Note: Descriptions are shown in the official language in which they were submitted.
__ WO 91/12328 2 0 l 5 9 7 4 p~/US91/01013
-1-
TOTALLY SYNTHETIC AFFINITY REAGENTS
1. INTRODUCTION
The present invention relates to novel reagents
and the process for making them. This invention provides a
process for synthesizing and identifying new binding
reagents of specific affinity. The Totally Synthetic
Affinity Reagents (hereinafter TSARS) are concatenated
heterofunctional polypeptides or proteins having a binding
domain and at least one additional peptide effector domain
~0 that is chemically or biologically active. The TSARS can be
used as intermediates to form unifunctional polypeptides or
proteins having a desired binding activity.
In the invention, DNA encoding a binding domain
and DNA encoding an effector domain are inserted into a
~5vector using recombinant DNA technology methods. Following
transformation of vectors into cells, expressed proteins are
screened for interactions with a ligand of choice to
identify TSARS of defined specificity, affinity and avidity.
The method of the present invention differs, inter alia,
20 from prior art methods for forming fusion proteins in that
the nucleotide sequence encoding a putative binding domain
having specificity for a ligand of choice is obtained by a
process of mutagenesis as described herein.
30
WO 91/12328 PCT/US91/01013
2015914
- A schematic of the general method of the
invention follows:
BINDING DOMAIN NUCLEOTIDE SECaUENCE (BD~
EFFECTOR DOMAIN NUCLEOTIDE SE(~UENCE (ED)
OPTIONAL LINKER NUCLEOTIDE SEG1UENCE (OLD)
VECTOR (Vl
(OLD)
(V)~ - - ' /(ED)
TRANSFORMED CELLS
EXPRESSED PROTEINS
SCREENING WITH
LIGAND "A"
TSAR--"A"
PROTEIN--BINDING DOMAINIOPTIONAL LINKER/EFFECTOR DOMAIN
In an alternative embodiment, a third nucleotide sequence
encoding a linker peptide is inserted between the nucleotide
sequences encoding the binding domain and the effector
~ domain. This schematic is provided for illustrative
purposes only and is not to be construed as limiting the
invention. Other alternative modes will become apparent to
those of skill in the art upon reviewing the following
description, examples, figures and appended claims.
_. ...,~
WO 91/12328 PCT/US91/01013
2075974 _3_' ;
2. BACKGROUND
2.1. BINDING INTERACTIONS
The binding of molecules to each other involves
direct partner specificity, interaction and stability. The
strength of the interaction is determined by the number of
atomic bonds that are made and their overall length and
strength. In general, bonds between catalytic biomolecules
must be reversible because binding partners must be
recycled. For example, in enzyme-substrate recognition,
~~ binding constants are low so that multiple rapid reactions
can occur. Similarly, binding initiation interactions
between promoter DNA and RNA polymerase also require less
than maximal affinity and stability otherwise the RNA
polymerase enzyme is unable to migrate from the promoter and
~5 is transcriptionally inactive. Thus, bonds between
biological molecules are frequently not of the highest
affinity and stability possible although binding reactions
of structural and surface components that involve permanent
cell-cell interactions and anchorage functions may be very
20 stable with high affinity between the binding partners.
Binding can be accomplished by charge attraction
between surfaces and/or by pairing complementary three
dimensional molecular surfaces or structures, e.g. a
25 protruding surface fitting into a cavity. The tertiary
structure of the protrusion or cavity is the result of
flexible polypeptide chains forming shapes that are
determined by weak chemical bonds. Thus the amino acid
sequence as the primary structure of a peptide provides the
~ chemical subgroups that are aligned in proper position to
effectuate proper interactions by the secondary and tertiary
structure of the peptide. The types of weak bonds involved
in tertiary structure include van der Waals bonds,
hydrophobic bonds, hydrogen bonds and ionic bonds. Just as
~ these bonds are involved in intramolecular structure, they
WO 91/12328 2 0 7 5 9 l 4 . PCT/LJS91/01013
-4-
can also be involved in intermolecular binding between
macromolecules. Thus, intermolecular binding is
accomplished by electrostatic bonds, hydrogen bonds, Van der
Waals bonds, etc., as well as by combinations thereof.
It is difficult to predict which amino acids in a
region of a protein structure are responsible for what
function, even with the aid of a known tertiary structure.
It becomes even more difficult to predict the effect of
specified amino acid changes. Predictions of important
interacting sequences based on similarities of primary
~0 sequence can be incorrect for failure to recognize sequence
similarity arising from a common genetic origin rather than
from protein design and function constraints. See Subbiah,
J. Mol. Biol. 206: 689 (1989). At this point in time it is
,5 not only impossible to predict what amino acid
changes within a peptide will result in a new or altered
protein function, it is also impossible to predict what
sequence of amino acids will produce a peptide of given
function. Thus, the analysis of known interactions at the
molecular and atomic level is completely unsuitable for
20 developing wholly new interactions, especially those that
might not occur in nature where macromolecular interactions
are limited to the constraints imposed by the aqueous
environment within cells and the subsequent requirements of
25 biological and biochemical interactions.
In contrast to the prior art which has not solved
the difficulties of developing totally novel binding
specificities, the present invention provides a method for
producing polypeptides or proteins having a desired binding
~ specificity similar to naturally occurring binding proteins
which does not require detailed information with regard to
either the specific amino acid sequence or secondary
structure of the naturally occurring binding protein. In
addition, the method provides a process to generate and
.....,
WO 91/12328 2 0 7 5 9 l 4 s. PCT/US91/01013
identify new peptide compositions having new binding
interactions that are not limited to natural interactions or
constrained by the evolutionary process.
2.2. PROTEIN STRUCTURAL MOTIFS INVOLVED
IN SOME KNOWN AFFINITY REACTIONS
The study of known interactions and known
components has delineated the minimum size requirements for
macromolecular interactions. A significant finding of
macromolecular structure and function studies is that
interactions involving large macromolecules are often
limited to a small region of the macromolecule. Moreover,
in some cases similar types of interacting molecules have
been shown to have similar structures in comparable regions
of interaction. Specificity between individual partners
arises then from distinct chemical subgroup and atomic
interactions between the molecular partners.
Described below are only a few of the
characterized protein structural motifs that are involved in
specific binding interactions, especially those of
regulatory and developmental significance. A more
comprehensive description of structural and functional
analyses of characterized solved protein structures can be
found in the Bibliographic Files of the Protein Data Bank
located at Brookhaven National Laboratory. The binding
regions exemplified by each motif described below are small
regions of the total protein well within the size range of
the binding domains in the present invention. In addition,
these motifs suggest that secondary structure similarities
are often more important in binding than are specific amino
~ acid sequences. Because secondary structure predictions are
hardly accurate, predictions of what amino acids are
involved in binding in any given sequence without other
independent evidence are impossible.
WO 91 / 12328 PCT/US91 /01013
2015974
-6-
2.2.1. REGULATORY DNA BINDING PROTEINS
Genetic, biochemical, physiological and
crystallographic studies of two bacterial phage repressors
and the cyclic AMP receptor protein (CAP) lead to the
development of the helix-turn-helix protein structural motif
5for sequence specific DNA binding interactions. The helix-
turn-helix structural motifs that contact DNA are similar in
each protein although the actual protein sequences vary.
Sequence homology studies, while complicated by the
evolutionary relatedness of the proteins, suggest that other
~~ DNA-binding proteins like lac repressor, lambda cII protein
and P22 repressor share the helix-turn-helix motif.
Proteins containing helix-turn-helix motifs are reviewed in
Pabo and Sauer, Ann. Rev. Biochem. 53: 293 (1984).
More recently, two protein structural motifs
~5 other than the helix-turn-helix have been demonstrated in
DNA binding proteins. The "leucine zipper" is a periodic
repetition of leucine residues at every seventh position
over eight helical turns in the enhancer binding protein or
EBP of rat liver nuclei [Landschultz et al., Science 240:
20 159 (1988)]. Noting that the a helix within this region
exhibits amphipathy wherein one side of the helix is
composed of hydrophobic amino acids and the other helix side
has charged side chains and uncharged polar side chains,
the authors proposed that this structure had unusual helical
stability and allowed interdigitation or "zippering" of
helical protein domains, including both inter- and intra-
protein domain interactions.
In 1985, Berg [Science 232: 485 (1986)] noted
~ that five classes of proteins involved in nucleic acid
binding and gene regulation could form small, independently
structured, metal-binding domains that were termed zinc-
fingers. The five classes were 1) the small gag type
nucleic acid binding proteins of retroviruses with one copy
~ of the sequence Cys-X2-Cys-X4-His-X4-Cys, 2) the adenovirus
y r
-..WO 91/12328 PCT/US91/01013
207 5914 -7- .
ElA gene products with ~Cys-X2'Cys-X13-Cys-~2-Cys; 3) tRNA
synthetases with Cys-X2-Cys-X9-Cys-X2-Cys; 4) the large T
antigens of SV40 and po3yoma viruses of Cys-X2-Cys-X11-13
His-X2-His; and 5) bacteriophage proteins with Cys-X3-His-
X5-Cys-X2-Cys, where X is any amino acid. Berg predicted
that these sequences were involved in metal binding like the
TFIIIA factor of Xenopus laevis with Cys-X2-5-Cys-X12-His-
X2-3-His [Miller et al., EMBO J. 4: 1609 (1985)] and the Zn
domain of aspartate carbamoyl-transferase with Cys-X4-Cys-
X25-Cys-X2-Cys [Honzatko et al., J. Mol. Biol. 160: 219
~ (1982)]. Such predictions have been borne out.
The helix-turn-helix, zinc-finger and leucine-
zipper motifs can be found singly, multiply or as a mixture
with other domains in any given protein, e.g., the poly
(ADP-ribose) polymerase involved in DNA replication and
repair processes has been suggested to contain a zinc finger
and a nucleotide binding fold [Cherney et al., Proc. Natl.
Acad. Sci. 84: 8370 (1987)].
2.2.2. RNA BINDING PROTEINS
Although not as well characterized as the DNA
binding proteins, RNA binding proteins are known. For
example, proteins that associate directly with ribosomal
RNAs, the RNAs of snRNPs and scRNPs, and with mRNAs all have
regions that interact with RNA, and the interaction is often
with a specific nucleic acid sequence. Other proteins like
T4 gene 32 protein recognize RNA in a non-sequence specific
manner. Different methods have been used to identify the
specific RNA binding regions of these proteins.
2.2.3. METAL BINDING PROTEINS
In addition to the regulatory Zn++ metal binding
proteins discussed by Berg (supra Section 2.2.1), small,
ubiquitous sulfur-rich peptides of approximately 60-100
~ amino acids, which are called metallothioneins, bind a
WO 91/12328 PCT/US91/01013
2075974
variety of metal ions and are involved in heavy metal
detoxification in vertebrates and fungi [Metallothioneins,
pp. 46-92 eds. Kagi and Nordberg, Birkhauser Verlag Basel
(1979); Tolman U.S. Patent 4,732,864 issued March 22, 1988].
The term phytochelatin was proposed for the major
heavy metal binding peptides of higher plants [Grill et al.,
Science 230: 674 (1989)]. The structure of these small
peptides was determined to be NH3+-y Glu-Cys-7Glu- Cys-y
Glu-Cys-y Glu-Cys-Gly-Coo with minor components of (7Glu-
Cys)nGly where n=3, 5, 6 or 7. The peptides were induced by
~0 and bound Cd++ ++ ++ ++ ++
Cu , Hg , Pb and Zn
2.2.4. NUCLEOTIDE FOLD AND GTP BINDING PROTEINS
The crystal structure of the GDP-binding protein
EF-Tu was determined [Jurnak, Science 230: 32 (1985); la
Cour et al., EMBO J. 4: 2385 (1985)] and indicated that a
region of twisted ~ sheet was involved in nucleotide
binding. The nucleotide sits in a cavity at the carboxy
ends of the p-sheet with contacts to the protein situated in
four loops connecting p-strands with a-helices. The folding
pattern around the diphosphate component and the residues
binding the nucleotide are highly conserved between bacteria
and other species [McCormick et al., Science 230: 78
(1985)]. Constant features were a loop connecting a
strand at the carboxy edge of a p-sheet with an antiparallel
helix as seen in the Rossman dinucleotide fold [Rao and
Rossmann, J. Mol. Biol. 76: 241 (1973)]. The loop in EF-Tu
was eight amino acids long and the Gly-X4-Gly-Lys sequence
showed conservation with other purine-nucleotide binding
~ proteins. The guanine base binding portion of the loop of
sequence Asn-Lys-Cys-Asp was also conserved.
