Note: Descriptions are shown in the official language in which they were submitted.
W092/~760 PCT/US91/06238
2~8971~1
METHOD AND CO~POSITIONS FOR DIAGNOSING AND TREATING
CH~ONIC FATIGUE IMMUNODYSFUNCTION SYNDROME
The invention described herein was made in the
course o~ work under grants or awards ~rom The United
States National Institutes of Health, the Department of
Health and ~uman Services.
Backqround of this Inventign
Chronic Fatigue Immunodysfunction Syndrome
(CFIDS) is an illness charactexized by a myriad of
symptoms including immunologic and neurologic
abnormalities. However, because the symptoms o~ CFIDS
are similar to those of a number of other conditions,
CFIDS patients are often misdiagnosed as having some
other condition, including psychosomatic illnsss. In
fact, the disorder characteri~ed by some or all of the
symptoms of CFIDS listed below, has been diagnosed as
being chronic active Epstein Barr Virus infection
syndrome, chronic mononucleosis, postviral fatigue
syndrome, low natural killer cell syndrome, [D. Buchwald
and A.L. Komaroff, Rev. Infectious Dis., 13(Suppl.l):S12-
8 ~1991)], Royal Free disease, 'yuppie disease',
neurasthenia, and myalgic encephalomyelitis. See, e.gO,
L. Williams, Time, May 14, 1990, p. 66; W. Boly,
Hippocrates, July/August 1987, pg. 31-40; H. Johnson,
Rollinq Stone, p. 56; and G.P. Holmes et al, Annals
Intern. Med., 108:387-389 (1988).
A working case definition of CFIDS has recently
been developed [Holmes et al, cited above]. To fulfill
the working case definition of CFIDS, both major criteria
and either six or more symptomatic criteria plus two or
more physical criteria and eight or more symptomatic
criteria must be present. The two major criteria are
persistent, relapsing or easy fatigability that does not
W092/0~760 PCT/US~l/06238
208~'761
resolve with bed rest and is severe enough to reduce
daily activity by at least half and, the exclusion o~
other chronic clinical conditions, including pre~xistin~
psychiatric diseases. The minor criteria include, ~ild
fever or chills, sore throat, lymph node pain,
unexplained generalized muscle weakness, muscle
discomfort, myalgia, prolonged (greater than 24 hours)
generalized fatigue following normal exercise levels, new
generali2ed headaches, migratory noninflammatory
arthralgia, neuropsychological symptoms including
photophobia, transient visual scotomata, forgetfulness,
excessive irritability, confusion, difficulty thinking,
inability to concentrate, and depression, sleep
disturbance, and initial onset of symptoms as acute or
subacute. The physical criteria include low-g~ade fever,
nonexudative pharyngitis, and palpable or tender anterior
or posterior cervical or axillary lymph nodes.
The ~irst documented CFIDS-like epidemic
occurred in Los Angeles more than 50 years ago. Serious
epidemics struck 1,136 people in Iceland in 1948 and
affected as many as lOo,O00 peoples in the U.S., Canada
and New Zealand in 1984. New occurrences of CFIDS-like
outbreaks have been reported steadily since then.
Diagnosis of CFIDS is difficult, and expensive,
because these symptoms resemble those of other conditions
and diagnosis o~ten involves eliminating the presence of
other conditions. Currently, no specific tests to
pinpoint the syndrome and, although in the past several
specific agents including Epstein ~3arr virus, certain
enteroviruses and Human Herpes virus type 6 have been
associated with CFIDS-like illnesses, no etiological
agent of ~FIDS has been definitively identified.
Retroviruses are a family of spherical
enveloped viruses comprising three sub-families,
3 5 oncovirinae, spumavirinae and Lentivirinae. The viruses
W092/05760 PCT/VS91/06~38
2~97~1
are designated as B-type, C-type or D-type, dep~nding on
certain structural characteristics of the virions. Among
such reported characteristics are the location af the
central nucleoid, the presence o~ low molecular weight
~ gcne proteins, the DNA ~e~uence of the trans~or RN~
primer binding site (PBS) in the 5' LTR, and tho symptoms
which the v~ruses induce in infected hosts.
