Note: Descriptions are shown in the official language in which they were submitted.
g~
The present invention relates to chelator sequences of
amino acids, to metals chelated by the chelator sequence, to
luminescent lanthanide3 chelated ~o the amino acid sequence and to
the use of the luminescent Lanthanide - amino acid complexes in
assays.
BACKGROUND OF THE INVENTION
_
In quantitative clinical chemistry, assays that are
ba3ed on the use of antibodies, to give selectivity, and radioiso-
topes, to give sensitivity, dominate. The procedure is known as
radio-immunoassay (RIA). However, there has been increasing
effort to eliminate the use of radioisotopes because of potential
health hazards in their use, expense of disposal, and limited
shelf-life of reagent~. In the search for rapid, sensitive, and
non radio-isotopic assay methods, the u~e of fluorescence based
procedures, i.e., fluorescent immunoassay (FIA), has become of
great interest.
The first fluorescence probes suffered seriou-q limita-
tions to sensitivity owing to interference from natural fluor-
eRcence from various compounds in biochemical samples such a~
blood serum. Filters have been used, but even then these fluores-
cence methods are not as ~ensitive as radio-immunoassays. The use
of pulsed-light source time-resolved fluorometers, as described in
Canadian Patent No. 1~082~106r has been applied to increase great-
ly the sensitivity of clinical diagno~tics so that the FIA method
2~
can compete with the RIA method. A review of fluoroimmunoassay
methods appears in a paper entitled "Immunoassays with Time -
Resolved Fluorescence Spectroscopy: Principle~ and Applications",
by E.P. Diamandis in Clinical Biochemi3try, Volume 21, pp. 134-
150, June 1988, and other immunoa say methods are the subject of
references listed at the end of the review.
In order to benefit from the inherent sensitivity of
time resolved principles, a f1uorescent label to substitu~e for
radioisotopes must be used. The luminescent lanthanides, for
example Europium, Terbium, Samarium and Dysprosium are of
interest, Terbium and Europium being of primary interest. These
have been used with organic chelates, for example EDTA based or
diXetone ligands.
Many organic chelators of luminescent lanthanides have
been synthe~ized; see for example U.S. Patent Nos. 4,374,120;
4,637,988 and 4,772,563. These chelators were based on oxygen
atoms or nitrogen atoms or both as donor atoms and are, for exam-
ple, diketonec or dicarboxylates. Some chelating agents enhance
the emission of the lanthanides by energy transfer ~rom the
organic portion of the chelating ayent following irradiation by a
light ~ource, for example UV lamp or laser. Whether enhancement
occurs depends upo~ the overlap of the fluorescence and/or
phosphorescence spectrum of the organic chelating agent, or
chromophore, and the absorption spectrum of the lanthanide, i.e.,
whether Forster Resonance Energy Transfer or Dexter exchange can
take place between the chromophore and the lanthanide. Hence,
ideally, a particular chromophoric chelating agent should be
selected ~or a particular lanthanide.
-- 2
2~ 7 1~
Various disadvantages accompany use of the diketone and
dicarboxylate chelating agents. For instance, all lanthanide~ can
have a coordination number up to 9, but more usually have a co~
ordination number of 6 or 8, i.e., the lanthanide will, theoreti-
cally, bind to three or four bidentate chelating agents, respect-
ively. Many of the chelating agents are bidentate so that to
chelate fully an ion with a coordination number of 6 three mole-
cules of bidentate chelating agent would be required to bind to
the ion. With bidentate ligands this rarely happens; usually only
one or two molecules of chelating agent bind to the ion. This has
two di~advantages. The strength of the attachment between the
central atom and the chelating agent, i.e., the affinity constant,
is less than it would be if all coordination Rites were occupied
by the -~ame chelating agent, and hence the sensitivity as a ~robe
in FIA is less. The coordination sites not occupied by chelating
agent are frequently occupied by water. Water has a quenching
effect on luminescence, which again reduces sensitivity.
SUMMARY OF THE INVENTION
In one aspect, the present invention provide~ a chelator
sequence selected from the group consisting of ~equences of twelve
amino acids containing the following amino acids:
SEQ ID ~O:l:
Asx Xaa Asx Xaa Asx Xaa Xaa Xaa Glx Xaa Glx Glx
1 5 10
and sequences of the said amino acids in which one or more of the
said amino acids is bonded to a chromophore.
This amino acid sequence can also be expressed, using
the one letter notation for amino acid sequences proposed by
IUPAC-IUB~ as follows:
B X B X B X X X Z X Z Z
1 5 10
The number indicates the residue number in the chelator
sequence. Residues 1, 3, 5, 9, 11 and 12 are residues that can
donate electrons to the chelated metal ion.
In another aspect, the invention provides a complex
comprising a luminescent lanthanide and a chelator ~equence selec-
ted from the group consi~ting of sequences of twelve amino acid
containing the following acidR:
SEQ ID NO:2:
Asx Xaa Asx Xaa Asx Xaa Xaa Xaa Glx Xaa Xaa Glx
and sequences of the said amino acid~ in which one or more of the
said amino acids is bonded to a chromophore.
This sequence can be expressed in ~ingle letter notation
as follow~:
B X B X B X X X Z X X Z
1 5 10
It is preferred that in this complex position 11 of the
amino acid 3equence is occupied by Asx.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
The following Table 1 lists amino acids and the corres-
ponding one letter symbol~ and three letter symbols proposed to
IUPAC-IUB.
r
Table I
= ~ . . .. ~ .. _ _ . _, _ _ _ ,
One-Letter Three-Letter
~ymbo1 symbol Amino acid
~ _ _ _ _ . . . _ _
A Ala Alanine
B Asx Aspartic acid or asparagine
C Cys Cysteine
D Asp A~partic acid
E Glu Glutamic acid
F Phe Phenylalanine
G Gly Glycine
H His Histidine
I Ile Isole~cine
~ Lys Lysine
L Leu Leucine
M Met Methionine
N Asn Asparagine
P Pro Proline
Q Gln Glutamine
~ Arg Arginine
S Ser Serine
T Thr Threonine
V Val Valine
W Trp Tryptophan
X Xaa Unknown or "other"
Y Tyr Tyrosine
Z Glx Glutamic acid or glutamine
In one preferred embodiment of the invention the
chelator sequence i8 as follows:
SEQ ID NO:15:
A~p Xaa Asn Xaa Asp Xaa Xaa Xaa Glu Xaa Glu Glu
In a more preferred embodiment the chelator ~equence is
as ~ollows:
SEQ ID ~0:16:
ABP Xaa Asn Xaa Asp Xaa Trp Xaa Glu Xaa Glu Glu
1 5 10
A preferred complex comprises a luminescent lanthanide
and a chelator sequence as follows:
~C~ r ~
SEQ ID NO:17:
Asx Xaa Asx Xaa Asx Xaa Xaa Xaa Glx Xaa Xaa Glx
1 5 10
In a more preferred complex the chelator sequence i~ as
follows:
SEQ ID NO:18:
Asx Xaa Asx Xaa Asx Xaa Xaa Xaa Glx Xaa Glx Glx
wherein Xaa in the 7-position is Trp, Tyr or Phe or a derivative
of Trp, Tyr or Phe, or Cys derivatized by a chromophore.
In another embodiment the complex comprises a chelator
sequence as follows:
SEQ ID NO:l9:
Asp Xaa Asn Xaa Asp Xaa Trp Xaa Glu Xaa Xaa Glu
Examples of specific preferred chelator sequences of
amino acids in accordance with the invention include the follow-
ing:
SEQ ID NO:3:
Asp Lys Asn Ala Asp Gly Trp Ile Glu Phe Glu Glu
SEQ ID NO:4:
Asp Lys Asn Ala Asp Trp Gly Ile Glu Phe Glu Glu
1 ' 5 10
SEQ ID NO:5:
A~p Lys Asn Ala Asp Ala Trp Ile Glu Phe Glu Glu
SEQ ID NO:6:
Asp Lys Asn Ala Asp Gly Trp Ile Glu Trp Glu Glu
1 5 10
SEQ ID NO:7:
Asp Lys Asn Ala Asp Ala Trp Ile Glu Trp Glu Glu
1 5 1~
~ J~
. SEQ ID N0:8:
Asp Lys Asn Ala Asp Trp Gly Ile Glu Trp Glu Glu
1 5 10
SEQ ID N0:9:
Gly Asp Lys Asn Gly Asp Gly Trp Ile Glu Phe Glu Glu Leu
1 5 10
SEQ ID N0:10:
Gly Asp Lys Asn Gly Asp Gly Tyr Ile Glu Phe Çlu Glu Leu
1 5 . 10
SEQ ID N0~
Gly Asp Lys Asn Gly Asp Gly Phe Ile Glu Tyr Glu Glu Leu
1 5 10
SE9 ID No. 12
Gly Asp Lys Asn Gly Asp Gly Tyr Ile Glu Trp Glu Glu Leu
1 5 10
SEQ ID ~0:22:
Asp Lys A-~n Ala Asp Gly Cy8 rle Glu Phe Glu Glu
SEQ ID N0:20:
Gly Asp Lys Asn Ala Asp Gly Cys Ile Glu Phe Glu Glu Leu
SEQ ID N0:21:
Ser Leu Val Ala Leu Asp Asn Asn Ala Asp Gly Cys Ile Glu Phe
1 5 10
Glu Glu Leu Ala Thr Leu Val Ser
The sequence of twelve amino acids constitutes one mole-
cule, or portion of a molecuLe, that can satisfy all the coordina-
tion sites of an ion that has a coordination number of 6, 7, 8 or
9 i.e. the chelator sequence forms a hexadentate to nonadentate
ligand. Particularly when the amino acid sequence is part of a
large peptide chain, as di~cussed below, the amino acid sequence
and the ion are strongly bound; affinity constants greater than
lOg and sometimes greater than 1011 are obtained. ~urthermore, as
S~ ~
more coordination sites of the ion are occupied less water binds
to the metal and water quenching of luminescence is reduced.
