Note: Descriptions are shown in the official language in which they were submitted.
~ WO91/1~74 PCT/US91/0~298
2 ~
PURIFIED HCV AND HCV PROTEINS AND PEPTIDES
; 1. Field of the Invention
The present invention relates to purified hepatitis c
virus (HCV), mature virus proteins and glycopeptide anti-
gens isolated from the virus, and vaccine and diagnostic
compositions which utilize the particles, proteins and an-
tigens.
: 2. References
Burk, K.H., et al., Proc. Natl. Acad. Sci. U.S.A.
81:3195-3199 (1984)).
Chomozynski et al, Anal.Biochem. 162:159 (1987).
Eichberg, J. Med. Primatol. 14:165-168 (1985).
Innis, M.A., et al, eds., PCR Protocols: A Guide to Methods
and Applications, Academic Press (l990).
Enat, et al., Proc. Natl. Aca. Sci. USA 81:1411
(1984)-
Feinstone et al., Infect. Immun. 41:816-821 (1983).
Harlow, E., et al., Antibodies: A Laboratory Manual
(1988).
He el al., J. Infect Dis. 156:626-640 (1987).
Jacob et al., Hepatolo~y 10:921-927 (1989).
Jacob, et al., J Infect Dis, 161:1121 (1990).
Lanford, R.E., et al., In Vitro Cell. Dev. Biol.
25:174-182 (19~9)
WO9l/lSS74 PCT/US91/022~
2~7~7~
Jat, et al., Mol. Cell Biol. 6:1204-1217 (1986)).
Lanford et al., Virolo~y 97:295-306 (1979).
Lanford et al., In Vitro Cell Dev. Bio., 25:174-182
(1989).
Maniatis, T., et al., Molecular Cloning, Cold Spring
Harbor Laboratory, Cold Spring Harbor, N.Y.,1982).
Maslamsky, C.J. et al., In Vitro Models for Cancer
Research, Vol. II: Carcinomas of the Liver and Pancreas,
M.M. Weber and L.I. Sekely (eds.), CRC Press: Bo~a Raton,
10 Fla., pp.43-60 (1985)).
Michalopoulos ,G. et al., Exptl. Cell. Res. 94:70
` (1975)
Murphy, in Virology, B.N. Fields e al., Eds., Raven
Press, pp.17-18 (1985).
' 15 Portnoy, et al., J. Lab. Clin. Med., 89: 560-563,
: 1977),
Salas-Prato, in Growth of Cells in Hormonally Defined
Media, (Book A, G.H. Sato, et al., Eds)., Cold Spring
Harbor Laboratory, pp. 615-624 (1982).
Sambrook, et al. eds. Molecular Cloning. A Laboratory
Manual, Vols. 1, 2, and 3, 2nd ed. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York (1989);
Schlesinger, S., et al, eds. in The Togaviridae and
Flaviviridae, Plenum Press, New York (1986).
and Sell, M.A., et al., In Vitro_Cel. Dev. Biol.
; 21:216-220 (1985).
* Valenza, F.P., et al, J ~ed Primatol, 11:342 (1982).
~ . .
3. Backaround of the ~nvention
Non-A, Non-B hepatitis has long been recognized as a
virus-induced disease, distinct from other forms of viral-
associated liver diseases, including hepatitis A virus
, .
, , '
.. . , , , ~ ~ , . .. ... .. . . . ... . . ..
~ WO91/155~4 PCT/US91/02298
2~7~7
(HAV) and B virus (HBV), and hepatitis-induced by cytomega-
lovirus (CMV) or Epstein-Barr virus (EBV). NANBH virus is
implicated in greater than 90% of all post-transfusion
hepatitis cases, and is responsible for the induction of
5 chronic hepatitis in 40-50% of infected individuals. There
is growing evidence for at least two distinct types of
NANB~ viruses. One is an enterically transmitted virus,
and may be seen in epidemic form where sanitation condi-
tions are poor. The other is parenterally transmitted
10 NANBH virus, now commonly referred to as hepatitis C virus
(HCV), which is a ma~or source of hepatitis in transfused
blood.
The limited availability of an animal model (~CV
infects only chimpanzees and humans) and the absence of an
15 in vitro tissue culture model suitable for growing HCV has
limited the isolation and characterization of mature HCV
virus. Such particles would be useful for production of
inactivated or attenuated HCV for vaccine and diagnostic
purposes, and for isolation and identi~ication of intact,
20 mature HCV proteins, and glycosylated HCV antigens.
4. Summarv of the Invention
It is therefore a general object of the invention to
provide isolated, intact HCV virus particles, and protein
25 and glycopeptide antigens obtainable therefrom.
The invention includes, in one aspect, purified HCV
virus particles characterized by: (a) a single-stranded RNA
genome; (b)- a flavivirus type s~ructure having virus
particle sizes between about 30-60 nm, enveloped capsid
30 structures, external stalks 2-5 nm in length and width, and
` an icosahedron symmetry, and (c) immunospecific reaction
with HCV-infected individuals. In one embodiment, the RNA
~ ,:
.
'.
.. , .. , . . . .. .: : .. ,, :
.: . ., ~ . . : . . . - ,
WO91/15574 PCT~US91/022Q~
2~79~77
genome of the particles contains a region with the sequence
shown in Figure 4.
The particles are useful, in inactivated form, in a
vaccine composition, or for generating monoclonal antibod-
S ies specific against HCV virus antigens, and in particular,against glycopeptide antigens.
The protein components of the virus particles, when
fractionated and purified, yield mature HCV pro*eins, such
as purified, mature C, el (gp35), e2 (gp70), and the HCV
lO counterparts to NS2, NS3, NS4, or NS5, which may be sub-
stantially free of HCV genomic ~NA, and non-viral serum and
cell proteins normally associated with HCV virus infection
in humans.
A purified protein or protein mixture is useful in
15 a vaccine composition, for generating monoclonal antibodies
specific against HCV viral proteins, and in a diagnostic
system for detection of human anti-HCV anti-sera.
The virus particles or proteins isolated therefrom
also provide a source of ~CV-specific glycopeptide anti-
20 gens, i.e., glycopeptide regions of a glycosylated HCVproteins, such as gp35 and gp70. The antigens are useful
in a diagnostic system for detecting human sera from HCV-
infected individuals.
In another aspect, the invention includes an antibody
25 specific against the HCV glycopeptide antigen. The anti-
body is useful as a diagnostic reagent, for detecting the
pxesence of ~CV antigens in HCV-infected human sera.
'/These and other objects and features of the invention
will become more fully apparent when the following detailed
`30 description of the invention is read in conjunction with
the accompanying dxawings.
-~ WO91/15~74 PCT/US91/02298
2~7~77
Brief Descri~tion of the Drawings
Figures lA and lB are electron photomicrographs of HCV
particles at two different magnifications, where the bars
in the figures indicate 50 nm;
Figures 2A-2E are electron photomicrographs of HCV
particles, where Figures 2A-2D (bar = 23 nm) show typical
variation in size and shape, with a core-like structure
being evident in Figure 2C, and Figure 2E (bar = 17 nm) is
taken at higher magnification and shows external surface
10 stalks on the virus particle;
Figures 3A-3C are electron photomicrographs of HCV
particles, showing bar-like structures within the virus
^ core (3A and 3C) and prominent envelope structures with
external stalk projections (3B);
15Figure 4 gives the sequence of a cDNA region of an HCV
strain isolated from HCV-infected liver, also showing
nucleotide divergence with earlier published HCV sequences,
designated JT and PT;
Figure 5 shows electrophoretic patterns of PCR pro-
- 20 ducts of RNA from various immortalized CU chimpanzee hepa-
tocyte cell lînes derived from HCV-infected chimpanzee
~ hepatocytes (lanes 1-8), and from chimpanzee liver RNA
:~ during the acute phase of HCV infection (lane 9); and
Figure 6 shows electrophoretic patterns of PCR pro-
25 ducts of RNA from various HCV-infected CHMP cells ~lanes 1-
12 and 14), from the inoculum used to infect the cells
(lane 13), from chimpanzee liver RNA during the acute phase
of HCV infection (lanes 15 and 18), and from an HCV cloned
fragment.