B-type viruses such as the mammalian virus,
mouse mammary tumor virus (MMTV), have a central nucleoid
located acentrically and mature virions can be visualized
by electron microscopy both intracellularly and
extracellularly.
All known human retroviruses are C-type
viruses, both oncoviruses (HTLV I and II) and
lentiviruses (HIV 1 and HIV 2), in which the central
nucleoid is located concentrically and mature virions are
usually visuali.zed extracellularly. Exogenous
oncoviruses and lentiviruses occur widely among
vertebrates and are associated with many diseases.
C-type oncoviruses include human T-cell
lymphotropic viruses (HTLV) including HTLV I and II.
These HTLV viruses are linked with certain rare human T-
cell malignancies. HTLV-I is linXed with a chronic
demyelinating disease of the central nervous system
called HTLV I-associated myelopathy (HAM) or tropical
spastic paraparesis (TSP) [E. DeFreitas et al, AIDS
Research and Human Retroviruses, 3(1):19-31 (1987)].
Both HTLV-I and II have been reported as a coinfection
with HIV in many cases of AIDS. Two members of this
family, HTLV I and HTLV II, have been cloned and
sequenced, and appear to represent evolutionarily
divergent viral subgroups. The sequence for HTLV I was
published in M. Seiki et al, Proc. Natl. Acad. Sci.. USA,
80:3618-3622 (1983). See, also, G. M. Shaw et al, Proc.
Natl. Acad. Sci.,_USA, 81:4544-4548 (1984). The
W092~0s760 PCT/US91/06238
7Sl
nucleotide sequence of HTLV II was published in K.
Shimotohno et al, Proc. Natl. Acad. Sci.. USA, ~:3101-
3105 (lg85).
C-type lentiviruses include the hu~an
retroviruses, HIV-1 (the causative agent Or AIDS) and
EIIV-2, as well as equine infectious anemia virus (EIAV).
To date, other non-C type retroviruse~ or D
type retroviruses have been identified in primates, but
not in humans. Mason Pfizer monkey virus (MPMV) is a
type D virus which produces depletion of lymphocytes and
hind-limb paralysis when innoculated into newborn monkeys
CD~ Fine et al, Cancer Res., 38:3123-3139 (1978)]. D
type viruses are also characterized by the ability to
infect human T and B cells. [See, e.g., M. D. Daniel et
al, Science, 223:602-605 (1984); C. S. Barker et al,
Virol., 15~:201-214 (1986); A. A. Lackner et al, Curr.
Topics Microbio. Immunol., 160:77-96 (1990)].
The Spumavirinae sub-family includes the Foamy
viruses [J. J. Hooks et al, Bacteriol. Rev., 39:169-185
(1~75)~. Ten serotypes of foamy viruses have been
identified in a variety of Old World and New World
monkeys but they appear to be non-pathogenic in all
animal species tested.
There exists a need for a diagnostic method to
detect the occurrence of CFIDS/ permitting patients to be
properly diagnosed, as well as therapeutic and vaccinal
agents to treat and/or desirably prevent the infection.
Summary_of the_Invention
The present invention provides a novel,
substantially isolated Chronic Fatigue Immunodeficiency
Syndrome-associated virus, hereafter referred to by the
name CAV. Polynucleotide sequences of CAV and
polypeptides of CAV are useful as diagnostic reagents in
the diagnosis of CFIDS patients. Polynucleotide
W092/05760 PCT/US91/OG23~
2~7s~
sequences of CAV and polypeptide sequences oE CAV are
useful in therapeutic or vaccinal compositions Eor the
treatment or prevention of CFID5.
Also disclosed by this inv~ntion ar~ mcthods
and assays Por diagnosing and/or treating CFID5 patients.