Water quenching can sometimes be reduced further by use of a
detergent molecule which displaces water in the coordinating cage
around the metal atom. A suitable detergent for this purpose is
tri-n-octylphosphine oxide, known as TOPO.
The amino acids not specified in the chelator sequence,
i.e. those in the 2, 4, 6, 7, 8 and 10 positions are selected with
regard to the likelihood that a particular amino acid will assist
in binding, or at least will not interfere with binding. For
instance proline may prevent the amino acid sequence from adopting
the conformation neceRsary for chelating, so use of proline is not
preerred. If too many negatively charged atoms are present in
the chelator sequence electrostatic repulsion may affect the bind-
ing affinity, so the chelator sequence should not contain too many
aspartic or glutamic acid moieties, or should be balanced by
lysine arginine or histidine moieties.
If the chelator sequence i8 to be used with a lumin-
escent lanthanide in, for example, FIA, then the unspecified amino
acids can also be selected with regard to the desired luminescence
effect. To enhance luminescence it is desirable to include in the
chelator sequence an amino acid that includes an aromatic ring.
The order of preference of such acids i~ tryptophan, then tyrosine
and then phenylalanine. For instance tryptophan is a chromophore
whose luminescence 4pectrum overlaps with the absorption spectrum
of Terbium. Therefore energy transfer from tryptophan to Terbium
occurs and enhanced luminiscence of Terbium is observed. Conse-
quently if Terbium is the lanthanide being used tryptophan is to
be preferred to, say, tyro~ine, as an amino acid to occupy un-
specified positions. When luminescence i8 required it is prefer-
red that tryptophan occupies position 7 of the 12 amino acid
sequence.
The amino acids that occupy the unspecified positions
will normally be selected from those amino acids that appear in
naturally occurring peptides or protein~. It is possible to use
other closely related amino acids, however. Amino acids that
differ from tho~e that occur in nature by replacement of a ring
methine group by a nitrogen atom, by replacement of a hydroxy
group by an alkoxy group, by insertion of an alkyl group in place
of a hydrogen atom attached to a basic nitrogen atom or by inser-
tion of an alkoxy group or a halogen atom, preferably a fluorine
atom, in place of a hydrogen atom on an aromatic ring, can be
used. Mention i8 made, for example, of 7-azatryptophan, 5-
methoxytryptophan, 4-fluorotryptophan and 4-methoxytyro ine.
The chelator sequence of twelve amino acids can be used
alone but it i9 preferred that the sequence forms part of a larger
molecule. There is known a family, defined by genetic lineage, of
high affinity metal-binding proteins which includes the much
studied calcium binding proteins calmodulin, troponin C, parval-
bumin, calbindin 9K and oncomodulin. These proteins contain one
or more sites, usually two to four sites, which are loops of amino
acids situated between alpha-helices. The loops usually bind
strongly to calcium. For instance parvalbumin has two calcium
binding -~ites and calmodulin has four calcium binding sites per
molecule. Oncomodulin has three loops known a~ the AB, CD and EF
loop~. Of these the CD and EF loops bind calcium strongly, but
the AB loop does not. It is believed that the AB loop at one
time had the ability to bind calcium but for some reason that
ability has been lost.
These calcium binding proteins will bind Terbium (III)
and other luminescent lanthanides with affinity constants up to
103 or more times greater than they bind calcium. In preferred
embodiments of the invention amino acids of a loop of a c~lcium
binding site in a calcium-binding protein are replaced by a
chelator sequence of twelve amino acids in accordance with the
present invention. For instance oncomodulin has the CD calcium
binding site between amino acids 50 and 63 and the EF site between
amino acids 89 and 102. It i5 preferred to replace the amino
acids of one or both of these sites by a chelator sequence of
amino acids in accordance with the invention. Another site in
oncomodulin which is preferred for substitution by a chelator
sequence of the present invention i8 that of the A~ loop between
amino acids lS and 28.
Some of the amino acids of the sequence of the invention
will be present in the loops in the calcium binding sites of the
naturally occuring binding protein and others will not be pre3ent,
but will have to be inserted in place of other amino acids that,
in nature, occur at that particular poqition. The number of amino
acid~ inserted should equal the number of amino acids removed, so
that the general conformation at the binding ~ite, i.e. a loop
flanked by alpha-helices, is maintained. Although it may not be
necessary to replace all twelve amino acid~ in a loop to obtain a
sequence in accordance with the invention, for the sake of sim-
plicity of description and definition reference will be made to
-- 1 0
~" ~ J ~
replacing naturally occuring 12 amino acid sequence by 12 amino
acid sequences of the invention.
The chelator sequence of amino acids can be used as such
or as part of a larger molecule, as indicated above. As it is
composed of amino acids it can readily be attached to a protein by
well known methods and then chelated with a luminescent lantha-
nide, to provide a fluorescent marked protein. For instance, at
the one end of the amino acid sequence there will be an amino
nitrogen atom and at the other end of the equence there will be a
carboxyl group. These can be used to bind to other molecules.
Some amino acids contain functional groups which can be used to
crosslink the amino acid sequence to the other mo]ecules. For
example lysine can crosslink via an amino group, cysteine can
crosslink via a sulphur atom, serine can crosslink via a hydroxy
group and the dicarboxylic amino acids can crosslink via the
carboxyl group of the ~ide chain. If necessary an amino acid able
to croYslink can be attached at the N-end or the C-end of the 12
amino acid sequence.
In addition to the calcium binding proteins mentioned
above, other proteins can be modified, by chemical synthesis or by
genetic engineering, to incorporate a chelator ~equence of amino
acids in the molecule.
The chelator sequence of twelve amino acid-~ can be made
by chemical synthesis or by genetic engineering. When the twelve
amino acid chelator sequence constitutes the whole or a major part
of the molecule the method of chemical ~ynthesis is preferred.
This method may also be preferred when the sequence i5 to be
attached to the end of a peptide chain, for instance when attached
$~ 7 ~
as a marker to a hormone, an antibody or a tumour marker. When
the sequence is to be incorporated at one or more intermediate
points of a peptide or protein then genetic engineering may be the
preferred method. Expression systems, for example bacterial and
yeast expression systems, for at least 30me of these proteins are
known and mutant proteins having amino acids selectively exchanged
can be obtained by site directed mutagenesis.
Luminescent complexes of the invention can be used as
markers or probes in various assay methods to detect the presence
of, for example, antibodies, antigens, hormone~, en~ymes, carbo-
hydrates, DNA ~equences, etc and even lanthanides themselves.
Thus the assay method can involve forming a complex or chelate of
the amino acid sequence of the invention and a luminescent lan-
thanide, and o~erving the fluorescence of the complex formed.
The analyte can be the amino acid sequence it~elf, it can be a
molecule bound to the amino acid sequence or to a molecule con-
taining the amino acid sequence or it can be the luminescent
lanthanide itself. The detection can be qualitative or quantita-
tive. When the chelator sequence of twelve amino acid~ form the
total molecule the affinity for the lanthanide is usually lower
than when the chelator sequence i9 part of a longer peptide or
protein chain. Complexes with low affinity can be used for
qualitative determinations but complexes with high affinity are
preferred for quantitative determinations. One assay method is a
sandwich assay method in which an antibody i9 immobilised, for
instance by binding to a glass surface, or the like. Antigen,
whose presence is to be detected, is passed over the surface and
binds to the immobilised antibody. Thereafter a further antibody,
2t~ ,7~
which is ?abelled by being attached to a fluorescent complex of
the invention, is passed over the ~urface. The further labelled
antibody binds to the bound antigen~ ExcesA labell0d antibody is
washed away. Thereafter the fluorescence spectrum of the material
bound to the glass surface i~ obRerved and this serves as a quali-
tative or quantitative indicator of the presence of the antigen.
