Note: Descriptions are shown in the official language in which they were submitted.
X~7~
Title: Attaching and ~ffacing Protein oi Enterohemorrhagic
.coli
FIELD OF l~IE INVEliq~Il~N
The present invention relates to a DNA segment having a
sequence encoding a protein a~sociated with attaching and
effacing activity of enterohemorrhagic E.coli, or an
oligonucleotide fragment thereof. The DNA segment of the
invention can be used to produce a protein associated with
a-~taching and effacing activity of enterohemoxrhagic
E.coli or a part thereof, by culturing a transformant host
cell which includes a recombinant molecule comprising a
DNA segment of the invention or an oligonucleotide
fragment thereo and an expression control sequence
operatively linked to the DNA segment.
The DNA segment of the invention also permits selection of
DNA and amino acid sequences unique to a protein
associated with attaching and effacing activity of
enterohemorrhagic E.coli. Novel DNA segments or proteins
can thus be constructed ~hich contain the unique D~A and
amino acid sequences. The invention also relates to uses
of the DNA segments encoding a protein associated with
attaching and effacing activity of enterohemorrhagic
E.coli. and fragments thereof, and uses of a protein
associated with attaching and effacing activity of
enterohemorrhagic E.coli or parts thereo.
.
~AC~GROU~D OF THE INVE~ION
Enteropathogenic Escherichia coli (EPEC) colonize the
intestine of humans (Ulshen, M., and Rollo J. (1980~ N.
Engl. J. Med. 302, 99-102) and experimental animals,
(Tzipori, S., Robbins-Brown, R.M., Gonis, G., Hayes, J.,
Wither~, N., and McCartney, E. (1985) Gut 26, 570-578)
producing a characteri~tic lesion which has been called
attaching and effacing (AE) (Moon, H.W., Whipp, S.C.,
Argenzio, R.A., Levin, M.M., and Gianella, R.A. 1983.
-- 1 --
'- . '
"--
. .
.
~, ' : ' ' 1 '
~'' , , ` ~.
2 ~ 7 ~ ,.. '.i
Infect. Immun. 41, ].340-1351). The lesion consists of an
extremely close (lOnm) approximation of the bacterial
outer mem~rane ~o the intestinal epithelial cell membrane.
~he microYilli of the enterocyte are effaced and tbere is
polymerization of actin in the cytoplasm subjacent to the
area of bacterial attachment (Rnutton, S., Baldwin, T.,
Williams, P.H., and McNeish, A.S. (1989) Infect. Immun.
57, 1290-1298). The AE lesion is also produced by
enterohemorrhagic E.coli (EHEC) of serogroups 026, 0111
and 0157 (Tzipori, S., Wachsmuth, I., Smithers, J., and
Jackson, C., (1988) Gastroenterology 94, 590-597; Tzipori,
S., Wachsmuth, I.R., Chapman, C., Birner, R., Brittingham,
J.~ Jackson, C., and Hogg, J. (1986) J. Infect. Di~. 154,
712-716).
Escherichia coli serotype 0157 H7 is the most important
member of the group of E.coli which produce verotoxins and
is a major public health concern. Among the verotoxin-
producing ~.coli, serotype 0157:H7 is most commonly
associated with human disease. This serotype is a
recognized cause of hemorrhagic colitis, occurring both
sporadically and in ma~or outbreaks, and is also a cau~e
of the hemolytic uremic syndrome especially among children
and the elderly. These organisms are probably acquired by
humans from an animal source via contaminatPd meat and
occasionally unpasteurized dairy products. Outbreaks of
disease caused by 0157:H7 have been associated with
consumption of undercooked hamburgers and raw milk tRiley
~W, Remis RS, Helgerson SD, et al. N Engl J Med 1983;
308:681-5; Borczyk AA, Karmali MA, Lior H, et al.
(Letter). Lancet 1987; 1:98; Duncan L, Mai V, Carter A,
et al. Outbreak of gastrointestinal disease - Ontario. Can
Dis Wkly Rep 1987; 13-2:5-8).
A method that would identify the~e organisms in animal and
food samples would be very u5eful for screening infected
herd~ and contaminated food. Pre~ently, the detection of
verotoxin and DNA probes for verotoxin do not distinguish
. ,.. . . . , , . : .. : ,..... . : ..
.: .. . ..... .
., . .:
: . , . . . . ,. . : . . . . .
2 ~3 ~ ~ 7 ~ ~
verotoxin-producing E.coli which are impor~ant causes of
human disease such as 0157:H7 from those which, although
present in animals, rarely if ever cause human disease.
Jerse et al. ((1990) Proc. Natl. Acad. Sci. USA 87, 7839-
7843) and Donnenberg et al. ((1990) Infect. Immun. 58,
1565-1571) have identified a gene in the EPEC strain
E2348/69 which was necessary but not sufficient for the
formation of the AE lesion. This gene of approximately
3kb, which was designated eae, encodes a 94 kilodalton
outer membrane protein (Jer e, A.E. and Kaper, J.B. (1991)
Abst. Ann. Am. Soc. Microbiol. B-112, p.44). It was shown
that E234B/69 mutants carrying transposon TnPhoA
insertions in the eae gene were unable to produce the AE
lesion when incubated with HEp-2 cells (Donnenbexg ~.,
Calderwood, S., Donohue-Rolfe, A., Keusch, G.T., and
Kaper, J. (1990~ Infect. Immun. 58, 1565-1571). A lkb
Stul-Sall fragment which encompasses the central one third
of the EPEC eae gene was found to hybridize with DNA
isolated from bacteria of classical EPEC serogroups as
well as with DNA isolated from EHEC of serogroups 026 and
0157 (Jerse, A., Yu, J., Tall, B., and Kaper, J. (1990)
Proc. Natl. Acad. Sci. US~ 87, 7839-7843). Although both
EPEC and EHEC strains cause ultrastructurally similar
lesions, as shown in gnotobiotic piglets (~oon, H.N.,
Whipp, S.C., Argenzio, R.A., Levin, M.M., and Gianella,
R.A. 1983. Infect. Immun. 41, 1340~1351; Tzipori, S.,
Wachsmuth, I.K., Chapman, C., Birner, R., Brittingham, J.,
Jackson, C., and Hoggl ~. (1986) J. Infect. Dis. 154, 712-
716~ and in tissue culture cells (Knutton, S., Baldwin,
T., Williams, P.H., and McNeish, AoSo (1989) Infect.
Immun. 57, 1290-1298), the two types of infection can be
differentiated by anatomic site of involvemant, suggesting
differences in adherence factors.
3S
SUMMARY OF TH~ INVFNTIO~
The present invention provicle~ a purified and isolated DNA
segment having a sequence which codes for a protein
~ 3 ~
,. . . . - .
~ ~ , . . .. .
; .. . :, . .:,
.. . . ..................... .
' ', . ' ', , , ' . , , ' .
'' ., .. , ., , ~ ,, . ,, , ,', ' . , ' ~ ' "
~ Q~
associated with attaching and effacing activity of
enterohemorrhagic E.coli. In a preferred embodiment~ a
purified and isolated DNA segment is provided having a
sequence which codes for a protein associated with
attaching and effacing activity of enterohemorrhagic
E.coli having an amino acid sequence which has substantial
homology with the amino acid sequence as shown in the
5equence Listing as SEQ ID NO:1. Most preferably, the
purified and isolated DNA segment has a sequence having
substantial sequence homology with the nucleotide sequence
as shown in the Sequence Listing as SEQ ID NO:l.
The invention also relates to a recombinant molecule
adapted for transformation of a host cell comprising the
DNA segment of the invention operatively linked to an
expression control sequenc0. A transformant host cell
including a recombinant molecule of the inventicn is also
provided. Still further, this invention provides plasmids
which comprise ~he recombinant molecules of the invention~
The present invention further relates to an avirulent
strain of an enterohemorxhagic E.coli comprising an
avirulent bacterial carrier strain transformed with a
recombinant molecule of the invention, and a vacc~ne
composition comprising a bacterial carrier strain
transformed with a recombinant molecule of the invention.
.
The invention also provides a method of preparing a
protein associated with attaching and effacing activity of
enterohemarrhagic _.coli, utilizing a DNA segment of the
invention. The method comprises culturing a transformant
host cell including a recombinant molecule comprising a
DNA segment of the invention and an expression control
sequence operatively linked to the DNA segment, in a
suitable medium until the protein is formed and thereafter
isolating the protein.
., : .: .. :. .,., . , :. : - . .. , : :, ,: .: . . -: , .: : . . ..
.. : .. . , : ............ . .. .
.. .. . . . . . .
.: . . . " . , :,
- ~07~7~ ~
The invention still further~provides a substantially pure
protein associatPd with attaching and effacing activity of
enterohemorrhagic E.coli. In a preferred embodiment the
protein has an amino acid sequence which has substantial
homology with the amino acid sequence as shown in the
5equence Listing as SEQ ID NO:l.
The invention also relates to antibodies specific for an
epitope of a protein of the invention, preferably a
monoclonal antibody, and a method for preparing the
antibodies.
A diagnostic kit for de~ecting enterohemorrhagic E.coli,
preferably E.coli 0157 in a sample comprising a monoclonal
antibody of the invention and directions for its use i5
also provided.
.
The in~ention also contemplates an immunoassay for the
detection of enterohemorrhagic E.coli, preferably E.coli
0157, comprising contacting a sample suspected of
containing enterohemorrhagic E.coli with a monoclonal
antibody of the invention to form an immune complex; and
determining the presence of the immune complex.
The DNA segments of the invention or oligonucleotide
fragment~ of the DNA segments, allow those skilled in the
art to construct nucleotide probes for use in the
detection of nucleotide sequences in samples such as
biological or food samples. The nucleotide probes may be
used to detect nucleotide sequences that encode proteins
related to or analogous to the attaching and effacing
protein of the invention.
Accordingly, the invention provides a method for detecting
the presence of a DNA segment having a sequence encoding
a protein related to or analogous to a protein associated
with attaching and effacing activity of enterohemorrhagic
E.coli or an oligonucleotide fragment thereof in a samplet
-- 5 --
-: ,. . , - . , ., . . . . : . ~ , . .
, : , . : : ,: : . . . :
: ,, : : ,. . , :,
, : . , ,.. . , :,:: ,, .. , , .. " :
- . . . -: , . .
. .., ~ : . . ~ :;
: . ,: , ::
, ' ,., , : ,
~07~7~ ~
comprising contacting the sample with a nucleotide probe
capable of hybridizing with the DNA segment or an
oligonucleotide fragment thereof, to form a hybridization
product, under conditions which permit the formation of
the hybridization product, and assaying for the
hybridization product.
The invention further provides a kit for detectin~ the
presence of a DNA segment having a sequence encoding a
protein related to or analogous to a protein associated
with attaching and effacing activity of enterohemorrhagic
E.coli or an oligonucleotide fragment thereof in a sample,
comprising a nucleotide probe capable of hybridizing with
the DNA segment or an oligonucleotide fragmen~ thereof,
reagents required for hybridization of the nucleotide
probe with the DNA segment or an oligonucleotide fra~ment
thereof, and directions for its use.
The DNA segmen~ of the invention also permits the
identification and isolation, or synthesis, of nucleotide
sequences which may be used as primer6 to amplify a DNA
segment of the invention or an oligonucleotide fragment
thereof, for example in the polymerase chain reaction
(PCR).
Accordingly, the invention relates to a method of
determining the presence of a DNA segment having a
sequence encoding a protein associated with attaching and
effacing activity of enterohemorrhagic E.coli or a
predetermined oligonucleotide fragment thereof in a
sample, comprising treating the sample with primers which
are capable of amplifying the DNA segment or the
predetermined oligonucleotide fragment thereof, in a
polymera~e chain raaction to form amplified sequences,
under conditions which permit the formation of amplified
sequences, and, assaying for amplified sequences.
, . . . , ~ . .
207~
The invention further relates to a kit for determining the
presence of a DNA segment ha~ing a sequ~nce encoding a
protein associated with attaching and effacing activity of
enterohemorrhagic E.coli or a predetermined
oligonucleotide fragment thereof in a sample, comprising
primers which are capable of amplifying the DNA segment or
the predetermined oligonucleotide fragment thereof in a
polymerase chain reaction ~o form amplified sequences,
means for assaying the amplified sequences, and directions
for its use.
The present inventors have designed specific nucleotide
sequences for detecting pathogenic verotoxin-producing
E . coli strains . ~he present invention therefore further
provides a purified and i olated nucleotide sequence
comprising the sequence shown in the Sequence Listing as
SEQ ID NO:2; the sequence shown in the Sequence Listing as
SEQ ID NO:3; the ~equence shown in the Sequence Listing as
SEQ ID NO:4, the sequence shown in the Sequence Listing as
SEQ ID NO:5; the sequence shown in the Sequence Listing as
SEQ ID NO:6; the sequence shown in the Sequence Listing as
SEQ ID NO:7; the sequence shown in the Sequence Listing as
SEQ ID NO:8; the sequence shown in the Sequence Listing as
SEQ ID NO:9; a sequence having substantial homology
thereto, or a fragment of the nucleotide sequence.
