 minutes at rsom
temperature, and then pre-warmed medium was added and the
plates were incubated at 34C. At regular points of time
~
.
.'~'
.
, ......................................................................... .
~ . .
,
, - ,. .- . , . , ,, . : . .
. - . . .. . . .... ... .
,
W090/15145 PCT/GB90/00~1
- 31 - 2~ 3
over a period of 15 hours, medium was aspirated and the
cells were washed twice in PBS before being scraped from the
dish into a 1.5 ml tube. Cells were pelleted and then lysed
5 by being resuspended in 0.1 ml of buffer containing 0.1 M
Tris (pHl.5), 0.1 mNaCl, 1.5 mM NgC12 and 0.25% (vol/vol)
Nonidet P-40 (Sigma Chemical Co, St. Louis, Missouri, US).
Virus titres in the lysate were determined by
plaque assay on Hep-2c cells grown in six-well dishes
10 (Corning Glass Works, corning, New York, US). Sl/HPV16/Ll
repli`cated slightly less well than the unmodified Sabin 1 in
hep-2c cells, producing a titre of 1o8-4 compared with 109
for Sabin 1. The plaques formed by S1/HPV16/L1 were
indistinguishable in size from those of Sabin 1.
The antigenic character of S1/HPV16/L1 was examined
by a standard neutralisation assay (Jenkins et al, J.
Virol., March 1990, 54(3), 1203-1206). Sl/HPV16/Ll was
neutralised by the anti-HPV16 monoclonal antibodies (Mabs)
8C4, ID6 and 5A4, which are specific for peptide 269-284 of
~ 20 Ll-HPV16, and by a polyclonal serum raised against a
; L1-HPV16/~-galactosidase fusion protein. However, the virus
was not neutralised by Mabs which recognised other regions
of L1-HPV16.
In a radioimmunoprecipitation assay, a 1/400
25 dilution of Mab 5A4 recognised Sl/HPV16/Ll, whereas Mab IC6
failed to react at a dilution of 1/10. Neither antibody
recognised Sabin 1. This suggests that the antigenicity of
the HP~16 sequence expressed on the surface of poliovirus
closely resembles that of the papillomavirus capsid antigen
30 found in infected cells, although it was of interest that
one Mab specific for peptide 269-2~4 (3D1) did not
neutralise and failed to recognise the chimaera in a
radioimmunoprecipitation assay. The chimaera was also
` neutralised by polyclonal Sabin 1 antiserum and by Mabs
35 raised against Sabin 1 antigenic sites 2 and 3. As
expected, the chimaera was not neutralised by a site 1-
specific Mab (955).
- . ............................ . .
, ' . :' ' . ~:.' . . , , :
W090/15145 PCT/GB9~iU0841
Z~S~S~3 ~
t~ - 32
Infection of Hep-2c-monolayers by Sl/HPVl6/Ll was
blocked by a Mab specific for the cellular receptor of
polioviruses (Minor et al, Virus Res. 1, 1984, 203-212).
5 This demonstrated that the chimaera retained its capacity to
bind to an enter cells via the normal route used by
polioviruses. ~his observation also suggests that the
extensive modification of antigenic site l did not confirm
novel receptor-binding properties on the virus.
The immunogenicity of Sl/HPVl6/Ll was assessed in
rabbits by subcutaneous inoculation in adjuvant. Sequential
bleeds from each of three animals showed an increase in
antibodies which neutralised the chimaera. The sera also
showed an increase in reactivity in ELISAs against the
15 ~-galactosidase/Ll-HPVl6 fusion protein (amino acids 172 to
375) and the Ll-HPVl6 peptide 269-284. Similar results were
obtained when a different fusion protein of tryptophan E
synthatase and Ll-HPV16 residues l to 505 were used as a
solid phase target. No reactivity against Ll-HPVl6 peptides
20 299 to 313 and 329 to 343 was observed.