The chelator sequences of the invention can readily be
chelated to metals such as the lanthanides by known methods. It
is usually desirable to chelate at a p~ below 7 and if a buffer is
to be used it is preferred that it contain nitrogen atoms in
preference to oxygen atoms; a preferred buffer is piperazine-N,N'-
bis~2-ethane-~ulfonic acid], known as PIPE5. The ionic ~trength
should not be too high, preferably not greater than about 0.1 M.
Although the chelator amino acid sequences of the inven-
tion are particularly u~eful for chelating luminescent lanthanides
for use as probes or markerY for fluorescence immunoassays, they
can be used to chelate metals other than luminescent lanthanides
and they can be used in a~ays other than fluorescence immuno-
a~says. For example, they can be used to bind calcium. It is
possible to immobilise a chelator aequence of amino acids, or a
peptide containing a chelator sequence of amino acids, on a suit
able substrate such a~ polyacrylamide beads. If a solution
containing calcium is pas~ed over these beads the calcium ions
will be chelated by the amino acids and im bilised with them, so
that the ~olution is freed of calcium.
The chelator sequence can also be uYed to assay for
lanthanides. Terbium displays luminescence but a large quantity
%f.~. g~
of Terbium is normally required, only a low luminescence effect is
observed even at Terbium concentrations as high as 0.25 M. As i8
demonstrated in an example below, addition of a particular
chelator sequence of the invention (having ability to enhance
luminescence of Terbium) to a solution of Terbium resulted in
Terbium being detected at a concentration of 7xlO-1 mM.
The chelator sequence of the invention differs in effect
from the calcium-binding loops found in nature. The naturally
occurring loops can both bind and release calcium ions and after a
calcium ion has been released by a naturally occurring loop the
loop is available again to bind a calcium ion. The naturally
occurring loop can be switched from calcium binding to calcium
releasing. In contrast, the amino acid ~equences of the invention
do not readily release bound calcium ions; to release the calcium
ions it is necessary to change the conformation of the sequence by
protein denaturation for example by heat, acidification, alkalini-
sation, high salt concentration, etc.
The chelator sequence of the invention or a luminescent
complex of the invention can be attached to other compounds of
interest such as avidin or thyroglobulin, and used, for example,
in amplification systems usin~ biotin.
The chelator sequence or the luminescent complex can
also be bound to a molecule containing another active site for use
in assays. For instance a complex of Terbium and an amino acid
sequence of the invention may be bound as part of a molecule that
also contains e.g. Europium bound to an organic non-proteinaceous
chelating agent. With such a reactant it is possible to conduct
C~ J i 9i l7
one test to detect two analytes.
In one embodiment of the invention an amino acid of th~
twelve amino acid sequence is covalently bonded to a chromophore.
If the chelator sequence is then used to chelate a fluorescent
metal there can occur energy trans~er from the chromophore to the
metal, to enhance luminescence.
The amino acids of the twelve amino acid sequence that
chelate directly to a metal atom are the acids that occupy posi-
tions 1, 3, 5, 7, 9 and 12 of the 3equence. It is desirable that
the chromophore shall be as closed to the ~etal as possible, to
facilitate energy transfer, so it i9 preferred that a chromophore
i8 covalently bonded to one or more of the acids in these posi-
tions. A chelator sequence having a chromophore attached to one
or more of the positions 2, 4, 6, 8, 10 and 11 is still within the
scope of the invention, however.
The invention requires that positions 1, 3 and 5 shall
be occupied by aspartic acid or asparagine. These compounds have
side chains containing a carboxyl group or an amide group,
respectively. When these chelate, an electron pair from the
carbonyl oxygen atom of the side chain is used to ~orm the chelat-
ing bond to the metal atom. The invention requires that positions
9 and 12 shall be occupied by glutamic acid or glutamine, which
again have side chain~ containing a carboxyl group or an amide
group, respectively. When these chelate, it is again an electron
pair from the carbonyl oxygen atom of the ~ide chain that is used
to form the chelating bond~ In order to locate a chromophore
close to the metal, it is preferred to use in position 1, 3 or 5
2 ~` ~3 sç~ 7 r~ ~
aspartic acid or asparagine in which the OH group or the NH2 group
respectively, has been replaced by a chromophore. Alternatively
or additionally, there may be used in position 9 or 11 glutamic
acid or glutamine in which the OH group or the ~H2 group has been
replaced by a chromophore. The chromophore is thus attached to
the carbon atom of the carbonyl group whose oxygen atom is supply-
ing the electron pair of the chelating bond.
Suitable chromophores for attachment to the carbonyl
group of the side chain of aspartic acid, asparagine, glutamic
acid or glutamine include derivatives of pyrene coumarin ~alicylic
acid, benzophenone and dimaleimidylstilbene and the like. Such
compounds are known to persons 3killed in the art. Sequences
containing chromophores can be prepared by well known methods of
peptide synthesis, using in place of one or more of the aspartic
or glutamic moieties a chromophoric derivative of the aspartic or
glutamic moiety. These synthetic methods permit the location of
the chromophore-bearing acid at a selected position or positions
in the sequence.
Chromphore-bearing aspartic derivatives for use in posi-
tion 1, 3 or 5 of the sequence, and chromophore-bearing gLutamic
derivatives for use in position 9 or 12 can be obtained by a
condensation reaction between a chromophore and the ~ide chain of
the aspartic acid, asparagine, glutamic acid or glutamine. The
chromophore ~oiety will contain one or more aromatic rings, usual-
ly fused together, for example naphthalene, anthracene, phenan-
threne, pyrene or coumarin moieties. Attached to the aromatic
ring will be a functional group that can react with the amino acid
) r.~
ide chai~ to form, for instance, an ester or amide. E~amples of
compounds that can be condenRed with the aspartic acid, aspargine,
glutamic acid or glutamine include N~ pyrenyl)-hydroxyactamide,
~-(l-pyrenyl)-amino-acetamide, 7-diethylamino-3-~(4'-hydroxy-
acetylamino)-phenyl-4-methylcoumarin, 7-diethylamino-3~((4'-amino-
acetylamino)-phenyl-4-methylcoumarin, hydroxyacetamidosalicylic
acid, aminoacetamidosalicylic acid, l-pyrenemethyl hydroxyacetate,
l-pyrenemethyl aminoacetate, benzophenone-4-hydroxyacetamide and
benzophenone-4-aminoacetamide.
The acids that occupy the 2, 4, 6, 7, 8, 10 and 11 posi-
tion-q are not limited to aspartic acid, asparagine glutamic acid
and glutamine. The acids in these positions can be bonded to a
chromophore, bonding at po~ition 7 being preferred. The amino
acid to which the chromophore is bonded should contain an extra
functional group, in addition to the carboxyl group and the amino
group of the amino acid. This extra functional group is used to
bond covalently the chromophore to the amino acid. Acidq that can
be used include cysteine, lysine, methionine, threonine and
arginine, of which cysteine in position 7 is preferred.
So that there i~ ~peci~icity in the polnt of attachment
of the chromophore, it i~ desirable that the amino acid appears
only once, at the desired position, in the chelator sequence.
If cysteine is present only in the 7-position then a chromophore
that reacts selectively with cysteine will attach only at the
7 -pO8 i tion.
By way of example, there is described the obtaining of a
pro~ein including a twelve amino acid chelator sequence of the
- 17 -
~ f~ 3 ~
invention, in which position 7 is occupied by cysteine bonded to a
chromophore. By cassette mutagenesis a protein is modified to
replace a naturally occurring twelve amino acid equence of the
invention that has cysteine at position 7. The obtained, modified
protein is then reacted with a chromophore that will bond only to
cysteine. There is therefore obtained a protein that includes a
twelve amino acid ~equence of the invention having a chromophore
bonded to cysteine at position 7 of the twelve amino acid
sequence. To achieve ~pecificity of attachment of the chromo-
phore, it may be neces~ary or desirable to remove an amino acid
that appears in the protein outside the twelve amino acid sequence
and to replace it by an amino acid that i9 non-rsactive with the
chosen chromophore. For instance, oncomodulin has a cysteine
moiety at position 18. When the CD loop of oncomodulin was re-
placed by a twelve amino acid sequence of the invention having
cysteine at po~ition 7 of the sequence, as described in Example XI
below, the cysteine at position 18 of oncomodulin was replaced by
valine. Consequently there was in the obtained protein only one
cysteine moiety.