Accordingly, the present invention relates to a method for
detecting verotoxin-producing E.coli of the serogroups 05,
026, 0103, 0111, 0118, 0145, and 0157 in a sample
comprising contacting the sample with a SalI-StuI fragment
comprising the sequence as shown in the Sequence Listing
as SEQ I~ NO:2 and the sequence as shown in the Sequence
Listing as SEQ ID NO:3, under conditions which permit the
fragment to hybridize with a complementary sequence in the
sample to form a hybridization product, and assaying for
the hybridization product.
- 7 -
., . . -
. ,.. - ~ ., . . . . , ,. . :
.
.. . . . ..
. .. .
~07~71 ~;
The invention also contemplates a method for detecting
~erotoxin-producing E.coli serogroup 0157 in a sample
comprising contacting the sample with a 0.5 kb fragment
comprising the sequence as shown in the 5equence Listing
as SEQ ID NO:4 and thP sequence as shown in the Sequence
Listing as SEQ ID NO:5, under conditions which permit the
fragment to hybridiza with a complementary sequence in the
sample to form a hybridization product, and assaying for
the hybridization product.
- `
A metho~ for detecting pathogenic verotoxin-producing
E.coli strains of the serogroup 0157 in a sample is also
provided comprising treating the sample with the
nucleotide sequence PlEH shown in the Sequence Listing as
SEQ ID NOs6 and the nucleotide sequence P2EH5 shown in the
Sequence Listing as SEQ ID NO:7 in the polymerase chain
re~ction, under condition~ which permit the formation of
amplified s~quences which terminate with the nucleic acid
sequence of one of the primers and the complementary
nucleic acid sequence of the other of the primers, and,
assaying for the amplified sequences.
The invention further provides a kit for detecting
verotoxin-producing E.coli of the serogroups 05, 026,
0103, 0111, 0118, 0145, and 0157 in a sample comprising a
SalI-StuI fragment comprising the sequence as shown in the
Sequence Listing as SEQ ID NO:2 and the sequence as shown
in the Sequence Listing as SEQ ID NO:3, reagents required
for hybridization of the fragment with a DNA segment
encoding the attaching and effacing protein of
enterohemorrhagic E.coli or an oligonucleotide fragment
thereof, and directions for its use.
~.-.
The invention alao xelates to a kit for detecting
verotoxin-producing E.coli of the serogroup 0157 in a
sample i8 comprising a 0.5 kb fragment (A3-B2) comprising
the sequence as shown in the Sequence Listing as SEQ ID
NO:4 and the sequence as shown in the Sequence Listing as
~, . ~ , . :, . :
: ~ . , . , , ,. , .......................................... ;
:. ' . , : :
2 0 7 (3 ~ ~ ~
SEQ ID N0:5, reagents required for hybridization of the
fragment with a DNA segment encoding the attaching and
effacing protein of enterohemorrhagic E.coli or an
oligonucleotide fragment thereof, and directions for its
use.
The invention further relates to a kit for detecting
pathogenic verotoxin-producing E.coli strains of the
serogroup 0157 in a sample comprising the primers PlEH as
shown in the Sequence Listing as SEQ ID N0~6 and P2EH as
shown in the Sequence Listing as SEQ ID N0:7/
respectively, reagents required for the amplification in
a PCR reaction of sequences which terminate with the
nucleic acid ~equence of one of the primers and the
complementary nucleic acid sequence of the other of the
primers, and directions for its use.
DI~SCRIPTION OF l~E DRI~liilINGS
The invention will now be described in relation to the
drawings in which:
Figure 1 shows the DNA sequence of the EHEC eae gene and
the deduced pro~ein sequence starting at the start codon
at 206 bp;
Figure 2 shows the homology between the dedused protein
sequences of the EPEC and EHEC eae genes;
.
Figure 3 shows the amino acid sequence alignment of th
predicted EP~C and EH~C proteins;
Figure 4 shows the results of colony blot hybridizations
of various 0 serogroups usin~ A) a central (Cl-C2) 1 kb
fragment and B) a 3I tA3-B2) 0.S fragment of the 0157:H7
eae gene;
_ g _
- , . .. . : . ~. : . . ..
.. . . , , ,, ~ . ,: .. :. ....
. - . - .. : . . , . . ., .... . : . . .:
, : . -, . ,,, ... , --- .. ,, .: , . : . , . , . : ,
,. - , : : ., . . :
. . . . . .
.:
2 (3 7 ~ 1 1 f;
Figure 5 shows the results of colony blot hybridization~
of various O serogroups using a 0.45 kb fragment (PlEH-
P2EH) of ~he 0157:H7 eae gene;
Figure 6 shows the primer locations on the 3' region of
EHEC eae gene;
Figure 7 shows the amplification products of VTEC and EPEC
using specific primer sets A3-B2 (O.5 kb) and PlEH-P2EH
(O.45 kb);
Figure 8 shows the results of colony blot hybridizations
of serogroups 0157 (VT+), 0157 (VT-), 05, 026, 0111, 0113,
0121, and 0127 with [~32p] dATP end-labeled with P2EH
oligonucleotide; and
Figure 9 shows the alignment of the deduced amino acid
sequences at the 3' end of: 0157: EHEC eae 0157:H7
protein; 0111: EHEC eae Olll:H8 protein; EPEC: EPEC eae
0127:H6 protein; and INV : Y.pseudotuberculosis invasin.
D~TAIL~D DESCRIPTION OF ~H~ INV~NTION
The present inventors have identified a chromosomal eae
gene associated with attaching and effacing activity in
enterohemorrhagic E.coli (EHEC). The EHEC eae gene was
identified from EHEC serotype 0157:H7 strain CL-8. The
entire predicted structural gene was sequenced including
205 bp upstream and 118 bp downstream. Figure 1 and the
s~quence shown in the Sequence Listing as SE~ ID NO:l,
show the DNA sequence of the EHEC eae gene and the deduced
protein sequence starting at the start codon at 206 bp.
Comparison of nucleotide sequence similarity between the
EHEC and EPEC eae genes shows 97~ homology in the first
2200 bp and only 59~ homology in the last 800 bp (Figure
2). The amino acid sequence alignment of the predicted
EPEC and EHEC proteins is shown in Figure 3. The N-
terminal amino acids are highly conserved for the first
685 amino acid6 while for the C-terminal amino acidsl only
- 10 -
,: , : , :, , .
: :, . , . . :
' ~ ' . :, . .. . . . . .
f ':
, ~ ~, ' ., ',, , " ' '
',' .~ : .
~7~
short stretches can be aligned. There i8 conservation of
cysteine residues at positions 859 ~nd 933 of the
alignment.
Both the EHEC and EPEC sequences show similarity to the
Yersinia pseudotuberculosis invasin gene (Isberg, R.R. et
al., (1987) Cell 50, p.769) with greatest diverg~nce at
the C-terminus. The C-terminal end of the Yersinia inv
gene is associated with receptor binding (Leong et al,
10 EMBO J 199~; 6:1979-89) and it is possible that the same
applies to the eae gene products.
The inventors also probed verotoxin-producing E.coli
(VTEC) (251 strains) of multiple O-serogroups with a
15 highly conserved lkb Stul-Sall central fragment from the
EHEC eae gene using colony hybridization. Only the
following VTEC serogroups (125 strains) were found to be
positive: 05, 026, 0103, 0111, 0118, 0145, and 0157.
Using the polymera~e chain reaction (PCR) a less conserved
20 0.5kb probe was generated from the 3' end of the EHEC eae
gene. Among the 251 VTEC strains tested using colony
hybridization, only those strain6 belonging to the 0157
; serogroup ~ere positive. Additionally, the 3~end of eae
genes of VTEC strains appear to have unique nucleotide
25 sequences as determined on selected O-serogroups. These
; O-serogroups initially hybridized with the highly
conserved central regions of the eae genes.
Therefore, the presQnt inventors have shown that the
30 central 1 kb fragment of the EHEC eae gene is homologous
in a variety of O serogroups of verotoxin-producing E.coli
(VTEC) strains but that there is diversity at the C-
terminal end. The heterogeneity at the 3' end of eae genes
allows for specific detection of clinically relevant VTEC
35 strains and may be as~ociated with differences in receptor
binding.
.. : : , . .
:; , . . . .
:: : : ~ . .. .. . . : ,
- . , , .: .
. ~: :,, , , :
2~7~
Accordingly, the present invention provides a purified and
isolated DNA segment having a sequence which codes for a
protein associated with attaching and effacing activity of
enterohemorrhagic .coli.
In a preferred embodiment, a purified and isolated DNA
segment is provided having a sequence which codes for a
protein associated with attaching and effacing activi~y of
enterohemorrhagic E~.coli having an amino acid sequence
which has substantial homology with the amino acid
sequence as shown in the Sequence Listing as SEQ ID N0:1.
Most preferably/ the purified and isolated DNA segment has
a sequence having substantial sequence homology with the
nucleotide sequence as shown in the Sequence Listing as
SEQ ID N0:1.
DNA segments of the present invention encoding a protein
associated with attaching and effacin~ activity of EHEC or
related or analogous sequences may be isolated and
sequenced, by selectively amplifying the region of the eae
gene using the polymerase chain reaction me~hod and
genomic DNA. It is possible to design synthetic
oligonucleotide primers from the sequence shown in the
Sequence Li~ting as SEQ ID N0:1 for use in PCR and ~or
screening genomic libraries. An amplified fragment can be
cloned and characterized by DNA sequence analysis. DNA
segments of the present invention encoding the protein
associated with attaching and effacing activity of EHEC
may also be constructed by chemical synthesis and
enzymatic ligation reactions using procedures known in khe
ar,t.
It will be appreciated that the invention includes
nucleotide or amino acid sequences which have substantial
sequence homology with the nucleotide and amino acid
sequences shown in the Sequence Listing as SEQ ID NOo 1~
The term "sequences having substantial sequence homology"
means those nucleotide and amino acid sequsnces which have
- 12 -
. , , , .; . . ,., : . , , : . .
.". . . , ,, . . , . : :, : .
` , ,,' ,: ,; : , : ~ . ' ,'' , , . , .' . '
" : ~- :
. ; ,, : :
.
207~7~ ~3
slight or inconsequential sequence variations from the
sequences disclosed in the Sequence Listing as SEQ ID N0:1
i.e. the homologous sequen~es function in substantially
the same manner to produce substantially the same
polypeptides as the actual sequences. The variations may
be attributable to local mutations or structural
modifications.
It will also be appreciated that a double s~randed
nucleotide sequence comprising a DNA segment of the
invention as shown in Figure 1 or an oligonucleotide
fragment thereof, hydrogen bonded to a complementary
nucleotide base sequence (see Sequence Listing 5EQ ID
N0:1), an RNA made by transcription of this doubled
; 15 stranded nucleotide sequence, and an antisense strand of
a DNA segment of the invention or an oligonucleotide
fragment of the DNA segment, are contemplated within the
scope of the invention.
:
A number o unique restriction sequences for restriction
enzyme~ are incorporated in the DNA segment identified in
the Sequence Listing as SEQ ID N0:1, and these provide
access to nucleotide sequences which code for polypeptides
unique to the protein associated wi~h attaching and
effacing activity of EHEC. D~A sequences unique to the
protein associated with attaching and effacing activity of
; EHEC or isoforms thereof, can also be constructed by
chemic l synthesis and enzymatic liga~ion reactions
carried out by procedures known in the art.
The DNA segment~ of the invention or oligonucleotide
fragments o~ the DNA segments, allow those skilled in the
art to construct nucleotide probes for use in the
detection of nucleotide sequences in samples ~uch as
biological specimens or food samples. A nucleotide probe
may be labelled with a detectable marker such as a
radioacti~e lakal which provides for an adequate signal
and has sufEicient halE-liEe such as 32p, 3H, 14C or the
- 13 -
.. ..
- .. -- . , . .. ~ . . . :
- ~ : . . .:
., . .. : . .
~- . - , . . . : .
~. , , ~ . ~ . . . . . .
..... : .. : . .. : . . ,.. - . : :
:. , ,: , , , :
.. . . . . .
,
2 ~ rl ~3 r~ ~ ~
like. Other labels which may be used include antigens
~hat are recognized by a spacific labelled antibody,
fluorescent compounds, enzymes, antibodies specific for a
labelled antigen, and chemiluminescent compounds. An
appropriate label may be selected having regard to the
rate of hybridization and binding of the probe to the
nucleotide to be detscted and the amoun~ of nucleotide
available for hybridization.
iO The nucleotide probes may be used to detect DNA segments
having sequences that encode proteins related to or
analogous to the protein associated with attaching and
effacing activity of EHEC.