Since HPVl6 can not as yet be cultured in vitro,
large amounts of purified virions are unavailable for
immunological assay. The ability of the rabbit antisera
raised against Sl/HPVl6/Ll to recognise HPVl6 virions was
' 25 therefore tested by immunoperoxidase staining of HPVl6-
positive human biopsy material. Representative rabbit
antisera raised against Sl/HPVl6/Ll (third bleed serum from
- a rabbit~ contained antibodies which detected HPVl6 antigen
- in human tissue whereas pre-immune rabbit antiserum did not
30 contain such antibody. Immune rabbit antisera to Sabin type
l did not react with any tissue sections.
~ .
."~ .
,
.. . . ... .
.
. : , ,~. . ,
- ,. ..
WO90/15145 PCT/GB90/On841
_ 33 _ 2~5~13
The invention further relates to cassette vectors
generally. A cassette vector is a construct that allows
the rapid and extensive modification of a specific region
of a protein. The coding sequence for this specific region
is delineated by the presence of flanking S' and 3'
restriction sites. Modification of the region is achieved
by digestion of the cassette vector at the 5' and 3' sites
and ligation of the digested vector with a DNA fragment
with suitable complementary ends. This fragment is usually
a pair of annealed complementary oligonucleotides but may
be a purified restriction fragment or a suitably prepared
PCR product.
, We have now devised a cassette vector which
simplifies the modification of a specific region of a
protein. According to the present invention, there is
provided a cassette vector which comprises a coding
- sequence for a polypeptide and in which a pre-selected
region of the coding sequence is defined by flanking 5' and
3' restriction sites which are unique to the vector,
wherein the said pre-selected region is composed of such a
nucleotide sequence that:
;(a) recovery can be prevented of self-ligated
vector after digestion of the cassette vector with the
- 25 restriction enzymes which cut at the flanking 5' and 3'
restriction sites; and/or
(b~ the cassette vector is incapable of expressing
the said polypeptide.
,
.'~
~I lB~TlTUTE SHEET
.. . . - . . .
. . ., , .. . ~.
-- ~ . .: . - . :
'. ' ' ~ ' '. ~ ' ., . " . ~'
.. .. , . .. .
.`: . . - - :. . . . ... . . .
WO~0/15145 PCT/GB90/00~1
2C\5~ .3
. r j r~
; ~ - 34 -
The cassette vector may encode any polypeptide.
The polypeptide may be a viral capsid protein or a
therapeutically active protein, for example a protein
capable of exhibiting activity in a human or animal. The
polypeptide may be a prokaryotic or eucaryotic protein.
The cassette vector may comprise a cDNA, for example a
poliovirus cDNA such as the cDNA of an attenuated strain of
type l poliovirus.
A pre-selected region of the coding sequence is
defined by 5' and 3' restriction sites unique to the
vector. These sites may be engineered into the coding
sequence by site-directed mutagenesis or by PCR as
described previously. In one aspect, the nucleotide
lS sequence of this pre-selected region is constructed so that
recovery of self-ligated vector can be prevented after the
vector has been cut at the flanking 5' and 3' restriction
sites. The use of molecular genetic procedures such as the
use of phosphatase to prevent re-ligation of the cut
vector, or the gel purification of the cut vector fragment,
all theoretically prevent the reformation of the cassette
vector. In practice, however, they are not infallible and
considerably increase the vector preparation time.
~- Furthermore, they often decrease ligation efficiency
-.......................................................................... -
~'
,. ..
. ~,
~,.
SUB~T,--, UTE SHEET
~_' ' , '
"' ' .
' . ' ' . , ' ~ ' . ': . ,
.. . '
WO90/151~5 PCT/GB~0~0~
5S'~13
t 1 ,, ~, I
- 35 -
for example due to the presence of contaminating nucleases
on agarose gels.
According to the invention, recovery of the
S parental cassette vector can be prevented by providing at
least one restriction site within the pre-selected region
of the coding sequence and ensuring that this or each such
site`is unique to the coding sequence and, preferably,
unique to the entire cassette vector. The site may be a
Sst II, Not I or Mlu I site. The provision of a unique
restriction site within the pre-selected region of the
coding sequence means that, upon digestion of a ligation
mixture of a vector cut at the 5' and 3' restriction sites
and of a DNA fragment insert with the enzyme which cuts at
the uni~ue restriction site, the pre-selected region is
cut. The enzyme should not of course cut the DNA fragmentO
The recovery of self re-ligated vector can therefore be
prevented.