Chromophores that can react with cysteine, or other
mercapto-containing amino acids, include N-(l-pyrenyl)-iodoacet-
amide (PIA), 7-diethylamino-3-((4'-iodoacetylamino)-phenyl)-4-
methylcoumarin ~DCIA), iodoacetamido~alicylic acid (IASA), 1-
pyrenemethyl iodoacetate (PMIA), 4,4'-dimaleimidylstilbene (DIMS)
and benzophenone-4-iodoacetamide (~PIA). An iodine-containing
chromophore can be reacted in known manner with the mercapto-
containing amino acid in aqueous solution at a slightly alkaline
- 18 -
7 ~ !J',~
pH, about pll 8. The solution can be buffered, for example with a
buffer composed of 150 mM KCl and 10 mM Tris. A condensation
reaction takes place between the iodine-containing chromophore and
the acid. The reaction is illu~trated with reference to N-(l-
pyrenyl)iodoacetamide and cysteine, a follows:
[ ~ NH-C-CH2-I +HSCH2CHCOOH
\
1~1 `/
~ NH-C-CH2-S-CH2-CHCOOH + HI
W
Cysteine will react under -~imilar conditions with the
maleic double bond of dimaleimidylstilbene by adding to the double
bond, resulting in formation of a covalent bond between the sulfur
atom and a carbon atom of the double bond.
Chromophores for attachment to the chelator sequence can
be considered to be composed of a chromophoric moiety and a linker
moiety. When the chromophore is to be linked with a mercapto
group, as with cysteine, a preferred linker moiety contains an
iodoacetyl group that reacts as described above. If the chromo-
phore is to be attached to a functional group other than a mercap-
to group the linker moiety will be different. For instance, for
attachment to an amino group as with lysine or arginine,
-- 19 --
% ~ i 7 ~ ~
an i othiQcyanate, succinimide or sulfonyl halide linker moiety
can be used. For attachment to a hydroxy group as with serine or
threonine, an acyl nitrile or acyl azide linker moiety can be
used. Chromophores composed of a chromophoric moiety and such
linker moieties are known and are commercially available from, for
instance, Molecular Probes, Inc. of Eugene, Oregon, USA.
It has been ~ound, and is demonstrated below, that bind-
ing of both Tb3+ and Eu3+ to a PIA-14mer of the invention results
in significant enhancement of luminescence. Similarly, Eu3+
luminescence i8 enhanced by a DCIA-14mer of the invention.
A preferred chelator sequence i8 a 23mer of following
structure:
SEQ ID NO:21:
Ser Leu Val Ala Leu Asp Asn Asn Ala Asp Gly Cys Ile Glu Phe
1 5 10
Glu Glu Leu Ala Thr Leu Val Ser
In this sequence, the twelve membered chelator sequence is ~lanked
by two stretches of residues that have a tendency to alpha-helix
formation, modelling the naturally ocurring helix-loop-helix motif
in oncomodulin. This sequence was covalently bonded to DCIA,
chelated with Eu3+ and luminescence was measured. A l~mer
sequence was covalently bonded to DCIA, chelated with Eu3+ and
luminescence was mea~ured. It was found that the 23mer gave a
greater enhancement of luminescence, suggesting that the short
alpha-helical portions played a stabilizing role in binding the
lanthanide.
Another preferred sequence of the invention is a twelve
- 20 -
chelator sequence inserted, by cassette mutagenesis, into onco-
modulin in place of the naturally occurring CD loop. This
sequence is as follows:
SEQ ID NO:22:
Asp Lys Asn Ala Asp Gly Cyq Ile Glu Phe Glu Glu
1 5 10
Oncomodulin modified to contain this ~equence in place of the
natural CD loop i8 referred to aY construct 3. It was found that,
with DCIA construct 3, Eu3+ could be detected at a concentration
as low as 10-1 moles/litre. Filling of both metal binding site~
of the modified oncomodulin by Eu3+ could be detected.
Construct 3 was also covalently bonded to the chromo-
phore IASA, and found to enhance Tb3+ luminescence. Again, fil-
ling o~ two metal binding ~ites could be detected. Using a fixed
concentration of Tb3+(2 M), 10-1OM of IASA-con~truct 3 could be
detected.
The invention i9 further illu~trated in the following
examples and accompanying figures. Example I uses chelator
~equences made by chemical synthesis and Examples II to VI use
sequences made by genetic engineering of oncomodulin and show
procedures used to produce oncomodulin and to produce modified
oncomodulin~, parbicularly oncomodulin which has been modified to
replace the natural amino acid sequence rom 51 to 62 of oncomodu-
lin by the sequence identified above as SEQ ID NO:3 to form a
modified oncomodulin (hereafter Conqtruct I), in accordance with
the invention.
Reference is made to drawing~, of which:
Figure 1 is a purity profile of a peptide (by reverse
2f~3~J~7 ~
phase chromatography on a PepRPC HR5/5 Pharmacia column);
Figures 2a, b, c and d repre~ent the fluorescence spec-
tra of peptide of Example I when measured in the presence and
absence of exces~ Terbium,
Figure 3 illustrates the strategy in constructing a
plasmid for expression of oncomodulin,
Figure 4 illustrates the nucleotide equence of the
junction between the TAC promoter and the oncomodulin sequence of
a new plasmid;
Figure 5 illustrates the correct plasmid sequence for
expre3sion of oncomodulin mutant Glu 59. The DNA sequence of the
mutant Glu 59 and the native Asp 59 is shown where the native
sequence for the 59th amino acid has been altered from GAT to
GAG;
Figure 6 illustrates the W spectra of bacterially
expre~sed oncomodulin and oncomodulin from rat hepatoma;
Figure 7 demonstrates the antigenic cross-reactivity of
the bacterially expressed oncomodulin and that of oncomodulin from
rat hepatoma
Figure 8 illustrates the fluorescence excitation spec-
trum of apo native Glu 59 bacterially expressed oncomodulin and
its response to the addition of calcium;
Figure 9 shows the EcoRV to Sst I fragment of plasmid
pGEM-TAC-ONCO and of pla~mid pGEM-TAC-ONCO-CI;
Figures 10 and 11 are graphs, on different scales,
illu-~trating the fluorescence at 545 nm of complexes of Terbium
bound to oncomodulin and to oncomodulin mutants, particularly an
- 22 -
C~ 7 ~ ~
oncomodulin modified to contain (Construct I) between amino acids
50 and 63 of native oncomodulin,
Figure 12 iq a graph howing the fluorescence of tyro-
sine when the tyrosine is part of an amino acid sequence bound to
Terbium;
Figure 13 is a graph showing the fluorescence of trypto-
phan when the tryptophan i5 part of an amino acid ~equence bcund
to Terbium:
Figure 14 is a graph showing relative fluorescence
intensity at different concentrations of Terbium bound to oncomod-
ulin modified in accordance with the invention (Construct I); and
Figure 15 ~hows the elution profile of the Trp 57 onco-
modulin on a Sephadex G50 column.
Figures 16A and 16B are graphs showing the effect of
addition of Tb3+ (squares) or Eu3+ (triangles) to a PIA-14mer on
the luminescence of added lanthanide.
Figure 17 i3 a graph showing the effect of different
metal ions on light Qcattering from a PIA-14mer, using Tb3+ (tri-
angles), Eu3~ (circles) and Ca2+ (squares).
Figure~ 18A and 18~ are graphs showing the effect of
Eu3+ addition to a DCIA-14mer on Eu3+ Luminescence.
Figur~ 19 i8 a graph ~howing the effect on Eu3+ lumines-
cence of Eu3~ addition to DCIA-14mer (open triangles) or DCIA-
23mer (~illed triangleq).
Figure 20 is a graph showing Eu3+ luminescence measured
after addition at various concentrations to 200~L 1.5~M DCIA-
construct 3 in 150 mM KCl, lO~M PIPES, pH 7Ø
~ ~ 7, ~ 3
Figure 21 is a graph showing the effect on Eu3~ lumines-
cence of Eu3+ addition (lO~M stock) to DCIA-construct 3 (l~M) in
200~L of l50mM KCl, 101D~S PIPES, pH 7 . 0.
Figure 22 is a graph showing the effect on Tb3~ lumines-
cence of Tb3~ addition (lO~M stock) to IASA-construct 3 (l~M3 in
200~L of 150mM KCl, lOmM PIPES, pH 7Ø
Figure 23 i8 a graph ~howing the effect on Tb3+ lumines-
cence of holding ~Tb3+] = 2~M and varying level of IASA-construct
3 in 200~L of 150mM KCl, lOmM PIPES, pH 7Ø
Example I:
This example reports studies with peptides similar to
the Construct I binding loop and the CD binding loop of oncomod-
ulin and demonqtrates binding efficiency of the Contruct 1
sequence and preference of the aromatic amino acid position for
efficient Re~onance Energy Transfer.
Six peptide of 14 amino acid~ were prepared by ynthe-
tic methods. Of these, peptide~ 2 to 5 (see below) are similar to
Con~truct I. Peptides 6 and 7 are not similar to Construct I, but
they do demonstrate the effect of an aromatic amino acid at posi-
tion 7.