Ant~bodies to CAV antigenic regions and 1~ Yl~E_ cells
containing CAV polynucleotide sequences or polypeptides
are also described.
Other aspects and advantages of the present
invention are described further in the following detailed
description.
Brief DescriPtion of the Fiqures
Figs. lA and lB illustrate potential CAV DNA
sequence fragments. One strand of the DNA sequence is
reported as Fig. lA; the complementary strand is reported
as Fig. lB.
Figs. 2A through 2F illustrate the six
potential reading frames of the putative CAV
polynucleotide sequences of Figs. lA and lB.
Fig. 3 is an electron photomicrograph of human
H-9 lymphoblastoid T cells infected with CAV, as
described in Example 1~
Fig. 4 is another electron photomicrograph of
human B-Jab lymphoblastoid B cells infected with CAV, as
described in Example 1.
Detailed Description of the Invention
The present invention provides methods and
compositions for the detection, treatment and prevention
against infection of humans, and possibly other mammals,
by a virus which causes, or at least contributes to, the
disease termed Chronic Fatigue Immunodysfunction
Syndrome. This invention involves the discovery by the
W092/0~760 ~CT/~S91/06238
20~97~1
inventors and the substantial isolation of the apparently
unknown CFIDS-associated virus, CAV.
It is believed that at least a percenta~e of
patients, both human and anlmal, exhibiting CFIDS
symptoms are su~ering from in~ction by CAV. This virus
i5 present in the body fluids of a 6tatistically-
significant number of suspected human CFIDS patients,
b~sed on the physical symptoms normally associated with
this disease, e.g., ~he presence of a chronic illness
with a pattern of clinical symptoms, immunologic
abnormalities, activation of herpes viruses and
abnormalities of the central nervous system. Suspected
CFIDS patients who do not test positive for the presence
of this virus are believed to be suffering from a
different disease, or to have presently undetectable
levels of viral infection in the body fluids assayed.
This virus may also be the causative agent of other
diseases with symptoms similar to the above-defined CFIDS
symptoms, but which diseases are known by other names.
CAV and polypeptides thereof, which may be
found in cells of body ~luids of a human patient with
CFIDS symptoms, have been substantially isolated from
contaminants with which the virus and its polypeptides
occur in natural sources. CAV or a polypeptide thereof
may also be obtained substantially isolated from
contaminants with which it is associated by means of its
production, e.g., by recombinant means or by chemical
synthesis. Such natural sources and/or production
sources include human cells or cellular components, cells
or cellular components of any other animal infected by
CAV, host cell expression systems, cell culture
supernatants, chemical purification eluates and the like.
The terms "substantially isolated" or
"purified" as used herein with reference to CAV or CAV
polypeptides is defined as follows. A composition of CAV
W092/057~0 PCT/US91/06~38
?.D~97~1
or a polypeptide thereof is substantially isolated from a
natural or production source, as defined above, where the
percentage of CAV or its polypeptide relative to the
source and without regard to other contaminants i9 ~t
least 10% on a weight percenta~e basis. ~he de~initlon
o~ "subs~antl~lly isolated" ~rom a natural or production
source also encompasses a percentage purific~tion o~ ~t
least 25~ on a weight percentage basis. Similarly a
composition of CAV or a polypeptide thereof is
substantially isolated from a natural or production
source as deflned above where the percentage of CAV or
its polypeptide relative to the source and without regard
to other contaminants is at least 40% on a weight
percentage basis. The definition of substantially
isolated may include a purification percentage of at
least 60~ on a weight percentage basis.
This virus may be characterized by one of the
following morphological, physical and biological
features. The virus may also be character.ized by a
combination of two or more of these features of the CAV
prototype virus of this invention.
The term "CAV", as will be understood by viral
taxonomists, includes the entire viral species
characterized by the prototype isolate described herein.
It is understood that CAV includes both the prototype
isolate as well as other isolates, as described below.