Accordingly the pre en~ invention also relates to a method
for detecting the presence of a DNA segment having a
sequence encoding a protein related to or analogous to a
protein associated with attaching and effacing activity of
enterohemorrhagic E.coli or an oligonucleotide fragment
thereof in a ~mple, comprising contacting the sample with
a nucleotide probe capable of hybridizing with the DNA
segment or an oligonucleotide fragment thereof to form a
hybridization product, under conditions which permit the
formation of the hybridization product, and assaying for
the hybridization product. The nucleotide probe may b~
labelled wi~h a detectable marker as described herein and
the hybridization product may be assayed by detecting the
detectable marker or the detectable change produced by the
detectable marker.
The invention also provide~ a kit for detecting the
presence of a DNA segment having a sequence encoding a
protein related to or analogous to a protein associated
with attaching and effacing activity of enterohemorrhagic
E.coli or an oligonucleotide fragment thereof in a sample,
comprising a nucleo~ide probe capable of hybridizing with
the DNA segment or an oligonucleotide fragment thereof,
reagent~ reguired for hybridization of the nucleotide
14 -
- . , , ; . :,
.
,,, , , . , ::
.. . . . . . . .
- ' ',, ' -' ','
.
~07~7~ ~j
probe with the DNA segment or an oligonucleptide fragment
thereof, and directions for its use.
The DNA segment of the invention permits the
identification and isolation, or synthesis of nucleotide
sequences which may be used as primers to amplify a DNA
segment of the invention or an oligonucleotide sequence
thereo~, for example in the polymerase chain reaction
(PCR). The length and bases of the primers for use in the
PCR are selected so that they will hybridize to different
strands of the desired sequence and at relative positions
along the sequence such that an extension product
synthesized from one primer when it is separated from its
template can serve as a template for extension of the
other primer into a nucleic acid of defined length.
The primers may be preparad using techniques known in the
art such as for example phosphotriester and phosphodiester
methods or automated techniques. Restriction endonuclease
digests may also be used as primers.
It will be appreciated that the primers may contain non-
complementary sequences provided that a sufficient amount
of the primer contains a sequence which is complementary
to the DNA segment of the invention or oligonucleotide
sequence thereof, which i~ to be amplified. Restriction
site linkers may also be incorporated into the primers
allowing for digestion of the amplified products with the
appropriate restriction enzymes facilitating cloning and
sequencing of the amplified product.
It will also be appreciated hat the invention includes
nucleotide ~equences which have substantial sequence
homology with the above-mentioned nucleotide probes and
primers. Further, it will be appreciated that a double
stranded nucleotide sequence compri~ing a nucleotide probe
or pri~er, hydrogen bonded to a complementary nucleotide
base sequence, an ~NA made by ~ranscription of this
-- 15 -- :
, . . : . :- . : , , ~, -
: . . , . .,:: - .. . , . . , : .. : .:. - ~ . :
: . . . . : . ..
. ~ .. . : . ,: . . . . . . .
- . , . .: .... : . :. . ., , : .
... ,.. .. . . , .: . ., : :. . . . .
,- , , : . , .: . . .
..
. .
207~7~;
doubled stranded nucleotide sequence, and an antisense
strand of a nucleotide probe or primer, are contemplated
within the scope of the inventionO
In an embodiment of the invention a method of determining
the presence of a DNA segment having a sequence encoding
a protein associated with attaching and effacing activity
of enterohemorrhagic E.coli or a predetermined
oligonucleotide fragment thereof in a sample, is provided
comprising treating the sample with primers which are
capable of amplifying the DNA segment or ~he predetermined
oligonucleotide fragment thereof in a polymerase chain
reaction to form amplified seguences, under conditions
which permit the formation of amplified sequences and,
- 15 assaying for amplified sequences.
The polymerase chain reaction refers to a process for
amplifying a target nucleic acid sequence as generally
described in Innis et al, Academic Press, 1990 and U.S.
Patent 4,800,159. Generally, amplification of the target
nucleic acid sequence may be accomplished by means of a
pair of primers which flank the nucleic acid sequence to
be amplified. The primers hybridize to opposite strands
of the tar~et se~uence and DNA synthesis proceeds across
the region between the primers, thereby doubling the
amount of that DNA segment. Repeated cycles of
denaturation, priming and extension permit rapid
exponential amplification of the target sequence.
The amplified product~ can be isolated and distinguished
based on their respective sizes using techniques known in
the art. For example, after amplification, the D~A sample
can be separated on an agarose gel and visualized, after
staining with ethldium bromide, under ultra violet (UV)
light. DN~ may be amplified to a desired level and a
further exten~ion reaction may be performed to incorporate
nucleotide derivatives havin~ detectable markers such as
radioactive labelled or biotin labelled nuclsoside
- 16 -
. ,., . . :
. :. , ., . : . ..
- . ~ . . . .
.
.
.
-, . ~. , .
.
, . . . . . . . .
2 0 7 ~ rl ~ ~;
triphosphates. The detectable markers may be analyzed by
restriction and electrophoretic separation or other
techniques known in the art.
The conditions which may be employed in the method~ of the
invention using PCR are those which permit hybridization
and amplification reactions to proceed in the presence of
DNA in a sample and appropriate complementary
hybridi~ation primers. Conditions suitable for the
polymerase chain reaction are generally known in the art.
Preferably, the PCR utilizes ~ polymerase tGeneAmp Kit,
Perkin Elmer Cetus~ as the polymeri~ation agent and each
cycle consists of the following: denaturation at 94C X 1
min; annealing at 55C X 1 min; and extension at 720 X 1
min.
The invention still further provides a kit for determining
the presence of a DNA segment encoding a protein
associated with attaching and effacing activity of
enterohemorrhagic E.coli or a predetermined
oligonucleotide fragment thereof in a sample comprising
primers which are capable of amplifying the DNA segment or
the predetermined oligonucleotide fragment thereof, in a
poly~erase rhain reaction to form amplified sequences,
means for detecting the amplified sequences, and
directions for its use.
~he present invention also relates to a method of
detecting verotoxin-producing E.coli using the DNA segment
of the invention and oligonucleotide fragments thereof. As
hereinbefore men~ioned the present inventors have found
that a SalI-StuI fragment (C1-C2) comprisin~ the sequences
~s shown in the Sequence LL ting ac SEQ ID NO:2 and SEQ ID
NO:3, may be used to detect verotoxin-producing E coli of
the serogroups 05, 026, 0103, 0111, 0118, 0145, and 0157.
A 0.5 kb fragment (A3-B2~ comprising the sequences as
shown in the Sequence Listing as SEQ ID NO:4 and SEQ ID
- 17 - -
.- , . . . ... , . .. .. .. . . :
. . .: : . .: . : - .
.. , . ,, ,. , .. , . ~ : . .
- : .
. . . . . . . . . . . . . .
,~ . , .- . . - . ,: .. :, . , , ,. ,. , :
. .. . - -, , . . , ., . , . . : . . :. . : : , ,, ;: :
. . ' ' ,': .. , . :, , . : ,.' '' : , , . " : :,
,., : ,, . , ' ,, ~ ,, ,
..
2 ~
N0:5 has also been found to be useful for detecting
vero~oxin-producing E.coli serogroup 0157.
The present inventors have also designed specific
nucleotide probes for detecting pathogenic verotoxin-
producing E!coli strains of the serogroup 0157. In
particular, the synthetic nucleotide probes PlEH and P2EH
shown in the Sequence Listing as SEQ ID N0:6 and SEQ ID
N0:7, respectively, were found to specifically detect only
verotoxin-producing E.Coli serotypes 0157:H7 and 0157:NM.
Non verotoxin-producing 0157:NM strainsi and other 0157:H
serotypes were not detected by PlEH and P2EH, making these
probes ideal for detecting pathogenic 0157 EHEC.
The synthetic nucleotide probes PlEH and P2EH shown in the
Sequence Listing as SEQ ID N0:6 and SEQ ID N0: 7,
respectively, were also used in PC~ and were found to
specifically detect only verotoxin-producing E.coli 0157
serogroups. Non verotoxin-producing 0157 serogroups were
not detected by PlEH and P2EH, making these probes ideal
for detecting pathogenic 0157 EHEC.
The nucleotide seguences P10 and P20 shown in the Sequence
Listing as SEQ ID N0:8 and SEQ ID N0:9, respectively,
based on the Olll:H8 sequence were found to detect
verotoxin-producing Olll:H8 and Olll:NN but not Olll:Hll
strains in~icating that there is further diversity in the
carboxyl-terminal within the serogroup.
Accordingly, the present invention provides a purified and
isolated nucleotide sequence comprising the sequence shown
in the Sequence Listing as SEQ ID N0:2; the sequence shown
in the Sequence Listing as SEQ ID N0:3; the saquence shown
in the Sequence Listing as SEQ ID N0:4, the sequence shown
in the Sequence Listing as SEQ ID N0:5; the seguence shown
in the Sequence Liiting as SEQ ID N0:6, the sequence shown
in the Sequence Listing as SEQ ID N0:7; the sequence ~hown
in the Sequence Listing as SEQ ID N0:8; the sequence shown
- ~8 -
'
'' '' ', ' ', ' ~ ' ' '
~: ' ~ " ' ' ' ,, "' . . ' :
2o7 8rl ~ ~
in the Sequence Listing as SEQ ID NO:9; a sequence having
substantial homology thereto or a fragment of the
nucleotide sequence. The location of th~ se~uences of the
sequence shown in the Sequence Listing as SEQ ID NO:2, SEQ
ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID
NO:7 on the 0157:H7 ea~ gene are shown in Figure 6.
The invention relates to a method for detecting verotoxin-
producing E.coli of the serogroups 05, 026, 0103, 0111,
0118, 0145, and 0157 in a sample, comprisin~ contacting
the sample with a SalI-StuI fragment (Cl-C2) comprising
the sequence a~ shown in the Sequence Listi~g as SEQ ID
NO:2 and the sequence as shown in the Sequence Listing as
SEQ ID NO:3, under conditions which permit the fragment to
hybridize with a complementary sequence in the sample to
form a hybridization product, and assaying for the
hybridization product.
The invention relates ~o a method for detecting verotoxin-
producing E.coli serogroup 0157 in a sample comprising
contacting the sample with a 0.5 kb fragment (A3-B2)
comprising the sequence as shown in the Sequence Listing
as SEQ ID NO:4 and the sequen~e as shown in the Sequence
Listing a3 SEQ ID NO:5, under conditions which permit the
fragment to hybridize with a complementary sequence in the
sample to form a hybridization product, and assaying for
~he hybridization product.
Hybridization conditions which may be used in the method
of the invention are known in the art and are described
for example in Sambrook J, Fritch EF, Mania~is T. In: :
Molecular Cloning, A Laboratory Manual,1989. (Nolan C,
Ed.), Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY. The hybridization product may be assayed using
techniques known in the art. The oligonucleotide ~ragments
may be labelled with a detectable marker as described
herein and the hybridization product may be assayed by
.. .
:',
- 19 - .,-
... . . .
. . .
. .
. : .: . . . : . .
.
~7~73~ ~
detec~ing the detectable marker or the detectable change
produced by the detectable marker.
The inven~ion still further relates to a method for
detecting pathogenic verotoxin-producing E.coli strains of
the ~erogroup 0157 in a sample comprising treating the
sample with the nucleotide sequence PlEH shown in sequence
the Sequence Li~ting as SEQ ID NO t 6 and the nucleotide
~equence P2EH5 shown in the Sequence Listing as SEQ ID
NO:7 in a PCR reaction, under conditions which permit the
formation of amplified sequences which terminate with the
nucleic acid sequence of one of the primers and the
complementary nucleic acid sequence of the other of the
primers, and, assaying for the amplified sequences.
The PCR reaction and suitable conditions permitting
formation of amplified seguences are described above.
A kit for detecting verotoxin~producing E.coli of the
serogroups 05, 026, 0103, 0111, 0118, 0145, and 0157 in a
æample is provided comprising a SalI-StuI fragment (C1-C2)
comprising the seguence as shown in the Sequence Listing
as SEQ ID NO:2 and the sequence as ~hown in the Sequence
Listing as SEQ ID NO:3~ reagents required for
hybridization of the fragment with a DNA segment encoding
the attaching and effacing protein of EHEC or an
oligonucleotide fragment thereof, and directions for its
use.
A kit for detecting verotoxin-producing E.coli of the
serogroup 0157 in a sample is also provided comprising a
O.5 kb fragment (A3-B2) comprising the ~equence as shown
in the Sequence Li~ting as SEQ ID NO:4 and the equence as
shown in the Sequence Listing as SEQ ID NO:5, reagents
required for hybridization of the fragment with a DNA
~egment encoding the attaching and effacing protein of
EHEC or an oligonucleotide fragment thereof, and
direction~ for its use.
- 20 -
:-- . ~ 1 -
- . . .:
- ~
.
- . ,
' . - ' ' :
,
~7~
The invention also contemplates a kit for detecting
pathogenic verotoxin-producing E.coli strains of the
serogroup 0157 in a sample comprising the primers PlEH and
P2EH as shown in the Sequence Listing as SEQ ID NO:6 and
as SEQ ID NO:7, respectively, reagents required for the
; amplification in a PCR reaction of sequences which
terminate with the nucleic acid sequence of one of the
primers and ~he complementary nucleic acid sequence of the
other of the primers, and dire~tions for its use.