The protected peptide resins were aynthesized u~ing a
p-methyl-benzhydrylamine resin (100-200 mesh, 04-08 meq/g) and
N-~-tertiarybutoxy-carbonyl(t-boc)amino acids by the method of
simultaneou3 multiple peptide synthe~is (SMPS) developed by
Houghten (Reference 15, hereby incorporated by reference) from the
original solid phasP peptide synthesi~ method of Merrifield
(Reference 16, hereby incorporated by reference). The peptides
~ , 2 7 ~
were cleaved hy the conventional hydrogen fluoride/anisole proce~
dure (Reference 17). A typical purity profile (by reverie phase
chromatography on a PepRPC HR5/5 Pharmacia column) ~or a peptide
is shown in Figure 1. The column was eluted with a gradient of
0.1~ TFA/H20"(Solvent A~ and 0.1% TFA/CH3CN (50lvent B). 200 ~g
of peptide 3 ~as injeeted in 25 ~1 of Solvent A. The gradient
pxoceeded from 0-60% in 20 minutes at a flow rate of 0.7 ml/min.
Detection was made by a Pharmacia W -M monitor at 214 nm. This
elution profile demonstrate3 that the peptide is approximately 95
pure.
Peptides ~imilar to Construct I:
Peptide 2
SEQ ID NO:9:
Gly A p Lys Asn Gly Asn Gly Trp Ile Glu Phe Glu Glu Leu
1 5 10
Peptide 3
SEQ ID NO:10:
Gly Asp Lys Asn Gly Asp Gly Tyr Ile Glu Phe Glu Glu Leu
Peptide 4
SEQ ID NO:ll:
Gly A~p Lys Asn Gly Asp Gly Phe Ile Glu Tyr Glu Glu Leu
1 5 10
Peptide 5
SEQ ID NO:12:
Gly Asp Ly~ Asn Gly Asp Gly Tyr Ile Glu Trp Glu Glu Leu
1 5 10
Peptides similar to CD binding loop of Oncomodulin:
Peptide 6
SEQ ID NO:13:
Gly Asp Asn Asp Gln Ser Gly Tyr Leu Asp Gly Asp Glu Leu
1 5 10
- 25 -
~ , 2 ~ ~ ~
Pept lde 7
SEQ ID NO:14:
Gly Asp Asn A3p Gln Ser Gly Trp Leu Asp Gly Asp Glu Leu
The peptides 2-5 were 14mers where residues 2-13 had a
similar sequence as the 12 amino acids which were incorporated
into Construct I. A glycine in position 6 is qubstituted for an
alanine in the Construct I protein ~equence.
The tryptophan re~idue (position 7) in pept ide 2 corre-
sponds to tryptophan 57 in the Con~truct I protein. The peptides
each have a glycine at the N terminal end and a leucine at the C
terminal end. The peptides 3, 4 and 5 are variant~ of peptide 2.
Peptide 6 corresponds to the CD binding loop of oncomodulin and
peptide 7 ha~ a tryptophan residue substituted for the tyrosine,
corresponding to tyrosine 57 in the native oncomodulin.
Figure 2 represents the fluorescence spectra of each
peptide in the presence and absence of excess Terbium. These were
measured as indicated in Example II below.
Figure 2a show~ that peptide 2, which i~ analogous to
the binding loop inaerted into Construct I, binds Terbium, and
tryptophan 7 transfers energy to the bound Terbium resulting in a
Terbium lumineqce~ce at 545 nm. The tryptophan fluorescence is
also quenched on binding Terbium. In the case of peptide 3
(Figure 2b) which was the ~ame as peptide 2 except a tyrosine
residue wa~ substituted in place of tryptophan 7, again Terbium
luminescence could clearly be observed. Peptide~ 4 and 5
(Figures 2c, d) ~how that location of an absorbing chromophore in
position 10 (corresponding to rejidue 60 in oncomodulin), resulted
~ s~7;7 ~
in a poor,energy transfer to the Terbium when bound to the pep-
tide. It i~ assumed in this latter statement that these peptides
bound Terbium with ~imilar efficiencies as peptide 2.
Peptide 7 (Figure 2a) has a tryptophan located in posi-
tion 7 and the balance of the ~equence i~ similar to the binding
loop of native oncomodulin' ~ CD site. Only a low intensity of
Terbium luminescence was observed. Peptide 6 (Figure 2b) has a
tyrosine located in po~ition 7, and also ~hows the same low level
of Terbium luminescence. This probably indicates that peptides 6
and 7 do not bind Terbium with the same affinity a~ the Con-
struct I type peptides, 2-S.
Studies Involving Oncomodulin
Until recently oncomodulin has been available only in
limited quantities from the rat Morris hepatoma 5123 and other
tumours. We report here a bacterial e~pression sy~tem for onco-
modulin which permits the isolation of oncomodulin in large
quantities and also permits site directed mutagenesis to isolate
oncomodulin modified to contain chelating sequences of amino acids
in accordance with the invention.
Construction of Expres~ion Plasmids: A bacterial vector
for expres~ion of,oncomodulin wa~ constructed from the coding
~equence of an oncomodulin cDNA joined to the TAC promoter
(References 1, 2; see below) (TAC promoter Genblock, Pharmacia P~)
inserted in the plasmid pGEM-l (Promega Biotec). The oncomodulin
coding sequence wa~ obtained from pONCO-4, a plasmid containing
the entire oncomodulin sequence as well as 73 nucleotides of the
5'-non coding sequence and 253 nucleotide~ of the 3'-non coding
2 t~
sequence of the oncomodulin messenyer RNA (Reference l, hereby
incorporated by reference). All 4ynthetic oligonucleotides were
made by the phosphoramidite method using an Applied BioSystems
380A synthesizer.
The qtrategy used is described in Figure 3. The ~AC
promoter was introduced into pGEM-1 as a HindIII-Bam~I fragment to
yield pGEM-TAC (steps 1-3). The oncomodulin coding ~equence wa~
obtained from pONCO-4 (~eference l, hereby incorporated by
reference), after digestion with HindIII followed by treatment
with ~al31 (which deleted the 5'-non coding sequence and part of
the coding region), and finally digestion with Dra I (steps 5-6).
The blunt ended fragmentq were cloned into pGEM-TAC, which had
been prepared by dige~tion with 8amHI and the resulting ends
filled with the large fragment of DNA polymerase I (Klenow) (step
4). A subclone in which a BamHI restriction site had been re-
generated was chosen (step 7), and the junction sequenced. This
plasmid was then linearized with BamHI and the ends were rendered
blunt by treatment with mung bean nuclease (step ~). A double
stranded DNA fragment of 15 base pairs (step 9), composed of two
complementary ~ynthetic oligonucleotides, was then introduced
between the TAC promoter and the oncomodulin sequence in order to
restore the entire coding region (step l0). In addition, this
generated a new unique Cla l restriction site and a Shine/Dalgarno
~equence, AGGA, 4 nucleotides upqtream of the start codon.
The construction was designed so that the Shine-Dalgarno
polymerase binding sequences were immediately upstream of the ATG
start codon of the oncomodulin coding sequence. A new, unique
- 28 -
r~ ;f 13
Cla 1 restriction site was also created by this ligation, which
proved useful in the screening ~or the desired recombinant. The
re~ulting nucleotide sequence of the junction between the TAC
promoter and the oncomodulin coding ~equence in the new plasmid is
SEQ ID NO:2~, shown in Figure 4. The sequence was determined from
the SP6 promoter region, which is upstream of the TAC promoter, by
the dideoxy chain termination method (Reference 3, hereby in-
corporated by reference).
Oncomodulin Expression and Purification: The plasmid
pGEM-TAC-ONCO was uRed ~uccessfully to transform E. coli JM101,
JM103, DH5, or GW5889, the latter being lon- (i.e. free of endo-
genous lon protease). The transformants were screened for oncomo-
dulin production. The isolation of oncomodulin from bacteria was
ba~ed on procedures used for calmodulin (Reference3 4, 5, hereby
incorporated by reference). Bacteria were harvested from 2L of
culture in L-broth by centrifugation, and the pellet (approx. 5-7
g) requspended in 20 mL of 2.4 M sucrose, 40 mM Tris-HCl, 10 mM
EDTA, pH 8Ø The suspension was incubated on ice for 30 min.
80mL of 50 mM Hepes-HCl, 100 mM KCl, 1 mM E~TA, 1 mM dithio-
threitol, 100 ~g/ml lysozyme were then added, and the bacteria
lysed at 4C overnight. The lysed bacteria were centrifuged a~
40,000g for 30 min in a Beckman LS65 ultracentrifuge (60Ti rotor).
The clear supernatant was heated rapidly in a boiling water bath,
held between 65-80C for 5 min, and cooled immediately on ice.
The denatured proteins were removed by centrifugation at 40,000g
for 30 min. The oncomodulin in the resulting supernatant was
isolated by ammonium sulph~te precipitation, followed by sequen-
- 29 -
tial ion exchange and gel filtration as previously described ~or
extracts of tumour tissue (References 6, 71 hereby incorporated by
reference).