'
. .. - ... . , . . . .. .,. , , . : . : .:
WO91/15574 PCTtUS91/022~ ;
2~7~77
Detailed Description_of the Invention
I. HCV Virus Particles
This section describes cell culture sources of HCV
5 particles having the characteristics:
(a) a single-strand RNA genome;
tb) a flavivirus type structure having virus particle
sizes between about 30-60 nm, enveloped capsid structures,
- external stalks 2-5 D in length and width, and an icosa-
10 hedron symmetry, and
(c) immunospecific reaction with HCV-infected individ-
uals.
A. Cell culture sources.
One cell-culture source of HCV virus particles is a
cultured primary hepatocytes derived from the liver of an
HCV-infected chimpanzee or human, and cultured under
conditions which maintain the differentiated state of the
infected cells for 3-4 weeks. Methods for preparing
20 primary primate hepatocytes for culture, and culture medium
conditions effective to preserve liver-specific functions
r for extended periods in culture have been described by the
inventors (Lanford, 1989)
Details of the primary cell culture methods are given
25 in Example 1. Briefly, liver tissue obtained from an HCV-
infected chimpanzee or human is perfused and hepatocytes
are dislodged by treatment with collagenase. The cells are
washed several times, then plated on culture plates at a
density of about 5 x 105 to 5 x lo6 cells per 60 mm plate.
30 The hepatocytes are maintained in serum-free medium (SFM)
which has been specifically designed to allow the cells to
grow in culture in a highly differentiated state, as
., '
: -
~ .
- . .
~ WO91/15574 PCT/US91/02298
2~7~77
evidenced by the continued production and secretion in
culture of liver-specific proteins.
one preferred SFM is composed of Williams' medium E
(WME) supplemented with lO mM HEPES, pH 7.4, 50 ug gentami-
5 cin, and the following supplements: EGF (epidermal growthfactor), insulin, glucagon, BSA (bovine serum albumin),
soybean lipids, linoleic acid, hydrocortisone, selenium,
cholera toxin, LGF (liver growth factor, a glysyl-histidyl-
lysine tripeptide~, ECGS (endothelial cell growth supple-
lO ment), transferrin, ethanolamine, prolactin, somatotropin,and TRF (thyrotropin-releasing factor), in the proportions
given in Example l. The sources of these materials are
given elsewhere (Lanford). The cells are maintained in
the SFM under standard cell culture conditions. The medium
15 is changed, e.g., 24 hours after isolation and every 48
hours thereafter, during the culture period. Under these
conditions, the cells undergo 2-4 rounds of replication in
the first several days of culture, e.g., within 7-lO days,
and thereafter continue to function as liver-specific cells
20 in culture, but without appreciable signs of cell replica-
tion, for 3-4 weeks total culture period. Thereafter, the
virus-infected cells gradually lose hepatocyte differentia-
tion, as evidenced by a decline in the production of liver-
specific proteins.
The differentiation of the primary hepatocytes in
: culture can be assessed by following changes in the pro-
duction and secretion of liver-specific proteins. In one
approach described in Example l, proteins from the culture
- medium are fractionated by sodium dodecyl sulfate-poly-
30 acrylamide gel electrophoresis ~SDS-PAGE~, and the frac-
tionated proteins are detected by immunoblotting, using
antibodies directed against the proteins of interest. In
. . ',
- - . . . . .
.: . , ~ : . ~ . . .
WO91/l5~74 PCT/US91/022~
2~79~77
a second approach, also described in Example 1, radio-
labeled cell culture proteins are immunoprecipitated with
immobilized, protein-specific antibodiçs, and the precipi-
tated antibodies are then fractionated by SDS-PAGE. In
5 both cases, analysis of the gel patterns showed that the
hepatocytes produced a number of liver~specific proteins in
approximate relative proportions to that found in plasma
for up to 3-4 weeks, then showed a gradual decline in the
amount of protein produced. The decline in liver-specific
lO protein production, such as apolipoprotein production,
paralleled a degeneration in the`hepatocyte cultures.
HCV particles were obtained from the HCV-infected
hepatocytes in culture for up to three-seven weeks after
the infected cells were placed in culture (Table 1).
Another source of HCV particles, in accordance with
the invention, is chimpanzee or human primary hepatocytes
which are infected in vit~o with ~CV inoculum. A method of
obtaining and culturing hepatocytes from uninfected
chimpanzees is given in Example 5, and generally follows
20 the culture method used to form stable, differentiated
primary hepatocytes derived from HCV-infected liver cells.
The cells are infected with a pooled inoculum of plasma
samples from several chimpanzees with known acute HCV
infection, as described in Example 5.
Table 1 below compares viral counts obtained from
cultured hapatocytes which were derived either from HCV-
infected chimpanzees tPTTx196, PTTx174, PTTx268, and
: PTTx198) or from non-infected chimpanzees, whose cultured
hepatocytes were infected in vitro (PTTx266 and PTTx344),
30 where culture samples were taken at the culture times
indicated. The results show the ability to replicate,
isolate and purify the HCV virus in hepatocytes derived
,, ~ , : . : .
. . ~ - . :. - ~ . .
,, .. . . ~ : .
. . . ., -
.: - .. . :: . ~ .
..-"WO91/15574 PCT/US91/02298
2~7~77
g 1,
from both HCV-infected and non-infected HCV-infectable
animals.
Table l
ANIMAL ¦ DAY OF CULTURE
i _ _ ,.
r ~ Russel ~ 3 6 _
¦PTT x174 Orville lS 1.0 ~ :
...1
~ 1 ~
~1 ~rr ,~ 0.~ ~ ID 2 4 ~¦
~ 7 i ~ :
., ,
.' .
. . . , . .. - : . - : . .
. . . , . : , , : : : : . : . :
- . . , . . . . . :: ~ .: .
WO 91/15~74 PCr/US91/02~
207~77
. . _ .
ANIMALDAY OF CULTURE PARTICLES Xl06/ml 1
.. .. .
A third source of HCV particles, also in accordance
5 with the invention, is immortalized chimpanzee or human
hepatocytes which are infected in vitro with HCV after
-immortalization. Immortalization is achieved by introduc-
ing an oncogene into stable, non-infected or HCV-infected
primate hepatocytes in culture, as detailed in the compan-
10 ion patent application for "An Immortalized Hepatocyte Cell
Line", and illustrated in Example 6. Briefly, hepatocytes
obtained from non-infected or H~V-infected chimpanzees (or
humans) are cultured, as above, under conditions which
allow expression a liver-specific proteins for extended
15 culture periods. During the first 2-4 rounds of replica-
tion of the cultured cells, the culture is exposed to a
- ~ . . .... ... .
_WO 91/15~74 PCI`/IJS91/02298
2~7~
11
virus or plasmid vector containing a suitable oncogene,
such as the SV40 large T antigen oncogene, and immortalized
cells are selected on the basis of continued growth beyond
initial 2-4 rounds of replication, when non-immortalized
5 cells are essentially non-replicative.
To select an immortalized cell line capable of
supporting HCV infection and replication, several immortal-
ized cell lines from above are infected with an HCV
inoculum, and the individual cell lines are assayed for the
10 presence of HCV RNA, using PCR methods such as detailed in
Example 6.