The DNA segment of the pre~ent invention having a sequence
which codes for a protein associated with attaching and
effacing activity of EHEC, or an oligonucleotide fragment
of the DNA segment including the nucleotide sequences of
probes and primers described herein may be incorporated in
a known manner into a recombinant molecule which ensures
sood expression of the protein or part thereof. In
general, a recombinant molecule of the invention contains
the DNA segment or an oligonucleotide fragment th~reof of
the invention and an expression control sequence
opera~ively linked to the DNA segment or oligonucleotide
fragment. The DNA segment of the invention or an
oligonucleotide fragment thereof, may be incorporated into
a plasmid vector, for example, pTZ18R.
The protein as~ociated with at~aching and effacing
activity of EHEC or isoforms or parts thereof, may be
obtained by expression in a suitable host cell using
techniques known in the art. Suitable host cells include
30 prokaryokic or eukaryotic organisms or cell lines, for
example, E.coli JN 101 and E.coli LE 392. The protein or
parts thereof may be prepared by chemical syn~hesis using
~echniques well known in the chemistry of proteins such as
solid phase synthesis (~exrifield, 1964, J. Am. Chem.
35 Assoc. 85:2149-2154) or ~ynthesis in homogenous solution
(Houbenweyl, 1987, Nethods o~ Organic Chemistry, ed. E.
Wansch, Vol. 15 I and II, ~hieme, Stuttgart).
- 21 -
.. , , ........ . . . . , . ~ , :
.. : . : . . ~ , ; .,:. ., , ,. : . . .. . .
,, . . : : , . . ~ . . i ,, : , . , : ,
, . !
,; '. . ' ., , ', . ' . . .: . ' . ' ~ . .
. . , ' ' ' ' ' , " . " ' ' . , , '' ' '. ' ' ' " ' ' . . , ' , ',''' ' ,' ''. ' . . . . .
2~7~7.~
The protein associated with attaching ~nd effacing
activity of EHEC or isoforms or parts thereof, of the
invention may be expressed in an avirulent bacterial
carrier strain such as Salmonella and Shigella strains.
Accordingly, in a further aspect of the invention an
avirulent strain of an EHEC is provided comprising an
avirulen~ bacterial carrier strain transformed with a
recombinant molecule of the invention. The avirulent
strain may provide the basis for a vaccine composition
which may be useful for effecting immunity against
diseases caused by EHEC, in particular E.coli serotype
0157:H7. The invention therPfore also provides a vaccine
composition comprising a bacterial carrier strain
transformed ~i.th a recombinant molecule of the invention.
The vaccine composition may be useful in Pffecting
immunity against diseases such as hemorrhagic colitis and
hemolytic ur~mic syndrome.
The vaccine compositions can be prepared by per se known
methods for the preparation of pharmaceutically acceptable
vaccines which can be administered to patients. The
vaccine composition may be in an oral or injectable form
and may include pharmaceutically acoeptable vehicles. On
this basis, the vaccine compositions include, al~eit not
exclusively, solutions of the bacterial carrier strain
transformed with a recombinant molecule of the invention
in association with one or more pharmaceutically
accep~able vehicles or diluents, and contained in buffered
solutions with a suitable pH and iso-osmotic with the
physiological fluid~. -
The protein associated with attaching and effacing
activity of EHEC or parts thereof, may be used to prepare
monoclonal or polyclonal antibodies. Antibodies may be
prepared which bind a distinct epitope in an unconserved
region of the protein. Conventional methods can be used to
prepare the antibodies. As to the details relating to the
preparation of monoclonal antibodies reference can be made
- 22 -
. . . .: .. : .. . . :. . .
:: .. . ., , , : : :
. ... : :..... , , , : . : . :
.: ., . : . . . . . .
:: ,:, . . ~: , : , . .
. , . . , .. -:, . .
, ., . . , , . :
to Goding, J.W., Monoclonal Antibodies: Principles and
Practice, 2nd Ed., Academic Press, London, 1986. In
general monoclonal antibodies are prepared by obtaining
hybridomas derived from immortalizing antibody producing
cell~ obtained from a mammal having been immunized with a
protein, and screening the hybridomas for production of
antibody which binds the isolated protein.
The polyclonal or monoclonal antibodies may be used to
detect a protein associated with attaching and effacing
ac~ivity of EHEC in various biological materials or food
sample~, for example ~hey may be used in an Elisa,
radioimmunoassay or histochemical tests. Thus, the
antibodies may be used as diagnostic reagents to qiuantify
the amount of protein associated with attaching and
effacing activity in a sample.
The monoclonal and polyclonal antibodies may be labelled
with a detectable marker including various enzymes,
fluorescent materials, luminescent materials and
radioactive materials. Examples of suitable enzymes
include horseradish peroxidase, biotin, alkaline
phosphatase, ~-galacto~idase, or acetylcholinesterase;
examples of suitable fluorescent materials include
umbelliferone, fluorescein, fluorescein isothiocyanate,
rhodamine, dichlorotriazinylamine fluorescein, dansyl
chloride or phycoerythrin; an example of a luminescent
material includes luminol; and example~ of suitable
radioactive material include I125, I131 or tritium.
The invention will be more fully understood by reference
to the following example ~owever, the examples are
merely intended to illustrake embodiments of the invention
and are not to be construed to limit the scope of the
invention.
S
Example 1
- 23 -
- . ., - . ; .
,, .. .. : .: . .. .,: , .. , .: ., .. , ", ~, .
.. : - . . . . . . .: : .. , ~ . . .. . .. .
`~; ' :' ' ' ' . .:', ,' ' ': ~' , . :
:' ' '. ', ' ~' ' ' ' ' ' , ' ' ,
~7~
Cloning and sequencing of eae gene homologue from EHEC
strain 0157
The following materials and methods were used in the
investigations illustrated in the example:
Bacteriological media
E.coli strains were grown in L-broth and L-agar (Lech, K.
and Brent, R. (1989) in Current Protocols in Molecular
Biology (Ausubel, F.M. et al. Eds.) John Wiley & Sons, New
York) supplemented when necessary with lOOug/ml
carbenicillin ~Si~ma Chemical Co., St.Louis, N0). For
production of single stranded D~A, strains were grown in
2xYT broth (Sambrook, J., Fritch, E.F , and Maniatis, T.
(1989) in ~olecular Cloning, A Laboratory Manual (Nolan,
C., Ed.) Cold Spring Harbor Laboratory Press, New York).
Bacteriophage lambda was grown in lambda broth (Lech, K.
and Brent, R. (1989) in Current Protocols in Molecular
Biology (Ausubel, F.M. et al. Eds.) John ~iley & Sons, New
York ) .
Bacterial str~ins and vectors
E.coli strains E2343/69 (EPEC), serotype 0127:H6 and CL8
(EHEC), serotype 0157:~7 were obtained from
Dr. M. Karmali, The Hospital for Sick Children, Toronto,
Canada, and have been previously described (Levine, M.M.,
Nataro, J.P., Karch, H., Baldini, M.M., Xaper, J.B.,
Black, R.E., Clements, M~o and O'Brien, A.D. (1985) J.
Infect. Dis. 152, 550-559; Karmali, M.~., Petric, M., Lim,
C., Fleming, P.C., Arbus, G.S. and Lior, H. (1985) J.
Infect. Dis. 151, 775-882; Sherman, P., Soni, R. and
Karmali, M.A. (1988) Infect. Immun. 56, 756-761). E.coli
JM101 (Messing,J. (1979) Recomb. DNA Tech. Bull. 2,43-48)
was used a the host for plasmid pTZ18R (Mead, D.A.,
Szczesna-Skorupa, E., and Kemper, B. (1986) Protein
Engineering. 1,67-74) and E coli LE392 (Borckf K., Beggs,
J.D., Brammar, W.J., Hopkins/ A.S., and Murray, N.E.
(1976) Mol. Gen. Genet. 146, 199-207; Nurray,
N.E.,Brammar, W.J., and ~urray, K. (1977) Mol. Gen. Genet.
- 24 -
2 {~ 7 ~3 r~ ~ ~
150,53-61) was used for propagation of bacteriophage
lambda GEM-11 (Promega, Madison, WI). Bacteriophage M13K07
(Rokeach, L., Haselby, J. and Ahoch, S~ (1988) Proc. Nat.
Acad. Sci. USA. 35, 4832-4836) was used as a helper to
produce single stranded DNA from pTZ18R and recombinant
derivatives.
DNA manipulation and sequencing
Plasmid DNA was prepared by the method of Birnboim and
Doly (Birnboim, H.C. and Doly, J. (1979) Nucl. Acids Res.
7, 1513-1523). Bacterial genomic DNA was extracted using
hexadecyltrimethyl ammonium bromide precipitation (Murray,
N.G., and ~hompson, W.F. (1980) Nucl. Acid~i Res. 8,4321-
4325). Genomic DNA isolated from the EHEC strain CL8 was
partially digested with Sau3A and fragments were size-
fractionated by sucrose density gradient centrifugation
(Sambrook, J., Fritch, E.F.I and Maniatis, T. (1989~ in
Molecular Cloning, A Laboratory Manual (Nolan, C., Ed.)
Cold Spring Harbor Laboratory Press, New York). The
desired fragments (14-23kb) were iæolated and ligated to
dephosphorylated lambda Gem-11 BamHlarms (Promega,
Wisconsin, NA] and packaged using the Packagene System
extracts (Promega, WiScOnQ in, MA). Bacteriophage particles
were propagated in E.coli LE392 and plated for plaque
isolation.
The 1 Kb Stul-Sall fragment described by Jerse et al
(Jerse, A., Yu, J., Tall, B., and Kaper, J. (1990) Proc.
Natl. Acad. Sci. USA 87, 7839-7843) was used as a probe
for the eae gene. It was produced by amplification of the
central region of the eae gene of strain E2348/69 by the
polymerase chain reaction (Sambrook, J., Fritch, E.F., and
Maniatis, T. (1989) in Nolecular Cloning, A Laboratory
Manual (Nolan, C., Ed.) Cold Spring Harbor Laboratory
Press, New York) using Taq polymerase (Perkin Cetus Elmer
Corp., Norwalk, CT). Primers flanking the Stul and Sall
sites were designed using the nucleotide sequence of the
eae gene of E2348/69 deposited in Genbank by Jerse et al.
- 25 -
: '. , ' , ;, , -.' , . ' ' ' . : ';
:
~ 0 '7 ~
(Jerse, A., Yu, J., Tall, B., and Kaper, J. (1990) Proc.
Natl. Acad. Sci. USA 87, 7839-7843). The ups~ream primer
was ATGG~ATTCTCGTC~CAGTTGCAGGCCTGGT (2241-2263 of the eae
sequence~ and the downstream primer was
ATGGAATTCCGAAGTCTTATCA- GCCGTAAAGT (3350-3328 of the eae
sequence) with EcoRl recognition sequences included at the
5'end of each primer. The fragment was labelled with ~32p
dATP u~ing a random priming kit (Boehrinser Mannheim).~his
probe was used in plaque hybridizations to further
identify clones containing the putative eae sequence.
Fragments which hybridized with ~he probe were subcloned
in pTZ18R (Sambrook J, Fritch EF, Maniatis T. In:
Molecular cloning, A Laboratory Manual,1989. (Nolan C,
Ed.), Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY.~. Nested deletions were constructed by
sequential diges~ion with exonuclease IXI and S1 nuclease
using the Erase-a-base System (Promega, Madison, WI).
Single stranded templates were prepared from fragments
cloned in pTZl8R by superinfection with bacteriophage
Nl3K07. DNA sequencing was performed using the Sanger
dideoxy chain termination method (Sanger, F., Niklen, S.
and Coulson, A.R (1977) Proc.Nat.Acad. Sci. USA. 74, 5463-
5468) with Se~uenase Version 2.0 (United States
Biochemicals, Cleveland, Ohio). The entire sequence of a
3.5Kb region including the eae gene was determined using
oligonucleotide primers where necessary. Sequence analysis
was performed using the Wisconsin Genetics Computer Group
sequence analysis software package version 6.0 ~Devereux,
J., Haeberli, P., and Smithies/ O. (1984) Nucleic Acids
Res. 12, 387-395).
Nucleotide s~q~ence and accession number
The DNA sequence data was submitted to the EMBL database
and assigned the accession number X60439.
Of the plaques screened, several hybridized to the EPEC
eae probe on primary screening and one designated AGEM-11
~6 -
: ' ' ', , ' ', ' ' , ' ' '~
:, , : . .
.. : . . . .
~ ~ . . . ,, .:
. .
,
:. . .