In a second aspect, the nucleotide sequence of the
pre-selected region of the coding sequence is constructed
so that the polypeptide encoded by the entire coding
sequence can not be expressed. The pre-selected region
must be modified for the entire coding sequence to be
expressed properly. The coding sequence for the
~ 25 polypeptide is not provided as an
:.
~ TEF ~ T ~ 5 ~ F~T
:- . . . , . . ............. :, - - : .
. : , . ~ . . . - . . : . :
,, ,, . : -:
..
WO90/15145 PCT/GB90/00~1
$.~
2~55~3 - 36 -
open reading frame for the full length of the sequence.
This can be ensured either by introducing a frameshift in
the pre-selected region of the coding sequence or by
providing a stop codon within that region. Both a
frameshift and a stop codon can be introduced.
As mentioned above, a cassette vector allows
modification of a specific region of a protein. In a
cassette vector according to the invention, the protein
coding sequence on each side of this region must be
maintained. However, the coding sequence for the specific
region of the protein it is wished to modify should not be
maintained completely. Indeed it is irrelevant what the
coding sequence is as it will be replaced. The nucleotide
sequence spanning the region of the polypeptide coding
sequence that is to be replaced can therefore be
constructed so that it results in a frameshift in the
downstream nucleotide sequence and, in particular, in the
polypeptide coding sequence downstream of the flanking 3'
restriction site. Alternatively or additionally, a stop
; codon can be provided within the nucleotide sequence
- spanning the region of the polypeptide coding sequence that
is to be replaced. Whichever approach is adopted, it is
then impossible for the full length protein coding sequence
to be translated.
" !
' '`'
' ',`
;"C t
'
., , . : ' ~ ' '
: -', , .' . . . ~ :
I ' :. ~ '. . . '
.. , '
WO90/1514~ PCTlGB90/OO~i t
~ 2C`S~
A protein for which it is desired to modify a
specific region can be represented by the formula (I):
X-Y-Z (I)
in which Y represents the amino acid sequence of the region
to be modified and X and Z represent the amino acid
sequences of the remainder of the protein. The
corresponding coding sequence may be represented by the
formula (II):
X'-Y'-Z' (II)
in which Y' represents the nucleotide sequence encoding the
region of the protein to be modified and X' and Z'
represent the nucleotide sequences encoding the remainder
of the protein. A cassette vector according to the
invention can comprise the nucleotide sequence of formula
(III):
: X'-Y " -Z' (III)
: wherein Y'' is flanked by unique 5' and 3' restriction
:. si~es and:
(al) Y' and Y!' do not contain the same number of
. nucleotides and the difference in the number of nucleotides
^ is indivisible by 3; and/or
. (bl) Y'' comprises a stop codon.
.' .
, .
. ,,. ~
, :
:' , ' ' -': - ' ' -: ~ ' ' ' . ': '
:'' '' ' ' ' ' " '", ' - ' ' ' .' ''' " " , ,. ' , "- ' ' : ' ~ ' , ' ,, ,: ''
' ' . ' . .' ' ' ': , . ~' :' . , .: , ' ' ," . :
WO90/15145 PCTIGB90/00841
i, ...~; !.;, , , ~,
Z~55S~3
- 38 -
The number of nucleotides of the sequence Y'' must
be sufficient to ensure that the cassette vector can be cut
at both the 5' and 3' flanking restriction sites. Where Y'
represents an integral number of codons, the nucleotide
sequence denoted by therefore must contain 3n-1 or 3n-2
nucleotides, in which n is an integer of at least 1.
Typically n is an integer from 2 to 10, for example from 3
to 8. A suitable vector is provided in particular when n
is 4.
The 3' flanking restriction site of the cassette
vector may be a Dra 1 site. A stop codon can be
introduced, typically in conjunction with a frameshift, by
providing the Dra 1 site as follows:
" *
TT TAA A
where * denotes the stop codon.
The cassette vector is typically a plasmid. The
; plasmid generally comprises an origin of replication, so
20 that it is replicable in a host which harbours it.