Figure S shows a gel analysis of the PCR products from
HCV-infected CU~cell lines (produced by immortalization of
hepatocytes from an ~CV-infected chimpanzee). Lanes 1-8
15 are CUl, CU3, CU4, CU5, CU6, CU8, CU9 and CU12, respective-
ly. Lane 9 is a positive control of chimpanzee x198 liver
RNA during the acute phase of HCV infection and was
processed identically as the CU RNA samples. Lanes lO and
11 are the cDNA and PCR negative controls to demonstrate
20 the lack of contamination during the PCR assay. Lane 12 is
lambda DNA cleaved with HindIII as size markers. Lane 5
(CU6) and 9 (PCR positive control) show a positive reac-
tion. All lanes have a lower band that represents the
primers used in the PCR reaction. Positive reactions were
25 obtained with CU6 cell line, the inoculum used to infect
the cell lines, and each of the positive controls. The
negative controlled were negative indicating that no
contamination occurred during the PCR reaction.
i Figure 6 shows a gel analysis of PCR products from
30 HCV-infe~ted CHMP cell lines (produced by immort lization
of hepatocytes derived from non-infected chimpanzees
hepatocytes). Lanes 1-12 represent CHMP 1.21, 1.22, 1.23,
~ . . . . .
- : - . : . ~ . . . . .
W091~1~574 PCT/US91/02~?n~
2~7~7
12
}~,.24, 1.25,1.26, 1.27, 1.28, 1.29, 1.30, 1.31 and 1.32,
respectively. Lane 13 is the PCR analysis of the inoculum
used to infect both the CU and CHMP cell lines. Lane 14 is
CHMP 2.02. Lane 15, 18 and 19 are PCR positive controls.
5 Lane 15 and 18 are PTTx198 liver RNA as described for
Figure 6. Lanes 16 and I7 are cDNA and PCR negative
controls, respectively. Lane 19 is a P~R positive control
consisting of a gel purified band from a cloned fragment of
HCV homologous to the PCR primers used in this assay. Lane
10 20 is HindIII digested lambda DNA as size markers.
Positive reactions were obtained with CHMP 1.27 and
CHMP 2.02 cell lines, the inoculum used to infect the cell
- lines, and each of the positive controls. The negative
- controls wexe negative indicating that no ontamination
15 occurred during the PCR reaction.
Thus, of the 20 CU and CHMP cell lines tested, three
were permissive for infection with and replication of HCV.
The cell lines are CHMP 1.27, CHMP 2.02 and CU6. These
results demonstrate that immortalized chimpanzee hepato-
20 cytes, whether derived from non-infected or HCV-infected
animals, are infectable with HCV, and support replication
- of HCV, for use in the production of HCV.
. . .
B. - Isolation of Virus Particles
Virus particles can be isolated from HCV infected
chimpanzee or human hepatocytes in culture by gradient
centrifugation methods, as described in Example 2. In one
preferred method, culture ~edium is clarified by low-speed
centrifugation, then separated from soluble culture-medium
' 30 components by centrifugation through a 20% sucrose layer by
high-speed centrifugation. The material is further
.i :.
.,
., :
,
.
_WOgl/tS574 PCT/US91/02298
~7~7
purified by centrifugation onto a 68% sucrose cushion at
high speed.
Other methods for separating vixus particles from
soluble culture-medium components may be used. For
5 example, clarified culture medium can be passed through a
size-exclusion matrix, to sepa~ate soluble components by
size exclusion.
Alternatively, the clarified culture medium can be
passed through an ultrafiltration membrane having a 10-20
10 nm pore size capable of retaining virus particles, but
passing solute (non-particulate) culture medium components.
C. Virus Particle Characteristics
Purified HCV virus particles from above were examined
15 for morphological features, as detailed in Example 2.
Figures lA and lB are electron photomicrographs of HCV
particles from cells derived from PTTx174 chimpanzee, at
two different magnifications, where the bars in the figures
indicate 50 nm. Figures 2A-2E are electron photomicro-
20 graphs showing further structural features and variationsin HCV particles (composite of HCV's from liver derived
from different HCV-infected chimpanzees), where the bars in
; Figures 2A-2D represent 23 nm. A core-like structure is
evident in Figure 2C. Figure 2E (bar = 17 nm) is taken at
25 higher magnification and shows external surface stalks on
the virus particle;
The electron micrographs of HCV particles (from
hepatocytes derived from the liver of PTTx266 chimpanzee)
in Figures 3A-3C show bar-like structures within the virus
30 core (3A and 3C) and prominent envelope structures with
extern~l stslk projections (3~
., :
., .
~' ~
: ., . . ~ - . . . . .. . . .
W09l/l5~74 PCT/US91/02~
2~7~
14
Summarizing the structural features, the HCV particles
have:
(a) an approximate average outside diamPter of 39-46
nm, but with a wide range in particle size (30-60nm);
(b) an internal core structure approximately 35-4Onm
in diameter;
(c) a dense intra-core bar-like structure within
some of the particles;
(d) external "stalks" and "knobs" protruding from the
envelope, which measure approximately 2 to 5 nm in
length, and 2 to 5 nm in width, respectively;
(e) particle envelopes; and
(f) icosahedron symmetry.
The virus particles isolated and visualized electron
15 microscopically from the tissue cultured hepatocyte medium
displayed a morphology similar to the genus flaviviruses of
. the Togaviridae family. Togavirus virions consist of a
lipid-containing envelope with surface projections sur-
rounding a spherical nucleocapsid with proven or presumed
20 icosahedral symmetry. Virions are 40 to 70 nm in diameter.
The genome consists of one molecule of positive-sense
infectious ssRNA of MW 4x106. The viruses exhibit pH-
dependent hemagglutinating activity. Replication takes
place in the cytoplasm, and assembly involves proven or
:25 presumed budding through host cell membranes. [See, for
example, Murphy or Schlesinger).
Similarly, the chloroform sensitive nature of the HCV
virus, indicative of a lipid-containing envelope (Fein-
stone), as well as the apparent size distribution of the
30 HCV agent (30-60nm) determined by selective filtration
techniques (He), are features compatible with our ultra-
-W091~15~74 PCT/US91tO2298
2~7~$7~
structural observations of an enveloped virus, whose size
range is observed to be 39-60nm.
D. Infective HCV Particles
The HCV particles isolated as disclosed above are also
infectious. This is evidenced by the ability of cell
culture medium from the HCV-infected primary or immortal-
ized hepatocytes to produce HCV infection in chimpanzees.
Details of one study in which culture medium from HCV-
lO infected primary hepatocytes is used to infect chimpanzees
are given in Example 4. Weekly blood samples and periodic
liver biopsies showed active hepatitis infection at 16-20
weeks after initial infection.
.: :
15 D. Virus Particle Genome
The virus particles described in Example 2 were
isolated from primary hepatocytes derived from the liver of
a chimpanzee infected with the Hutchinson strain of HCV.
In order to detect and sequence the RNA genome of the
20 infective HCV, total RNA isolated from the biopsied liver
sample was amplified by polymerase chain reaction (PCR)
methods, using HCV-specific primers, and the amplified
fragment was cloned and sequenced, according to methods
detailed in the Example 4.
~ 25 The amplified, cloned HCV sequence (termed BTR 623)
r,' includes 623 nucleotides of HCV specific sequence. This
; isolate was compared to sequences of previously published
JI and PT HCV clones (Kubo), as shown in Figure 4. The
!, sequences given in this figure indicate that the HCV strain
~; 30 used in these studies has significant seguence divergence
with the published isolates. The greatest level of
divergence was seen with the Jl sequence. BTR 623 had
'
.
