Note: Descriptions are shown in the official language in which they were submitted.
2058872
- 1 -
D a s c r i p t i o n
The present invention concerns a process for the
production of IgA protease from E. coli inclusion
bodies.
Various pathogenic bacterial species (e. g. of the genus
Neisseria, such as for example Neisseria gonorrhoeae and
Neisseria meningitidis or the genus Haemophilus such as
for example Haemophilus influenzae) which grow on human
mucous membranes secrete proteases which are specific
for human Ig A1 and which are denoted IgA proteases. The
immunoglobulin Ig A1 is an important component of the
secretory immune response that is intended to protect
against infections by such pathogenic organisms (review:
Kornfeld and Plaut, Ref. Infect.Dis. 3 (1981), 521-534).
These proteolytic enzymes, which are denoted IgA
proteases, for example cleave the following recognition
sequences as described for example by Pohlner et al.,
(Nature 325 (1987), 458-462):
1. Pro-Ala-Pro -~ Ser-Pro
2. Pro-Pro -~ Ser-Pro
3. Pro-Pro -~ Ala-Pro
4. Pro-Pro -~ Thr-Pro
In this case "-~" in each case denotes the cleavage site
of the IgA protease.
The TgA proteases mentioned above are secretory proteins
which have an N-terminal signal sequence for the
transport into the periplasma and a C-terminal helper
20588'2
- 2 -
protein sequence which subsequently allows secretion
from the periplasma into the medium.
The cloning and expression of an IgA protease from
Neisseria in E. coli is described for example in PNAS
USA 79 (1982) 7881-7885 and EMBO J. 3 (1984) 1595-1601.
A disadvantage of the isolation of IgA protease
according to the known methods is, however, the low
productivity and vitality of the E. coli cells which
have been transformed with an IgA protease gene which
only results in a very low volume yield of IgA protease.
Since IgA protease is very important as a proteolytic
enzyme for the cleavage of fusion proteins produced by
genetic engineering (cf. W091/11520) there is a great
need for a method of isolating IgA protease which
overcomes at least some of the drawbacks of tha state of
the art.
The object according to the present invention is
achieved by a process for the production of recombinant
IgA protease which is characterized in that
(1) an IgA protease gene is modified in such a way that
the DNA region of the IgA protease gene coding for
the C-terminal helper sequence is no longer
functionally active,
(2) a host cell is transformed with the IgA protease
gene modified according to step (1) or with a
vector containing this modified gene,
(3) the modified IgA protease gene is expressed in the
transformed host cell,
(4) the IgA protease which forms as inclusion bodies is
isolated from the host cell and
2058872
- 3 -
(5) the IgA protease is converted into active protein
by in vitro activation.
It was surprisingly found that an IgA protease which no
longer has a functionally active helper sequence (and
thus can no longer be secreted from the host cell into
the medium) is formed as inactive inclusion bodies
within the host cell and that a~ter activation of these
inactive inclusion bodies very high volume yields of IgA
protease are achieved. These inactive inclusion bodies
can be isolated according to the usual methods from the
cells and subsequently converted into the active form by
means of in vitro activation.
It is essential for the process according to the present
invention that the DNA region coding for the C-terminal
helper sequence of the IgA protease is no longer
functionally active. This can for example be achieved by
partial or complete deletion of the DNA region coding
for the helper sequence. The deletion of DNA fragments
can be carried out in a manner familiar to one skilled
in the art, as for example by in vitro mutagenesis on
double-stranded or single-stranded DNA or by cleavage
with suitable restriction enzymes and removal of
restriction fragments from the region of the helper
sequence. A further possibility for such a modification
of the IgA protease gene is to carry out an in vitro
mutagenesis in the DNA region coding for the helper
sequence by means of which one or several translation
stop codons are introduced into this region which then
prevent a complete translation of the helper sequence
when the IgA protease gene is expressed.
It is preferred in the process according to the present
invention that the IgA protease gene is modified in such
2~588'~2
- 4 -
a way that the helper sequence of the IgA protease coded
by this modified gene is completely deleted. This can
for example be achieved by introducing one or several
translation stop codons into the IgA protease gene
directly at the beginning of the C-terminal helper
sequence. A further possibility for the deletion of the
helper sequence is a PCR reaction on IgA protease cDNA
using suitable primers as described in example 1.
In the process according to the present invention it is
also preferred that the IgA protease gene is in addition
modified in such a way that the DNA region coding for
the N-terminal signal sequence of the IgA protease is no
longer functionally active. In this way the transport of
the IgA protease into the periplasma is also blocked so
that the inactive inclusion bodies are formed in the
cytosol of the transformed host cell.