Oncomodulin Mutagenesis: The HindIII to XmaI fragment
of pGEM-TAC-ONCO (Figure 3) was subcloned into the polylinker
region of pTZ19R (Reference 8, hereby incorporated by reference;
~Pharmacia PL Biochemicals) to produce pTZl9-Onco. Single strand-
ed DNA was obtained from the resulting recombinant after infection
of a bacterial culture with helper phage M13K07 (Pharmacia PL)
using the procedure of Zoller and Smith (Reference 9, hereby in
corporated by reference). A synthetic oligonucleotide (21mer)
containing the desired mutation (eg for Glu 59:
TGGATACCTCGAGGGAGATGAG (SEQ ID NO:26)) was used to prime the syn-
the~is of the second DNA strand before transformation of competent
E. coli JM103. A new XhoI site was al80 created which was useful
in screening. The kinase labeled oligonucleotide was also used to
screen the resulting transformants, and the nucleotide sequence of
the choice candidates was determined by the dideoxy chain termina-
tion method (Reference 3, hereby incorporated by reference)
(Figure 5).
Characterization of ~ecombinant Oncomodulin: Ultra-
violet spectra were obtained with a Beckman DU8 spectrophotometer
using oncomodulin at 5 mg/mL in a buffer consisting of 10 mM
sodium cacodylate, 150 mM KCl, 1 mM dithiothreitol pH 7.0, which
had been pas~ed over the cation exchange resin Chelex lOQ (BioRad
Laboratories). The resulting working buffer had a residual cal-
cium concentration, estimated by atomic absorption spectrometry
- 30 -
, 7 ~ ~
(Pye Unicam SPl91), of less than 0.002 mM.
The fluorescence spectra were obtained with SLM 8000C
spectrofluorimeter equipped with Neslab Endocal ~TE-5DD circuLat-
ing bath. The spectra were corrected for contributions of the
blank, and normalized for comparison. The fluorescence
(~ ex = 280 nm~ of a solution of oncomodulin in the cacodylate
buffer described above, was measured in 0.5 cm quartz cuvettes at
20C (a~sorbance reading~ at 280 nm approximately 0.05). The
excitation and emission bandpasses were both 4 nm.
The W spectra of bacterially expressed oncomodulin and
rat hepatoma oncomodulin are shown in Figure 6. Antigenic compar-
ison of the recombinant oncomodulin with the native protein from
hepatoma was made using an immunoradiometric assay (Reference 11,
hereby incorporated by reference). The re~ults are illustrated in
Figure 8.
The tryptic peptide~ of recombinant oncomodulin were
separated by reverqe-phase HPLC, and their amino acid composition
and sequence obtained as described (Reference 12, hereby incorpor-
ated by reference).
Con~truction of pGEM-TAC-ONCO-CI
The plasmid pGEM-TAC-ONCO which contain~ the DNA ~e-
quence encoding the rat oncomodulin protein, under the control o~
the bacterial TAC promoter, described above, was digested with the
restriction enzymes EcoRV and S~tI, each cutting a unique 3ite in
the DNA. The two fragments thus obtained were separated by gel
electrophoresis and the large fragment was recovered by electro-
elution. Two complementary oligonucleotides whose sequence (SEQ
C,t~ '7 ~ ~
ID N0:29) is shown in Figure 9 were synthesized on an Applied
BioSystem DNA synthesizer model 380A. (Nucleotide triplets can of
course be replaced by other triplets coding for the same amino
acid.) Equimolar amounts of the two oligonucleotides were mixed
in a colution 10 mM TRIS pH 8.0, 1 mM EDTA and 0.2 M NaCl at room
temperature for 20 minutes. The annealed oligonucleotides were
then ligated to the large EcoRV-S-~tI fragment of pGEM-TAC-O~C0
thus restoring the reading frame of the oncomodulin ~equence.
This new pla~mid DNA was used to transform DHS cells from which
the modified oncomodulin protein is extracted. The general
methods used for growing the bacteria, purifying the plaqmid DNA,
restriction enzyme digestion, ligation of DNA fragments and trans-
formation of the bacteria are those described in several molecular
biology technique books such as "Molecular Cloning" by
T. Maniatis, E.F. Fritsch and J. Sambrook, Cold Spring Harbor
Laboratory, 1982.
The nucleotide ~equence of the recombinant plasmid DNA
molecule was checked by DNA sequencing through the modified region
by the chain termination method of Sanger using oligonucleotide
primers flanking both 3ides of this region.
Expres3ion and Purification of Recombinant Proteins
The methods used to extract from bacteria and to purify
the mutated recombinant oncomodulin are those de~cribed above in
relation to the extraction and purification of native recombinant
oncomodulin.
Titration with Terbium
Example II: Native oncomodulin:
Protein was dissolved in 10 mM PIPES, 100 mM KC1, pH 6.5
,77~
to a final concentration of 45 M. The protein sample was excited
at 285 nm in an SLM 8000 C fluorimeter, and the emission at 545 nm
was monitored. The emission and excitation band pass were 4 nm
and the temperature was 20C. This ample, which gave an emission
at 545 nm due to the fluorescence of Terbium, was titrated with
increasing additions of the metal to the protein solution. The
emission was measured after each of 45 2 ml aliquots of 2.5 mM
TbC13 in PIPES buffer. The resulting fluorescence was plotted
against the ratio of Terbium to protein concentration
(Figure 10).
The bacterially expressed native oncomodulin had an
increased Terbium luminescence with increasing Terbium addition,
which reached a maximum at approximately 2Tb/mole of protein.
Thi~ was not unexpected because of the presence of 2 binding ~ites
in the oncomodulin ~tructure shown by X-ray crystallography, and
the ability of oncomodulin to bind only 2Catmole (Reference 13,
hereby incorporated by reference). It was also in agreement with
published results on Tb binding to oncomodulin purified from rat
liver tumours (Reference 14, hereby incorporated by reference).
The increase in fluorescence was concluded to be due to energy
tran~fer from Tyr~57 and/or Tyr 65, which are the only two tyro-
sines in the native molecule. About one third of the total
Terbium fluorescence was produced when 0-1 Tb/mole was bound, with
the major fluorescence output occurring when 1-2 Tb/mole of
protein were bound. This was interpreted to mean that the EF ~ite
(the ~ite with the highe~t affinity) was the one filled first but
~ ~:3 ~3 ~
with the minor contribution to overall fluore~cence, while Tb
binding to the CD ~ite led to the major emission signal.
The replacement of Tyr 65 with Phe 65 caused an unexpec-
ted 30% increase in the Terbium luminescence fluorescence (Figures
10 and 11~. While not wishing to be bound by any theory, it is
suggested that the substitution of Tyr 65 by Phe 65 may have
re ulted in a conformational change in the protein which results
in enhanced energy transfer from Tyr 57-to bound Terbium.
The replacement of Asp 59 with the longer Glu 59 caused
a doubling in the Tb emission (Figure~ 10 and 11). While not
wishing to be bound by any theory, it i9 suggested that the Glu 59
eliminated a water bridge between Asp 59 and the chelated Tb and
this elimination of water reduces the quenching by solvent, which
subsequently leads to increased Terbium fluorescence. Also a
conformational change that brings the Tb slightly closer to the
Tyr 57 energy donor cannot be ruled out.
The substitution of Tyr 65 by Trp 65, or Phe 102 by
Trp 102 was designed to increase Tb emission by providing a better
energy transfer donor. Thus the decrease in Tb signal from both
Trp 65 and Trp 102 mutants of oncodulin was unexpected. It i9
quggested that, the presence of tryptophan 102 or tryptophan 65
provides an alternative competitor for energy transfer from Tyr 57
to the bound Terbium.
The~e observations on single amino acid substitution
result in the conclusion that Tyr 57 i~ an important source of
energy for excitation of Terbium in both the CD and EF sites. It
is evident that the extent of Tb emission can be modified by
- 34 -
2~ 7~
protein engineering.
Example III: Construct I:
Protein was dissoLved as in Example II to a final con-
centration of 8 ~M. The titration with Terbium was performed as
in Example II.
The titration of Construct I, where 10 amino acids in a
linear sequence in oncomodulin were changed so that the modified
oncomodulin molecule included a chelator ~equence of the inven-
tion, caused a dramatic improvement in the emission signal from
Tb, which was nearly 20 fold better than that of native oncomodu-
lin (Figures 10 and 11). Also noticeable was that the major
fluorescence change now occurred when 0-1 Tb/mole protein was
bound. This contrasts with native oncomodulin, where the major
fluorescence change occurs when between 1-2 moles of Terbium per
mole of oncomodulin are bound.
Example IV:
This example demonstrates Resonance Energy Transfer
(RET) from aromatic amino acid~ (tyrosine and tryptophan) to bound
Terbium in oncomodulin and mutant proteins.