.~
,' ' ' , ' '' ,"' ' ', ;' '' , ,, ,, '; , ~ ~ :
WO9l/15~4 PCT/US91/02~
2~79~7
16
96.2~ nucleotide and 97.4% amino acid homology with PT, and
79.8~ nucleotide and 93.8% amino acid homology with Jl.
II. HCV Antiaens
5 A. HCV proteins
Heretofore, HCV virus proteins have been obtained only
in recombinant form, using expression vectors with known
HCV coding sequences to express HCV proteins or peptides in
a suitable expression system. Such recombinant proteins
10 are likely to differ from mature, intact virus proteins in
glycosylation, acetylation, and phosphorylation modifica-
tions, as well as terminal residue modifications or
cleavages. These modifications, particularly glycosylation
features, are likely to be important in virus interactions
15 with host cells (Schlesinger), and in the host's immune
response to the virus.
The present invention allows glycosylation and other
post-translation modifications in intact HCV virus proteins
to be identified and isolated. The glycosylation sites can
20 be identified by standard Western blotting procedures
(Harlow), in which isolated HCV virus is fractionated by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE), and the virus protein bands are probed with HCV
antisera, to identify im~unoreactive viral proteins.
25 Similarly, the viral proteins can be cleaved by selected
proteases, prior to Western blotting, to identify immunore-
active peptide fragments. The immunoreactive proteins or
protein fragments can be identified by amino acid sequenc-
ing of the Western blot bands, either directly, or after
30 additional band purification, if necessary.
~ rom the identification of the proteins, and from
known consensus sequence~ for glycosylation sites, e.g.,
.. . . , . . . . . : . . ~ ................ - , .
.. - :
- WO91/15574 PCTtUS91/0229X
2 ~ 7 ~ ~ 7 rl
17
Asp-X-Ser/Thr, proteins or fragments thereof which contain
glycosylated residues can be identified. Alternatively,
such proteins or fragments can be identified by comparing
2-dimensional gel electrophoresis patterns of virus
5 proteins or peptide fragments before and after treatment
with selected glycosida6es. Two RCV proteins, gp35, and
gp70, have been identified by others from coupled in vitro
translation end studies, as containing glycosylation sites
based on their sensitivity to endoHglycosidase.
After identifying glycosylated proteins or peptides of
interest, the isolated viral particles are used as a source
of the selected glycoprotein or peptide. Protein or pep-
tide isolation from the viral particles can be carried out
by standard methods, such as ion exchange and size-exclu-
15 sion chromatography, and HPLC purification. T h e
present invention contemplates in particular, mature gp35
(El) and gp70 (E2) HCV proteins with native glycosylation,
and mature glycosylated peptides from these two proteins.
The proteins and peptides are useful in a diagnostic system
20 and in a vaccine composition, as described in Section IV
below.
III. Anti-HCV Antibodies
i In another aspect, the invention includes polyclonal
25 or monoclonal antibodies specific against mature HCV
particles and protein components thereo~. The antibodies
are defined by specific immunoreactivity with features of
HCV particles, or proteins or peptide fragments thereof,
due to normal post-translational modifica~ion. That is,
30 the antibodies are immunoreactive only with recombinant RCV
proteins which contain normal virus post-translational
modifications.
.
- :
.
WO9l/15574 PCT/US91/02~A8
2~7~77
18
Polyclonal antibodies can be prepared, in accordance
with one embodiment, by affinity chromotography, using the
glycopeptide antigens identified from above immobilized on
a solid support, for extracting immunoreactive antibodies
5 in naturally-infected human or chimpanzee HCV anti-sera or
antisera generated specifically against the glycopeptide
antigen.
Alternatively, the glycosylated proteins or peptides
from above can be used to produce monoclonal antibodies,
10 employing standard methods (Harlow~. Briefly, the protein
or peptide antigen is used to elicit an immune response in
an animal, such as a mouse or rabbit, B lymphocytes from
the spleen of the immunized animal are immortalized with a
suitable hybridoma partner, and selection of desired
15 hybridomas is made on the basis of immunoreactivity with
~ the glyc~protein or peptide of interest. The antibodies
- made by the selected hybridoma are useful in a diagnostic
method, for screening human sera for HCV infection, and in
a vaccine composition, for producing active immunity, as
20 discussed in Section 4.
. ~
IV. Utilitv
A. Detection of HCV Antisera
The virus particles, and proteins and glycosylated
25 peptides derived therefrom are useful as diagnostic
reagents for detecting anti-HCV antibodies present in HCV-
infected sera. As noted above, the mature particles,
proteins and glycosylated peptides o~fer the advantage over
recombinantly prepared HCV peptides and proteins in that in
30 addition to peptide antigens, the agents provide potential-
ly unique antigenic sites associated with mature viral
proteins, such as glycosylated peptides.
. , , . ~ . ............................ .
:: . , . ; ~
WOgl/15574 PCT/US9t/02298
2~7~'77
19
In one preferred diagnostic configuration, test serum
is reacted with a solid phase reagent having surface-bound
viral proteins or peptides. After binding anti-HCV
antibody to the reagent and removing unbound serum compo-
5 nents by washing, the reagent i5 reacted with reporter-
labeled anti-human antibody to bind reporter to the reagent
in proportion to the amount of bound anti-HCV antibody on
the solid support. The reagent is again washed to remove
unbound labeled antibody, and the amount of reporter
10 associated with the reagent is determined. Typically, the
reporter is an enzyme which is detected by incubating the
solid phase in the presence of a suitable fluorometric or
colorimetric substrate.
The solid surface reagent in the above assay prepared
15 by known technigues for attaching protein material to solid
` support material, such as polymeric beads, dip sticks, or
filter material. These attachment methods generally
include non-specific adsorption of the protein to the
support or covalent attachment of the protein, typically
20 through a free amine group, to a chemically reactive qroup
on the solid support, such as an activated carboxyl,
hydroxyl, or aldehyde group.
In a second diagnostic configuration, known as a
hompgeneous assay, antibody binding to a solid support
25 produces some change in the reaction medium which can be
` directly detected in the medium. Known general types of
homogeneous assays proposed heretofore include (a) spin-
; labeled reporters, where antibody binding to the antigen is
detected by a change in reported mobility (broadening of
30 the spin splitting peaks), (b) fluorescent reporters, where
binding is detected by a change in fluorescence efficiency,
(c) enzyme reporters, where antibody binding effects
.
.
WO91/15~74 PCT/US91/022~
207~7~
enzyme/substrate interactions, and ~d) liposome-bound
reporters, where binding leads to liposome lysis and
release of encapsulated reporter. The adaptation of these
methods to the protein antigen of the present invention
5 follows conventional methods for preparing homogeneous
assay reagents.
In each of the assays described above, the assay
method involves reacting the serum from a test individual
with the protein antigen and examining the antigen for the
lo presence of bound antibody. The examining may involve
attaching a labeled anti-human antibody to the antibody
being examined, either IgM (acute phase) or IgG (convales-
cent or chronic phase), and measuring the amount of
reporter bound to the solid support, as in the first
15 method, or may involve observing the effect of antibody
binding on a homogeneous assay reagent, as in the second
method.
Also forming part of the invention is an assay system
or kit for carrying out the assay method just described.
20 The kit generally includes a support with surface-bound
mature virus particle, protein or peptide, and a reporter-
labeled anti-human antibody for detecting surface-bound
- anti-409-1-1 antibody.
25 B. HCV Vaccine
The virus particles, or mature processed proteins or
antigenic peptides therefrom can be formulated for use in
a HCV vaccine. The vaccine can be formulated by standard
~ethods, for example, in a suitable diluent such as water,
30 saline, buffered salines, complete or incomplete adjuvants,
and the like. The immunogen is administered using standard
t-chniqu-s for antibody induction, suoh as by subcutaneous
, . , . . - . . . ~
~ i . . .