D4-4 with an insert of 14Kb, was chosen for furt~ 7
The fragments carrying the EHEC eae homologue were
identified by hybridization to the lKb EPEC probe. The
èntire predicted structural gene was sequenced including
205 bp upstream and 118 bp downstream. Figure 1 shows the
DNA sequence of the EHEC eae gene and the deduced protein
sequence staxting at ~he start codon at 206 bp. The end of
the open reading frame is denoted by an asterisk. ~he
sequence was compared with that of the EPEC eae gene.
~he EPEC and EHEC sequences are virtually identical for
the first 2200 bp of the structural gene and for
approximately 200 bp upstream of the star~ site. However,
there is considerable divergence in the last 800 bp where
the similarity is only 59% (Figure 2).
The amino acid sequence alignment of the predicted EPEC
and EHEC proteins is shown in Figure 3. The positions of
the terminal cysteine residue~ are denoted by asterisks.
The N-terminal amino acid~ are highly conserved for the
first 685 amino acids while for the C- terminal amino
acids, only short stretches can be aligned. There is
conservat~on of cysteine residues at positions 859 and 933
of the alignment.
~erse et al. first noted the similarity between the
central regions of eae gene of EPEC and the inv gene of
Yersinia p~eudotuberculosis (Jerse AE, Yu J, Tall BD,
Kaper, J.B. Proc Natl Acad Sci USA 1990; 87s7839-43). The
invasin protein, a product of the inv gene is an outer
membrane protein of Y. pseudotu~erculosis which has been
extensively studied by Isberg et al. (Isberg, R.R.,
Voorhis, D.L. and Falkow, S. (1987) ~ell. 50,769-778).
When expressed in ~ 12, the inv gene is necessary
and sufficient for invasion of HEp-2 cells in tissue
culture (Isberg, R.R., and Falkow, S. (1985) ~ature. 317,
262-264). The invasin protein has been divided into three
domains on the basis of mutational analysis and the study
of fusion proteins (I~berg, R.R. (1989) Mol. Microbiol.
- 27 -
.:' : : , '' '' . . ' .
- ::- :- .
-
.
: ,
: - ,
,, : : :. . . .
. .
:~ ~ ....................... . ,. , ' ;
2~ ~r~ ~ ~
3,1449-1453). ~he ~mino terminus is important for export
beyond the inner membrane whil~ the central region is
critical for stable localization in the outer membrane.
The last 192 residues at the carboxyl terminus have been
shown to be responsible for binding to ~1 integrin
receptors on the eukaryotic cell surface (Leong, J.M.,
Fournier, S., and Isberg, R.R. (1990) EM~O. Jnl. 9,1979-
1989). This domain also carries the epitopes recognized by
neutralizing monoclonal antibodies. Examination of the two
sequences published for the inv genes of Y. ent~rocolitica
(Niller, V.L. and Falkow, S. (1988) Infect. Immun.
56,1242-1248) and the Y. pseudotuberculosis
(Isberg RR, Voorhis DL, and Falkow S. Cell 1987; 50:769-
78) showed that there was similarity to the eae genes in
~he central one third of the sequence. The predicted
protein products of the two inv genes also possess 2
subterminal cys~eine residue with a second approximately
80 amino acids upstream. This suggests that the carboxyl
termini of all four proteins contain a disulfide loop
which may be necessary for biologic activity.
On the basis of the similarities between the inv and eae
genes, the carboxyl termini of the eae proteins are
predicted to be the receptor binding domains. It is likely
tha~ the dissimilarities in ~his region of the molecules
are responsible fox antigenic variation and possibly for
differences in receptor binding specificity. Sherman et al
~Sherman, P., Cockerill III, F., Soni, R., and Brunton, J.
(1991) Infect. Immun. 59,890-899) showed that antiserum
raised against a 94 kilodalton outer membrane protein of
an 0157:H7 strain inhibited adherence and AE lesion
formation by the homologou EHEC strain but had no effect
on the adherence of the EPEC ~train E2348/69. Differences
in receptor Rpecificity could explain the differences
observed in intestinal colonization by EPEC and EHEC
strains. EPEC colonize the entire intestine in animal
models and the upper small bowel of humans. In
contrast,EHEC strain~ colonize the cecum and large
, . , ... . , , :; . , . . :. .. ..
-. - ,
., . , : .
~7,~P~
intestine in animal models while in human~ they cause
intense proximal colonic inflammation, characteristic of
hemorrhagic colitis tRnutton, S., Baldwin, T., Williams,
P.H., and McNeish, A.S.(1989) Infect. Immun. 57, 1290-
1298; Tzipori, S., Wachsmuth, I., Smithers, J., and
Jackson, C., (1988) Gastroenterology 94, 590-597;
Tzipori, S., Wachsmuth, I.K., Chapman, C., Birner, R.,
Brittingham, J., Jackson, C., and Hogg, J. (1986) J.
Infect.Dis. 1~4, 712-716; Riley, L. (1987) Annu. Rev.
Microbiol. 41, 383-407; Karmali, M. (1989) Clin.
Microbiol. Rev. 2, 15-38). Recent reports suggest that
adhesions encsded by the high molecular weight plasmids of
EPEC and EHEC strains are important in determining the
specificity of adherence to tissue culture cells
; 15 (Baldini, M.M., Kaper, J.B., Le~ine, M.M., Candy, D.C.A.,
and Moon, H.W. (1983) J. Ped. Gastroenterol. Nutr. 2,534-
538; Karch, H., Hessemann,-J., Laufs, R. , O~Brien, A.D.,
Tacket, CØ, and hevine, M.M. (1987~ Infect. Immun.
55,455-461; Cantey, J.R., and Moseley, S.L. (1991) Infect.
I~mun. 59, 3924-3929; Jerse, A.E., Gicquelais, K.G., and
Kaper, J.B. (1991) Infect.Immun. 59, 3869-3875). It
remains to be seen whether differences in the C-terminal
regions of the eae gene products of different EPEC and
EHEC strains might result in alterations of receptor
specificity.
.
EXAMPLE 2
Serotype Di6tribution of the EHEC eae Gene Among
Verotoxin-Producing E.coli.
Probes based on the EH~C eae gene were used to study the
; serotype distribution of the eae homologue in a collection
of verotoxin-producing E, coli isolated from human animal
and ~ood so~rces using colony hybridization. Colony
hybridizations were carried out using standard techniques
under highly stringent conditions (Sambrook J, Fritch EF,
Maniatis T. In: Molecular cloning, A laboratory
Manual,1989. (Nolan C, Ed.), Cold Spring Harbor Laboratory
- 29 -
.. , ~ . ~ ~ .... ... . . .
.- ~ ... - , , : -: ,
:: : ~ ,, .,, . , , , , .. , . :
. : : -, . :. : ., . :: : . , :
:. , ;, .. . . - : . ~ ; , : ., , . . :
.~ : , : ; ;... : .. .
, ~ , . , , , ~
- . . . ..
.
~ ~ 7 ,~
Press, Cold Spring Harbor, NY.). DNA for probes was made
by PCR amplification using strain 0157-H7 or strain
Olll:H8. The primers used to amplify the probes are set
forth in Table 1 and are also shown in the Sequence
Listing as SEQ ID NOS: 2 to 9. DNA fragments used ~s
probes were lab~led with [~32p] dATP using the Random
Primed DNA Labeling Rit (Boehringer Mannheim).
Oligonucleotide probes were end-labeled with ~y32p ] dATP
using T4 polynucleotide kinase (Sambrook J, Fritch EF,
Maniatis T. In: Molecular cloning, A laboratory
Nanual,1989. (Nolan C, Ed.), Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, NY.~.
DNA for sequencing wa~ made by PCR amplification using
primers based on sequences within the 0157:H7 eae gene.
Sequencing ~as carried out using the ds ~NA Cycle
Sequencing System (BRL Lifs Technologies) according to the
manufacturer's instructions.
The results of the colony blot hybridizations using probes
based on the 0157:H7 EHEC eae gene are shown in Table 2
and Figure 4. The results show that whereas the central
1 kb fragment C1-C2 hybridized to a variety of the 0
serogroups of VTEC tes~ed, a 0.5 kb fragment A3-B2 in the
carboxyl-terminal region only hybridized to 0157 strains.
Eae homologues among VTEC were detected in serogroups
0157, 0111, 026, 05/ 0103, 0145 and 0118 but not 0113 and
0156. A 0.5 kb fragment (A3-B2) derived from the less
conserved 3' region hybridized with serogroups 0157 and
occasional 0111 strains. However, a more specific 0.45 kb
probe (PlBH-P2EH) only hybridized with VTEC of serogroup
0157 (Figure 5).
Example 3
Oligonucleotide primers specific to the EHEC eae gene were
used in polymerase chain reaction assays to test 150 VTEC
of diverse serogroup which were isolated ~rom food,
animal and human specimens. In particular, previously
,
- 30 -
. . , . - , . , ~ . . . :
: . : ; . : . : . . ~
- - . . . ~ :
- . . . .
- . : :. : . :
: :. . ., . .. . , : .
-
~ 0 7 8 1~ 6
characterized and serotyped isolates of verotoxin-
producing E.coli and enteropathogenic E.coli strains
derived from human, food and animal sources were
contributed by A.Borczyk, C. Gyles and M.Karmali, The
Hospital for Sick Children, Toronto, Canada. Several
colonies wer~ selected, resuspended in 50~1 PCR buffer
(X1) (Perkin Elmer Cetus) and boiled for 10 mins prior to
use as template DNA in PCR amplifications. The PCR
reaction conditions were as follows: 50~1 reactions were
set up using lmM deoxynucleotide triphosphates, 1~ PCR
Buffer, 1 unit Tag polymerase (GeneAmp Kit, Perkin Elmer
Cetus~, 20 pmol of each primer and 1~1 sample preparation.
Each cycle (X40) consisted of the following:
denaturation @ 94C X 1 min
annealing ~ 55C X 1 min
extension @ 72C X 1 min.
.
Primers based on the 0157:~7 sequence and the 0111
sequence, (primers P10 and P20) were used to amplify DNA
from the various serogroups. The primers are shown in
Table 1. The location of the A3, B2, PlEH, and P2EH
primers on the 0157:h7 eae gene are shown in Figure 6.
Colony blot hybridization using [y32p] dATP oligonucleotide
probes was used to confirm the specificity of the primers.
Colony blot hybridizations were performed as described in
Example 2.
Verotoxin-producing E.coli of serogroups 0157 and 0111
strains were detected by PCR with primers A3-B2, giving a
O.5 kb fragment. Both primer sets A3-B2 and PlEH-P2EH did
not detect non verotoxin-producing E.coli of the
serogroups 0157 and 0111. Primer set PlEH-P2EH
specifically detected only 0157 verotoxin positive strains
giving a 0.45 kb fragment (Table 3, Figure 7). Figure 7
shows the amplification products of VTEC and EPEC using
specific primer sets A3-B2 (0.5 kb) and PIEH-P2EH (0.45kb)
and in particular the following:
- 31 -
,;. '. ~. - ' ' - - ' ~ . . . ., , ., . :, . ....
, , . .:
'. . .. ~ . .. . ' - ~' .
, . ~,.
'', ' ~ ' ' ' . ' ,. ~ ~
.
- . ,:
.
~7~7~
LANES 1,20:MW STANDARDS
LANE 3:0157:H7~
LANE 5:0111:H8+
LAN~ 7:0111:NM+
A3-B2 PRIM~RS
LANE 8:05:NM -
LANE 9:0127:H6-
LaNE 13:026:Hll-
LANES lO,ll-NEG CONTROLS
LANE 14:0157:H7+
LANE 15:0111:H8-
PlEH-P2EH PRIMERS
LANE 16:0111sNM-
~ LAN~ l9:NEG CONTROL
:~ 15
Colony blot hybridization using [~32p] dATP oligonucleotide
probes confirmed the specificity of primer~ PlEH P2EH data
obtained from the PCR. Only veroto~in-producing 0157
~erogroups hybridized with PlEH and P2EH t~igure 83.
Attempts to amplify DNA from serogroups 05, 026 and 0118
using primers based on the 0157:H7 sequence were
unsucce~sful. The only serogroup which gave a PCR
amplification product was an Olll:H8 strain using primers
2214 and 3011. Comparison3 of the C-terminal ends of the
eae genes from an 0157:H7, 0111:~8, an EPEC strain and the
Y. pseudotuberculosis inv gene are shown in ~igure 9.
Based on the 0111 se~uence, primers P10 and P20 were
designed which gave a PCR product fox Olll:NM and Olll:H8
verotoxin-producing (VT+) strains but no~ Olll:Hll
indicating that there are differences among ~VT+) 0111
serotypes. ~owever, non verotoxin-producing (VT-) Olll:H2
and Olll:H12 strains were negative.
.
The present invention has been described in detail and
~ith particular reference to the preferred embodiment ;
however, i~ will be understood by one having ordinary
- 32 -
.
.. ., . ., ,, . ,. . ,,: .. , ,, , . ., . " .. , , . , :,. . , ,: .. . .
,: , . . . ~ ., ., , ,., .. , , . : ,
, ., . ,. ~: .: . ., : . . .