It is preferred that the inactivation of the signal
sequence is carried out by completely deleting the .
corresponding DNA region according to the usual
techniques. Subsequently DNA sequences from the DNA
regions coding for the mature protein which may have
been lost can be filled in again by introducing a
synthetic oligonucleotide by genetic engineering. The
signal sequence can, however, also be deleted by a PCR
reaction using suitable primers as described in
example 1.
A prokaryotic cell, especially an E. coli cell, is
preferably used as the host cell for the process
according to the present invention. In addition it is
preferred that the host cell is transformed with a DNA
sequence coding for an IgA protease which is under the
control of an inducible promoter. Examples of suitable
- 5 - 208872
inducible promoters are for example the tac, lac or trp
promoter or other similar promoters which are known to
one skilled in the area of molecular biology.
The IgA protease produced in the process according to
the present invention is formed in the host cell as
inclusion bodies. The isolation of inclusion bodies and
their conversion into active protein by in vitro
activation can be carried out in any manner known to one
skilled in the art. Examples of such methods are
described for example in EP-A 0 361 475, DE-A 36 11 817,
DE-A 35 37 708, WO 87/02673; Jaenicke, R. & Rudolph, R.
(1989) Protein structure - a practical approach, Ed.:
Creighton T.E. Oxford University Press, 191; Rudolph, R.
(1990) Modern methods in protein and nucleic acid
analysis, Ed.: Tschesche, published by H. Walter
deGruyter, 149-171; Jaenicke, R. (1987) Prog. Biophys.
Molec. Biol. 49, 117.
The in vitro activation of the IgA protease preferably
includes a solubilization step and a renaturation step.
The renaturation step in this process can be carried out
by feeding the denatured protein continuously or
discontinuously into the renaturation buffer. In this
process it is.preferred that the renaturation step is
carried out in the form of a discontinuous pulse
renaturation.
It is particularly preferred that the renaturation step
for the activation of the IgA protease is carried out in
the presence of 0.2 to 1 mol/1 arginine and most
preferably of 0.4 to 0.8 mol/1 arginine. In addition it
is preferred that the reactivation is carried out at a
pH of 5 to 9, particularly preferably at a pH of 6 to 8.
_ 6 _ 20588'72
When the IgA protease is renatured from inactive
inclusion bodies active soluble protein is formed in a
yield which ranges from about 10 % to over 30 %,
depending on the starting material and renaturation
method. Although the renaturation yield is not
quantitative, nevertheless a substantially higher yield
of active IgA protease is obtained with the process
according to the present invention compared to
conventional methods.
The present invention also concerns an IgA protease
which has been produced by a process according to the
present invention i.e. by activation from inclusion
bodies.
In addition the invention. concerns a recombinant DNA
which codes for an IgA protease and is modified in such
a way that on expression of the recombinant DNA an IgA
protease results whose C-terminal helper sequence is no
longer functionally active and is preferably even
completely deleted. The recombinant DNA according to the
present invention is preferably additionally modified in
such a way that on expression of the recombinant DNA an
IgA protease is formed whose N-terminal signal sequence
is no longer functionally active and especially
preferably is completely deleted. Genetic engineering
methods for the modification or deletion of DNA regions
which lead to the desired results have already been
mentioned or are so familiar to one skilled in the area
of molecular biology that they do not have to be
explicitly elucidated.
The present invention also concerns a recombinant vector
which contains at least one copy of a recombinant DNA
according to the present invention. The recombinant DNA
_ ~ _ 20~88'~2
according to the present invention in this vector is
preferably under the control of an inducible promoter.
The vector according to the present invention can be
present outside the chromosome of the host cell (e.g. a
plasmid) or integrated in the genome of the host cell
(e.g. bacteriophage in an E. coli cell). The vector is
preferably a plasmid.
The invention in addition concerns a cell which is
transformed with a recombinant DNA according to the
present invention or with a recombinant vector according
to the present invention. This cell is preferably a
prokaryotic cell and particularly preferably an E. coli
cell.
The invention is further elucidated in the following by
the present examples in conjunction with the sequence
protocols.
SEQ. ID. NO. 1 shows the primer A used in
example 1
SEQ. ID. NO. 2 shows the primer B
SEQ. ID. NO. 3 shows the primer C
SEQ. ID. NO. 4 shows the primer D
The plasmid pMAC 1 was deposited at the German
Collection for Microorganisms (DSM), Griesebachstral3e 8,
D-3400 Gottingen and assigned the number DSM 6261.