There ara many characteristics of the protot~pe isolate
which a taxonomist could use to identify and classify new
CAV isolates. Based on the prototype virus specifically
exemplified in ~he following examples, CAV may be
morphologically characterized as a retrovirus,
particularly a non-C retrovirus which is capable of
infecting humans. Electron microscopy of viral particles
formed in infected human cell cultures (see Figs. 3 and
4) sugqests that CAV is a non-C-type retrovirus because
W092/05760 PCT/US91/06238
2~89761
of its diameter, morphology, formation and location of
intracellular virions. More specifically, as d~scribed
in Example 1 above, CAV-infected cells could be
characterized by electron dens~ circulAr virion~, 50
with electron-luscent cores and others w~th electron~
dense cores, associated with the rough endoplasmic
re~iculum and inside large abnormally distended
mitochondria in the cells. All particles are the same
shape and size, 46-50 nm (460-500~). No extracellular
virus is observed. No forms budding from the cytoplas~ic
membranes are observed. Thus, CAV-infected cells could
also be characterized by the presence of intracytoplasmic
particles.
CAV is believed to be specifically
distinguishable from the viruses previously identified
with CFIDS, namely Epstein-Barr virus, HHV-6 and a
variety of enteroviruses. CAV morphology also apparentl~
distinguishes it from the human C-type retroviruses, HTLV
I and HTLV II. The apparent location of its virions in
the mitochondria distinguishes CAV from HIV.
One characteristics of CAV appears to be its
ability to infect both human B and T cells. As described
in more detail in Example 1, this virus was apparently
propagated in culture by mixing leukocytes from CFIDS
patients with two types of human cell lines, H9
lymphoblastoid T cells and B-Jab lymphoblastoid B cells.
These cell lines are also permissive for HTLV I and HTLV
II, respectively. Both these cell lines are permissive
for xenotropic primate D type viruses, e.g., Mason Pfizer
monkey virus (MPMV), and Foamy (Spuma) viruses [see, Fine
et al, Daniel et al, Barker et al and Hooks et al, cited
above].
Another possible characterizing feature of CAV
is its apparent tRNA primer binding site (P8S)
preference. Retroviruses can be categorized with respect
W0~2/05760 PCT/US91/0623X
2~8~ 6~
to the DNA sequence in the U5 region of their S' LTR
which binds transfer RNA's (tRN~) for certain types o~
amino acids ~see, e.g., F. Harada et al, ~pn. ~. C~nce~
~, 81:232-2~7 (1990)]. For example, a C typ~ virus,
such as HrrLV I or II, has a tRNA prim~r bindin~ sit~
TGGGGGCTCGTCCGGGAT which binds the tRN~ for proline. In
fact, all mammalian C-type viruses use the tRNA site for
proline except HIV. As descr.ibed in detail in Example 7,
the PCR technique was utilized to amplify the U5 region
in CAV to determine its tRNA binding site. The results
of this experiment indicated that the primer binding site
is for the tRNA of lysine. This result further indicates
that CAV is a non-C type retrovirus.
Yet another way a taxonomist may characterize
CAV is by the presence of the low molecular weight g3_
proteins, pll-12, pl3-1~, p27-28. As described in detail
in Example 8, the apparent CAV qaq proteins of these
molecular weights were immunoprecipitated from leukocytes
of CFIDS patients using a mouse monoclonal antibody (MAb)
K-1 [described in E. DeFreitas et al, AIDS Research_and
Human Re.troviruses, 3:19-32 (1987), as the HTLV I MAb in
Table 2, p. 26] which recognizes an antigenic determinant
on the ~ protein of HTLV I, II and Simian T cell
lymphotropic virus (STLV). Classes of primate and non-
primate animal retroviruses have such characteristicallysized qaq proteins [J. Leis et al, J. Virol., 62:1808-
1809 (1988)].