- , . . . , ~. ., ; ' ~
~..... ... . . .. . - ~
, , . . .. ~ . . ........ ~ ~
_~WO91/15574 PCT/US91/02298
2$7~77
21
administration of physiologically compatible, sterile
; solutions containing inactivated or attenuated virus
particles or antigens. An immune response producing amount
of virus particles is typically administered per vaccini-
5 zing injection, typically in a volume o* one milliliter or
less.
A specific example of a vaccine composition includes,
- in a pharmacologically acceptable adjuvant, intact virus
particles. This vaccine contains a combination of core and
10 envelope antigens. Another specific example includes, in
- a pharmaceutically acceptable adjuvant, a purified mature
virus protein, such as the gp35 or gp70 protein, or a
combination of C ~core) protein with envelope protein, such
as the gp35 or gp70 proteins.
Although the invention has been described with respect
to particular methods, cell line, HCV strains, and applica-
tions, it will be apparent that various changes and
modification can be made without departing from the
invention.
Example 1
; Primary HCV-Infected Chimpanzee HeDatocytes
A. Liver Sa~ples
A parenteral ~CV virus infection was induced in
25 chi~panzee PTTx7, a 14-year old female, by inoculation with
5 ml of a 20-fold concentrate of acutiei phase plasma of
unknown titer derived from a second chimpanzee passage of
the Hutchinson strain of HCV (obtained from Dr. K Burk,
Biotech Resources, Inc., San Antonio, TX~) was monitored by
30 ALT/AST (alanine aminotransferase/aspartate aminotransfer-
ase) enzyme fluctuations from weekly ~lood samples and by
histopathologic examination of periodic liver needle punch
,., - . . : ,: . .. . , . . - . : ,: . . : , - :, ,
:, .. . :. . . . . . . .. . ,... . , .: .. ... :. : . . - . .. ,. , :
W09l/15574 PCT/US91/02~
2~79~7~
biopsies, according to published methods (Valenza). The
"PTT" animal designations used herein identify individual
chimpanzees housed at the Southwest Foundation for 3iomedi-
cal Research, San Antonio, TX.
All biopsies were processed identically using conven-
tional techniques. Immediately after harvesting, the liver
biopsies were fixed for 1-3 hours in neutral buffered 3.7%
formalin, processed manually according to standard proce-
dures, embedded in paraffin, sectioned at 4 microns and
10 stained with hematoxylin and eosin. All sections were
examined histologically by the same board certified
veterinary pathologist.
Since the onset of clinical hepatitis was significant-
ly delayed, a second inoculation of 1.5 ml
(1025 CID50) of the original HCV virus Hutchinson inoculum
was administered at week 10 to assure infection. The
appearance of elevated ALT on week 12 indicated that the
second inoculum either potentiated the primary infection or
was not required. The ALT profile of the animal exhibited
20 a rise above normal values from 12-19 weeks post inocula-
tion, and a second ALT elevation occurred on week 39.
A liver punch biopsy taken after ALT elevations (week
19) revealed an increased number of lymphocytes in portal
areas and in the parenchyma of the liver. Associated with
25 the parenchymal lesions were necrotic hepatocytes. The
hepatocytes around central vein areas were often lightly
stained and granular with minimal swelling of the cyto-
plas~. All these changes described indicated minimal,
lymphocytic, multifocal, viral hepatitis.
Liver wedge surgery was performed on week 14 at the
onset of definitive ALT elevation. Ketamine hydrochloride
was used as the immobilizing and preanesthetic agent.
,~ ~
. . .. . - . ~ .
, , ,: .. , . .. : . :. : : : .
. : ~ ......... . . . . . . . .
:. :, . . .
~WO91/15574 PCT/US91/02298
2~7~77
23
Surgery was performed under general anesthesia with non-
hepatotoxic sodium pentobarbital. A liver wedge of
approximately 10 g was perfused using a modification of
established protocols (Maslansky). Microscopic examina-
5 tion of liver tissue taken at this time revealed occasional
collections of lymphocytes and macrophages in hepatic
triads and in focal parenchymal areas. There were no other
changes indicating a significant inflammatory response.
Although minimal inflammation was present, this finding
10 could be representative of normal liver tissue.
A two-step perfusion procedure was employed with all
solutions maintained at 37C throughout the perfusion
procedure. The initial perfusion lasted 10 minutes using
l liter of Ca++, Mg++ -free Hanks Balanced salt solution
15 supplemented with lO mM HEPES (pH 7.4), 0.5 mM EDTA, and
lO0 ~g/ml gentamicin sulfate. The next perfusion was for
r 20 minutes at approximately 60 ml/min. of Williams Medium
` E (WME) supplemented with lO mM HEPES (pH 7.4), 100 ~g/ml
gentamicin sulfate, and 200 units/ml collagenase Type I
; 20 (300 units/mg, Sigma, St. Louis. M0).
The liver capsule from above was removed with fine
forceps and hepatocytes were dislodged by gentle agitation
- in 100 ml of the above collagenase solution. The hepato-
cyte suspension was filtered through several layers of
25 gauze pads into an equal volume of cold Williams Medium E
(WME) containing 5% fetal bovine serum (FBS), 10 mM HEPES
(pH 7.4), and 100 ~g/ml gentamicin sulfate. Hepatocytes
- were sedimented at 50 x g for 5 minutes and cell pellets
were resuspended in WME 5% FBS. Sedimentation was repeated
30 twice, pellets were resuspende~ in lO ~l WM~ 5~ FBS, and
viability and cell density were determined by trypan blue
exclusion.
. ~ .
- :.
.. ,; .. . . . . . . . . .. .. .. . . . .
- . ~ ... : . ~ . . ~ . . .
.. . . . . .. ,; ., . . . . .
WO9l/15574 PCT/US91/0~8
2979~7
B. Cell Culture Conditions
PRIMARIA plates ~Falcon, Becton-Dickinson, Lincoln
Park, NJ) were coated with rat tail collagen (Michalopou-
los) for 6 minutes at room temperature, the excess collagen
5 was removed, and plates were dried overnight under U.V.
light. Viable cells were plated at a density of 3-4 x 106
cells/60mm dish. Cell attachment occurred during a 3-hour
incubation at 37C, 10~ CO2 in WME, 5% FBS, at which time
cell monolayers were gently washed one time with WME and
10 re-fed with the serum-free medium formulation described
below. The medium was changed 24 hours after isolation and
at 48 hour intervals thereafter.
The cultured hepatocytes displayed a typical hepato-
cyte morphology as observed by phase-contrast microscopy on
15 day 5 of culture. This morphology was maintained until
days 21-28 when the cultures exhibited a degenerative
process.
In this and the other examples below, the serum-free
media (SFM) formulation utilized a basal medium supplement-
20 ed with 10 mM HEPES, pH i.4, 2.75 mg/ml NaHC03, and 50 ~g/mlgentamicin, together with the supplements as listed below.
In the described media of Table 2, Williams Medium E (WME)
served as a basal medium. Although WME is presently
preferred as the basal medium of the serum-free medium
25 other commercial media formulations can be expected to give
satisfactory results. For instance, a mixture of Dulbec-
co's modified Eagle's medium and Ham's Fl2 medium (Salas- -
; Prato) or RP~I 1640 (Gibco) (Enat, Sell should give
satisfactory results when supplemented with the supplements
30 llsted in Table 2.