2058'72
E x a m p 1 a 1
Preparation of plasmid constructs for the expression of
IgA protease in the form of inclusion bodies
In order to express IgA protease as inclusion bodies,
the region coding for the protein without signal
sequence and helper sequence is cloned downstream of a
strong promoter as described in the following (amino
acid position + 1 to position 959, Pohlner J., Halter
R., Beyreuther K., Meyer T.F., Nature 325, (1987), 458-
462) .
For this chromosomal DNA is isolated from N. gonorrhoeae
(e. g. MS 11) and used to carrying out a polymerase chain
reaction (PCR, method cf. EP-A 0 200 362, EP-A 0 201
184). The following primers are used for the PCR.
Primer A (SEQ. ID. NO. 1L
5' GAAGAATTCGGAGGAAAAATTAATGGCACTGGTACGTGATGATGTCGATTATCAAA 3'
Primer B ~SEQ. ID. NO. 2):
5' TTTTTGTAATAAAGATCTTTGCCTTG 3'
The first 5 codons of the IgA protease were optimized
for an efficient expression in E. coli without changing
the amino acid sequence and used for primer A, which
includes the ATG start codon as well as an ECo RI
recognition sequence (GAATTC).
20588'2
_ g _
Primer B contains sequences adjacent to the Bgl II
recognition sequence of the IgA protease (ca. amino acid
positions 553-561). The PCR fragment (A/B = ca. 1650 bp,
5' terminal region of the IgA protease gene) obtained in
this way is purified and recleaved with the enzymes
ECo RI/Bgl II.
In order to prepare the 3' region of the IgA protease
gene a second PCR reaction is carried out with the
following primers:
Primer C ~SEQ. ID. NO. 3):
5' CAAGGCAAAGATCTTTATTACAAAAA 3'
Primer D (SEQ. ID. NO. 4):
5' TTCAGCTGGTCGACTTATCACGGGGCCGGCTTGACTGGGCGGCC 3'
Primer C corresponds to the coding region of primer B
(Bgl II cleavage site) and primer D contains sequences
of amino acid positions 952-959 with an adjacent stop
codon and a Sal I recognition sequence. The PCR fragment
(C/D = 1200 bp) obtained in this way is isolated and
recleaved with the enzymes Bgl II/Sal I.
Subsequently a three fragment ligation is carried out:
with the fragments A/B, the fragment C/D and the vector
pKK 223-3 (DSM 3694P) which was previously digested with
the enzymes Eco RI and Sal I and purified. The vector
obtained in this way is denoted IgA-Prot III and is
transformed in E. coli K12.
-1°- 2058872
Example 2 (comparative example)
Isolation of soluble IgA protease according to the
conventional method.
a) Isolation from 1 1 shaking culture
E. coli K12 cells transformed with the plasmid pMACl
(8878 bp) were used as the starting material. The
complete coding region for IgA protease is located on
this plasmid and is under the control of the lambda
promoter. The plasmid carries an ampicillin resistance.
The cells were cultured in LB medium overnight at 28°C
and subsequently diluted 1:100 with LB medium. The
culture was then incubated for a further 4 hours at
37°C. The cells were separated by a centrifugation step.
The culture supernatant was sterile-filtered over a
cellulcse-acetate filter, dialysed against 20 mmol/1
Tris/HC1, pH 7.5, 10 mmol/1 EDTA, 10 % glycerol (buffer
A) and concentrated to 1/10 its volume with the aid of a
SALVIA capillary dialyser E-15U t'1'
A negative elution on DEAE-Sephadex A-50~min 20 mmol/1
Tris/HC1, pH 7.5, 10 mmol/1 EDTA and 10 % glycerol was
carried out as the first purification step. The column
was loaded with 0.5 mg protein per 1 ml gel matrix. In
this separation the IgA protease is in the eluant and
most of the E. coli proteins are bound to the carrier.
Washing the column matrix again with buffer A plus
1 mol/1 NaCl showed that less than 10 0 of the IgA
protease binds to the column material.
2058872
- 11 -
Finally it is purified on a cation exchanger
(FractogelR-EMD-S03' -650M). The protein binds in
20 mmol/1 Tris/HC1, 10 mmol/1 EDTA, 10 % glycerol
pH 7Ø Then the buffer can be changed to pH 8Ø The
elution is carried out with a linearly increasing NaCl
gradient whereby the IgA protease is eluted with a
buffer of pH 8.0 at a salt concentration of 0.1 mol/1
NaCl and with a buffer of pH 7.0 at 0.2 mol/1 NaCl.