It appears that the virus has the ability to
induce the presence of viral qaq proteins in the nucleus
and cytoplasm of cells which it infects. CAV may also be
characterized, therefore, by immunohistochemical staining
of the CFIDS leukocytes using K1 Mab as having viral qaq
proteins located in the nucleus as well as the cytoplasm
of infected cells. This characteristic of viral g~
protein localization also indicates a non-C type
wo9~/o57~n PCT/US91/06238
~ ~ ~ 9 l 61
retrovirus. The virus may also be characterized by the
presence o~ a qaq gene sequence which di.~ers ~rom the
g~_ gene sequences o~ HTLV I and HTLV II.
The ~ollowing Tables I and II illustrate
comparative ~if~erences between C~V and other known human
and other animal retroviruses on the basis o~ the above-
mentioned reported viral characteristics, and the
symptomology which known retroviruses induce in infected
host~.
W092/0~760 PCT/US91/06238
20g~751
11
Table I
SUMMARY OF CORRELATIONS OF CFIDS RETROVIRUS
WITH KNOWN TYPES
Infects Intracyto Uses gag gag
Human T plasmic tRNA proteins pro~ein~
and particles lysine made in pll-12, pl3-14,
Virus B Cells by EM primer nucleus p27-28 (Mr)
~ +l + + +
B-type
MMTV o2 +
C-type (oncovirus)
Avian 0 0 o o 0
Mammalian 0 0 0 0 0
(non-primate)
Primate + o 0 0 +
(non-human)
Human
(HTLV I
and II) + 0 0 0 0
C-type (lentivirus)
HIV + o + o o
EIA~ 0 + + o +
D-type
MPMV + + + 0
Foamy + + ~ + 03
. . . ~
Plu~ (+) mc~n~ reponcd io Gter~ulre r,r, for CFIDS, in thi~ rpplic~dr~.
(O) me~n- u repo~ed ul G~er~ù~ro lo our l~ra/lcdgc.
3 0 ' No reporu r~ 1 4 protein cb~cleri~dr~ in li~er~b~re cllhougb Ihey were deduced by ~N~ ~cqucncu)g.
W092/05750 PCT/US91/06238
20~ 7b1
Table II
CORRELATIONS OF CFIDS RETROVIRUS
WITH KNOWN TYPES
RepQ~ed s~mpt-3Q~5lQ9y
Syncytia Immuno Reactiv.
Formation Suppres- Neurologic Fatigue/ of
Virus in vitro sion Dysfunction Wasting Herpes
CAV + + + + +
B-type
MMTV 0 0 o o 0
C-type (oncovirus)
Avian 0 + + ~ +
Mammalian 0 + + + +
(non-primate)
Primate 0 + + 0 +
(non-human)
Human
(HTLV I
and II) 0 + + o O
C-type (lentivirus)
HIV + + + + +
EIAV 0 + 0 +
D-type
MPMV + + + + +
Foamy + ~ 04 0 +
-- . . ---- - ~
l~ol~ from naral ti5~UC.
WO9~/0~6~ PCT/US91/06238
2~97 ~1
CAV, or a subtype of the virus, may be
characterized by the ~resence of a polynucleotide
sequence, either RNA or DNA, which may be obtained, and
its nucleotides identified, by the application of
standard sequencing techniques, including poly~orase
chain reaction techniques (PCR), to sources containiny
the substantially isolated virus. It is within the
routine skill in the art to obtain polynucleotide
sequences of a substantially isolated virus from sources
thereof using the techniques and se~uences described
herein. Such sources are defined above as natural
sources or production sources.
Polynucleotide sequences of CAV or of subtype
viruses thereof are thus part of this invention.