: . : , . . .,:, , , - . . . ~, . . . ..
,: . . :, , ,, , -,. , , ,. : .. . . , :
. , . : . . : .. . , . . , . , , : , :: , : : :. : ~ -
~$~
skill in the art that chan~es can be made thereto without
departin~ from the spirit and scope thereof.
Formin~ part o~ the present diqclosure are the appended
sequence li~tings.
. ~. . . . . . .
'; , . '.. ~, .-, ., .,. , . , . , . . ' . : :
,, : : .'': ' . ' ,,', ~ , ~, : .
. , . :- , ., , . ~ ,
, . . . .
:. . ,:
.
.
:
.
`- 2~7~
TABLE 1
PRIMERS
Cl 5 'ATG GAA q~C ~CG TCA CA~ TqG C~G GCC TGG T 3 ' ~en~e
C2 5'ATG GAA ~C: CG~ AG~ CTT P,~C ~GC CGT AAA GT 3'antisense
A3 5'ATG GAA TTC GGA TGT TC~ ACG GTA ~GT CT 3~ sen3e
B2 5'ATG GAA TTC RC~ P~TA CCG TCT GTG ~GG AT 3' antisen~e
2214 5'P.TG GG~ ~CC CC& A!rA TCB Cl~G TAG C~A ATG G~rA AGG AT 3'seslse
3 011 5 ~ ATG AAG Cqlq! GAil~ TTC TC~ ~A ~A ACS~ GCA T i ' anti~ense
P lEH 5 ~ AAG CGA CTG AGG TCI~ C~ 3 ' sen~
P2EH 5 ~ ACG CTG CTC ACT AGA T~:T 3 ' ~ntisense
~ .
P 10~ 5 ~ AGA CCT AG(: TTA C~ T~. 3 ~ sen
P20 5 ' TAT TTT ATC A~;C q~l!C AG~ 3 ' ~JIti~n~e
' .'
-- 34 --
.. . -, , ~ . , . . ,. . ., . ., . . .
", . ..
. ~ : ~ ., '', : , , .,, ~
.. . .. . . , , ., ~ , .
X ~J 7 ~3
TABLE 2
SEFlOGl~ D~8TIRIIIII~UTION OF EAE~llOOU90U:9e;UES
aMo~G VEI~lE9T~XlN-laROD(lClNG E.~QLI
OBE
~GIQN
~B2 PlI FH-P2EI-I
SEROGROUP (1.0kb) ~0.5kb) (0.45 k~3
0157 ~7~ 8 7/ 7
C)l~l 11 / 111 2 / l~1r I ~
026 15~12 ~/ 7 0/ 2
05 7 / 7 l 6 0 / 1
0103 4 / 4 l 3 ~9 / 1
0~45 51 S ~/13
0118 1 / 1 ~ 9 / 2
0113 tl/ 5 ~/ 4 ~/ 1
0156 ~ / 4
0127:H6 1,~ 1 0/ ~I 0/
(E23~8)
015:H~ 1 /
(RDECl )
-- 3s --
TABLE 3 % ~3 7 3 7
D~GTION 01: 0157:H7 .~LI BY I~ R
III!;ING Sil~lFliE æRl~JlElRS
A3DI@~2 1~1 EH~
SEP~OS;FlOalF~S ~Po~ T~ #Pos 1 ~T~
0157 ~T~3 ~$
(~71~
0157 ~ o ~ ~ o / $
0111 ~) 17 ~ . 0 l 12
(NM,IH8,H11~
0111 ~ 2 0 / 2
(H2,H12)
026 ~l $ ~l 2
* ID / 27 0 / 16
*~ ~ / 5 C~ / 3
E~P~:*** l 4 1~ / 1
EIEC 0 / 1 ~ ¦
(~13~3
* vrEc (01, 02, C~, 07, 016, 018, 0~ ~ 40, ~2, 091, 0103, 0113,
0117, 0118~ 0121, 0145, 0~, 0?)
~* ETEC (06, 0115, 0148, 0153)
***EPEC (015, 011~, 012~
-- 36 --
- : .. . . . .
-: ; , .. . ..
,
. ' ' ' , ' .
~ ~ 7 ~
SEQVENCE LISTING
1. G~NER~L INFORMATION
(a) APPLICANTs Joyce de Azavedo, James Brunton
and Marie Louie
(b) TITLE OF INVENTION: Attaching and Effacing
Protein of Enterohemorrhagic E.coli
(c) NUMBER OF SEQUENCES: 9
2. CORRESPONDENCE ADDRESS:
(a) ADDRESSEE: Linda M. Kurdydyk,
Bereskin & Parr
tb) STREET: Box 401, 40 King Street West
(c) CITY: Toronto, Ontario
(d) COUNTRY: Canada
(e~ ZIP CODE: M5H 3Y2
3. COMPUTER READABLE FORM:
(a) MEDIUM TYPE: Floppy di~k
(b) COMPUTER IBM PC compatible
(c) OPERATING SYSTEM: PC-DOS/MS-DOS
(d) SOFTWARE. DOS Text File
4. CURRENT APPLICATION DATA:
(a) A~PLICATION NUMBER: Unknown :~
(b) FILING DATE- Unknown
(c) CLASSIFICATION: Unknown
5. ATTORNEY/AGENT INFORMATION:
(a) NAME: Linda M. Kurdydyk
(b) REGISTRATION NUMBER: 34,971 :~.
(c ) REFERENCE NUMBER/DOCKET NUMBER~ 3153-057/LMX
6. TELECOMMIJNICATION INFORMATION: ::
(a) TELEPHONE: (416~ 364-7311
(b) TELECOPY: (416) 361-1398
7. INEORMATION FOR SEQ ID NO:l:
(a) SEQUENCE CH~RACTERISTICS:
(i) LENGTHs 3131 base pairs
(ii) TYPE:nucleic acid
(iii) STRP.NDEDNESS: double
(iv) TOPOLOGY~ linear
(b) MOLECULAR TYPE: DNA (genomic)
(c) SEQUENCE DESCRIPTION: S~Q ID NO:l:
TCGAGAATGAAATAGAAGTCGTTGTTAAGTCAATGGAAAACCTGTATTTGGTATTACATA
1 + + + + + + 60
AGCTCTTACTTTATCTTCAGCAACAATTCAGTTACCTTTTGGACATAAACCATAATGTAT
a: S R M K * X S ~ L S Q W R T C I W Y Y
b: R E * N R S R C * V N G K P V F G I T *
c: E N E I E V V V K S M E N L Y L V L H N -
- 37 - ~:
. .. ~ : -
-
~; , :,: . . : . : :
: . , : .
. .
2 ~ 7 ,~
ATCAGGGAATAACATTArJAAAACGAACATATGAAAATAGAGGAAATCAGTTCAAGCGACA
61 t + + - + + + 120
TAGTCCCTTATTGTAATCTTTTGCTTGTATACTTTTATCTCCTTTAGTCAAGTTCGCTGT
a I R E * H * R T N I * K * R K S V Q A T
b S G N N I R R R T Y E N R G N Q F K R Q
c Q G I T L E N E H M K I E E I S S S D N -
ATAAACATTATTACGCCGGAAGATAAAATCCGATCTATTAATATAATTTATTTCTCATTC
121 + + + + + + 180
TATTTGTAATAATGCGGCCTTCTATTTTAGGCTAGATAATTATATTAAATAAAGAGTAA&
a I N I I T P E D K I R S I N I I Y F S F
b * T L L R R K I K S D L L I * F I S H S
c K H Y Y A G R * N P I Y * Y N L F L I L -
TAACTCATTGTGGTGGAGCCATAACATGATTACTCATGGTTGTTATACCCt;GACCCGGCA
181 ---- --+~- - -+----- +---~ -+ --~ -+- ----- ~ 240
ATTGAGTAACACCACCTCGGTATTGTACTAATGAGTACCAACAATATG5GCCTGGGCCGT
a * h I V V E P * H D Y S W L L Y P D P A
b N S L W W S H N M I T H G C Y T R T R H -
c T H C G G A I T * L L M V V I P G P G T -
CAAGCATAAGCTAAA~AA~ACATTGATTATGCTTAGTGCTGGTTTAGGATTGTTTTTTTA
241 ------___+_________+_ _______+_________+ + + 300
GTTCGTATTCGATTTTTTTTGTAACTAATACGAATCACGACCAAATCCTAACAAAAAAAT
a Q A * A K K N I D Y A * C W F R I V F L
b K H K L K K T L I M L S A G L G L F F Y
c S I S * K K H * L C L V L V * D C F F M -
TGTTAATCAGAATTCATTTGCAAATGGTGAAAATTATTTTAAATTGGGTTCGGATTCAAA
30l + + + + ~ + 360
ACAATTAGTCTTAAGTAAACGTTTACCACTTTTAATAAAATTTAACCCAAGCCTAAGTTT
a C * S E F I C K W * K L F * I G F G F K
b V N Q N S F A N G E ~ Y F K L G S D S K
c L I R I H L Q M V K I I L N W V R I Q N -
ACTGTTAACTCATGATAGCTATCAGAATCGCCTTTTTTATACGTTGAAAACTGGTGAAAC
361 + - + ~ + ----- ~---------+ 420
TGACAATTGAGTACTATCGATAGTCTTAGCGGAAAAAATATGCAACTTTTGACCACTTT~
a T V N S * * L S E S P F L Y V E N W ~ N
b L L T H D S Y Q N R L F Y T L K T G E T
c C * L M I A I R I A F F I R * K L V K L -
- 38 -
,, , . ; . , . ::
... . . .. .. . .
.. , ., , ~ . . .
.
, , : , . . , ~,
2~7~7~ ~
TGTTGCCGATCTTTCTAAATCGCAAGATATTAATTTATCGACGATTTGGTCGTTGAATAA
421 ~ +---------+~ +--- + + 480
ACAACGGCTAGAAAGATTTAGCGTTCTATAATTAAATAGCTGCTAAACCAGCAACTTATT
a C C ~ S F * I A R Y * F I D D L V V E *
b V A D L S K S Q D I N L S T I W S L N K
c L P I F L N R R I L I Y R R F G R * I S -
GCATTTATACAGTTCTGAAAGCGABATGATGAAGGCCGCGCCTGGTCAGCAGATCATTTT
481 + + + + 540
CGTAAATATGTCAAGACTTTCGCTTTACTACTTCCGGCGCGGACCAGTCGTCTAGTAAAA
a A F I Q F * K R N D E G R A W S A D H F
b H L Y S S E S E M M R A A P G Q Q I I L
c I Y T V L K A K * * R P R L V S R S F C -
GCCACTCAAAAAACTTCCCTTTGAATACAGTGCACTACCACTTTTAGGTTCGGCACCTCT
5~1 + + + + + + 600
CGGTGAGTTTTTTGAAG~GAAACTTATGTCACGTGATGGTGAAAATCCAAGCCGTGGAGA
a A T Q X T S L * I Q C T T T F R F G T S
b P L K K L P F E Y S A L P L L G S A P L
c H S K N F P ~ N T V H Y H F * V R H L L -
TGTTGCTGCAGGTGGTGTTGCTGGTCACACGAATAAACTGACTAAAATGTCCCCGGACGT
601 + -+ - +~ - + ----- -~ --- + 66
ACAACGACGTCCACCACAACGACCAGTGTGCTTATTTGACTGATTTTACAGGGGCCTGCA
a C C C R N C C W S H E * T D * N V P G R
b V A A G G V A G H T N K L T K N S P D V
c L L Q V V L L V T R I N * L K C P R T * -
GACCAAAAGCAACATGACCGATGACAAGGCATTAAATTATGCGGCACAACAGGCGGCGAG
661 + + + + + + 720
CTGGTTTTCGTTGTACTGGCTACTGTTCCGTAATTTAATACGCCGTGTTGTCCGCCGCTC
a D Q K Q H D R * Q G I K L C G T T G G E
b T K S N N T D D K A L N Y A A Q Q A A S
c P K A T * P ~ T R ~ * I M R H N R R R V -
TCTCGGTAGCCAGCTTCAGTCGCGATCTCTGAACGGCGATTACGCGAAAGATACCGCTCT
721 ----- - -+---- ~ ~- +-~ - + - + + 780
AGAGCCATCGGTCGAAGTCAGCGCTAGAGACTTGCCGCTAATGCGCTTTCTATGGCGAGA
a S R * P A S V A I 5 E R R L R E R Y R S
b L G S Q L Q S R S L N G D Y A K D T A L
c S V A S F S R D L * T A I T R K I P L L -
- 39 -
.