Result:
Concentrate before DEAE-Sephadex 3.5 mg protease
(70 % pure)
Eluate after DEAE-Sephadex 2.4 mg protease
(90 % pure)
Eluate after FractogelR-EMD-S03' -650M 1 mg protease
(> 95 % purity)
b) Isolation of IgA protease from a 10 1 fermenter
The starting material and purification were carried out
analogous to example 2a).
Result:
Concentrate before DEAE-Sephadex: 50 mg IgA protease
(50 % purity)
Eluate after DEAE-Sephadex: 30 mg IgA protease
(60 % purity)
Eluate after FractogelR-EMD-S03' -650M: 12 mg IgA protease
(> 95 o purity)
20~88'~2
- 12 -
Example 3
Isolation of IgA protease from inclusion bodies (process
according to the present invention)
The starting material was the construct IgA-Prot III
(example 1) in E. coli cells (DSM 3689) which
additionally contain a lacIq plasmid for the expression
of the lac repressor.
500 ml LB medium containing 50 ~g/ml kanamycin and
50 ~.g/ml ampicillin was prepared for the 1 1
fermentation culture. This medium was inoculated with
7.5 ml of an overnight culture which resulted in an
OD550 of ca. 0.1. Then a 3 to 4 hour incubation at 37°C
was carried out while shaking (150 rpm). The cells were
induced with 5 mmol/1 IPTG at an OD550 of ca. 0.8. The
cells were harvested after a 4 hour incubation at 37°C
while shaking (150 rpm).
IB preparation:
The cells are harvested by centrifugation, taken up in
10 ml Tris-magnesium buffer (10 mmol/1 Tris, pH 8.0,
1 mmol/1 MgCl2) and lysed with lysozyme (0.3 mg/ml).
They are incubated for 15 minutes at 37°C and subjected
to one passage of a French press (1200 psi).
Subsequently a DNAse digestion (1 mg DNAse I) is carried
out for 30 minutes at 37°C.
- 13 -
20 5 88 7 2
20 ml 0.5 mol/1 NaCl, 20 mmol/1 EDTA, pH 8.0 and 3 ml
20 % Triton X l0~is added and incubated for 10 minutes
at room temperature.
The suspension is centrifuged for 10 minutes at
15000 rpm and 4°C. The pellet is taken up in 30 ml
50 mmol/1 Tris, pH 8.0, 50 mmol/1 EDTA and 0.5
Triton X 100~nd treated with ultrasound. It is
centrifuged again, resuspended and treated with
ultrasound. This procedure is repeated for a further two
times. Subsequently it is centrifuged and the pellets
obtained in this way are used as IBs in example 3.
Table 1 shows the results for the fermentation in a 1 1
shaking culture and in a 10 1 fermenter.
Table 1
Fermentation E. coli Total protein IgA protease
strain from IB material (%) (g)
(g)
1 1 HB 101 0.125 50-70 0.06-0.09
10 1 IK12 C600 I 20.8 I30-50 6.2-10.4
It can be seen from Table 1 that 60-90 mg protease is
obtained as inclusion body (IB) material from the 1 1
shaking culture. At a renaturation yield of ca. 10
this would yield 6 to 9 mg active IgA protease (compared
to 3.5 mg by the conventional method).
6.2 to 10.4 g protease is obtained as IB material from
the 10 1 fermenter. This would yield 620 to 1040 mg IgA
- 14 -
protease if l0 % is renatured (compared to 50 mg
protease by the conventional method).
It can be clearly seen from these results that the
process according to the present invention results in an
increase in the yield of at least 2 to 3-fold (1 1
culture) or 20 to 30-fold (10 1 fermenter).
Example 4
Renaturation of the IgA protease from inclusion bodies
(1 1 fermentation)
The inclusion bodies were first solubilized, then
dialyzed and then renatured in the respective buffers.
Solublization of the IB material:
6 mol/1 guanidine/HC1, pH 8.5
0.1 mol/1 Tris
1 mmol/1 EDTA
0.1 mol/1 dithioerythreitol (DTE)
Incubation: 2 h at room temperature
Vol: 10 ml, protein concentration: l0 ma/ml
Dialysis of the solubilisate:
6 mol/1 guanidine/HCl, pH 3
1 mmol/1 EDTA
Duration: 12 h at room temperature
against 10 1 buffer
- 15 -
Renaturation buffer:
1) 100 mmol/1 Tris, 1 mmol/1 EDTA, 1 mmol/1 DTE, pH 8.5
2) 100 mmol/1 Tris, 1 mmol/1 EDTA, 1 mmol/1 DTE, pH 7.5
3) 20 mmol/1 Tris, 1 mmol/1 EDTA, 1 mmol/1 DTE, pH 8.0
4) 0.6 mol/1 Arg/HC1, 1 mmol/1 EDTA, 1 mmol/1 DTE, pH 8.0
5) 0.6 mol/1 Arg/HC1, 1 mmol/1 EDTA, 5 mmol/1 reduced
glutathione (GSH)/0.5 mmol/1 oxidized glutathione
(GSSG), pH 8
Pulse renaturation:
The denatured protein is added in 5 portions to the
renaturation buffer; the time interval between the
individual additions was 30 minutes and the protein
concentration in the preparation increased by 20 ~,g/ml
per pulse. The final protein concentration was
eventually 100 ug/ml.