'
`
: -, . . . ~ ~ . : : ~
-~09l/15574 PCT/US9t/02298
2 ~ 7 ~
Table 2
. SupplementMedium Concentration
EGF lO0 ng/ml
5 Insulin 10 ~g/ml
~lucagon 4 ~g/ml
BSA 0.5 mg/ml
Linoleic Acid5 ~g/ml
Hydrocortisone10~ M
10 Selenium lO~ M
: Cholera Toxin2 ng/ml
LGF 20 ng/ml
Transferrin5 ~g/ml
: Ethanolamine10~ M
: 15 ProlactinlO0 ng/ml
Somatotropin1 ~g/ml
TRF lO~ M
' To prepare the media, the supplements were added in
: 20 the following quantities in Table 2 to 500 ml of WME in a
; sterile plastic bottle:
5 ml 50 mg/ml BSA (bovine serum albumin), 500 ~g/ml
Linoleic Acid
25 0.5 ml 5 mg/ml Insulin
0.5 ml 5 mg/ml Insulin, 5 mg/ml Transferrin, and 5 ~g/ml : .
Selenium (ITS)
50 ~l 102 N Hydrocortisone
5 ~l 200 ~g/ml Cholera toxin -
, 30 0.5 ml 100 ~g/ml EGF (epidermal growth factor)
: 50 ~l 10-2 ~ Ethanolamine
0.5 ml 1 mg/ml Somatotropin
`
, i '., . . ~ . ! ~ . ' ' .
'' ' ' ", . . ~ ' , ~ " ; ' ' ' ' ' ~ `' ', " ,`; ' "' ' ' `, "" ; ' ' ' ' ', ' ' ' " ' ' '
~ '.' ' ' , .
~ ' `, ' ' '` . ;~i ' "` '' ' " ' ' "' '; ' ' '
. .
WO91~15574 PCT/US91/022~
2~7~77
26
50 ~l l mg/ml Prolactin
0.5 ml 10'3 M Thyrotropin Releasing Hormone
50 ~l 200 ~g/ml LGF (liver growth factor, i.e., glycyl-
histidyl-lysine)
5 l ml 2.0 mg/ml Glucagon
WNE was purchased with L-glutamine and without
NaHC03 from Hazelton Research Products, Inc. (Denver,
Pennsylvania). Supplements, including growth factors and
hormones were obtained from Sigma (St. Louis, M0) or
10 Collaborative Research (Bedford, MA).
C. Secretory Protein Production
The synthesis and secretion of albumin, apolipoprotein
A-I and apolipoprotein E were monitored by immunoblotting
15 of sequential aliquots of tissue culture medium, according
to standard methods (Haslow). Briefly, proteins were
separated by sodium dodecyl sulfate-polyacrylamide qel
electrophoresis (SDS-PAGE), and were electrophoretically
transferred to Nylon-X nitrocellulose filters (Fisher) at
20 lO0 mA current for 16 hours at 4C. Unoccupied binding
sites were blocked in 10% nonfat dry milk in phosphate
;~ buffered saline (PBS) for 2 hours at 37 C in PBS-milk-Tween
( PBS containing 5% nonfat dry milk, 0.3% Tween-20), using
r~ primary antibodies directed against each of the specific
25 proteins. Membranes were washed three times with PBS-Tween
and incubated l hour at 37C in PBS-milk-Tween with tl~I]-
protein A (8.5 ~Ci/~g, New En~land Nuclear, Boston, MA).
` Membranes were washed three times with PBS-Tween and air
dried. Immunoblots were autoradiographed at -85 C on XAR-5
30 film (Kodak, Rochester, N.Y.) with intensifying screens.
The levels of apolipoproteins A-I and E increased in
the cultures up to day 13, remained constant from day 13-
28, and declined from day 28-45. Albumin detected by this
.
, ~
., .
: - : ' - ~
- .. , . . .. ~ . : . . -
. . . .
W091/15~74 PCT/US91/02298
2~7~7
27
immunoblot procedure remained at constant levels throughout
the culture period. Although albumin is a marker for
differentiated hepatocytes, it is not as stringent of a
marker for the differentiated state as is lipoprotein
5 synthesis.
- The decline in lipoprotein synthesis after 28 days in
culture paralleled a degeneration in the hepatocyte
cultures. The degeneration of primary hepatocytes after 3-
4 weeks of culture was evid~nt in cultures derived form two
lO different HCV-infected chimpanzees. Normal hepatocyte
cultures generally survive more than lOO days in the serum
free media. It thus appears that the degenerative process
of HCV-infected primary hepatocytes may be due to viral
induced cytopathic effect.
To further characterize the differentiated state of
the hepatocytes in vitro, the de novo synthesis of liver
specific plasma proteins was analyzed. On day 17, cultures
were labeled for 24 hours with [35S] methionine (>800
~Ci/m~ol, ICN) for 24 hours. Medium was filtered and mixed
20 with l/lO volume of lOx CHAPS extraction buffer [final
concentration 1.0% CHAPS (CalBiochem), 0.25mM phenylmethyl
~ulfonyl fluoride, lOmM EDTA, 0.05 M Tris (pH 8.0), O.l M
NaCl, lOO ~M leupeptin] and incubated for l hour at 4 C
with agitation. Commercially obtained antibodies (CalBio-
25 chem, San Diego, CA and Boehringer Mannheim, Indianapolis,
~ IN) directed against human plasma proteins (20~1) were bound
i to protein A-agarose beads (50 ~ epligen) for l hour in
CHAPS extraction buffer on ice. The beads were washed two
times with detergent wash buffer [CHAPS extraction buffer
` 30 plus 1% deoxycholic acid and 0.1% SDS~ and were incubated
with the labeled medium overnight at 4C with agitation.
-. : . , . . - : . .
.: - .
. . . . . . .
~: ;, : . ~ :: .
WO9l/lSS74 PCT~US9l/02~
2~7~77
28
The beads were pelleted and washed three times with
detergent wash buffer~
Bound proteins from the culture medium were eluted
with 50 ~l electrophoresis sample buffer containing 2% SDS
5 and 2% 2-mercaptoethanol, heated at 100C ~or lO min. and
analyzed by SDS-PAGE. Gels were processed for fluorography
with Autofluor (National Diagnostics, Somerville, NJ),
dried, and autoradiographed at -85 C on XAR-5 film.
Analysis of the gel patterns indicates that the amount
10 of plasma proteins synthesized in vitro reflects the
concentrations found in plasma. The intensities of the
polypeptide bands in descending order were albumin, o-l
antitrypsin, plasminogen, fibrinogen, transferrin, apo A-I
`~ and E, beta-2 macro~lobulin, pre-albumin, apo A-II and A-
15 III, complement components C3, C4 and C5, C-reactive
protein, and apo C-2 and C-3. All markers examined were
detected with the exception of o-fetoprotein, which is a
marker for poorly differentiated hepatocytes.
:: -
Exam~e 2
HCV_Particles
A. Virus Particle Isolation
Infected primary hepatocyte cells from above were
grown on coverslips and analyzed at various times during
25 the culture period for the presence of a novel HCV virus-
associated antigen that can be detected by immunocytochemi-
cal staining (Burk). Typical cytoplasmic staining was
observed in all samples examined, with a tendency for the
percentage of cells expressing this marker to increase with
30 time in culture. ~owever, the number of cells with
definitive staining never increased above 10%.
.. ..
:. :
.. . ,. - ~ ,
-~WO91/1~574 PCT/US91/02298
~7~77
29
To examine the culture medium ~`or HCV particles,
culture media were collected on days 11 and 13 in cultured
hepatocytes from a second chimpanzee (PTTx174) which had
been infected in vivo by inoculation with acute phase
5 plasma from chimpanzee PTTx7.
A sample of culture medium was clarified by centrifu-
gation at 12,000 x g, 30 min. at 4C. The clarified medium
(23 ml) was layered over a discontinuous sucrose gradient
formed of 5 mls of 68~ sucrose in phosphate buffered saline
; 10 (PBS), and 10 ml of 20% sucrose. The layered material was
centrifuged at 27,000 rpm (131,000 x g) in a Beckman SW28
rotor for 3.8 hours. A 2 ml sample at the 68%/20% sucrose
interface was drawn off and diluted to a final sucrose
concentration of 20% with PBS. Several gradients (4-6)
15 were prepared from the media collected from each time
point.