Sequences which contain one or more nucleotide
differences from the sequences of CAV but which code for
sequences homologous to CAV, are also included in the
present invention. Due to the high rate of transcription
error in RNA viral replication, it is anticipated that
CAV polynucleotide sequences will be characterized by
certain variation among isolates, and possibly
hypervariable reg.ions or domains. Distinct CAV subtypes
may be characterized by sequences which vary from the
sequences of the prototype virus described herein, but
which share overall genomic organization and large
regions o~ conserved sequences. Particularly, virally
encoded enzyme sequences are expected to be similar among
subtypes of CAV. Viral homology at the amino acid level
among CAV subtypes is expected to be at least 40%. More
specifically, such homology is expected to range between
abo'lt 40% to about 95%. Homology between subtypes may be
at least 50%. Other subtypes of CAV may have amino acid
homologies of at least 60% or more. Some isolates will
be at least 70% homologous, while others will be at least
80% or 90% homologous.
W O 92t05760 PC~r/US91/06238
208~7~1
14
It is understood that CAV polynucleotide
sequences include those sequences which hybridi~e under
stringent or relaxed hybridization conditions [5ee, T.
Maniatis et al, Molecular Clonin~ ~ho~or~ M~
Cold Spring Harbor Laboratory (1982), pagos 387 to 3~9]
to the native CAV nucleotide (RN~ or DNA) sequences.
Pr~ferably, high stringency conditions are employed ~or
hybridization of CAV sequences. A polynucleotide
sequence of this invention may also be capable o~
hybridizing under stringent conditions to a
polynucleotide sequence encoding an antigenic site of
CAV. An example of stringent hybridization condition is
hybridization in 4XSSC at 650C, followed by a washing in
O.lXSSC at 65C for an hour. Alternatively an exemplary
stringent hybridization condition is in 50~ formamide,
4XSSC at 50C.
Polynucleotide seguences may hybridize to
native CAV sequences under relaxed hybridization
conditions. An example of such non-stringent
~0 hybridization conditions are ~XSSC at 50C or
hybridization with 30-40% formamide at 42C.
A polynucleotide sequence of this invention may
also differ from the CAV polynucleotide sequences
described above due to the degeneracies of the genetic
code. Further, a polynucleotide sequence according to
this invention may be a sequence which is the complement
of a CAV polynucleotide sequence. Polynucleotide
sequences of CAV are expected to contain sequences not
found in HTLV I or HTLV II.
Allelic variations (naturally-occurring base
changes in the species population which may or may not
result in an amino acid change) of CAV DNA sequences are
also included in the present invention, as well as
analogs or derivatives thereof. Similarly, DNA sequences
which code for CAV peptides or antigenic sites, but which
differ in codon sequence due to the degeneracies of the
genetic code or variations in the DNA sequence o~ CAV
which are caused by point mutations ox by induced
modifications to enhance the activity, half-life or
production of the peptides encoded thereby are also
encompassed in the invention.
Modifications of interest in the CAV sequences
may include the replacement, insertion or deletion of a
selected nucleotide~s) or amino acid residue(s) in the
coding sequences. For exa~ple, a structural gene may be
manipulated by varying individual nucleotides, while
retaining the correct amino acid(s), or the nucleotides
may be varied, so as to change the amino acids, without
loss of biological activity. Mutagenic techniques for
such replacement, insertion or deletion, e.g., in vitro
mutagenesis and primer repair, are well known to one
skilled in the art [See, e.g., United States Patent No.
4,518,58~].
One potential source of polynucleotide
sequences of CAV is the DNA obtained from supernatant
extracted from tissue culture cells cocultivated with
leukocytes from a human CFIDS patient. T~is DNA was
depssited with the American Type Culture Collection
(ATCC), 12301 Parklawn Drive, Rockville, Maryland 20852,
U.S.A. pursuant to the Budapest Treaty on the
International Recognition of the Deposit of Microorganism
~or the Puxposes of Patent Procedure on August 28, 1991
and designated ATCC No. (not yet provided by ATCC).
CAV polynucleotide sequences may be obtained
and their nucleotides identified by the application of
standard sequencing techniques to the lambda Fix
amplified phage library of Sau3A-digested genomic DNA
containing integrated CAV, similarly deposited with the
ATCC on August 28, 1991 and designated ATCC No. 75087.
.. ~ , .