In order to determine the activity of the renatured IgA
protease a dialysis is carried out in cleavage buffer
(50 mmol/1 Tris/HC1 pH 8, 1 mmol/1 CaCl2). Human IgA was
used as the cleavage substrate. Table 2 shows the
results of the cleavage experiments (incubation: 6 h at
37°C) on the renaturates obtained by using the above
renaturation buffers (1-5).
208872
- 16 -
Table 2
Cleavage of human IgA with IgA protease isolated
according to the present example (incubation: 6 h at
37°C). The isolate obtained after the dialysis contains
about 50 % IgA protease.
Renaturate Ratio Cleavage
protease/substrate (%)
(ug)
1 1:20 10
2 1:20 30
3 1:20 10
4/5 1:100 100
1:500 50
1:1000 30
1:2000 10
1:5000 5
soluble protease1:500 100
(100 % pure)
It can be seen in Table 2 that IgA protease can be
renatured in all buffers. The yields in an arginine
(Arg) buffer are, however, 10 to 100-fold higher than
without arginine. As a comparison the substrate was
- cleaved by 100 % with soluble purified IgA protease
(according to example 1) at a protease: substrate ratio
of 1:500. From this a renaturation yield of ca. 50 % can
be determined for buffer 4) and 5).
2058872
- 17 -
Example 5
Dependence of the optimization of the renaturation of
IgA protease from inclusion bodies on the pH and
arginine concentration
Solubilization and dialysis are analogous to example 4.
Pulse renaturation: protein addition was carried out as
described in example 4.
1) Determination of the renaturation yield while
varying the pH value.
0.6 mol/1 Arg/HC1
1 mmol/1 EDTA
pH 4, 6, 8
2) Renaturation while varying the arginine
concentration
1 mmol/1 EDTA, pH 8
1 mmol/1 DTE
Arg/HCl: 0.2; 0.4; 0.6 and 0.8 mol/1
Subsequently a dialysis was carried out at room
temperature against a 100-fold volume of the cleavage
buffer (50 mmol/1 Tris/HC1, pH 8, 1 mmol/1 CaCl2).
20588'72
- 18 -
Table 3
Cleavage of human IgA with the aid of the IgA protease
isolated according to the present example. The dialysate
contains about 50 to 70 % IgA protease. In the cleavage
preparation 50 ~,g substrate was incubated with 1 ~.g
renatured IgA protease for 6 h at 37°C.
pH % Cleavage Arginine (mol/1) % Cleavage
4 10 0.2 85
6 95 0.4 90
8 100 0.6 95
0.8 95
The optimal reactivation of the IgA protease is at a pH
of 6 to 8 and at an arginine concentration of 0.6 to
0.8 mol/1.
2058872
- - 19 -
SEQ. ID. NO.: 1 (Primer A)
TYPE OF SEQUENCE: nucleic acid single strand
LENGTH OF SEQUENCE: 56 nucleotides
GAAGAATTCG GAGGAAA.AAT TAATGGCACT GGTACGTGAT GATGTCGATT
ATCAAA
r 2o~s~~z
- 20 -
SEQ. ID. NO.: 2 (Primer B)
TYPE OF SEQUENCE: nucleic acid single strand
LENGTH OF SEQUENCE: 26 nucleotides
TTTTTGTAAT AAAGATCTTT GCCTTG
21 - 2058872
SEQ. ID. NO.: 3 (Primer C)
TYPE OF SEQUENCE: nucleic acid single strand
LENGTH OF SEQUENCE: 26 nucleotides
CAAGGCAAAG ATCTTTATTA CAAAAA
- 22 -
SEQ. ID. NO.: 4 (Primer D)
TYPE OF SEQUENCE: nucleic acid single strand
LENGTH OF SEQUENCE: 44 nucleotides
TTCAGCTGGT CGACTTATCA CGGGGCCGGC TTGACTGGGC GGCC