T. _."""~
WO 91/12328 PCT/US91/01013
2075974
2.2.5. CALCIUM BINDING PEPTIDES
The conserved EF-handvnsotif or helix-loop-helix
structure for Ca++ binding consists of a twelve amino acid
loop with alternating amino acids having anionic or
electronegative groups in~their side chains to form an
octahedral coordinate complex with the Ca++ ion that is
flanked by two amphipathical a helical segments [Kretsinger
and Nickolds, J. Biol. Chem. 248: 3313 (1973)].
Crystallin is a Ca++ binding protein wherein a
fifty amino acid region of the protein between residues 300
~0 and 350 possess the EF-hand motif characterized for Ca++
binding [Sharma et al., J. Biol. Chem. 264: 12794 (1989)].
2.2.6. ADHESIVE PROTEINS
Proteins that are present in extracellular
~5 matrices and in body fluids are involved in the attachment
of cells to their surrounding matrices and other cells. The
adhesive qualities of proteins known as integrins such as
fibronectin, vitronectin, osteopontin, collagens,
thrombospondin, fibrinogen and von Willebrand factor are
20 dependent on the tripeptide motif Arg-Gly-Asp which
functions as their cell recognition site. Ruoslahti and
Pierschbacher, Cell 44: 517 (1986). Affinity chromatography
using Sepharose covalently coupled to purified adhesin
25 protein allowed the isolation of cell surface receptor
proteins specific,for the bound adhesin. Pytela et. al.
Cell 40: 191 (1985): Pytela et. al. Science 231: 1559
(1986). Although a search of the protein sequence database
revealed 183 Arg-Gly-Asp sequences, not all of the proteins
~ containing the motif are recognized as a cell surface
adhesive protein, suggesting that factors other than the
primary sequence of a small region must be considered in
defining a binding site.
WO 91/12328 PCT/US91/01013
2015914
The role of the tripeptide Arg-Gly-Asp
recognition site in cell adhesion, migration, and
differentiation has been recently reviewed. See Ruoslahti
and Pierschbacher, Science 238: 491 (1987). However, a
different binding site was identified in laminin that
5consisted of the amino acid sequence Cys-Asp-Pro-Gly-Tyr-
Ile-Gly-Ser-Arg. Graf et. al., Cell 48: 989 (1987).
2.3. ANTIBODY STRUCTURES
Antibodies are composed of four peptide chains
~0 linked by sulfhydryl bridges and include two identical large
heavy (H) chains and two smaller light (L) chains.
Antibodies have a Y structure composed of three major
regions: the Fv antigen binding site of the H and L chains
on each of the upper tips of the Y, the Fab region composed
of the upper Y arms and the Fc area of the Y stalk.
Sequence comparisons of light and heavy chains
reveal that both contain variable (V) and constant (C)
regions. Within each variable region are found
complementarity determining regions (CDRs) which contribute
binding specificity to numerous different antigens by the
hypervariability of their sequence.
Cells synthesizing antibodies undergo DNA
rearrangements by recombination of different variable, D,
and J sequences at two steps in antibody maturation. One
set of rearrangements occurs in the genomic DNA and another
in mature B-cell mRNA to produce a large and diverse number
of possible sequence combinations that result in a
conservative approximation of 106-108 possible individual
~ antibody molecules. See Harlow and Lane, Antibodies: A
Laboratory Manual, Cold Spring Harbor Laboratory (1988)
pages 1-52, for a more detailed description of
immunochemical methods, introductory discussions of key
.._... ...~..,."I T
WO 91/12328 PCT/US91/01013
2075974
features of the immune response, structures of the different
classes of antibody molecules, and the mechanism of the
antibody response. .
Antibodies are defined in terms of affinity,
which is strength of binding, and avidity, which is a more
complicated estimate of the stability or functional affinity
of the binding reaction.. Although combinations of various
chromosomal V, D and J regions allow diversity of antibodies
and generate widely varying affinities and avidities to
different molecules, that diversity is limited by what can
~0 be recombined in vivo, by self recognition limitations, by
the inherent limitations of the aqueous environment within
living cells, by the nature of the antigen itself, i.e, a
toxic compound may be lethal before it is antigenic, and by
the inherent limitations of cell-cell interactions that are
~5 involved in antibody synthesis.
Limitations are also apparent in the quantity,
quality and purity of antibody that can be produced by an
animal. Although monoclonal antibody production does
overcome some of these limitations, it does not surmount
many of them. Moreover, monoclonal antibodies are still
limited to those antibody sequences produced _in vivo. The
production of monoclonal antibodies produced by fusion and
growth of animal cells in vitro still require costly and
technical manipulations that limit their usefulness and are
dependent on cells for the expression of complete molecules.
Thus severe limitations are apparent in the ability to
produce and grow appropriate clones of B-cells producing the
desired antibody of desired specificity, affinity and
~ avidity.
Immunoglobulins possess inherent characteristics
which also reduce their usefulness. The presence or absence
of an antibody generally cannot be directly measured
because, with the exception of antibodies specific for
~ transition state analogs of enzymatically catalyzed
WO 91/12328 PCT/US91/01013
2015974 _12--
reactions, an antibody has no catalytic activity that can be
assayed. One of the present limitations to the use of
monoclonal antibodies is the ability to detect an antibody
bound to an antigen. The presence of antibodies per se must
be measured indirectly usually with another antibody that
5has a covalently linked reporter group such as an enzyme or
a radioactive probe. Therefore indirect means of
quantitation are required for applications using antibodies,
necessitating multiple technical steps for measurement with
each step having its own hazards and inconveniences which
~0 include the need for technical expertise in personnel, the
use of multiple and often labile or hazardous reagents, time
consumption and casts. Furthermore the precision and
quantitation in these indirect tests is inherently limited
to the efficiency and kinetics of the indirect probe's
association with the antibody which can negatively impact on
the antibody-antigen interaction of interest which affects
the accuracy and reliability of the results.
Attempts have been made to overcome these
limitations. Recombinant DNA technology has allowed the
production of large amounts of monoclonal antibody chains in
cell culture [Cabilly et al., Proc. Nat'1. Acad. Sci. _81:
3273 (1988); Guarente et al., Cell 20: 543 (1980)]. Of
course the production of any such antibody by recombinant
DNA technology requires specific engineering using known DNA
sequences for each and every recombinant monoclonal antibody
desired. That process requires elaborate, time consuming,
costly and complex steps of identification, isolation,
sequencing and manipulation of the specific antibody gene of
~ interest so that large amounts of that antibody or a
chimeric molecule containing a portion of that antibody can
be genetically engineered.
Recombinant molecules containing constant
portions of the antibody identical to those of the host
~ species have been engineered for therapeutic purposes.
......,
., WO 91/12328 PCT/US91/01013
2075914 -13-
Natural production of host antibodies is largely infeasible
and impractical since human experimental subjects producing
the desired antibody are not available except in rare cases
and hybridoma production with human cell fusions has been
generally unsuccessful. Recombinant chimeric antibodies
have been produced in an attempt to solve these
difficulties. See eg. Morrison et al., Proc. Nat'1. Acad.
Sci. 81: 6851 (1984); Jones et al., Nature 321: 522 (1986).
Antibody binding specificity is determined
'0 primarily by the loops at tips of ,9-sheet defined by the
variable domains of the H and L chains found in Fv and Fab
proteolytic fragments. Recently recombinant DNA techniques
have been used to engineer Fv fragments with the antigen
binding loops of mouse anti-lysozyme D1.3 antibody, the
variable domains of H human NEW chains and L human REI
chains [Riechmann et al., J. Mol. Biol. 203: 825 (1988)).
The two H and L chains assembled in vivo and a functional Fv
fragment could be isolated.
2.4. OLIGONUCLEOTIDE SYNTHESIS AND MUTAGENESIS
The ability to chemically synthesize DNA allowed
scientists the opportunity to develop mutations at any base
in a given nucleic acid sequence. The technique overcame
the obstacles presented by in vivo mutagenesis techniques
such as diploidy, genome complexity, lack of suitable
selection schemes, high toxicity to the scientist caused by
the mutagen and low frequency of occurrence.
Recombinant DNA technology provided methods of
easily deleting large blocks of sequence by juxtaposing
~ otherwise separated restriction enzyme sites within a
sequence to crudely map regions of interest. Chemical
mutagenesis is useful but is limited in scope to alteration
of the nucleotides that are affected by the chemical, i.e.,
C to T transitions produced by sodium bisulfite.
~ Oligonucleotide site specific mutagenesis allows~mutations
WO 91/12328 PCT/US91/01013
2015974
-14-
of a specific nucleotide by construction of a mutated
oligonucleotide that includes modifications at the site of
interest. Ramdom mutagenesis techniques allow the rapid and
easy generation of a large number of a variety of
uncharacterized mutations.
Matteucci and Heyneker [Nucl. Acids Res. _11 .
3113 (1983)] used what they termed "'ambiguous synthesis" to
mutagenize a 9 by sequence preceding the initiation codon
for bovine growth hormone. Their goal was to develop a
ribosomal binding site that maximally optimized
translational expression of the protein. In their method,
oligonucleotides were manually synthesized on a cellulose
support using monomer addition triester chemistry. During
synthesis, the three precursors not specified by the
starting sequence were present at 8% while the specified
sequence precursor was present at 75% allowing ambiguous
incorporation of precursor at a predictable frequency at
each cycle of synthesis. The ambiguous oligos were added to
a specially prepared vector that had been engineered to have
appropriate restriction sites adjacent to the ATG start
codon. The ambiguous oligonucleotides were ligated to the
vectors, transformed and screened for nonhomology to the
wild type starting sequence. DNAs containing nonhomologous
sequences were sequenced to obtain frequency data. The
cells containing the ambiguously synthesized
oligonucleotides were screened for bovine growth hormone
production to identify up and down expression mutations.
Wells et. al. [Gene 34 . 315 (1985)] developed a
method of specific codon mutation to generate nineteen amino
~ acid substitutions at the single codon position 222 of
subtilisin. Different oligonucleotide pools were
synthesized and ligated into the vector and the DNAs from
different colonies were sequenced. Desired mutants were
then transformed into B. subtilis to produce secreted mutant
~ subtilisin.
_..__ WO 91/12328 PCT/US91/01013
2075914 -15-
McNeil and Smith [Mol. Cell. Biol. 5 . 3545
(1985)] used double stranded mutagenesis to develop random
variations of a 7 by sequence in the CYC1 transcriptional
start site region. They utilized a mixture of 71% of the
specified precursor defined by the wild type sequence and
doped the precursor reservoir with 9.7% of each of the other
precursors in order to generate double mutations over the 7
by sequence. They also developed a binomial distribution
equation giving nucleotide substitution yields of 9, 26 and
32% for 0, 1 and 2 nucleotide sequence alterations within
the target site.
Oliphant et. al [Gene 44 . 177 (1986)] described
a method for cloning random or highly degenerate nucleotide
sequences following chemical automated synthesis of
oligonucleotides. The capping reaction reagent normally
added after each step was deleted allowing increased yield
by including oligonucleotide that failed to react in the
previous step. Heterogeneous oligonucleotide lengths were a
second result of the omission of the capping step. The
oligonucleotides were cloned directly or after incubation
with Klenow fragment to convert them to double stranded
form. After sequencing, the nucleotide and dinucleotide
frequency's of 26 random insertions were determined, thus
demonstrating the utility of the mutagenic technique.
Hutchinson et al. [Proc. Nat'1. Acad. Sci. 83
- '
710 (1986)] developed a complete library of point
substitution mutations in a thirty nucleotide region of the
glucocorticoid response element of mouse mammary tumor
virus. Mutations were generated by contaminating each of
~ the four precursor reservoirs of an automated DNA
synthesizer with small concentrations of the three other
precursors to produce a 5% total impurity containing 1.5% of
each of the other three precursors. The oligonucleotides
were cloned into M13mp11 to screen for the generation of
~ termination codons which occurred in about 10% of
WO 91/12328 PCT/US91/01013
2075974 _16_ ._ _. r
transformants. The sequences of 546 random plaques
indicated that mutations were present at each of the thirty
nucleotides. Eighty-eight of the possible ninety
substitution mutations were found, as were fourteen single
base insertions and six single base deletions. Seventy-four
of the eighty-eight substitutions were recovered as single
mutations. A statistical analysis of the number of
transformants that needed to be sequenced to give a
probability of a complete library of single or double
mutations was included.