- ~. : ~ , , ' '
,
2~7~7.~
TGGTATCGCTGGTAACCAGGCTTCGTCACAGTTGCAGGCCTGGTTACAACATTATGGAAC
7~ -+------- +---~ --+ 840
ACCATAGCGACCATTGGTCCGAAGCAGTGTCAACGTCCGGACCAATGTTGTAATACCTTG
a W Y R W * P G F V T V A G L V T T L W N
b G I A G N Q A S S Q L Q A W L Q H Y G T
c V S L V T R L R H S C R P G Y N I ~ E R -
GGCAGAGGTTAATCTG~AGAGTGGTAATAACTTTGACGGTAGTTCACTGGACTTCTTATT
841 ~ + + + + + 300
CCGTCTCCAATTAGACGTCTCACCATTATTGA~ACTGCCATCAAGTGACCTGAAGAATAA
a G R G * S A E W * * L * R * F T G L L
b A E V N L Q S G N N F D G S S L D F L L
c Q R L I C R V V I T L T V V H W T S Y Y -
ACCGTTCTATGATTCCGAAA~AATGCTGGCATTTGGTCAGGT~GGAGCGCGTTACATTGA
901 ~ ------+---------+---------+---------+ --------~ 9bO
TGGCAAGATACTAAGGCTTTTTTACGACCGTAAACCAGTCCAGCCTCGCGCAATGTAACT
a T V L * F R K N A G I W S G R S A L H ~ -
b P F Y D S E K M L A F G Q V G A R Y I D
c R S M I P K K C W H L V R S E R V T L T -
CTCCCGCTTTACGGCA~ATTTAGGTGCGGGTCAGCGTTTTTTCCTTCCTGCAAACATGTT
961 + + -+------- -+-------- + + 1020
GAGGGCGAAATGCCGTTTAAATCCACGCC~AGTCGCAAAAAAGGAAG&ACGTTTGTACAA
a L P L Y G K F R C G ~ A F F P S C K H V
b S R F T A N L G A G Q R F F L P A N M L
c P A L R Q I * V ~ V S V F S F L Q T C W -
GGGCTATAACGTCTTCATTGATCAGGATTTTTCTGGTGATAATACCCGTTTAGGTATTG&
1021 ---------+-~ -+- - + + + + 1080
CCCGATATTGCAGAAGTAACTAGTCCTAAAAAGACCACTATTATGGGCAAATCCATAACC
a G L * R L H * S G F F W * * Y P F R Y W
b G Y N V F I D Q D F S G D N T R L G I G
c A I T S S L I R I F L V I I P V * V L V -
TGGCGAATACTGGCGAGACTATTTCA~AAGTAGCGTTAACGGCTATTTCCGCATGAGCGG
1081 ---------+---------~------~---+----~ +---------+ 1140
ACCGCTTATGACCGCT~TGATAAAGTTTTCATCGCAATTGCCGATAAAGGCGTACTCGCC
a W R I L A R L F Q K * R * R L F P H E R
b G E Y W R D Y F K S S V N G Y F R N S G
c A N T G E T I S K V A L T A I S A * A A -
-- ~0 --
,, , , .. ., . . . .. , . . .. , ., . , .: , . .. :
: ,. . : . . . .. , , , ,: . -,., ., . . ~., :~: , ,. .,:: .. ..
::. . ,: . . . : . , - .. ,.,. .... .. .. . : , .
: . : : ,. :i . . , . . . . : .. . .
2 0 7 ~ J t ~3
CTGGCATGAGTCATACAATAAGAAAGACTATGATGAGCGCCCAGCAAATGGCTTCGATAT
1141 ~ - --+---- -+---------+---------+---------+~---- ---+ 1200
GACCGTACTCAGTATGTTATTCTTTCTGATACTACTCGCGGGTCGTTTACCGAAGCTATA
a L A * V I Q * E R L * * A P S K W L R Y
b W H E S Y N K X D Y D E R P A N G F D
c G M S H T I R K T M M S A Q Q M A S I S
CCGTTTTAATGGCTA~CTACCGTCATATCCGGCATTAGGCGCCAAGCTGATATATGAGCA
1201 ---- + -- -- + + ---- + -~ + 1260
GGCAAAATTACCGATAGATGGCAGTATAGGCCGTAATCCGCGGTTCGACTAT~TACTCGT
a P F * W L S T V I S G I R R Q A D I * A
b R F N G Y L P S Y P A L G A K L I Y E Q
c V L M A I Y R H I R H * A P S * Y N S S -
GTATTATGGTGATAATGTTGCTTTGTTTAATTCTGATAAGC~GCA&TCGAATCCTGGTGC
1261 ---------+---------+----~ -+-~ +---------+~ --+ 1320
CATAATACCACTATTACAACGAAACAAATTAAGACTATTCGACGTCAGCTTAGGACCACG
a V L W * * C C F V * F * * A A V E S N C
b Y Y G D N V A L F N S D K L Q S N P G A
c I ~ V I N L L C L I L I S C S R I L V R -
GGCGACCGTTGGTGTAAACTATACTCCGATTCCTCTGGTGACGATGGGGATCGATTACCG
1321 -~ -- +---------+ ~ +---- ----+------ -+----- + 1380
CCGCTGGCAACCACATTTGATATGAGGCTAAGGAGACCACTGCTACCCCTAGCTAATGGC
a G D R W C K L Y S D S S G D D G D R ~ P
b A T V G V N Y T P I P L V T N G I D Y R
c R P L V * T I L R F L N * R W G S I T V -
TCATGGTACGGGTAATGAAAATGATCTCCTTTACTCAATGCAGTTCCGTTATCAGTTTGA
1381 ---- --+--~- - -+---- +------- + --~ --+- -------+ 1440
AGTACCATGCCCATTACTTTTACTAGAGGAAATGAGTTACGTCAAGGCAATAGTCAAACT
a S W Y G * * K * S P L L N A V P L S Y *
b H G T G N E N D L L Y S M Q F R Y Q F D
c M V R V M X M I S F T Q C S S V I S L I -
TAAATCGTGGTCTCAGCAAATTGAACCACAGTATGTTAACGAGTTAAGAACATTATCAGG
1441 --- -~ ---- - +---- - +~ --+---------+--- -----+ 150
ATTTAGCACCAGAGTCGTTTAACTTGGTGTCATACAATTGCTCAATTCTTGTAATAGTCC
a * I V V 5 A N * T T V C * R V R N I I R
b K S W S Q Q I E P Q Y V N E L R T L S G
c N R G L S K L N H S M L T S * E H Y Q A -
- 41 -
. . .
:, . -,: . , , , . ~ ,. : ... , . : . . "
. , . ,, - .. . - ., , . ~: : , .
.',: ' : ':: ' . ... . , : . :
.: .. -
. - . - , .. :. - .. . . . .
, . . . : , .
. :;.' . , : : :, .
.~: . , . . ,, , ,; , . .
J l ~
(~AGccGTTAcGATcTGGTrcAGcGTAATAAcAATATTATTcTGGAGTAcAAGAAGcAGGA
1501 ~ ~+---------~---------+--- - + ~560
GTCGGCAATGCTAGACCAAGTCGCATTATTGTTATAATAAGACCTCATGTTCTTCGTCCT
a Q P L R S G S A * * Q Y Y S G V Q E A G
b S R Y D L V Q R N N N I I L E Y X K Q D
c A V T I N F S V I T I L F W S T R S R I -
TATTCTTTCTCTGAATATTCCGCATGATATTAATGGTACTGAACACAGTACGCAGAAGAT
1561 --- + + + + + + 1620
ATAAGAAAGAGACTTATAAGGCGTACTATAATTACCATGACTTGTGTCATGCGTCTTCTA
a Y S r' S E Y S A * Y * W Y * T Q Y A E D
b I L S L N I P H D I N G T E H S T Q K
c F F L * I F R M I L N V L N T V R R R F -
TCAGTTGATCGTTAAGAGCAAATACGGTCTGGATCGTATCGTCTGGGATGATAGTGCATT
1621 -- - + --- --+ -----~ -+----- -+ + 1680
AGTCAACTAGCAATTCTCGTTTATGCCAGACCTAGCATAGCAGACCCTACTATCACGTAA
a S V D R * E Q I R S G S Y R L G * * C
b Q L I V K S K Y G L D R I V W D D S A L
c S * S L R A N T V W I V S S G N I V H Y -
ACGCAGTCAGGGCGGTCAGATTCAGCATAGCGGAAGCCAAAGCGCACAAGACTACCAGGC
1681 - + - + ---- + ----~-+---------+ --------+ 1740
TGCGTCAGTCCCGCCAGTCTAAGTCGTATCGCCTTCGGTTTCGCGTGTTCTGATGGTCCG
a T Q S G R S D S A * R K P K R T R L P G
b R S Q G G Q I Q H S G S Q S A Q D Y Q A
c A V R A V R F S I A E A K A H K T T R L -
TATTTTGCCTGCTTATGTGCAAGGTGGCAGCAATATTTATAAAGTGACGGCTCGCGCCTA
17~1 ------ --+----- -~ +------- -+ ------- + ---- + 1800
ATAAAACGGACGAATACACGTTCCACCGTCGTTATAAATATTTCACTGCCGAGCGCGGAT
a Y F A C L C A R W Q Q Y L * S D G S R L
b I L P A Y V Q G G S N I Y K V T A R A Y
c F C L L M C K V A A I F I X * R L A P M -
TGACCGTAATGGCAATAGCTCTAACAATGTACAGCTTACTATTACCGTTCTGTCGAATGG
1801 ---------+-- ----+~ - ~ ----+ --- + --- + 18~0
ACTGGCATTACCGTTATCGAGATTGTTACATGTCGAATGATAATGGCAAGACAGCTTACC
a * P * W Q * L * Q C T A Y Y Y R S V E W
b D R N G N S S N N V Q L T I T V L S N G
c T V M A I A L T M Y S L ~ L P F C R N V -
- 42 -
.: ..... . . : ~. , ,, ~
. ~ . : ~ . . . . . . . . . . ... .
'- ' :: : . ' -...... ' :. ': ' : . . . '. '.
- , :, . . .
,- ,, , ,, . , , , . . : ,,
., . i . .
2078~1 ~
l~CAAGTTGTCGACCAGGl'TGGGGTAACGGACTTTACGGCGGATAAGACTTCGGCTAAAGC
1861 ~ --+~ ---+----- ~ - + + + 1920
AGTTCAACAGCTGGTCCAACCCCATTGCCT5AAATGCCGCCTATTCTGAAGCCGATTTCG
a S S C R P G W G N G L Y G G * D F G * 5
b Q V V D Q V G V T D F T A D X T S A K A
c K L S T R L G * R T L R R I R L R L K R -
GGATAACGCCGATACCATTACTTATACCGCGACGGTGAAAAAGAATGGGGTAGCTCAGGC
1~21 ---------~--- - -+---------+- ----- + --------+ -- + 1980
CCTATTGCGGCTATGGTAATGAATATGGCGCTGCCACTTTTTCTTACCCCATCGAGTCCG
a G * R R Y H Y L Y R D G E K E W G S S G
b D N A D T I T Y T A T V R K N G V A Q A
c I T P I P L L I P R R * X R M & * L R L -
TAATGTCCCTGTTTCATTTAATATTGTTTCAGG~ACTGCAACTCTTGGGGCAAATAGT~C
1981 -- +-------- + ~ --+-~ -+--~ -+ -------+ 2040
ATTACAGGGACAAAGTAAATTATAACAAAGTCCTTGACGTTGAGAACCCCGTTTATCACG
a * C P C F I * Y C F R N C N S W G K * C
b N V P V S F N I V S G T A ~ L G A N S A
c M S L F ~ L I L F Q E L Q L L G Q I v P -
CAAAACGGATGCTAACGGTAAGGCAACCGTAACGTTGAAGTCGAGTACGCCAGGACAGGT
2041 + + + + + + 2100
GTTTTGCCTACGATTGCCATTCCGTTGGCATTGCAACTTCAGCTCATGCGGTCCTGTCCA
a Q N G C * R * G N R N V E V ~ Y A R T G
b K T D A N G R A T V T L K S S T P G Q V
c K R ~ L T V R Q P * R * S R V R Q D R S -
CGTCGTGTCTGCTAAAACCGCGGAGATGACTTCAGCACTTAATGCCAGTGCGGTTATATT
2101 ---- +-- - + --- + --- +- -~ + 2160
GCAGCACAGACGATTTTGGCGCCTCTACTGAAGTCGTGAATTACGGTCACGCCAATATAA
a R R V C * N R G D D F S T * C Q C G Y
b V V S A K T A E N T S A L N A S A V I F
c S C L L K P R R * L Q H L M P V R L Y F -
TTTTGATCAAACCAAGGCCAGCATTACTGAGATTAAGGCTGATAAGACAACTGCAGTAGC
2161 --- -----+---- ----+ ----+-~ ----+ ---+-~ --+ 2220
AAAACTAGTTTGGTTCCGGTCGTAATGACTCTAATTCCGACTATTCTGTTGACGTCATCG
a F * S N Q G Q H Y * D ~ G * * D N C S 5
b F D Q T K A S I T E I K A D K T T A V A
c L I K P R P A L L R L R L I R Q L Q * Q -
- 43 -
- , - , . . . . .
-: ,,~ . ~
. .
, . ., ~. . . . .. ..