The experiments were performed as in Example~ II and
III, except that t~he fluorescence from the aromatic amino acid
rather than luminescence from Terbium wa~ measured during the
titration. In the ca~es where tyrosine wa~ the only aromatic
amino acid, (Glu 59 mutant protein and native protein), the
protein fluroescence (originating from tyrosinej was monitored at
310 nm (Figure 12). In the ca~e where tryptophan was also one of
the aromatic amino acid residues in the protein, (Construct I and
2'7 ~ ~3
Trp 102), the protein fluorescence due to tryptophan was monitored
at 350 nm (Figure 13).
The fluorescence intensity in each of these caseY
decreased on addition of Terbium. The data plotted in Eigures 12
and 13 represent~ the fractional change in fluoreQcence Fo~
Fn/Fo versus ~Tb3+]/~Protein], where Fo is the fluorescence
in~ensity in the absence of Terbium and Fn is the fluorescence
intenqity after the addition of Terbium~.
In all ca3es, the fractional fluorescence change reached
a plateau value at a ~Tb3+]/[Protein] ratio of 2:1. The fraction-
al fluorescence change wa~ greater for Glu 59 than for native,
paralleling the increased Terbium luminescence seen in Figure 10.
This showR that RET from the tyrosine of the Glu 59 mutant to
bound Terbium was more efficient than that of native protein. In
the case of Construct I, E'igure 13 clearly shows that tryptophan
located in pGsition 57 has a high R~T efficiency especially when
compared to that of the Trp 102 mutant of oncomodulin. This
parallels the increased Terbium luminescence seen in Figure 11 of
Construct I. This ~hows that efficient RET from the tryptophan
to Terbium re~uires that the two species be in close proximity to
one another.
Exam~le V:
This example demonstrates the use of Construct I protein
to assay Terbium in low concentrations.
Stock solutions of Terbium in 10 mM PIPES, lO0 mM KCl,
pH 6.5 buffer were diluted to the concentration range shown in
Figure 14. Ten microlitres of a stoc~ solution of 0.57 mg/ml of
- 36 -
~;~`s~
Construct,I protein in the qame buffer was added to 1.5 ml samples
of each of the Terbium solutions.
The luminescence at 545 nm of these solutions was
measured as outlined in Example II, except that the emission band-
pass was 8 nm. The luminescent signal of a blank solution con-
taining no Terbium was measured under identical conditions and
subtracted from the signal of the samples. Figure 14 shows that
the response of the lumine~cent signal for Terbium is linear over
nearly 3 orders of magnitude of Terbium concentration. A sample
with a Terbium concentration as low as 7X10-13 M could be detec-
ted. This corresponds to a sample of 1.5 ml which contains only
1.05x10-15 moles of Terbium tor 6X108 ions).
ExamPle VI:
This example demonstrates the use of a Terbium binding
assay to replace a qualitative radioac~ive 45Ca assay which can be
used to detect the presenc0 of a protein containing a chelator
sequence.
oncomodulin mutant Trp 57 was purified ~rom bacteria as
outlined above (cf, Oncomodulin Expres3ion and Purification).
Figure 15 shows the final stage of purification by gel filtration
on Sephadex G50. ~ach fraction was monitored for the presence of
protein by measurement of absorbance at 280 nm. Aliquotq from
each fraction were assayed for calcium-binding properties with a
Chelex assay (Referenceq 6 and 7, hereby incorporated by referen~
ce) employing radioactive 45Ca and a scintillation counter.
Aliquot~ were also monitored for the presence of a
chelator sequence that show~ enhanced Terbium luminescence upon
- 37 -
2.~27~
binding Terbium. 20 ~L aliquots were diluted in 1.25 ml of a
10 ~M PIPES, 190 mM KCl buffer at pH 6.5. 5 ~L of a ~olution of
5 mM TbC13 solution was added to each aliquot, which led to the
formation of luminescent complexes when the protein was present.
The resulting fluorescence intensity was plotted in Figure 15
along with the values from the absorbance and the radioactive
calcium assay.
Figure 15 demonstrate~ that the addition of Terbium to a
protein capable of forming luminescent complexec can be used for
the detection of such proteins. Further, this assay avoidQ the
hazards of handling radioactive material~, and the cost of radio-
active disposal. The number of manipulative teps i8 also much
reduced, ~aking the assay simpler and quicker to perform.
Example VII:
A 14mer, with cysteine at position 7, of the following
~tructure wa~ prepared
SEQ ID NO:20:
Gly A~p Lys Asn Ala Asp Gly Cys Ile Glu Phe Glu Glu Leu
The chromophore ~-(l-pyrenyl)iodoacetamide (PIA) was
reacted with the 14mer at about pH8 in a ~Cl/Tri~ buffer and
thereby covalently bonded to the cysteine at position 7 of the
14mer. Samples of 10 ~M PIA-14mer in lOmM PIPES, pH 7.2, (200 ~L)
were titrated with 5 ~L aliquots of stock solutions of Tb3+ or
Eu3+ of concentrations 100 ~M and lmM. Fluorescence of the
chelated lanthanides was measured and plotted in Figure 16A (lOO~M
concentration) and Figure 16B (lmM) concentration. Results for
Tb3+ are plotted as ~quares and for Eu3+ are plotted as triangles.
- 38 -
?!~8277~
The data were not dilution corrected.
Example VIII:
500 ~L aliquots of 10 ~M ~olutions of the PIA-14mer of
Example VII were reacted with 5 ~L additions of lmM Tb3+, lmM Eu3+
and 3mM Ca2+, respectively, in 10 mM PIPES at pH 7.2. The effect
of light scattering on the chelated metal ions was observed, with
excitation at 344 nm and emission at 688 nm. Results are given in
Figure 17, trianglec indicating Tb3+ circles indicating Eu3+ and
squares indicating Ca2+. Data were corrected for instrument
response and dilution.
Example IX:
The 14mer of Example VII wa~ covalently bonded via
cysteine at the 7-position to the chromophore 7-diethylamino-3-
((4'-iodoacetylamino)phenyl)-4-methylcoumarin (DCIA). 10 ~M
aliquots of the DCIA-14mer in lOmM PIPES pH 7.2 (200 ~L) were
titrated with Eu3+ at concentrations of 100 ~M and lmM. Lumines-
cence was measured and result-~ are given in Figures 18A (100 ~M)
and 18B (lmM).
Example X;
A 23mer, with cysteine at position 7, of the structure
identified above as SEQ ID N0:21 was covalently bonded at the
7-position to DCIA. Stock solution of Eu3+ (100 ~M) was added to
a 2 ~M DCIA-23mer sample in 200 ~L of 50mM PIPES, pH 7Ø Stock
solution of Eu3+ was al~o reacted with the DCIA-14mer under the
same conditions. Luminescence was measured and re~ults are given
in Figure 19 (DCIA-14mer, open triangles; DCIA-23mer, filled tri-
an~les).
- 39 -
2~'~27~/ ~
Example X_:
Oncomodulin was modified, by cassette mutagenesis, to
replace the naturally occurring CD loop by the sequence identified
above as SEO ID ~0:22 and the natusally occuring cy~teine at
position 18 of oncomodulin was removed by site specific
mutagenesis and replaced by valine.
(Construct 3)
The DCIA chromophore was covalently bonded to the
cysteine mGiety at the 7-position and subsequently reacted with
Eu3~ at variou~ concentrations in 150mM KCl, lOmM PIPES, pH 7Ø
Luminescence was measured and results are given in Figure 20.
Eu3+ (10 ~M stock) was added to DCIA-Construct 3 (1 ~M)
in 200 ~L of 150mM RCl, lOmM PIPES, pH 7Ø Luminescence was
mea-~ured and results are given in Figure 21.
Example XII:
The chromophore iodoacetamidosalicylic acid tIASA) was
covalently bonded to the cysteine iety at position 7 of
Construct 3. Tb3~ tlO ~M stock) in different qualities was added
to the IASA-Construct 3(1 ~M) in 200 ~L of 150mM KCl, 10mM PIPES,
pH 7Ø Lumiscence was measured and results are given in Figure
22, graphed again~t the quantity of Tb3+ used. In a separate
experiment, the quantity of Tb3~ was maintained at 2 ~M and
reacted with varying amounts of IASA-Construct 3 in 200 ~L of
150mM RCl, lOmM PIPES, pH 7Ø Results are given in Figure 23.
Exam~le XIII:
Chromophores were attached to the cysteine in Construct
3 and evaluated for Tb3+ and Eu3~ sensitization.
- 40 -
~ ~ 2 7 r~ ~
Modified Construct 3 (1.5 M) _ Eu3~ Counts ?b3+ Counts
PIA 220,000 350,000
PMIA 160,000 386,000
DIMS 230,000 745,000
BPIA 32,000 280,000
~Ln3+~ = 5~M.
Abbreviation~;
PIA - N-(l-pyrenyl)iodoacetamide.
PMIA - l-pyrenemethyl iodoacetate.
DIMS - 4,4'-dimaleimidyl~tilbene.
BPIA - benzophenone-4-iodoacetamide.