Derbyshire et al. [Gene _46 . 145 (1986))
described an automated method of producing and cloning
single stranded oligonucleotides that direct a specific
change at a chosen site of a fragment of known DNA sequence.
A mixed sequence 28 mer preparation was made by
contaminating each of the monomer reservoirs with each of
the other precursors at 1.54 the concentration of the wild
type precursor monomer. The authors used a probability
equation that predicts the probability of mutations for any
length of oligo using a wide range of relative
concentrations of mutant and wild type precursor monomers.
The observed yield of mutations for single mutations (23),
double mutations (8), triple mutations (4) and quadruple
mutations (1) as compared to wild type sequence (18)
correlated remarkably well with the yield predicted by the
equation.
The use of random mutagenesis over a broad target
of the 5' end of the VA I gene was used to identify areas of
particular interest and function. Snouwaert et al. [Nucl.
~ Acids Res. 15: 8293 (1987)] generated libraries containing
randomly dispersed and clustered point mutations of the
adenovirus VA I gene by contaminating each of the precursor
phosphoramidite solutions with 2.5~ of the other
phosphoramidites during oligonucleotide synthesis of
~ segments of the VA I gene. Following assembly of the
.~... ....."T T ~, ""
_" WO 91/12328 , PCT/US91/01013
2075914
constituent oligonucleotides, the mutagenized
oligonucleotide library corresponding to the 5' end of the
VA I gene was cloned into an M13 vector. Individual clones
were then sequenced by the chain termination method and used
to reassemble a whole VA I gene. Each reassembled,
5sequenced, and mutated VA I gene was transcribed _in vitro to
test the effect of random mutations on the transcriptional
efficiency of the VA I gene. A second round of clustered
mutagenesis then aided in identifying the function of
particular nucleotides within a limited region.
2.5. RECOMBINANT DNA TECHNOLOGY AND GENE EXPRESSION
Recombinant DNA technology involves insertion of
specific DNA sequences into a DNA vehicle (vector) to form a
recombinant DNA molecule which is capable of replication in
a host cell. Generally, the inserted DNA sequence is
foreign to the recipient DNA vehicle, i.e., the inserted DNA
sequence and the DNA vector are derived from organisms which
do not exchange genetic information in nature, or the
inserted DNA sequence may be wholly or partially
synthetically made. Several general methods have been
developed which enable construction of recombinant DNA
molecules.
Regardless of the method used for construction,
the recombinant DNA molecule must be compatible with the
host cell, i.e., capable of autonomous replication in the
host cell or stably integrated into one or more of the host
cell's chro~:aosomes. The recombinant DNA molecule should
preferably also have a marker function which allows the
~ selection of the desired recombinant DNA molecule(s). In
addition, if all of the proper replication, transcription,
and translation signals are correctly arranged on the
recombinant vector, the foreign DNA will be properly
expressed in, e-g., the transformed bacterial cells, in the
~ case of bacterial expression plasmids, or in permissive cell
i
WO 91/12328 2 0 l 5 9 7 4 PCT/US91/01013
-18-
lines or hosts infected with a recombinant virus or carrying
a recombinant plasmid having the appropriate origin of
replication.
Different genetic signals and processing events
control levels of gene expression such as DNA transcription
and messenger RNA (mRNA) translation. Transcription of DNA
is dependent upon the presence of a promoter, which is a DNA
sequence that directs the binding of RNA polymerase and
thereby promotes mRNA synthesis. The DNA sequences of
eukaryotic promoters differ from those of procaryotic
promoters. Furthermore, eukaryotic promoters and
accompanying genetic signals may not be recognized in or may
not function in a procaryotic system and conversely
procaryotic promoters are not recognized and do not function
in eukaryotic cells.
Similarly, translation of mRNA in procaryotes
depends upon the presence of the proper procaryotic signals,
which differ from those of eucaryotes. Efficient
translation of mRNA in procaryotes requires a ribosome
binding site called the Shine-Dalgarno (S/D) sequence on the
mRNA [Shine, J. and Dalgarno, L., Nature 254:34 (1975)].
This sequence is a short nucleotide sequence of mRNA that is
located before the start codon, usually AUG, which encodes
the amino-terminal methionine of the protein. The S/D
sequences are complementary to the 3' end of the 16S rRNA
(ribosomal RNA), and probably promote binding of mRNA to
ribosomes by duplexing with the rRNA to allow correct
positioning of the ribosome.
Although the Shine/Dalgarno sequence, consisting
~ of the few nucleotides of complementarity between the 16S
ribosomal RNA and mRNA, has been identified as an important
feature of the ribosome binding site [Shine and Dalgarno,
Nature 254: 34 (1975); Steitz, in Ribosomes: Structure,
Function and Genetics ed. Chambliss et al. Baltimore, Md.,
~ University Park Press pp. 479-495 (1980)], computer analysis
. ..,. .......,
». WO 91/12328 PCT/US91/01013
2015914
-19-
has indicated that approximately one hundred nucleotides
surrounding the AUG initiating codon are involved in
ribosome/mRNA interaction as indicated by proper prediction
of translation start signals [Stormer et al., Nucl. Acids
Res. 10:2971 (1982): Gold et al., Proc. Natl. Acad. Sci.
81:7061 (1984)]. As of yet, no accurate prediction of what
actually provides the best and complete ribosome binding
site for maximum translation of a specific protein has been
made [see Joyce et al., Proc. Natl. Acad. Sci. 80:1830
(1983)].
Schoner and Schoner recognized the significance
of the entire ribosome/mRNA interaction region in the
development of recombinant expression vectors in their
characterization of a 72 by sequence termed the
nminicistron" sequence [see Figure 1 of Schoner et al.,
Proc. Natl. Acad. Sci. USA 83: 8506 (1986)]. A one base
deletion in the first cistron of the "'minicistron" sequence
was sufficient to increase the production of the downstream
recombinant protein Met-[Ala]bGH from 0.4% to 24% of total
cell protein (See Figure 4, pCZ143 compared to pCZ145,
Schoner et al., id.).
Alternatively a two base insertion also resulted
in significant expression of the peptide encoded by the
second cistron. Experiments indicated that the differences
In expression were due to translational differences because
mRNA levels. in these constructs were essentially equivalent
(no more than 3 fold different) as compared to the expressed
protein differences (which were approximately 50 fold). The
conclusion was that the position of the stop codon that
~ terminates translation of the first cistron of the
minicistron sequence affected the efficiency of translation
of the second cistron containing the coding sequence of the
recombinant protein. Most importantly Schoner & Schoner's
work indicated that one or two base changes in the sequence
WO 91/12328 PGT/US91/01013
2075974 :~.
-20-
immediately preceding the coding sequence of a recombinant
protein can have tremendous effects on downstream
expression.
Successful expression of a cloned gene requires
sufficient transcription of DNA, translation of the mRNA and
Sin some instances, post-translational modification of the
protein. Expression vectors have been used to express
proteins under the control of an active promoter in a
suitable host, and to increase protein production.
3. SUMMARY
The present invention relates to novel reagents
and the process for making them. This invention provides a
process for synthesizing and identifying new binding
reagents of specific affinity. The Totally Synthetic
Affinity Reagents (TSARS) are concatenated heterofunctional
polypeptides or proteins in which at least two functional
groups are brought together in a single peptide chain: a
binding domain and an additional effector domain that is
chemically or biologically active. The polypeptides or
proteins are expressed in prokaryotic or eukaryotic cells as
hybrid fusion proteins comprising at least one binding
domain, with affinity for a ligand, linked to one or more
additional chemically or biologically active effector
domains. The chemically or biologically active effector
domain can include peptide moieties such as an enzyme or
fragment thereof, a toxin or fragment thereof, a therapeutic
agent, a peptide that is useful for detection, a peptide
that enhances expression of the TSAR molecule, or a peptide
~ whose function is to provide a site for attachment of a
substance that is useful for detection. The binding domain
can be separated from the effector domain that is
biologically or chemically active by a linker peptide
WO 91/12328 PCT/US91/01013
2075914
-21-
domain. If desired, the linker domain can be either stable
or susceptible to cleavage either enzymatically or
chemically.
The invention provides a novel method for
producing heterofunctional binding fusion protein molecules,
termed TSARs, comprising the steps of: (a) inserting (i) a
first nucleotide sequence encoding a putative binding domain
having specificity for a ligand of choice and (ii) a second
nucleotide sequence encoding a biologically or chemically
active polypeptide or protein effector domain into a vector
~0 downstream from a 5'ATG start codon to produce a library of
vectors coding for an in-frame fusion protein; (b)
transforming cells with the vectors formed in step (a) to
express the fusion proteins; and (c) screening the expressed
fusion proteins to identify a TSAR having binding
~5specificity for the ligand of choice and the desired second
biological or chemical activity, in which the first
nucleotide sequence is obtained by a process of mutagenesis.
Mutagenesis, as used in this application, is
20 Intended to encompass any process which leads to the
production of an alteration, including a deletion, an
addition and a substitution of a nucleotide(s), in a sequence
of nucleotides encoding a protein, polypeptide or peptide
moiety. Hence, mutagenesis can be accomplished by chemical
25 synthesis of an altered nucleotide sequence; by alteration
induced in vitro or in vivo by any known mutagen such as
ionizing radiation or a chemical mutagenic agent: and by
insertion of an altered sequence generated using recombinant
DNA techniques such as insertion of isolated genomic DNA,
~ cDNA or a chemically synthesized oligonucleotide sequence.
Thus, mutagenesis encompasses random, site directed or site
selective techniques known to those of skill in the art.
According to one embodiment of the invention,
step (a) of the method further comprises inserting a third
~ nucleotide sequence encoding a peptide linker domain between
WO 91/12328 PCT/US91/01013
2015914 v
-22-
the first and second nucleotide sequences. The linker
domain can be either stable or susceptible to cleavage by
enzymatic or chemical reagents. According to one mode of
this embodiment, when there is a binding domain and the
linker domain is cleavable, the heterofunctional TSAR can be
used as an intermediate to prepare a unifunctional binding
polypeptide or protein having specificity for a ligand of
choice.
According to the present invention, the first
nucleotide sequence encoding a putative binding domain
~~ comprises a member of a group of sequences of nucleotides
obtained by a process of mutagenesis of the nucleotide
sequence encoding the binding domain of a receptor or anti-
ligand for a ligand of choice. A receptor is selected from
l5the group of naturally occurring receptors such as the
variable region of an antibody, an enzyme/substrate or
enzyme/co-factor binding site, a regulatory DNA binding
protein, an RNA binding protein, a metal binding protein, an
integrin or other adhesive protein, a calcium binding
2o protein, a lectin, etc. The nucleotide sequence encoding
the binding domain of the receptor is mutagenized, using
either random, site directed or site selective techniques
known to those of skill in the art, and the resulting group
of nucleotide sequences are inserted as the first nucleotide
25 sequence in step (a) of the method of the invention.
According to an alternative method of the present
invention using random mutagenesis, the first nucleotide
sequence comprises a group of nucleotide sequences generated
by random chemical synthesis or assembly of DNA fragments
~ selected by size but not sequence. In this embodiment,
randomly generated nucleotide sequences are employed as the
first nucleotide sequence in step (a) of the method of the
invention to form a library of vectors expressing fusion
proteins. The fusion proteins are screened using a ligand
~ of choice to identify a TSAR having binding specificity for
..~ T
.... WO 91/12328 PCT/US91/01013
2015914
-23-
the chosen ligand. Using this embodiment of the present
invention, the TSAR formed may have rather low binding
specificity for the ligand. In such case, the nucleotide
sequence encoding the binding domain of the identified TSAR
is determined. The determined nucleotide sequence is then
mutagenized and steps (a)-(c) of the method of the invention
are repeated to identify an additional TSAR having enhanced
binding affinity for the chosen ligand. Random mutagenesis,
as used in this application, is intended to encompass
mutagenesis accomplished either by random chemical synthesis
~0 of a nucleotide sequence or by random alteration by any
mutagenic agent or by assembly of DNA fragments selected by
size but not sequence.