,
,'., :
- . . .
,. . ~ , , , "
:, ,,,',',,' ,,' . ',,' ',' " ,., . " ', ~,' '
~ (~ 7 ~
AAATGGTAAGGATGCTATTAAATATACTGTAAAAGTTATGAA`AAACGGTCAGCCAGTTAA
2221 --- + + + + + + 2280
TTTACCATTCCTACGATAATTTATATGACATTTTCAATACTTTTTGCCAGTCGGTCAATT
a X W * G C Y * I Y C K S Y E K R S A S *
b N G X D A I K Y T V K V M K N G Q P V N
c M V R M L L N I L ~ K L * K T V S Q L I -
TAATCAATCCGTTACATTCTCAACAAACTTTGGGATGTTCAACGGTAAGTCTCAAACGCA
2281 -- +--- - -- ~-~-------~---------+-~ ----+~ -+ 2340
ATTAGTTAGGCAATGTAAGAGTTGTTTGAAACCCTACAAGTTGCCATTCAGAGTTTGCGT
a * S I R Y I L N K L W D V Q ~ * V S N A
b N Q S v T F S T N F G N F N G K S Q T Q
c I N P L H S Q Q T L G C S T V S L K R K -
AGCAACCACGGGAAATGATGGTCGTGCGACGATAACACTAACTTCCAGTTCCGCCGGTAA
2341 ---------+ --------+~ -----+---------+---------~-- + 2400
TCGTTGGTGCCCTTTACTACCAGCACGCTGCTATTGTGATTGAAGGTCAAGGCGGCCATT
a S N H G K * W S C D D N T N F Q F R R * - :
b A T T G N D G R A T I T L T S S S A G K
c Q P R E M M V V R R * H * L P V P P V K -
AGCGACTGTTAGTGCGACAGTCAGTGATGGGGCTGAGGTTAAAGCGACTGAGGTCACTTT
2401 ------ --+---~ -+--~ ----+---------+------~ 2460
TCGCTGACAATCACGCTGTCAGTCACTACCCCGACTCCAATTTCGCTGACTCCAGTGAAA
a S D C * C D S Q * W G * G * S D * G H F
b A T V S A T V S D G A E V K A T E V T F
c R L L V R Q S V M G L R L K R L R S L F -
TTTTGATGAACTG`AAAATTGACAACAAGGTTGATATTATTGGTAACAATGTCAAGAGGTC
2461 ----+ ----+ ----+ - ----+---------+-- ----+ 2520
AAAACTACTTGACTTTTAACTGTTGTTCCAACTATAATAACCATTGTTACAGTTCTCCAG
a F * * T E N * Q Q G * Y Y W * Q C Q E V
b F D E L K I D N K V D I I G N N V K R S
c L M N * K L T T R L I L L V T M S R G R
GATGTTGCCTAATATTTGGCTGCAATATGGTCAGTTTAAACTGAAAGCAAGCGGTGGTGA
2521 f + + + + + 2580
CTACAACGGATTATAAACCGACGTTATACCAGTCAAATTTGACTTTCGTTCGCCACCACT
a D V A * Y L A A I W 5 V * T E S K R W *
b M L P N I W L Q Y G Q F K L K A S G G D
c C C L I F G C N M Y S L N * K Q A V V M -
- 44 -
., .. ., . . . .~., , . . , .,, ~ . .,, :
: ,. , ' ' ' ,~ ,' ',: "'
. , . " , : ~
' ' ' ' , ~, , ' '.' , ' ~ : .
~0 ~7~
IlGGTACATATTCATGGTATTCAGAAAATlCCAGTATCGCGACTGTCGATGCATCAGGGAA
2581 ~ ~+-------- +~ - +- + + + 2640
ACCATGTATAAGTACCATAAGTCTTTTATGGTCATAGCGCTGACAGCTACGTAGTCCCTT
a W Y I F M V F R K Y Q Y R D C R C I R E
b G T Y S W Y S E N T S I A T V D A S G K
c V H I H G I Q K I P V S R L S ~ H Q G R -
AGTCACTTTGAATGGTAAAGGCAGTGTCGTAATTA~AGCCACATCTGGTGATAAGCAAAC
2641 - + + --+----- + ------+ + 2700
TCAGTGAAACTTACCATTTCCGTCACAGCATTAATTTCGGTGTAGACCACTATTCGTTTG
a S H F E W * R Q C R N * S H I W * * A N
h V T L N G K G S V V I R A T S G D K Q T
c S L * M V K A V S * L K P H L V I S K Q -
AGTAA&TTACACTATAAAAGCACCGTCGTATATGAT~AAAGTGGATAAGCAAGCCTATTA
2701 ---------+ -+---~ -+~ +---------~ + 2760
TCATTCAATGTGATATTTTCGTGGCAGCATATACTATTTTCACCTATTCGTTCGGATAAT
a S K L ~ Y K S T V V Y D K S & * A S L L
b V S Y T I K A P S Y N I K V D K Q A Y Y
c * V T L * K H R R I * * K W I S K P I M -
TGCTGATGCTATGTCCATTTGCAAAAATTTATTACCATCCACACAGACGGTATTGTCAGA
2761 -- +- - + -- - +- -----+------ -+---- + 2820
ACGACTACGATACAGGTAAACGTTTTTAAATAATGGTAGGTGTGTCTGCCATAACAGTCT
a C * C Y V H L Q K F I T I H T D G I V R
b A D A M S I C X N L L P S T Q T V L S D
c L M L C P F A K I Y Y H P H R R Y C Q I -
TATTTATGACTCATGGGGGGCTGCAAATAAATA~AGCCATTATAGTTCTATGAACTCAAT
2821 -------- +---------+ ------~+ ----+----- -+-~ - + 2880
ATAAATACTGAGTACCCCCCGACGTTTATTTATATCGGTAATATCAAGATACTTGAGTTA
a Y L * L N G G C K * I * P L * F Y E L N
b I Y D S W G A A N K Y S H Y S S M N S
c F M T H G G L Q I N I A I I V L * T Q * -
AACTGCTTGGATTAAACAGACATCTAGTGAGCAGCGTTCTGGAGTATCAAGCACTTATAA
2881 + + + 2940
TTGACGAACCTAATTTGTCTGTAGATCACTCGTCGCAAGACCTCATAGTTCGTGAATATT
a N C L D * T D I * * A A F W S I K H L *
b T A W I ~ Q T S S E Q R S G V S S T Y N
c L L G L N R H L V S S V L E Y Q A L I T -
- 45 -
- . , ,: . , . , : :
. - : . : . : . . . .
,.
, . . :, . , - . : . . . .
.. : -: . : ~
, , . :
,., ,. . . :. :
: : , . .
.~ ". . , . .,, . .: ,
:. . . . . . . . : . ..
~CTAATAACACAAAACCCTCTTCCTGGGGTTAATGTTAATACTCCAAATGTCTATGCGGT
2941 -- - + + + ~ + + 3000
GGATTATTGTGTTTTGGGAGAAGGACCCCAATTACAATTATGAGGTTTACAGATACGCCA
a P N N T K P S S W G * C * Y S K C L C G
b L I T Q N P L P G V N Y N T P N V Y A V
c * * H K T L F L G L M L I L Q M S M R F -
TTGTGTAGAATAATTCCATAACCACCCCGGCTAAAATATGTATTGTTTTAGTCGGGGCAT
3001 ~------ + -------~---- ----+---- -+---- + + 3060
AACACATCTTATTAAGGTATTGGTGGGGCCGATTTTATACATAACAAAATCAGCCCCGTA
a L C R I I P * P P R L K Y V L F * S G H
b C V E * F H N H P G * N M Y C F S R G
c V * N N S I T T P A K I C I V L V G A * -
AATTATTTCTTCTTAAGAAATAACCCTCTTATAATCAAATCTACTACTGGTCTTTTTATC
3061 + + - + - - +--- -+- - + 3120
TTAATAAAGAAGAATTCTTTATTGGGAGAATATTAGTTTAGATGATGACCAGAAAAATAG
a N Y F F L R N N P L I I K S T T G L F
b I I S S * E I T L L * S N L L L V F L S
c L F L L K K ~ P S Y N Q I Y Y W S F Y L -
TGCTTAATAGG
3121 ---------+- 3131
ACGAATTATCC
a C L
b A * *
c L N R
8. INFORNATION FOR SEQ ID NO:2:
(a) 5EQUENCE CHARACTERISTICS:
(i) LENGTH: 31 base pairs
(ii) TYPE: nucleic acid
(iii) STRANDEDNESS: single - .
(iv) TOPOLOGY: linear
( b ) MOLECULAR TYPE: DNA (genomic)
(c) SEQUENCE DESCRIPTION: SEQ ID NO:2:
5'ATG GAA TTC TCG TCA CAG TTG CAG GCC TGG T 3'
- 46 -
~, , ,~ , . . ..
. , .. : .
. -; .......... . . .; . ~ ,. . . .
. .''' ' ~',, , ~. , . . . ~ ; ..
.
.: ,
2~7~
9. lNFORMATION FOR SEQ ID NO:3:
(a) SEQUENCE CHARACTERISTICS-
(i) LENGTH: 32 ba~e pairs
(ii) TYPE: nucleic acid
iii) STRANDEDNESS: single
(iv) TOPOLOGY: linear
(b) NOLECULAR TYPE: DNA (genomic)
(c) SEQUENCE DESCRIPTION: SEQ ID NO:3:
5'ATG GAA TTC CGA AGT CTT ATC AGC CGT AAA GT 3'
10. INFORMATION FOR SEQ ID NO:4:
(a) SEQUENCE CHARACTERISTICS:
(i) LENGTH: 29 base pairs
(ii) TYPE: nucleic acid
(iii) STRANDEDNESS: single
(iv) TOPOLOGY: linear
(b) MOLECULAR TYPE: DNA (genomic3
(c) SEQUENCE DESCRIPTION: SEQ ID NO:4:
5~ATG GAA TTC GGA TGT TCA ACG GTA AGT CT 3'
11. INFORMATION FOR SEQ ID NO:5:
(a) SEQUENCE CHARACTERISTICS-
(i) LENGTH- 29 base pairs
(ii) TYPE: nucleic acid
(iii) STR~NDEDNESS: single
(iv) TOPOLOGY: linear
(b) MOLECULAR TYPE: DNA (genomic)
(c) SEQUENCE DESCRIPTION: SEQ ID NO:5:
5'ATG GAA TTC ACA ATA CCG TCT GTG TGG AT 3'
. . . : . :
.~ ' , ~: ' , ' ' . ' ', .' . , .,'.:, ,
. .
12. lNFORMATION FOR SEQ ID NO:6:
(a) SEQUENCE CHARACTERISTICS: 2 ~ 7 8 7 16
(i) LENGTH: 17 base pairs
(ii) TYPE: nucleic acid
(iii) STRANDEDNESS: single
(i~) TOPOLOGY: linear
(b) MOLECULAR TYPE: DNA (genomic)
(c) SEQUENCE DESCRIPTION: SEQ ID NO:6:
5'AAG C&A CTG AGG TCA CT 3'
13. INFORMATION FOR SEQ ID NO:7~
(a) SEQUENCE CHARACTERISTICS:
ti) LENGTH: 18 base pairs
(ii) TYPE: nucleic acid
(iii) STRANDEDNESS: single
(iv) TOPOLOGY: linear
(b) MOLECULAR TYPE: DNA (genomic)
(c) SEQUENCE DESCRIPTION: SEQ ID NO:7:
5'ACG CTG CTC ACT AGA TGT 3' .
14. INFORMATION FOR SEQ ID NO:8:
(a) SEQUENCE CHARACTERISTICS: .
(i) LEN&TH: 17 base pair~ :
(ii) TYPE: nucleic acid :
(iii) STRANDEDNESS: single
(iv) TOPOLOGY: linear
(b) NOLECULAR TYPE: DNA (genomic)
(c) SEQUENCE DESCRIPTION: SEQ ID NO:8:
5'AGA CCT AGG TTA CAT TT 3'
- 48 -
.: , ,, . , ~ ; :
,, , - : : . ... : ,
. . , ' '
'
.. . . . .. . . . ..
.,' ' .: :' ," ' '' ' ' ''' ~ . ;' ' " '
15. lNFORMATION FOR SEQ ID NO:9: 2 ~ 7
(a) SEQUENCE CHARACTERISTICS:
(i) LENGTH: 18 base pairs
( ii ) TYPE: ~ucleic acid
(iii) STRANDEDNESS: single
(iv) TOPOLOGY: linear
( b ) MOLECULAR TYPE: DNA (~enomic)
(c) SEQUENCE DESCRIPTION: SEQ ID MO:8:
5 ' TAT TTT ATC AGC TTC AGT 3'
-- 49 --
. , . - . .
,, . ,: . . : . :
:~ . . . : . .. . . .
.. : . . . . . . ,, .. - . , , : :
: . , ., . . ~
:;, . , , ,. , :: . ,,
~, : . .