;J ~ ~ f~
REFERENCES
1. Gillen, J.F., Banville, D., Rutledge, R.G., Narang, S.,
Seligy, V., Whitfield, J.F. ~ MacManus, J.P. (1987) J. Biol.
Chem. 262, 5308-5312.
2. Russell, D.R. & Bennett, G.N. (1982) Gene 20, 231-243.
3. Sanger, F.G., ~icklen, S. & Coulson, A.R. (1977) PNAS 74,
5463-5467.
4. Roberts, D.M~, Crea, R., Malecha, M., Alvarado-Urbina, G.,
Chiarello, R.H. & Watterson, D.M. (1985) Biochemistry, 24,
5050 5098.
5. Putkey, J.A., ~laughter, G.R. ~ Meanq, A.R. (1985) J. Biol.
Chem. 260, 4704-4712.
6. MacManus, J.P. (1980) Biochim. Biophyq. Acta 621, 296-304.
7. Durkin, J.P. Brewer, L.M. ~ MacManus, J.P. (19~3) Cancer Res.
43, 5390-5394.
8. Mead, D.A., Szczesna-Skorupa, E. & Remper, B. (1986) Protein
Engineering 1, 67-74.
9. Zoller, M.J. & Smith, M. (1983) Methodq Enzyl. 100,
46B-500.
10. MacManus, J.P., Szabo, A.G. & William~, R.E. (1984) Biochem.
J. 220, 261-268.
11. Brewer, L.M. & MacManus, J.P. (1987) Placenta 8, 351-363.
12. MacManus, J.P., Watson, D.C. & Yaguchi, M. (1983) Eur. J.
Biochem. 136, 9-17.
13. MacManu~, J.P., & Whitfield, J.F. (1983) in Calcium and Cell
Function (Cheung, W.Y., ed) IV, 411-440, Academic Press, New
York.
14. Henzl, M.T.,~Hapak, R.C. & Birnbaum, E.R. (1986) Biochim.
Biophyq. Acta 872, 16-23.
15. Houghten, R.A. (1985) P~S 82 5131-5135
16~ Merrifield, R.B. (1963) J. Amer. Chem. Soc. 85 2148-2154
17. Houghten, R.A., DeGraw, S.T., Bray, M.K., Hoffman, S .R. and
Frizzel, N. D. (1985) Int. J. Pept. Prot. Res. 27 673-678
- 42 -
2 ~ 1 rl ~
SEQUENCE LISTING
(1) GENEXAL INFORMATION:
~i~ APPLICANT: Banville, Dennis
Macmanus, John P
Marsden, Brian
Szabo, Arthur G
Hogue, Christopher
Sikorska, Marianna
Clark, Ian
(ii) TITLE OF INVENTION: Engineered protein chelates suit~ble
for
fluorescent lanthanide (e.g. terbium (III)) based tim~
resolved fluorescence assays
~iii) NU~BER OF SEQUENCES: 30
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Smart & Biggar
(B) STREET: P.O. Box 2999, Station D
(C) CITY: Ottawa
~D) STATE: Ontario
(E) COUNTRY: Canada
(F) ZIP: KlP 5Y6
(v) COMPUTER READABLE PORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: US
(B) FILING DATE:
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
tA) APPLICATION NUMBER: US 07/476757
(B) FILING DATE: 01-APR-1990
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Wheeler, Michael E
(C) REFERENCE/DOCRET NUMBER: 63247-223 CIP
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (613)232-2486
(B) TELEFAX: (613)232-8440
(C) TELEX: 053-3731
2 ~ 7 1 ~3
(2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 12 amino acids
tB) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECVLE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:
Asx Xaa Asx Xaa Asx Xaa Xaa Xaa Glx Xaa Glx Glx
, 10
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Asx Xaa Asx Xaa Asx Xaa Xaa Xaa Glx Xaa Xaa Glx
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
Asp Lys Asn Ala Asp Gly Trp Ile Glu Phe Glu Glu
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
- 44 -
2 ~5~C2
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
Asp Lys Asn Ala Asp Trp Gly Ile Glu Phe Glu Glu
1 5 10
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRlPTION: SEO ID NO:S:
Asp Lys Asn Ala Asp Ala Trp Ile Glu Phe Glu Glu
(2) INFORMATION POR SEQ ID NO:6:
(i) sEguENcE CHARACTERISTIC5:
(A) LENGTH: 12 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
Asp Lys Asn Ala Asp Gly Trp Ile Glu Trp Glu Glu
1 5 10
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
- 45 -
~ ~J ~ 7 7 ~
Asp Lys Asn Ala Asp Ala Trp Ile Glu Trp Glu Glu
1 5 10
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
Asp Lys Asn Ala Asp Trp Gly Ile Glu Trp Glu Glu
1 5 10
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 14 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) 5EQUENCE DESCRIPTION: SEQ ID NO:9:
Gly Asp Lys Asn Gly Asp Gly Trp Ile Glu Phe Glu Glu Leu
1 5 10
(2) INFORMATION FOR SEQ ID NO: 10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 14 amino acids
(B) TYP~: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
Gly Asp Lys Asn Gly Asp Gly Tyr Ile Glu Phe Glu Glu Leu
- 46 -
'7 ~
(2) INFORMATION FOR SEQ ID NO:ll:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 14 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCB DESCRIPTION: SEQ ID NO:ll:
Gly Asp Lys Asn Gly Asp Gly Phe Ile Glu Tyr Glu Clu Leu
1 5 10
(2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 14 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: lin~ar
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
Gly Asp Lys Asn Gly Asp Gly Tyr Ile Glu Trp Glu Glu Leu
1 5 10
(2) INFORMATION FOR SEQ ID NO:13:
(i) SEOUENCE CHARACTERISTICS:
(A) LENGTH: 14 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: 1 inear
(ii) MOLECULE~TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEO ID NO:13:
Gly Asp Asn Asp Gln Ser Gly Tyr Leu Asp Gly Asp Glu Leu
(2) INFORMATION FOR SEO ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 14 amino acids
?J ~ ~ ~ r~
(~) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptid~
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
Gly Asp Asn Asp Gln Ser Gly Trp Leu Asp Gly Asp Glu Leu
(2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A~ LENGTH: 12 amino acids
~B) TYPE: amino acid
(D) TOPOLOGY: linear
lii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
Asp Xaa Asn Xaa Asp Xaa Xaa Xaa Glu Xaa Glu Glu
(2) INFORMATION FOR SEQ ID NO:16:
~i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids
(3) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TS'PE: peptide
(xi) 5EQUENCE DESCRIPTION: SEQ ID NO: 16:
Asp Xaa Asn Xaa Asp Xaa Trp Xaa Glu Xaa Glu Glu
1 5 10
(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: 1 inear
(ii) MOLECULE TYPE: peptide
- 48 -
2 ~ 7 7 ~
rxi) SEQUENCE DESCRIPTION: SEQ ID NO:17:
Asx Xaa Asx Xaa Asx Xaa Xaa Xaa Glx Xaa Xaa Glx
1 5 10
(2) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
Asx Xaa Asx Xaa Asx Xaa Xaa Xaa Glx Xaa Glx Glx
1 5 10
(2) INFORMATION FOR SEQ ID NO:l9:
(i3 SEOUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids
~B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l9:
Asp Xaa Asn Xaa Asp Xaa Trp Xaa Glu Xaa Xaa Glu
1 5 10
(2) INFORMATION FOR SEO ID NO:20:
(i) SEOUENCE CHARACTERISTICS:
(A) LENGTH: 14 amino acids
(B) TYPE: amino acid
tD) TOPOLOGY: llnear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:
Gly Asp Lys Asn Ala Asp Gly Cys Ile Glu Phe Glu Glu Leu
1 5 10
- 49 -
~J ~i ~ r~
(2) INFO~MATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:
Ser Leu Val Ala Leu Asp Asn Asn Ala Asp Gly Cys Ile Glu Phe
-5 1 5 l0
Glu Glu Leu Ala Thr Leu Val Ser
(2) INFORMATION FOR SEQ ID NO:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:
Asp Lys Asn Ala Asp Gly Cys Ile Glu Phe Glu Glu
1 5 10
(2) INFORMATION FOR SEQ ID NO:23:
(i) 5EQUENCE CHARACTERISTICS:
(A) LENGTH: 37 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS- single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:
CACACAGGAA ACAGGATCGA TGAGCATCAC GGACATC
37
- 50 -
2~3~277~
(2) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH~ 57 base pairs
(B) TYPE: nucleic acid
(C) STRAN~EDNESS: double
(D~ TOPOLOGY: linear
~ MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
GATATCTTCC GGTTCATAGA CAACGACCAG AGTGGATACC TGGATGGAGA TGAGCTC
57
~2) INFORMATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 57 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:
GATATCTTCC GGTTCATCGA TAAGAACGCG GATGGATGGA TAGAATTCGA GGAGCTC
57
(2) INFORMATION FOR SEQ ID NO:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:
TGGATACCTC GAGGGAGATG AG
22