Additionally, the invention includes a
l5unifunctional polypeptide or protein having specificity for
a ligand of choice that can be prepared by chemically
synthesizing the amino acid sequence of the binding domain
of a fusion protein produced according to the method of the
invention.
The present invention thus provides novel and
20 improved binding reagents of desired binding specificity and
avidity as well as methods for using such reagents for a
variety of in vitro and in vivo applications.
3.1. ADVANTAGES AND OBJECTS OF THE INVENTION
The present invention provides a method for
forming a binding molecule that is reproducible, quick,
simple, efficient and relatively inexpensive. More
particularly, the invention provides a method of generating
~ and screening a large library of diverse heterofunctional
molecules. Thus, the invention provides a rapid and easy
way of producing a large library that results in a family of
related peptides with novel and improved binding
specificities, affinities and stabilities for a given
~ ligand. The diversity of binding characteristics that cari
WO 91/12328 PCT/US91/01013
2J75914
-24-
be obtained with the present invention is much greater than
the diversity that can be obtained for other binding
molecules that are formed in vivo.
In contrast to the prior art that relies on
isolation of specific genes and known sequences, the present
5invention has the advantage that there is no need for
purifying or isolating genes nor any need for detailed
knowledge of the function of portions of the binding
sequence or the amino acids that are involved in ligand
binding in order to produce a TSAR. The only requirement is
~0 having the ligand needed to screen a TSAR library to find
TSARS with affinity for that ligand. Since TSARS are
screened in vitro, the solvent requirements involved in
TSAR/ligand interactions are not limited to aqueous
,5solvents; thus, nonaqueous binding interactions and
,, conditions different from those found _in vivo can be
exploited.
TSARS are particularly useful in systems in which
development of binding affinities for a new substance and
20 developing different binding affinities for known substances
are important factors.
TSARS may be used in any _in vivo or _in vitro
application that might make use of a peptide or polypeptide
with binding affinity such as a cell surface receptor, a
25viral receptor, an enzyme, a lectin, an integrin, an
adhesin, a Ca++ binding protein, a metal binding protein,
DNA or RNA binding proteins, immunoglobulins, vitamin
cofactors, peptides that recognize any bioorganic or
inorganic compound, etc.
By virtue of the affinity of the binding domain
for a target, TSARS used in vivo can deliver a chemically or
biologically active effector peptide moiety, such as a
peptide, toxin or fragment thereof, or enzyme or fragment
thereof, to the specific target in or on the cell. The
~ TSARs can also have a, utility similar to monoclonal
_.,.T T ,
...~WO 91/12328 PCT/US91/01013
2075974
-25-
antibodies or other specific binding molecules for the
detection, quantitation, separation or purification of other
molecules. In one embodiment, there may exist multiple
binding domains that have the same specificity but are fused
to another distinct effector polypeptide or protein domain
that has a biological or chemical activity. In yet another
embodiment, the binding domain is separated from the
biologically or chemically active effector polypeptide or
protein portion by a linker domain. If the linker is
susceptible to chemical or enzymatic cleavage, the TSAR can
l0function as an intermediate in the generation of
unifunctional peptides of defined specificity, affinity and
stability.
The TSARS that are produced in this invention can
replace the function of macromolecules such as monoclonal or
polyclonal antibodies and thereby circumvent the need for
complex hybridoma formation or in vivo antibody production.
Moreover, TSARS differ from other natural binding molecules
in that TSARS have an easily characterized and designed
activity that can allow their direct and rapid detection in
a screening process.
These and other objects, aspects and advantages
of the present invention will become apparent to those
skilled in the art upon reviewing the following description,
examples, figures and appended claims.
3.2. DEFINITIONS AND ABBREVIATIONS
Affinity . Strength of binding
ATG . The DNA codon for f-met
and initiation of
translation
Avidity . Stability of binding
BSA . Bovine serum albumin
ATCC . American Type Culture
Collection
WO 91/12328 2 Q 7 5 9 l 4 PCT/L1S91/01013
-26-
bP . Base pair
Kilobase
ELISA . Enzyme linked
immunosorbent assay
HPLC High pressure liquid
chromatography
IPTG . Isopropyl-~-D-
thiogalactopyranoside
IgG,M, etc. . Immunoglobulin G, M, etc.
Ligand . A molecule or portion
thereof for which a
receptor naturally exists
or can be prepared
LB . Luria Broth
mRNA . messenger RNA
ONPG . 0-nitrophenyl-~-D-
galactopyranoside
O . Oligonucleotide
PAGE . Polyacrylamide gel
electrophoresis
PMSF . phenylmethane sulfonyl
fluoride
PL. PR Promoter left, promoter
right of a phage
PTAC' PTRC Hybrid tryp-lac promoter
Receptor . an anti-ligand; any macro-
molecular compound or
- composition capable of
binding to a particular
spatial and/or polar
organization of a molecule
or portion thereof
RNase . Ribonuclease
SDS . Sodium dodecyl sulfate
X-gal . 5-bromo-4-chloro-3-
... WO 91/12328 ~ , PCT/US91/01013
2015914
-27-
indolyl-~-D-
galactopyranoside
YT . Yeast tryptone broth
TBS . Tris Buffered Saline
3.3. AMINO ACID CODE
Alanine . A, Ala
Arginine . R, Arg
Asparagine . N, Asn
Aspartic acid . D, Asp
Cysteine . C, Cys
Glutamic acid . E, Glu
Glutamine . Q, Gln
Glycine . G, Gly
Histidine . H, His
Isoleucine . I, Ile
Leucine . L, Leu
Lysine . K, Lys
Methionine . M, Met
Phenylalanine . F, Phe
Proline . P, pro
Serine . S, Ser
Threonine . T, Thr
Tryptophan . W, Trp
Tyrosine , Y, Tyr
Valine . V, Val
_4. BRIEF DESCRIPTION OF THE FIGURES
Figure 1 depicts the steps in construction of the
~ expression vector p340.
Figure 2 depicts the oligonucleotide sequence used
in construction of the amino terminal end of the control
fusion protein.
Figure 3 is a diagram of the plasmid p325-13 which
~ encodes the control fusion protein.
WO 91/12328 PCT/US91/01013
2075974
_28_
Figure 4 depicts the nucleotide and amino acid
sequence of the TSAR-2 binding domain.
Figure 5 is a diagram of the plasmid p395-4 which
encodes TSAR-2.
Figure 6 depicts the alignment of the amino
5terminal end of the control fusion protein with the TSAR-2
binding domain.
Figure 7 shows the binding of lysozyme to the
control fusion protein and TSAR-2.
Figure 8 is a diagram of the control fusion and
TSAR-2 proteins, illustrating the "binding" domains, the
linker domains and the effector domains of these
heterofunctional proteins.
Figure 9 illustrates the specificity of TSAR-2 for
lysozyme and shows binding of TSAR-2 to lysozyme and bovine
serum albumen (BSA). The binding is detected using an assay
for ~-galactosidase which is the peptide encoded by the
effector domain.
5. DETAILED DESCRIPTION OF THE INVENTION
5.1. TSARS
In the present invention, novel reagents called
TSARS are created and produced as soluble, easily purified
proteins that can be made and isolated in commercial
quantities. These reagents are concatenated
heterofunctional polypeptides or proteins that include at
least two distinct functional regions. One region of the
heterofunctional molecule is a binding domain with affinity
for a ligand that is characterized by 1) its strength of
~ binding under specific conditions, 2) the stability of its
binding under specific conditions, and 3) its selective
specificity for the chosen ligand. The second peptide
portion of the heterofunctional TSAR molecule is an effector
domain that is biologically or chemically active such as an
~ enzyme or fragment thereof, a toxin or fragment thereof, a
..~.~
.....WO 91/12328 PCT/US91/01013
2075974
-29-
therapeutic agent or a peptide whose function is to provide
a site for attachment of a substance such as a metal ion,
etc., that is useful for detection. According to one
embodiment of the invention, a TSAR can contain an optional
additional region, i.e., a linker domain between the binding
domain and the effector domain. Linkers can be chosen that
allow biological, physical or chemical cleavage and
separation of the TSAR regions. TSARS having a cleavable
linker portion, thus, can serve as intermediates in the
production of unifunctional polypeptides or proteins having
a binding function and specificity for a ligand of choice.
Alternatively, the linker portion can be stable or
impervious to chemical and/or enzymatic cleavage and serve
as a link between the binding domain and the other peptide
l5portion(s) of the TSAR.
According to another embodiment of the invention,
the TSAR can include multiple binding domains or multiple
active effector portions or combinations of multiples of
each. The size of a binding domain is not limited, nor is
the binding quality of the TSAR limited to a single peptide
chain. Monomers, dimers and oligomers of a TSAR protein may
singly or in combination affect interaction with the ligand.
In the present invention, a ligand is intended to
encompass a substance, including a molecule or portion
thereof, for which a proteinaceous receptor naturally exists
or can be prepared according to the method of the invention.
A receptor is an anti-ligand and includes any macromolecular
compound or composition capable of binding to a particular
spatial and%or polar organization of a ligand. Thus in this
~ invention, a ligand is a substance that specifically
interacts with the binding domain of a TSAR and includes,
but is not limited to, a chemical group, an ion, a metal, a
peptide or any portion of a peptide, a nucleic acid or any
portion of a nucleic acid, a sugar, a carbohydrate or
~ carbohydrate polymer, a lipid, a fatty acid, a viral
PCT/US91 /01013
WO 91/12328 2 0 l 5 9 l 4
-30-
particle or portion thereof, a membrane vesicle or portion
thereof, a cell wall component, a synthetic organic
compound, a bioorganic compound and an inorganic compound.
The chemically or biologically active domain of
the TSAR imparts detectable, diagnostic, enzymatic or
5therapeutic characteristics to the TSAR. There is no
intended specified order for the two or more regions of the
TSAR relative to each other except that the linker domain,
if present, must be between the binding domain and the
effector domain of the TSAR. The positions of the regions
~0 of the TSAR are otherwise interchangeable.
In a particular embodiment, the binding and
effector regions of the TSAR protein are separated by a
peptide linker domain. The presence or absence of the
l5peptide linker domain is optional as is the type of linker
that may be used. The sequence can be stable or it can be
susceptible to cleavage by chemical, biological, physical or
enzymatic means. If a cleavable linker is used, the
sequence employed is one that allows the binding domain
portion of the TSAR to be released from the effector domain
20 of the TSAR protein. Thus when a linker is used that is
susceptible to cleavage, the heterofunctional TSAR protein
can be an intermediate in the production of a unifunctional
binding protein, polypeptide or peptide.
In a particular embodiment, the cleavable sequence
is one that is enzymatically degradable. A collagenase
susceptible sequence is but one example (see, for example,
Sections 8 and 9, infra). Other useful sequences that can
be used as an enzymatically cleavable linker domain are
~ those which are susceptible to enterokinase or Factor Xa
cleavage. For example, enterokinase cleaves after the
lysine in the sequence Asp-Asp-Asp-Lys. Factor Xa is
specific to a site having the sequence Ile-Glu-Gly-Arg, and
cleaves after arginine. Another useful sequence is Leu-
~ Val-Pro-Arg-Gly-Ser-Pro which is cleaved by thrombin between
.~ _...~ T
..~. WO 91/12328 2 0 7 5 9 l 4 , p~/US91/01013
-31-
the Arg and Gly residues. Other enzyme cleavable sequences
that can be used are those encoding sites recognized by
microbial proteases, viral proteases, the complement cascade
enzymes and enzymes of the blood coagulation/clot
dissolution pathway. Other enzyme cleavable sequences will
also be recognized by those skilled in the art and are
intended to be included in this embodiment of the invention.
Alternatively, the sequence may be selected so as to contain
a site cleavable by chemical means, such as cyanogen bromide
which attacks methionine residues in a peptide sequence.
~0 Another chemical means of cleavage includes the use of
formic acid which cleaves at proline residues in a peptide
sequence. The invention is not to be limited to the
specific examples of chemical cleavage provided here but
includes the use of any chemical cleavage method known to
~5those with skill in the art.