`Typically the host is a microbial host such as a strain of
bacterium e.g. E. coli. The plasmid also generally
comprises a marker gene such as an antibiotic-resistance
~gene. Preferred cassette vectors and, in particular,
1~ 25 plasmid cassette vectors are poliovirus cassette vectors as
mentioned previously, in particular pCAS7.
:;A cassette vector according to the invention can be
i/prepared
:....
',
SUBSTITUTE S~!FET
.,
. .
.. . . . . .
- ` . : . .`
'' , ''. ' ` ' . ' , :: ; ' :` , '
` . . .
. . .
WO90/1~14~ PCT/GB90/~
2~S~ 3
r ~, .7;
- 39 - ' i
by first engineering flanking 5' and 3' restriction sites
into a polypeptide coding sequence, and then cutting at the
restriction sites and ligating an appropriate DNA fragment
with the di~ested vector. Alternatively, the vector may be
obtained by site-directed mutagenesis or by the PCR method.
The cassette vector is preferably an expression
vector. A promoter and other transcriptional and
translational control sequences are provided so that a
recombinant protein can be expressed.
~ A recombinant vector which encodes a protein in
which a specific region has been replaced by a different
amino acid sequence can be prepared by:
(i) providing a double-stranded DNA fragment which
encodes the different amino acid sequence and which has 5'
and 3' ends compatible with the restriction sites digested
in step (ii);
(ii) digesting a cassette vector according to the
invention with the restriction enzymes which cut at the
said flanking 5' and 3' restriction sites of the cassette
vector; and
(iii) ligating the fragment from step (i) with the
digested vector obtained in step (ii).
Step (i) is generally conducted by constructing a
double-stranded DNA fragment by synthesising complementary
oligonucleotides and annealing the oligonucleotides. The
oligonucleotides may be boiled together for from 2 to 5
minutes, for example for about 3 minutes, and allowed to
cool to room temperature. Alternatively, a restriction
fragment may be provided.
';
.1 .
:.
S~IBSTlTUTE SHEET
':
,.... . , ., ,,,,, ~ .
- , .
. .. .... .
, , ~ : . . . : :
... ... .
WO90/15145 PCT/GB90/00~l
2~5~i~3 i
- 40 -
In step (ii), the cassette vector of the invention
is digested with the restriction enzymes which cut at the
5' and 3' restriction sites which flank the portion of the
cassette vector which is to be replaced. In step (iii),
the DNA fragment from step (i) is ligated with the cut
vector. If appropriate, the ligation mixture is digested
with the restriction enzyme which cuts at a unique site
provided within the nucleotide sequence of the cassette
vector flanked by the 5' and 3' restriction sites. This is
to prevent recovery of re-ligated cassette vector.
Any different nucleotide sequence can be provided
in the cassette vector. The resulting recombinant vector
can therefore encode a polypeptide having a different amino
-~ 15 acid sequence in a specific region. The different amino
acid sequence may be any foreign amino acid sequence as
described previously. A chimaeric protein incorporating
the different amino acid sequence can be expressed. A
-~- recombinant vector capable of expressing the chimaeric
protein is introduced into a compatible host. Expression
is allowed to occur.
Cells are transformed with the recombinant vector.
Any appropriate
:'
:., .
. .
.
. . , .. ~ , . . .
' - . :. ' ' : ' - ` :
:' , . , . ' : ~ . . :
' . ', . :
- . . : ~ , . - . .
- ,'
WO90/1514~ PCT/GB90/00841
2C`~5S~L3
. "~ .
- 41 - i,~
host-vector system may be employed. The transformed host
may be a prokaryotic or eucaryotic host. A bacterial or
yeast host may be employed, for example E. coli or S.
cerevisiae. Cells of a mammalian cell line may be
transformed. The transformed host is cultured under such
conditions that expression of the chimaeric protein occurs.
This protein can be isolated and purified. It may be
obtained in biologically pure form. It may be formulated
as a pharmaceutical composition also comprising a
pharmaceutically acceptable carrier or diluent.
''
'
I;
. ~, .
.1
:,
:- .. . . . . , . : ; , . . .. .
:, . , , . , - . . .