The diluted material (12.5 ml) was layered over 1 ml
of the 68% sucrose solution and centrifuged at 30,000 rpm
.(154,000 x g) for 16 hours in a Beckman SW41 rotor. The
;20 interface material (at the top of the 68% sucrose layer)
was collected by bottom puncture, collecting 1-1.5 ml of
material. The isolated material, containing purified HCV
virus, was frozen at -85C.
'
25 ~. Morphology
`-Purified HCV virus specimens from above were examined
by a modification of the pseudoreplication technique
(Portnoy). Briefly, 10 ~l of virus-containing fluid was
pipetted onto agar disks (2% in 0.15~ NaCl, 0.01~ merthio-
30 late). The agar disk surfaces were covered with a Parlo-
dion film, 0.75% in amyl acetate (Mallinckrodt, Paris, KY).
The fil~ containing the HCV viral agent was floated onto a
,
.
' "1 '' ' , ' '
': ~ ' , " ,' ,', . .
, I ~ . .
' , ~ ~ ', ; '' ' ' ' . . '
WO91/15574 PCT/US91/02~-~
2~7~7
liquid surface in a 1~ phosphotungstie acid, pH 7.0, and
retrieved by immersio~ onto copper grids t3mm). After
drying, the specimens were examined by transmission
electron microscopy without further treatment.
sVirus particles were observed in the samples obtained
from the purified tissue culture medium. Figures 1-3 are
electron micrographs of the observed material. The
morphological features of the particles are described
above.
~.
Example 3
HCV Particles from Cultured Cells are Infectious
; The production of infectious virus in the hepatocyte
cultures was assayed by inoculation of a chimpanzee with
15 tissue culture medium and monitoring the animal for signs
of disease. Tissue culture medium as described above was
c~llected from PTTx7 hepatocyte cultures at two-day
inter~als, and passed through 0.45 ~ filters and stored at -
`` 100 C. A pool of media from days 3 through 31 were
20 collected (190 ml total) and concentrated by pressure
dialysis under N2 gas at 4C with an exclusion membrane of
30,000 MM (YM30, Amicon, Beverly, MA)). An 8-fold concen-
trate (22 ml) was stored at -100C until use. The concen-
trated material (10 ml) was used to inoculate an HBV-immune
25 chimpanzee (PTTx196).
Weekly blood samples and periodic liver needle
biopsies were obtained from PTTx196 for analysis. A slight
increase in ALT occurred durin~ week 4 and microscopic
exa~ination of a li~er needle biopsy at that time revealed
30 minimal changes similar to those observed in normal tissue,
but of interest under these conditions. Liver needle
biopsles t-ken during weeks 8 and 12 exhibited essentially
i;
,
~WOgl/15574 PCT/US91/02298
2~7~77
31
normal tissue with no microscopic lesions recognized. Due
to the delay in onset of clinical hepatitis, a second
injection of the same inoculum (7ml) was administered at
week 12. This was followed by an elevation in ALT values
5 three weeks later. Peak ALT was exhibited 16-20 weeks
after the first inoculation. Histologic examination of a
liver needle biopsy taken at week 14 showed early signs of
hepatitis, including foci of inflammatory cells in the
hepatic parenchyma, and hydropic generation of hepatocytes
10 with occasional necrotic hepatocytes. Electron microscopic
examination of the biopsy revealed the presence of cyto-
plasmic tubules which are typical of HCV-infected tissue.
Plasma samples taken from PTTx196 during weeks 0, 18
and 23 of this experi~ental HCY infection were analyzed for
- 15 an increase in antibody titer to cytomegalovirus, Epstein-
Barr virus, herpes simplex virus, HBV surface and core an-
tigens (B sAG, HBcAG), and spumavirus, since these agents
may cause hepatitis or could be transmitted by this
methodology. No change in the antibody response to these
20 agents was detected in the plasma samples from PTTx196.
` These results demonstrate that the disease transmitted to
PTTx196 was caused by an HCV agent.
~6 Example 4
Genori_~çgyence of the ~CV Particles
Chimpanzee PTTx198, an 8 year old male chimpanzee, had
been inoculated wit~ the Hutchinson strain of HCV virus
- used in Example 2. During the acute-phase of the infec-
, tion, a liver wedge was used to isolate hepatocytes, which
-s 30 were cultured as HCV-infected primary hepatocytes as
described in Example 1. The culture medium was used to
purify virus as detailed in Example 2. HCY particles, of
,
WO 91/15574 P(~/US91tO22qs~
2 ~ 7 ~ 7
32
the type seen in Figures 1-3 and reported in Example 2,
were observed.
A second portion of the biopsied liver from the HCV-
infected animal was used to isolate total RNA by the
S conventional guanidinium isothiocyanate extraction and
ultracentrifugation through a cesium chloride gradient
(Sambrook). The RNA was used for cDNA synthesis with a
specific hepatitis C virus (HVC) oligodeoxyribonucleotide
as a primer for reverse transcription. The primer for cDNA
10 synthesis was derived from a previously reported primer
(Kubo), and has the sequence:
(5'-GGAAGCTTGACATGCATGTCATGATGTA-3')
The primer includes 20 nucleotides of HCV specific
sequence and 8 nucleotides at its 5' end containing a
15 HindIII restriction site for subsequent cloning purposes.
The reverse transcription was performed as described
(Sambrook) in the presence of S ~g of RNA, 0.5 ug of 3'
primer, 2 units of reverse transcriptase (E. Anglian
Biotech, Cambridge, MA) in a 10 ~l reaction volume contain-
; 20 ing 50 mM Tris-HCL pH 8.2, 6mM MgCl2, 10 mM dithiothreitol (DTT) and 500 ~M of each of the four deoxyribonucleotide
triphosphates (dNTP).
After incubation ~or 40 minutes at 42C, 1 ~l of the
reaction mixture was added to a PCR reaction mixture
25 provided in a commercial PCR kit ~Perkin-Elmer/Cetus), as
described by the manufacturer. The above 3'-end primer and
a 5'-end primer having the se~uences
(5'-GGGAATTCGGCTATACCGGCGACTTCG-3')
which includes 20 nucleotides of HVC sequence (Kubo) and an
30 additional 8 nucleotides at its 5' end and an EcoR1 site,
were added to the reaction mixture. The PCR reaction was
allowed to proceed for 30 cycles.
: ::
,
- WO9l/15574 PCT/US91/02298
2S7~77
The 623 basepair cDNA fragment amplified by PCR was
visualized on an agarose gel by ethidium staining. This
fragment was gel purified and amplified again by 30 cycles
of PCR. The resulting DNA was gel purified, digested with
5 EcoR1 and HindIII and cloned into the EcoRI/HindIII site of
plasmid pGEMX1 (Promega, Madison, WI). The nucleotide
sequence was determined by dideoxy chain termination method
on double stranded DNA using the SP6 and T3 promoter
;~ primers (Promega).
Example 5
HCV Particles from In Vitro Infected Primarv Cells
In Example 2, HCV particles were obtained from primary
hepatocytes which were infected in vivo, i.e., prior to
15 culturing as primary hepatocytes. In the present example,
uninfected chimpanzee primary hepatocytes in culture were
infected with HCV in culture, and the virus was allowed to
replicate in the infected cells.
Liver wedge biopsies were obtained from healthy,
20 uninfected chimps identified as PTTx256, a 5 year old male
chimpanzee, and PTTx344, a 1 year old female chimpanzee.