The binding domain of a TSAR may be of any size
that can be produced by the host cell. Moreover, the
binding reaction of the binding domain may be the result of
cooperativity between individual TSAR molecules as well as
20 the result of the independent affinity for the ligand by a
single TSAR molecule.
Once the binding domain of a TSAR has been
identified, new TSARS can be created by isolating and fusing
25 the binding domain of one TSAR to a different effector
domain. The biologically or chemically active effector
domain of the TSAR can thus be varied. Alternatively, the
binding characteristics of an individual TSAR can be
modified by varying the TSAR binding domain sequence to
~ produce a related family of TSARs with differing properties
for a specific ligand.
The biologically or chemically active effector
domain can impart an enzymatic activity that can be used to
identify or detect the TSAR. Alternatively it can impart a
~ therapeutic activity, e-g. a therapeutic group with a
WO 91/12328
2 J l 5 9 7 4 P~/US91/01013
-32-
proteolytic activity is attached to a binding domain with
affinity for fibrin to result in a TSAR that binds to fibrin
components in blood clots and dissolves them.
Alternatively, the effector domain can be a
5protein moiety that binds a metal, including but not limited
to radioactive, magnetic, paramagnetic, etc. metals, and
allows detection of the TSAR. Other examples of
biologically or chemically active effector peptides that can
be used in TSARS include but are not limited to toxins or
fragments thereof, peptides that have a detectable enzymatic
activity, peptides that bind metals, peptides that bind
specific cellular or extracellular components, peptides that
enhance expression of the TSAR molecule, peptides that
interact with fluorescent molecules, and peptides that
provide a convenient means for identifying the TSAR.
In the particular embodiments found in the
examples infra, the full sequence of the enzyme p-
galactosidase was used as the effector domain of the TSAR.
This protein provides a visual means of detection upon
addition of the proper substrate, e.g. X-gal or ONPG.
However, the effector domain of the TSAR need not be the
complete coding sequence of a protein. A fraction of a
protein that is readily expressed by the host cell and that
has the desired activity or function may be used.
5.2. METHOD TO PREPARE TSARS
The invention includes the process for making
novel TSARs~ In its most general embodiment, the process
comprises the steps of: (a) inserting (i) a first nucleotide
~ sequence encoding a putative binding domain having
specificity for a ligand of choice and (ii) a second
nucleotide sequence encoding a biologically or chemically
active polypeptide or protein moiety into a vector
downstream from 5'ATG start codon to produce a library of
~ vectors coding for in-frame fusion proteins; (b)
.."_,~ T
WO 91/12328 ; ~ ~ PCT/US91/01013
2015914
-33-
transforming cells with the vectors formed in step (a) to
express the fusion proteins; and (c) screening the expressed
fusion proteins to identify a TSAR having binding
specificity for the ligand of choice, in which the first
nucleotide sequence is obtained by a process of mutagenesis.
Mutagenesis, as used in this application, is
intended to encompass any process which leads to the
production of an alteration, including a deletion, an
addition and a substitution of a nucleotides) in a sequence
of nucleotides encoding a protein, polypeptide or peptide
~0 moiety. Hence, mutagenesis can be accomplished by chemical
synthesis of an altered nucleotide sequence; by alteration
induced in vitro or in vivo by any known mutagen such as
ionizing radiation or a chemical mutagenic agent; and by
insertion of an altered sequence generated using recombinant
DNA techniques such as insertion of isolated genomic DNA,
cDNA or a chemically synthesized oligonucleotide sequence.
Thus, mutagenesis encompasses random, site directed or site
selective techniques known to those of skill in the art. The
process permits the production of a large diverse class of
TSAR proteins each bearing a unique ligand-specific binding
sequence fused to a biologically or chemically active
effector peptide region.
According to one embodiment of the invention, step
(a) of the method further comprises inserting a third
nucleotide sequence encoding a linker peptide domain between
the first and second nucleotide sequences. The linker
domain can be either stable or susceptible to cleavage by
enzymatic or chemical reagents. When the linker domain is
~ cleavable, the heterofunctional TSAR can be used as an
intermediate to prepare a unifunctional binding polypeptide
or protein having specificity for a ligand of choice.
In an alternative embodiment of the invention the
first nucleotide sequence comprises a member of a group of
~ nucleotide sequences obtained by mutagenesis of the
WO 91/12328 2 0 7 5 9 7 4 ,. PCT/US91/01013
-34-
nucleotide sequence encoding the binding domain of a receptor
or anti-ligand for a ligand of choice. In this embodiment, a
receptor is selected from the group of naturally occurring
receptors such as the variable region of an antibody, an
enzyme/substrate recognition or activity site, a regulatory
DNA binding protein, an RNA binding protein, a metal binding
protein, an integrin or other adhesive protein, a calcium
binding protein, a lectin, etc. The nucleotide sequence
encoding the binding domain of the receptor is mutagenized,
using techniques known to those of skill in the art, and the
~0 resulting group of nucleotide sequences are inserted as the
first nucleotide sequence in step (a) of the method of the
invention.
According to an alternative method of the
l5invention using random mutagenesis, the first nucleotide
sequence comprises a group of nucleotide sequences generated
by random chemical synthesis or assembly of DNA fragments
selected by size but not sequence. In this embodiment
randomly generated nucleotide sequences are employed as a
20 first nucleotide sequence in step (a) of the method of the
invention to form a library of vectors expressing fusion
proteins. The fusion proteins are screened using the ligand
of choice to identify a TSAR having binding specificity for
the chosen ligand. Using this mode of the present
25 Invention, the TSAR formed may have rather low binding
specificity for the ligand. In such case, the nucleotide
sequence encoding the binding domain of the identified TSAR
is determined. The determined nucleotide sequence is then
mutagenized and steps (a)-(c) of the method of the invention
~ are repeated to identify a TSAR having enhanced binding
affinity for the chosen ligand. Random mutagenesis, as used
in this application, is intended to encompass mutagenesis
accomplished both by random chemical synthesis of a
_. _V..., T . "~
-yV0 91/12328 2 0 7 5 9 7 4 pCf/US91/01013
-35-
nucleotide sequence and random alteration by any mutagenic
agent as well as by assembly of DNA fragments selected by
size but not by sequence.
DNA that constitutes the nucleotide sequence
encoding the binding domain portion of the TSAR sequence can
be chemically synthesized de novo using a) totally random
synthesis; b) synthesis modeled on known binding motifs
including, but not limited to, those described su ra in
Section 2.2 where there is some homology between the
synthesized DNA and a known binding sequence but the basic
sequence is subject to random change based on contamination
of precursor reservoirs during synthesis; or c) by minor
alteration of the sequences of known binding domains based
on the limited and defined change of bases within the
sequence. Alternatively, binding domain DNA can be produced
by insertion of nonselected sheared genomic DNA or cDNA
fragments into the p340 vector. The resulting novel
molecules are screened using methods known to those of skill
in the art, for increased or decreased affinity, or avidity
for known ligands or for new specificities for novel
ligands, including new specificities detected using
nonaqueous solutions.
Since each individual TSAR construct can have a
different yet representative fragment of binding domain DNA,
each batch of recombinants produced will represent a
distinct library of relatedness. The frequency of
relatedness between each member of the library can be
calculated and will depend on the method used to generate
the binding domain DNA. Where variation within the library
~ is large, high density screening methods and lambda vectors
can be used. For example, if oligonucleotides are
synthesized on an automated DNA synthesizer like the Applied
Biosystems machine, a microprocessor allows the user to
program additions to growing oligonucleotide chains from any
~ one of seven precursor reagent bottles'. Addition of
WO 91/12328 2 0 7 5 9 l 4 PCT/US91/01013
-36-
nucleotides coding for known bases in a sequence is done in
the customary fashion using four single precursor bottles,
one for each pure precursor. In the positions where
nucleotides are varied, a mixture of four precursor
nucleotides from a fifth bottle will be programmed.
Insertion of random nucleotides at only nine amino acid
codons allows up to 7.9 x 1011 possible proteins to be
encoded and subsequently expressed. Since recombinant phage
libraries produced in vitro generally have no more than
10$-1010 members, every library constructed will have no
identical TSAR clones.
In the specific examples, (see, infra, Sections 8
and 9) the binding domain DNA was produced in a series of
steps allowing assembly of complementary oligonucleotides
l5that were first chemically synthesized, then cloned and
sequenced by the dideoxynucleotide chain termination method.
Individual DNA fragments encompassing the oligonucleotide
were then reassembled using appropriate restriction sites on
the end of each fragment and appropriate restriction sites
in the recipient plasmids. DNA fragments of up to 367
nucleotides long with a coding capacity of over one hundred
and twenty amino acids have been produced. Because known
binding sites, especially those described in Section 2
su ra fall within this size range, the size of the inserted
25fragment that can be synthesized will not limit the binding
domain DNA that can be generated and thus will not limit the
specificity that can be detected.
A~nucleotide sequence encoding an effector domain
having the desired chemical or biological activity is
~ obtained using methods familiar to those of skill in the
art. Such methods include, but are not limited to,
polymerase chain reaction (PCR) amplification of the desired
DNA and determination of its nucleotide sequence.
Alternatively, sequences encoding the desired activity can
~ be detected by hybridization using an oligonucleotide (or an
w. ..__».T T .............. ,~ ,~,
--~O 91/12328 2 0 7 5 9 7 4 P~/US91/01013
-37-
oligonucleotide family that includes all possible codon
translations of the peptide with desired activity) having a
sequence that encodes a known portion of the desired active
effector protein. The oligonucleotide(s) hybridization
allows the purification of restriction fragments of genomic
SDNA encoding the active protein. The genomic DNA or cDNA
copy is then sequenced. The nucleotide sequence can be
synthesized or an appropriate restriction fragment can be
isolated and juxtaposed to the binding domain sequence in a
vector through use of a linker adaptor or other means to
~0 produce an in-frame fusion protein. Alternatively, if the
nucleotide sequence of the protein of desired activity is
known and has been cloned already, isolation of the
nucleotide sequence encoding the desired activity can be
more readily accomplished by simple purification of the
restriction fragment containing the appropriate sequence.
The skilled artisan will recognize that to achieve
transcription and translation of the TSAR gene, in the
method of expressing the TSAR protein of the present
invention, the gene must be placed under the control of a
promoter compatible with the chosen host cell. A promoter
is a region of DNA at which RNA polymerase attaches and
initiates transcription. The promoter selected may be any
one that has been synthesized or isolated that is functional
In the host. For example, E.coli, a commonly used host
system, has numerous promoters such as the lac or trp
promoter or the promoters of its bacteriophages or its
plasmids. Also synthetic or recombinantly produced
promoters such as the PTAC promoter may be used to direct
~ high level production of the segments of DNA adjacent to it.
Signals are also necessary in order to attain
efficient translation of the TSAR gene. For example in
E.coli mRNA, a ribosome binding site includes the
translational start codon AUG or GUG in addition to other
~ sequences complementary to the bases of the 3' end of 16S
WO 91/12328 2 0 l 5 9 l 4 ~ . PCT/US91/01013
-38-
ribosomal RNA. Several of these latter sequences such as
the Shine/Dalgarno sequence have been identified in E.coli
and other suitable host cell types. Any S/D-ATG sequence
which is compatible with the host cell system can be
employed. These S/D-ATG sequences include, but are not
5limited to, the S/D-ATG sequences of the cro gene or N gene
of coliphage lambda, the tryptophan E, D, C, B or A genes, a
synthetic S/D sequence or other S/D-ATG sequences known and
used in the art. Thus, regulatory elements control the
expression of the polypeptide or proteins to allow directed
synthesis of the reagents in cells and to prevent
constitutive synthesis of products which might be toxic to
host cells and thereby interfere with cell growth.
A number of methods exist for the insertion of DNA
fragments into cloning vectors in vitro. DNA ligase is an
enzyme which seals nicks between adjacent nucleotides in a
duplex DNA chain; this enzyme may therefore be used to
covalently join the annealed cohesive ends produced by
certain restruction enzymes or to join blunt ended fragments
together. In addition, the enzyme terminal deoxynucleotidyl
transferase may be employed to form homopolymeric 3'-
single-stranded tails at the ends of fragments. For
example, by the addition of oligo(dA) sequences to the 3'
end of one population, and oligo (dT) blocks to the 3' ends
of a second population, the two types of molecules can
anneal to form dimeric circles. Any of these methods may be
used to fuse the different domains of the TSAR protein into
specific sites in the vector.
Thus the sequences coding for the different
~ regions of the TSAR protein are fused in a chosen vector in
a specific relationship to promoter and control elements so
that the TSAR sequence is in the correct reading frame with
respect to the ATG sequence that specifies the start of the
TSAR protein. Vectors encoding TSARs can be viruses,
~ bacterial plasmids, phage, eukaryotic cell viruses or
.-.. .....,...T T.
_.. WO 91/12328 2 0 7 5 9 l 4 . '\PCT/US91/01013
-39-
eukaryotic plasmids, or any other vector known to those with
skill in the art that allows a TSAR to be easily produced
and manipulated in different host cells. The vector
employed will typically have a marker function, such as
ampicillin resistance or tetracycline resistance, so that
5cells transformed with TSAR vectors can be identified. The
vector employed may be any of the known expression vectors
or their derivatives; among the most frequently used are
plasmid vectors such as pBR322, pAC1005, pSC101, pBR325, or
derivatives of these vectors: bacteriophage vectors such as
~0 lambda or its recombinant derivatives like lamda-gtll, M13
or its derivatives like M13mp7, T7 or T4; SV40, EBV,
vaccinia and adenovirus vectors; and yeast or insect
vectors. A specifically exemplified vector that is usefully
l5employed is p340 (see section 7.4 infra). The vector is
selected for its compatibility with the chosen host cell
system. Although bacteria, particularly E. coli, have
proven very useful for the high yield production of a
soluble TSAR protein, and therefore is the preferred host,
the invention is not so limited. The present method
contemplates the use of any culturable unicellular organism
as host: for example, eukaryotic hosts such as yeast,
insect, plant and mammalian cells are also potential hosts
for TSAR production. The selection of an appropriate
expression system, based on the choice of a host cell, is
well within the ability of the skilled artisan.
TSAR phage clones can be grown to a high density
and representative products can be transferred as a mirror
image onto nitrocellulose filters or analogous solid
~ supports after expression of the TSAR genes. Screening
large numbers of plaques containing TSAR proteins can be
accomplished using techniques that are similar to those
using radioactive nucleic acid probes, where the ligand
replaces the radioactive nucleic acid probe. In one
~ embodiment the ligand can be bound to the support. TSARS
WO 91/12328
2 0 7 5 9 7 4 PCT/US91/01013
-40-
with affinity for the ligand will be identified by their
selective association to the filter because of ligand
binding. Alternatively, the TSARS can be immobilized and
the properties of the ligand can be used to identify clones
that bind the ligand. Direct and indirect methods that
5identify the ligand, the TSAR protein or other components
that bind to either one can be used to screen recombinant
libraries and are well known in the art. See for example,
Young and Davis in DNA Cloning: A Practical Approach Vol 1
(ed. D.M. Glover) IRL Press, Oxford pp. 49-78; Young and
Davis, Proc. Nat'1. Acad. Sci. _80: 1194 (1983); Kemp and
Cowman, Proc. Nat'1 Acad. Sci. 78: 4520 (1981); Unit 6.7,
"Screening with Antibodies", Current Protocols in Molecular
Biology, John Wiley and Sons, New York, pp. 6.7.1-6.7.5
(1987) .
Binding to individual ligands can then be assayed
for each filter using repetitive rounds with a new
interaction tested each round. Individual phage plaques
that are positive in the binding assay can be isolated from
others in the library. Rapid purification of the specific
TSAR protein can be achieved by virtue of the association of
the effector portion of the chimeric TSAR molecule for its
substrate, e-g purification of p-galactosidase containing
TSARs by affinity of the ~-galactosidase for p-aminophenyl-
1-thio-p-D-galactopyranoside-Sepharose.
_5.3. APPLICATIONS AND USES OF TSARS
TSARS prepared according to the novel methods of
the invention are useful for _in vitro and _in vivo
~ applications which heretofore have been performed by binding
regions of antibodies, DNA binding proteins, RNA binding
proteins, metal binding proteins, nucleotide fold and GTP
binding proteins, calcium binding proteins, adhesive
~", »"",~ T
.~ Wp 91/12328 Z ~ 7 5 9 l 4 ~ P~/US91/01013
-41-
proteins such as integrins, adhesins, lectins, enzymes, or
any other small peptide or portion of a macromolecule that
has binding affinity for a ligand.
The TSAR products can be used in any industrial or
pharmaceutical application that requires a peptide binding
5moiety specific for any given ligand. The TSARS can also be
intermediates in the production of unifunctional binding
peptides that are produced and selected by the method of the
invention to have a binding affinity, specificity and
avidity for a given ligand. Thus, according to the present
invention, TSARS are used in a wide variety of applications,
including but not limited to, uses in the field of
biomedicine; biologic control and pest regulation;
agriculture; cosmetics; environmental control and waste
management; chemistry: catalysis; nutrition and food
industries; military uses; climate control; pharmaceuticals;
etc. The applications described below are intended as
illustrative examples of the uses of TSARs and are in no way
intended as a limitation thereon. Other applications will
be readily apparent to those of skill in the art and are
intended to be encompassed by the present invention.
The TSARS are useful in a wide variety of in vivo
applications in the fields of biomedicine, bioregulation,
and control. In these applications, the TSARS are employed
as mimetic replacements for compositions such as enzymes,
hormone receptors, immunoglobulins, metal binding proteins,
calcium binding proteins, nucleic acid binding proteins,
nucleotide binding proteins, adhesive proteins such as
integrins, adhesins, lectins, etc.
Other in vivo uses include administration of TSARS
as immunogens for vaccines, useful for active immunization
procedures. TSARS can also be used to develop immunogens
for vaccines by generating a first series of TSARS specific
for a given cellular or viral macromolecular ligand and then
~ developing a second series of TSARS that bind to the first
i
W0 91/12328 2 ~ 7 5 9 7 4
PCT/US91 /01013
-42-
TSARs i.e. the first TSAR is used as a ligand to identify
the second series of TSARS. The second series of TSARS will
mimic the initial cellular or viral macromolecular ligand
site but will contain only relevant peptide binding
sequences, eliminating irrelevant peptide sequences. Either
the entire TSAR developed in the second series or the
binding domain thereof can be used as an immunogen for an
active vaccination program.
In in vivo applications TSARS can be administered
to animals and/or humans by a number of routes including
~0 injection (e. g. intravenous, intaperitoneal, intramuscular,
subcutaneous, intraauricular, intramammary, intraurethrally,
etc.), topical application, or by absorption through
epithelial or mucocutaneous linings. Delivery to plants,
l5insects and protists for bioregulation and/or control can be
achieved by direct application to the organism, dispersion
in the habitat, addition to the surrounding environment or
surrounding water, etc.
In the chemical industry, TSARs can be employed
for use in separations, purifications, preparative methods,
and catalysis.
In the field of diagnostics, TSARs can be used to
detect ligands occurring in lymph, blood, urine, feces,
saliva, sweat, tears, mucus, or any other physiological
liquid or solid. In the area of histology and pathology,
TSARs can be used to detect ligands in tissue sections,
organ sections, smears, or in other specimens examined
macroscopically or microscopically. TSARS can also be used
in other diagnostics as replacements for antibodies, as for
~ example in hormone detection kits, or in pathogenic
detection kits etc. where a pathogen can be any pathogen
including bacteria, viruses, mycoplasma, fungi, protozoans,
etc. TSARS may also be used to define the epitopes that
monoclonal antibodies bind to by using monoclonal antibodies
T
~~ WO 91/12328 2 0 7 5 9 l 4 PCT/US91/01013
-43-
as ligands for TSAR binding, thereby providing a method to
define the conformation of the original immunogen used to
develop the monoclonal antibody.
The following examples are provided to illustrate
this invention. However, they are not to be construed as
5limiting the scope of the invention, which scope is
determined by this entire specification including the
appended claims.
6. EXAMPLE: MATERIALS AND METHODS
6.1. CONDITIONS FOR RESTRICTION ENZYME DIGESTION
Enzymes were obtained from commercial sources (New
England Biolabs) and digestions were carried out as
recommended by the manufacturer.
6.2. BACTERIAL STRAINS AND PLASMIDS
_E. coli JM1O1 (SupE, thi, o(lac-pro) [F', traD36,
proAB, lacqZ oMlS] (P-L Pharmacia, Milwaukee, WI) was
transformed as described in Hanahan, J. Mol. Biol. 166:557
(1983). Plasmid pKK233-2 was obtained from P-L Pharmacia;
plasmid pBS+ was from Stratagene. Several plasmids were
constructed as modifications of pBS+ cloning vector
(Stratagene) to allow for DNA amplification and ease in
sequencing each oligomer. Plasmid p282 was produced by
Insertion of a 28 base oligonucleotide adapter
(5'AGCTTCCATGGTCGCGACTCGAGCTGCA-3') between the HinD III and
Pst I sites of the pBS+ multiple cloning region. As a
result, the modified plasmid p282 no longer contains its
original Sph I restriction site but encodes additional sites
~ for Nco I, Nru I and Xho I. The vector p287 was constructed
by adding the sequence GCTCGACTCGCGACCATGGA between the PstI
and Hind III restriction sites of pBS+, thereby deleting an
SphI site of pBS+ and adding NcoI, NruI and XhoI restriction
WO 91/12328 2 0 l 5 9 l 4 ~ PCT/US91/01013
-44-
sites. Another transitional plasmid, plasmid p350, was used
to clone other binding domain DNA fragments. Plasmid p350
was produced by annealing oligonucleotide 737
[5'-AGCTGATTAAATAAGGAGGAATAACCATGGCTGCA] and oligonucleotide
738 [5'-GCCATGGTTATTCCTCCTTATTTAATC) which were then
5inserted into Hind III and Pst I digested plasmid pBS+.
Other plasmid constructs are as described in this
application. Plasmid DNA was prepared by the alkaline lysis
method [Birnboim and Doly, Nucl. Acids Res. 7: 1513 (1979)).
6.3. OLIGONUCLEOTIDE ASSEMBLY
Oligonucleotides were synthesized from CED
phosphoramidites and tetrazole obtained from American
Bionetics. Oligonucleotides were kinased with T4
polynucleotide kinase according to manufacturer's
suggestions (New England Biolabs). The kinase was
inactivated by heating at 65°C. Oligonucleotide mixtures
were annealed by heating at 65-85°C for 15 minutes and
cooled slowly to room temperature. The annealed
oligonucleotides were ligated with l0 U T4 ligase, ligated
products were separated on a 6% polyacrylamide gel, and the
fragments were recovered by electroelution.
6.4. DNA SEQUENCING
The DNA sequences of inserted fragments and
oligonucleotides were determined by the chain termination
method of Sanger et al., Proc. Natl. Acad. Sci. _74:5463
(1977), incorporating the modifications of Biggen et al.,
~ Proc. Natl. Acad. Sci. 80:3963 (1983), Hattori and Sakakai,
Anal. Biochem. 152:232 (1986), and Bankier et al., Methods
Enzymol. 155: 51-93 (1987).
~.. ._.,...,T T
_.WO 91/12328 - ~ PCT/US91/01013
2075914
-45-
7. EXAMPLE: CONSTRUCTION
OF AN EXPRESSION VECTOR
7.1. THE INITIAL VECTOR pJG200
Plasmid pJG200 was the starting material that was
modified to produce a general TSAR expression vector. The
5initial plasmid, pJG200, contained target cistrons that were
fused in the correct reading frame to a marker peptide with
a detectable activity via a piece of DNA that codes for.a
protease sensitive linker peptide [Germino and Bastia, Proc.
Natl. Acad. Sci. USA 81:4692 (1984); Germino et al., Proc.
Natl. Acad. Sci. USA 80:6848 (1983)]. The promoter in the
original vector pJG200 was the PR promoter of phage lambda.
Adjacent to the promoter is the gene for the CI857
thermolabile repressor, followed by the ribosome-binding
site and the AUG initiator triplet of the cro gene of phage
~5lambda. Germino and Bastia inserted a fragment containing
the triple helical region of the chicken pro-2 collagen gene
into the Bam HI restriction site next to the ATG initiator,
to produce a vector in which the collagen sequence was fused
to the lacZ ~-galactosidase gene sequence in the correct
20 translational phase. A single Bam HI restriction site was
regenerated and used to insert the plasmid R6K replication
initiator protein coding sequence.