The liver biopsies were used to produce primary cultured
hepatocytes, according to the methods detailed in Example
1. The cells were infected with a pool of acute phase
25 plasma from HCV-infected chimpanzees. The virus stock was
a pool of acute-phase plasma from HCY-infected chimpanzees.
The stock was diluted five-fold in SF~ and added to the
cultures. The cultures were incubated for 3 hr at 37C with
the inoculum, and then 1.5 ml of SFM was added to the
30 cultures and the incubation was continued for 16 hr. The
cultures were washed three times with WME to remove
residual inoculu~ and changed to SFM.
: , .
, :'' -' ' ' '.' ' ' ~ -~ . ', ' ' .'' ' ' ' ' ' "' ' ':
. . ~ ~ ., . - , . . .
, ~ . . . .. .. . . . .
WO9ltl5~74 PCT/US91/0229~
2 0 7 9 ~ 7 7
34
A sample of culture medium was taken at days 1, 2, 3,
6, 9, 12, 15, 18, and 21 for the PTTx266 animal, and at
days 1, 3, 5, 7, 9, and 12 for the PTTx344 animal. Virus
particles were isolated from culture medium by sucrose
5 gradient centrifugation, as detailed in Example 2. The
samples were examined by electron microscopy to determine
- viral counts. The results are shown in Table 1 above,
- expressed as virus particles per ml of culture medium.
The table also shows virus counts observed for culture
10 medium obtained at various times after initial culturing,
for cell cultures derived from liver cells of HCV-infected
chimpanzees, PTTx196, PTTx174, PTTx268, and PTTx198.
., .
Example 6
Im~orta~ized Uninfected Hepatocytes
Uninfected primary chimpanzee hepatocytes derived from
PTTx266 were cultured in SFM, substantially as described in
Example 1 for HCV-infected cells. The cells were immortal-
ized with a retrovirus derived from the U19-5 cell line
20 which constitutively produces the U19 amphoteric retrovi-
rus. The U19-5 cell line was a gift from Drs. P.S. Jat and
P.A. Sharp, M.I.T. (Cambridge, MA). The retrovirus
recombinant plasmid construct has been described in detail
(Jat). The plasmid construct produces a large T antigen
25 protein defective for binding to the SV40 origin of
replication.
- The U19-5 cell line was grown in DMEM medium with 10%
` fetal bovine serum (FBS) under standard culture conditions
; (Jat). Culture medium was collected at 24-hour intervals
30 and passed through a 0.45 ~m filter (Amicon, Beverly, CA))
;i prior to use for infection of primary hepatocyte cultures.
~:~
.
WO91~15574 PCT/US91/02298
2~ 7~ ~ 77
Subconfluent cultures of primary hepatocytes (Example
1) were infected one day post-plating by the addition of 1
ml of Ul9-5 culture medium to the cells in the presence of
PolybreneTM (8 ~g/ml). The plating density was such as to
5 allow the cells several rounds of cell division to occur
after introduction of the oncogene. After incubation
overnight, cells were washed three ti~es with WME and
maintained in SFM until colony outgrowths were observed,
typically about 1 month after infection.
The cells were selected for G418 (Geneticin, GIBC0,
Gaithersburg, MA) resistance by addition to the culture
medium of G418 (400 ~g/ml). The cells were then treated by
a collagenase/dispase (Boehringer Mannheim) solution at a
concentration of lO0 ~g/ml in phosphate-buffered saline
15 (PBS, pH7.2) for 10 minutes at 37C. Following dissocia-
tion, a five-fold excess of 5% fetal bovine serum in
Williams medium E (5~ FBS/WME) was added to the solution.
Cells were pelleted at 50 x g for six minutes, resuspended
` in a minimal volume of 5% FBS/WME and allowed to attach
20 during a 2-3 hour period at 37C under 10~ CO2. Ihe o~s
were plated at a low cell density so that single colony
outgrowths could be isolated and subcloned. From over 100
colonies, over 70 were picked based upon differences in
morphological appearance. The cell lines are designated
25 CHNP cells, and are assigned cell line numbers, such as
-` CHMP 1.21, CHMP 1.22, etc.
Example 7
HCV Infectivity_of Immortalized Hepatocytes
Immortalized chimpanzee hepatocytes derived from HCV-
infected primary hepatocytes were prepared substantially as
described in Example 6, but using hepatocytes obtained from
s
` .
.
~, . : . . - . ......
- : . : .
,, : .. . ~ -: : . .
. .
WO91/15574 PCT/US91/0229P
2 $ 7 ~ ~ 7 7
36
a liver biopsy of a chimpanzee (PTTx198) with acute-phase
HCV. The cell lines are designated CU cell lines.
Several CHMF~ (Example 6) and CU cell lines were
cultivated on collagen coated 25 fCm2 Primaria fla,~ks in SFM
5 under normal conditions (37C, 10% Co2 atmosphere). When
the cultures reached a level of 90S confluency, they were
inoculated with chimpanzee plasma known to contain HCV.
The inoculum was a pool of plasmas obtained from three
; chimpanzees (P~Tx7, PTTx268, and PTTx174) during the acute
10 phase of a HCV infection and did not contain any other
infectious agent. The plasmas were diluted 5-fold in SFM
and 1 ml was added to the cultures. After incubation for
~; 3 hr at 37C, another 3 ml of SFM was added to the cultures
and the incubation was continued for 16 hr. : The cultures
15 were washed three times with WME to remove the inoculum and
SFM was added. The medium was changed every other day and
on the 11th day after infection the cultures were harvested
'' for analysis.
20 B. RNA CharactP,rization
The cells were washed three times with phosphate
,i buffered saline (PBS) and the cellular RNA was extracted
'~ and purified using a standard GITC extraction procedure
';' (Chomozynski). The cells were lysed with a solution
~, 25 containing 4M guanidine isothiocyanate, 0.18~ 2- mercaptoe-
~,' thanol, and 0.5% sarcosyl. The cell lysate was extracted
several times with acidic phenol-chloroform- isoamyl
alcohol, and the RNA was precipitated wi~h isopropanol.
The purified RNA was resuspended in water and one tenth of
30 each sample was used for polymerase chain reaction (PCR)
amplification to detect the HCV RNA genome. ,
f '
, ~
.. : .
... . . .
W09l/15574 PCT/US91/02298
2~7~3~
37
PCR was conducted using standard methodology, as
detailed above (Innis). The first step involved a cDNA
reaction in which a DNA copy of the ~CV ~NA was made using
reverse transcriptase and an oligonucleotide primer
5 designated 6A that is complementary to the strain of HCV
used in our studies. The four primers used for cDNA and
PCR were derived from the putative nonstructural region of
HCV designated NS3 and their sequences are given below.
Primers:
10 5A 5' TCTGTGATAGACTGCAACACG 3'
6A 5' TTTGGTGATTGGGTGCGTCAG 3'
5B 5' GATGCTGTCTCCAGGACTCAA 3'
6B 5' AACAGCGCCCAGTCTGTATAGCAG 3'
The sequence of these primers was derived from the
15 sequence of a cDNA clone of a strain of HCV as previously
described (Jacob, 1991). A portion of the cDNA reaction
mixture (1/4th) was PCR amplified for 35 cycles using the
Taq polymerase and the oligonucleotide primers SA and 6A.
A portion of the first round of PCR (1/50th) was used for
20 a second round of PCR using the primers 5B and 6B.
Figure 5 shows a gel analysis of the PCR products from
HCV-infected CU cell lines. Figure 6 shows a gel analysis
of PCR products from HCV-infected CHMP cell lines. The
results of the gel studies are described above.
Although the invention has been described with respect
to particular cell lines and modes of HCV infection, it
will be apparent various changes and modifications can be
made without departing from the invention.
.- .. . .
'. .