The plasmid pJG200 expressed the R6K replicator
initiator protein as a hybrid fusion product following a
25 temperature shift which inactivated the CI857 repressor and
allowed transcription initiation from the PR promoter. Both
the parent vector construct with the ATG initiator adjacent
to and in frame with the collagen/-galactosidase fusion
(noninsert vector), and pJG200 containing the R6K replicator
~ initiator protein joined in frame to the ATG initiator codon
(5') and the collagen/,9-galactosidase fusion (3') (insert
vector), produced ~-galactosidase activity in bacterial
cells transformed with the plasmids. As a result, bacterial
I
WO 91/12328 2 0 l 5 9 7 4 , . PCT/US91/01013
-46-
strains containing plasmids with inserts are not
distinguishable from strains containing the parent vector
with no insert.
7.2. REMOVAL OF THE PR ,C 857 REPRESSOR
AND AMINO TERMINUS ~F CRO
The first alteration to pJG200 according to this
invention was the removal and replacement of the Eco RI-Bam
HI fragment that contained the PR promoter, CI857 repressor
and amino terminus of the cro protein which provided the ATG
start site for the fusion proteins. An oligonucleotide
linker was inserted to produce the p258 plasmid, which
maintained the Eco RI site and also encoded the additional
DNA sequences recognized by Nco I, Bgl II and Bam HI
restriction endonucleases. This modification provided a new
15ATG start codon that was out of frame with the collagen/
galactosidase fusion. As a result, there is no
galactosidase activity in cells transformed with the p258
plasmid. In addition this modification removed the cro
protein amino terminus so that any resultant recombinant
20fusion products inserted adjacent to the ATG start codon
will not have cro encoded amino acids at their amino
terminus. In contrast, recombinant proteins expressed from
the original pJG200 vector all have cro encoded amino acids
at their amino terminus.
7.3. ADDITION OF THE P ~~ PROMOTER, SHINE
DALGARNO SEQUENCETAND ATG CODON
In the second step of construction of a TSAR
expression vector, a restriction fragment, the Eco RI-Nco I
fragment of pKK233-2 (Pharmacia Biochemicals, Milwaukee,
WI), was inserted into the Eco RI-Nco I restriction sites of
plasmid p258 to produce plasmid p277. As a result, the p277
~.. WO 91/12328 " :. PCT/US91/01013
2075974
-47-
plasmid contained the PTAC (also known as PTRC) promoter of
pKK233-2, the lacZ ribosome binding site and an ATG
initiation codon.
In the p277 plasmid, the insertion of a target
protein sequence allows its transcription from an IPTG
inducible promoter in an appropriate strain background. The
appropriate strain background provides sufficient lac
repressor protein to inhibit transcription from the
uninduced PTAC promoter. Appropriate strains that can be
used include JM101 or XL1-Blue. Because cells can be
~0 induced by the simple addition of small amounts of the
chemical IPTG, the p277 plasmid provides a significant
commercial advantage over promoters that require temperature
shifts for induction. For example, induction by the PR
l5promoter requires a temperature shift to inactivate the
CI857 repressor inhibiting pJG200's PR promoter. Induction
of commercial quantities of cell cultures containing
temperature inducible promoters require the inconvenient
step of heating large volumes of cells and medium to produce
20 the temperature shift necessary for induction.
One additional benefit of the promoter change is
that cells are not subjected to high temperatures or
temperature shifts. High temperatures and temperature
shifts result in a heat shock response and the induction of
25 heat shock response proteases capable of degrading
recombinant proteins as well as host proteins [See Grossman
et al., Cell 38:383 (1984); Baker et al., Proc. Natl. Acad.
Sci. 81: 6729 (1984)].
7.4. IMPROVEMENT OF THE RIBOSOME BINDING SITE
The p277 expression vector was further modified by
insertion of twenty-nine base pairs, namely
5'CATGTATCGATTAAATAAGGAGGAATAAC3' into the Nco I site of
p277 to produce plasmid p340-1. This 29 by sequence is
~ related to, but different from, one portion of the Schoner
WO 91/12328 2 G l 5 9 7 4 ~ PCT/US91/01013
-48-
"minicistron" sequence [Schoner et al., Proc. Nat'1. Acad.
Sci. 83: 8506, (1986)]. The inclusion of these 29 base
pairs provides an optimum Shine/Dalgarno site for
ribosomal/mRNA interaction. The p340-1 expression vector
significantly differs from pJG200 because it contains a
5highly inducible promoter suitable for the high yields
needed for commercial preparations, an improved synthetic
ribosome binding site region to improve translation, and a
means to provide a visual indicator of fragment insertion
upon isolation. The steps in the construction of vector
p340-1 are diagrammed in Figure 1.
8. EXAMPLE: CONTROL FUSION PROTEIN
AND CONSTRUCTION OF TSAR-1
A plasmid construct was made that included a
~5portion of the DNA sequence encoding the variable domain of
a murine monoclonal antibody specific for a dansyl hapten,
fused to a DNA sequence encoding a collagenase sensitive
site and p-galactosidase.
Assembly of the synthetic oligomers was carried
out in multiple steps. In general, single stranded
oligonucleotides bearing complementary overhangs were
annealed and ligated to produce three separate double-
stranded fragments whose specific construction is described
below. Subsets of these double stranded oligonucleotides
were assembled in separate annealing and ligation reactions
to produce sub-fragments. Before assembly, synthetic
oligomers were kinased with 10 units of T4 polynucleotide
kinase. To_prevent concatenation during ligation, the 5'
terminal oligomers on either strand were not phosphorylated.
~ A modified pBS+ vector (Stratagene) was produced to simplify
subsequent cloning steps (see Section 6.2, supra). The
modified vector, designated p287, was made by changing the
pBS+ vector HindIII restriction site to a NcoI site. The
synthetic oligomers were separately cloned into vector p287
,~. ~...,~ T
- WO 91/12328 2 0 l 5 9 l 4 p~/US91/01013
-49-
to allow DNA amplification and sequence verification by
dideoxy-nucleotide sequencing. Insertion of the assembled
fragments into the modified vector produced different
recombinant plasmids each containing a portion of a
potential binding domain DNA region proceeding from amino to
carboxy terminus respectively as described below. Following
ligation, each plasmid DNA was transformed separately into
competent E. coli JM101.
The first fragment was composed of six
oligonucleotides and included the sequence from the XhoI
~~ site to the HindIII site of the sequence shown in Figure 2.
This fragment (B) was inserted into the XhoI and HindIII
site of p287 to yield p306.
A second fragment was composed of four
oligonucleotides incorporating the sequence between HindIII
and BamH I of the sequence shown in Figure 2. This fragment
(C) was cloned into HindIII and BamH I digested p287 to
produce p320. The XhoI/HindIII fragment (B) from p306 and
the HindIII/BamH I fragment (C) from p320 were subcloned
2o into p287 that had been digested with XhoI and BamH I to
yield p321 in which fragments B and C were juxtaposed at the
HindIII site.
A third fragment containing the sequence including
the AATTC nucleotides of the EcoR I site to the XhoI site of
Figure 2 was produced from six oligonucleotides. This
fragment (A) was cloned into EcoR I and XhoI digested p287
to yield plasmid p322.
The XhoI/BamH I B/C fragment of p321 and the
NcoI/XhoI subfragment of p322, the latter containing the A
~ fragment sequence, were subcloned into NcoI and BamH I
digested p277 (see Section 7.3) to yield p323.
The mini-cistron fragment was inserted into the
NcoI site of the modified p277 i.e., p323, to yield the
construct p325-13. A diagram of p325-13 is shown in Figure
~ 3.
WO 91 / 12328 2 G 7 5 9 l 4 v P~/US91 /01013
-50-
Although the DNA sequence encoding the fusion
protein expressed by p325-13 contained a portion of the
sequence of the variable domain of an antibody specific for
a dansyl hapten, binding studies indicated that the fusion
protein had no specific binding affinity for the dansyl
moiety. The fusion protein expressed by p325-13 was,
however, cleavable by collagenase and could be detected _in
vitro by the ~-galactosidase activity of its carboxyl
terminal end. As illustrated in Figure 7, the fusion
protein expressed by p325-13 also had no detectable specific
binding affinity for lysozyme although the amino-terminal
end of the fusion protein shares significant homology with
the variable region of the monoclonal antibody having
affinity for hen egg lysozyme reported by Darsley and Reed,
EMBO J. 4: 393 (1988).
The expressed fusion protein (hereinafter termed
"control fusion protein") could be modified to produce a
TSAR-1 according to the present invention as follows.
Random mutagenesis of the oligonucleotide sequence encoding
the amino-terminal end of the control fusion protein,
followed by expression and screening the family of related
fusion proteins formed using a dansyl or lysozyme ligand
would result in a TSAR having the desired binding domain
with affinity for the dansyl or lysozyme ligand, a
collagenase sensitive linker domain and an effector domain
having ~-galactosidase activity. For example, chemical
synthesis of the oligonucleotides encoding the amino-
terminal end of p325-13 using programmed reservoir
contamination results in a family of oligonucleotides which,
~ when expressed, yields a family of fusion proteins related
to the control fusion protein. Screening this family of
related fusion proteins results in a TSAR termed "TSAR-1"
having a binding domain with affinity for dansyl or lysozyme
and an effector domain having p-galactosidase activity.
~..~ T y ",..M
WO 91/12328 2 0 7 5 9 7 4 ; PCT/US91/01013
-51-
Screens are accomplished by replicating cells
containing vectors expressing the family of fusion proteins,
immobilizing expressed proteins from vector containing cells
to filter, applying either the lysozyme or the dansyl ligand
5to the filters, washing the unbound ligand from the filters,
detecting the bound ligand, and then examining the filters
for ligand binding to identify vectors expressing a dansyl
or lysozyme binding moiety.
9. EXAMPLE: TSAR-2 CONSTRUCTION
A plasmid construct was made that includes a
binding domain consisting of a chemically synthesized
modified sequence designed from the variable domain of a
monoclonal antibody with affinity for the G-Loop-2 region of
hen egg lysozyme, as reported by Darsley and Reed, EMBO J.
4: 393 (1988). The modified DNA sequence was fused to DNA
sequences encoding a collagenase sensitive site and p-
galactosidase. Assembly of the synthetic oligomers was
carried out in multiple steps.
In general, single-stranded oligonucleotides
bearing complementary overhangs were annealed and ligated to
produce double-stranded subfragments encoding the TSAR-2
binding domain. These double-stranded oligonucleotides were
then assembled to produce two separate double-stranded
fragments that together encode the TSAR-2 binding domain.
The specific construction of these two fragments is
described below. Before assembly, synthetic oligomers were
kinased with 10 units of T4 polynucleotide kinase. To
prevent concatenation during ligation, the 5' terminal
~ oligomer on either strand was not phosphorylated. Following
ligation, each plasmid DNA was transformed separately into
competent E. coli JM101.
The synthetic oligomers constituting the two
double-stranded fragments encoding the TSAR-2 binding domain
~ were separately cloned into the modified pBS+ vectors p287
WO 91/12328
2 G l 5 9 l 4 ~ PCT/US91/01013
-52-
or p350 (described in Section 5 supra) to allow DNA
amplification and sequence verification by dideoxynucleotide
sequencing. The first fragment was composed of six
oligonucleotides and included the sequence from the NcoI
site to the XbaI site of the sequence shown in Figure 4.
This fragment was cloned into NcoI and XbaI digested p350 to
produce plasmid p374-2.
The second fragment was composed of ten
oligonucleotides and included the sequence from the XbaI
site to the BamH I site of the sequence shown in Figure 4.
This fragment was cloned into XbaI and BamH I digested
plasmid p287 to produce plasmid p382-9.
The first NcoI/Xba I fragment of p374-2 and the
second XbaI/BamH I fragment of p382-9 were then subcloned
into NcoI and BamH I digested plasmid p340 (see Section 7,
supra) to produce plasmid p395-4, the TSAR-2 expression
vector. A diagram of plasmid p395-4 is shown in Figure 5.
The resulting protein fusion product, TSAR-2,
shares significant sequence homology in the binding domain
with the control fusion product described in Section 9 and
is identical to the control fusion protein in all other
parts of the molecules. A comparison of the sequence
similarity of the control fusion product and TSAR-2 is
provided in Figure 6. TSAR-2 differs in binding activity
when compared to the control as demonstrated in Figures 7
and 9.
10. EXAMPLE: CELL GROWTH AND EXPRESSION
FOR TSAR PURIFICATION
E. coli cells harboring the TSAR vectors or the
~ control fusion protein were grown in 10 liters of 2x YT
fermentation medium. [Miller, Experiments in Molecular
Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor
N.Y. p. 433 (1974)]. Cells were grown in a MagnaFerm Bench
Top Fermentor Model MA-100 (New Brunswick Scientific G.)
.~ ..r.., T " ,~
~,_ WO 91/12328 2 0 l 5 9 l 4 P~/US91/01O13
-53-
from a dilution of an overnight culture grown in M9 medium
to an OD590 of about 0.5. [Miller, supra, p.431]
supplemented with ampicillin. Cells were cultured in the YT
fermentation medium to an OD590 of 8 at which time IPTG was
added to 1 mM and lactose was added to 5 mM. During
fermentation the pH was maintained at 7. p-galactosidase
activity was monitored by a colorimetric assay with ONPG as
substrate using the protocol of Miller, supra, p. 433. When
~-galactosidase activity plateaued, the cells were harvested
by centrifugation and stored at -20°C.
11. EXAMPLE: PURIFICATION OF THE
CONTROL FUSION PROTEIN AND TSAR-2
E. coli cells containing either the p325-13
expressing the control fusion protein or the p395-4 plasmid
l5expressing TSAR-2 were harvested by centrifugation and
stored frozen. Frozen cell paste was resuspended in 0.05M
Tris-HC1 pH 8, 0.05M EDTA, 15% sucrose with freshly
dissolved lysozyme at 1 mg/ml in a volume of buffer such
that 1 g of cell paste was resuspended in 5 ml of buffer.
The cells were incubated on ice for 30 min. and then frozen
at -70°C, thawed rapidly and sonicated briefly to shear DNA.
PMSF was added to 1mM and the suspension was centrifuged at
27,000 x g for 30 min. at 4°C. Nucleic acids were
precipitated by dropwise addition of 10% streptomycin
sul f ate .
The supernatant was adjusted to 1.6 M NaCl and
applied to a p-aminophenyl-1-thio-~-D-galactopyranoside-
Sepharose column using the procedure of Ullmann [Gene 29: 27
(1984)]. A 3x7 cm column was routinely used for 24 g of
~ frozen cell paste. The TSAR/control protein was eluted with
0.1 M sodium borate, pH 5 and promptly precipitated with 40%
ammonium sulfate. The fractions were assayed for p-
galactosidase activity and the active fractions were pooled.
Protein was collected by centrifugation at 12,000 x g for 20
Wo 91~1z3~ 2 0 l 5 9 l 4 PCT/US91/01013
-54-
min. at'4'C. The TSAR/control protein precipitate was
dissolved in and dialyzed overnight against 0.05 M Tris-HC1,
pH 8.3, 0.15 M NaCl, 0.02% sodium azide, 0.1% polyethylene
glycol 8000 at 4°C. The purity of the TSAR/control protein
was monitored as units of ~-galactosidase per mg. of protein,
5as measured by the Bradford Assay (Bio-Rad). TSAR/control
protein was quantitated by colorimetric assay for
galactosidase activity using ONPG as substrate.
12. EXAMPLE: LYSOZYME BINDING
ASSAY OF TSAR-2
The binding affinities and specificities of the
control fusion protein and TSAR=2 to Chicken Egg Lysozyme
HC1 (Sigma Chemical Co., St. Louis, MO) were compared as
follows:
a) Two 96-well SeroCluster EIA plates (elisa
immuno-assay plates, Costar, Cambridge, MA) were coated
overnight: one with 25 ~g/ml chicken egg lysozyme in 1X TBS
(10 mM Tris-HC1, pH 8.0, 15 mM NaCl in distilled H20), the
second with 25 ~g/ml bovine serum albumin (BSA) also in 1X
2~ TBS. The volume placed in each well was 100 ~l.
b) Fourteen hours later the coating material
was removed by aspiration. Subsequently, 25 ~cg/ml BSA in 1X
TBST (TBS with Tween-20 added to a final concentration of
0.05%) was added at 200 ~l/well and plates were incubated
25 for 2 hours at room temperature to block additional binding.
c) After the 2 hour blocking period, both
plates were washed 8 times with 1X TEST.
d) Dilutions of the control and TSAR-2 proteins
were prepared during the 2 hour blocking reaction. To
~ determine what dilutions were required, the control and
TSAR-2 proteins were first assayed for beta-galactosidase
activity, and the activities compared. Because TSAR-2 had
only a very slightly higher beta-galactosidase activity than
~.. WO 91/12328 PCT/US91/01013
2075914
-55-
the control on an activity to mass basis (the ratio being
1:1.05), equal concentrations of each were used in the
assay.
Purified control and TSAR-2 proteins were diluted
to 100, 75, 50, 25, 10, 5, 1, and 0.1 ~g/ml. The dilutions
5were made into polypropylene tubes using standard pipetting
techniques. 1X TEST was employed as the dilutant. The
plates were loaded with 100 ul/well as follows:
CONTROL TSAR-2
BLANK
1 2 3 4 5 6 7 8 9 10 11 12
100 ~g/ml 100 ~g/ml 1X TBST
B 75 ~g/ml 75 ~g/ml
C 50 ~g/ml 50 ~g/ml
D 2 5 ~sg/ml 2 5 ~eg/ml
15 E 10 ~g/ml l0 ~g/ml
F 5 ~g/ml 5 ~g/ml
G 1 ~g/ml 1 ~g/ml
H 0.1 ~Q/ml 0.1 ~g/ml
Parallel plates 1 and 2 were run treated as in
(a). One plate was coated with chicken egg lysozyme and the
second was coated with BSA as an additional control ligand.
The incubation time to allow binding in this assay was 2
hours at 21°C.
e) The plates were washed 8 times with 1X TBST.
f) After aspirating the final wash buffer, 50
~1 of Z buffer (60mM Na2HP04.7H20; 40mM NaH2P04.H20; lOmM
KC1; 1mM MgS04.7H20: 50 mM beta-mercaptoethanol) was added
~ to each well (including the blank control wells). 50 ul/ml
of ONPG (4 mg/ml in distilled H20) was then added to each
well (including the blank wells).
2075974
-56-
g) Multiple determinations of optical density
were done over approximately 45 minutes. The plates were
read at 405 nm in a 5 and 10 minute kinetic run. The
results are expressed as the change in optical density over
time.
h) The color change was stopped by the addition
of 50 ml/well 1M Na2C03, and a final endpoint reading was
taken. All analyses were done using a Molecular Devices,
Inc. (Palo Alto, CA) Vmax (TM) kinetic microplate reader.
The data was collected and analyzed using softmax (TM)
colorimetric analysis software and an IBM-PC compatible
computer.
As can be seen from Figure 9, TSAR-2 protein is
able to bind to chicken egg lysozyme but not to bovine serum
albumin (BSA). In addition, the control fusion protein does
not bind to chicken egg lysozyme when compared to TSAR-2
even though the control fusion protein and TSAR-2 share very
close sequence similarities since they are absolutely
identical in all portions of the protein except the binding
domain (amino acids 2-118 for the control fusion protein and
3-114 for TSAR-2 as diagrammed in Figure 8). Although not
exactly similar in the binding domain, the two proteins are
closely related in binding domain sequence as is apparent
from the comparison of the sequences of these regions
presented in Figure 6 and the schematic of Figure 8.
TSAR-2 binding specificity and affinity for
different lysozymes was analyzed using these same kinetic
procedures by comparison of the binding of TSAR-2 to chicken
egg lysozyme and human milk lysozyme. Although TSAR-2 had
significant binding affinity for chicken egg lysozyme as
indicated in Figure 9, TSAR-2 had a very low affinity for
human milk lysozyme that could be detected in kinetic assays
only at high concentrations of protein (between 50-100 mg/ml
for human milk lysozyme as compared to binding to chicken
egg lysozyme that was detectable at concentrations below 1
B
~- WO 91/12328 2 0 7 5 9 7 4 , P~/US91/01013
-57-
~m/ml). Thus, TSAR-2 in this example is an illustration of
a heterofunctional protein produced by the method of the
invention which has a binding domain of characterized
affinity and specificity for chicken egg lysozyme as
distinct from human milk lysozyme, wherein the binding
domain is fused to a biologically or chemically active
polypeptide or protein, i.e. p-galactosidase in this
embodiment.
13. DEPOSIT OF MICROORGANISMS
The following plasmid was deposited with the
American Type Culture Collection (ATCC), Rockville, MD on
November 29, 1988, and has been assigned the indicated
accession number:
Plasmid Accession Number
p340 ATCC 40516
The following plasmids were deposited in strain
JM-101 with the Agricultural Research Culture Collection and
have been assigned the indicated accession numbers:
Plasmid Accession Number
p325-13 B - 18587
p395-4 B - 18588
The present invention is not to be limited in
scope by the plasmids deposited since the deposited
e~odiments are intended as illustrations of one aspect of
the invention, any of which are functionally equivalent
within the scope of this invention. Indeed, various
modifications of the invention in addition to those shown
and described herein will become apparent to those skilled
~ in the art from the foregoing description and accompanying
drawings. Such modifications are intended to fall within
the scope of the appended claims.
WO 91/12328 P~'/US91/01013
2075974
-58-
It is also to be understood that all base pair and
amino acid residue numbers and sizes given for nucleotides
and peptides are approximate and are used for purposes of
description.
10
20
30
~.. __..T T " ."..,..~. . . ......
._.. WO 91/12328 2 0 7 5 9 7 4 5 9 ~ ' , PCT/US91/01013
Inllrnetlonsl Appllcltlon No: PCT/
MICROORGANISMB
Oone~N lneel In cenneellen wish
the rnlcreertenlern referred
le en ....__~ 9.__.._ . 1.
.
",~._. el the deeerlelle~ r
A. 101NTIIICAT10N 01 D1I011T
r
r~.ye. aeoeelle ere IdenlIflel
en en eddhlenel eheH y
Nerve el Iesellerp In1111u11en
:~merican Type Culture Collection
Addreee cl deeea.r~r IneNwllew
Oncleswc eeltl eels en1 cwny
12301 Parklawn Drive
Rockville, :~ 20852
orle el eecteN r AteNeln Nvmlw r
Vovember 29, 1988 40516
. A001T10NAL INDCAT10N ~ Ilw.
llenY II ntl eIISe11t1. Thle
InIW wW vn I een11nw1 en .
mlyl W ached W .el
C. D!1NATID 1TAT1 IOII WNICN
NDICATIDII AI YAD11 (II IM
1w11ceNewt ut_wtl Itr t! INIIwerel
l41ee1
D. !!111TI IU11111NIMi sI IIICICTION
MIN 111wL II wH t111cIltl
Tht Inllcallewt ltltl tllw will
11 11w411t1 1! IAI IMNwNMII
111reN I1r (!lttllp IM Hwertl
wNwt H IM IwlletNewt 1
' A
"
.,
csaaNlw NI,rwler tl DNIII
)
1. Thle rheH wN rNN.t1 wllA
IA IwlerwNNwt1 tllNttlllw wlen
IIIt1 (N 11 slecYtl 11111 rNtlelw/
J~.
~
~w~
~''r
~/
l~~
'
~
:
. :'_ . _
rL
_
(AelA1r1111 011sa)
/
~
L~ Tht Itlt d wsN1111W w 1 1NCln1)
111M IwIHw111wI IVIW
l
e
_.. .. _. ~.._ ..... . _ . .
,
(AVtMrNl1 01111ep
rmw r~,mwonav I,I~w~~r~ INII
WO 91/12328 PCT/US91/01013
2075974
-60-
Agricultural Research Service Culture Collection
1815 North University Street
Peoria, IL 61604
Date of deposit: December 21, 1989 Accession Number B-18587
Date of deposit: December 21, 1989 Accession Number B-18588
T~~ ~