~U~ 210~1 1992
~!~91/06 ~3 8
Another potential source of CAV polynucleotide
sequ~nces obtainable by the application of standard
sequencing techniques i~ the Bluescript plasmid library
of BamHI~digested genomic DNA containing integrated CAV
in an E. coli strain, similarly deposited with the ATCC
on ~ugust 28, 1991 and designated ATCC No. 75088.
A CAV polynucleotide sequence may comprise a
nucleic acid sequence obtained from one of the ATCC
deposits identified above. CAV or a subtype thereof, may
also be characterized as comprising all or a portion of a
DNA sequence reported in Figs. lA and lB below. In
addition to the above, other CAV sequences may be
o~tained and/or created from the above deposits or from
other animal cell sources. A DNA sequence of this
invention may also be capable of hybridizing under
~tringent conditions to a DNA sequence from one of the
above ATCC deposits. A DNA sequence of this invention
may also be capable of hybridizing under stringent
conditions to a DNA sequence of Figs. lA and lB.
CAV is not limited to containing the sequences
of Figs. 1 or 2. The final characterization of CAV is
within the skill of a viral taxonomist with reference to
the prototype isolate described herein. Any on~ or more
of the above-described characteristics may be sufficient
to classify a new isolate as CAV.
Still another aspect of the invention is a CAV
polypeptide in substantially isolated form. Polypeptide
sequences of CAV or of subtype viruses thereof are also
part of this invention. A CAV polypeptide may be encoded
by the CAV polynucleotide sequences described above.
Preferably, a CAV polypeptide compri~es a sequence of at
least 10 amino acids encoded by the genome of CAV. A CAV
polypeptide may also comprise all or a fragment of a CAV
antigenic determinant. A CAV polypeptide may also
compri~e all or a fragment of a structural viral protein.
SUBS~4EET
~ W092/05760 PCT/US91/06~38
2 0 ~
A CAV polypeptide may also comprise all or a fragment of
a viral non-structural protein.
Polypeptide sequences which contain one or more
amino acid differences ~rom the polypeptide sequences of
CAV, but which code for sequences sharing homology at the
amino acid level to CAV, are also included in the present
invention. As described above, transcription error in
viral replication may produce CAV polypeptide sequences
characterized by certain hypervariable amino acid regions
or domains. Distinct CAV subtypes may be characterized
by polypeptide sequences which vary from the polypeptide
sequences of the prototype virus described herein, but
which share overall structural (primary, secondary and
tertiary) organization and large regions of conserved
sequences with the prototype virus described herein.
Particularly, virally encoded enzyme sequences are
expected to be similar among subtypes of CAV.
Viral homology at the amino acid level ~or CAV
subtypes is expected to be at least 40%. More
specifically, such homology is expected to range between
about 40% to about 90%. Homology between subtypes may be
at least 50%. Other subtypes of CAV may have amino acid
homologies of at least 60% or more; e.g., 70% or 80%.
This homology can be evaluated over the entire genome, or
discre~e fra~ments thereof, such as particular viral
protein coding domains, especially conserved (non-
structural~ proteins, or any of the sequences disclosed
herein.
Other polypeptide sequences of this invention
may be sequences capable of hybridizing under stringent
conditions to a CAV amino acid sequence. A polypeptide
sequence of this invention may also be capable of
hybridizing under stringent conditions to an amino acid
sequence encoding an antigenic site of CAV. Polypeptide
wO g2/0~760 2 0 ~ ~ r~ ~ ~ PCT/US91/06238
sequences of CAV are expected to contain sequences not
found in HTLV I or HTLV II.
Modified CAV polypeptides, analogs or
derivatives thereof are also encompassed by this
invention. A CAV polypeptide analog may be a mutant or
modified protein or polypepticle that has a homology of at
least 40% to CAV. More preferably a modified CAV protein
may have a homology of about 60%, and most preferably
above about 80% to a native CAV polypeptide.
Typically, CAV polypeptide analogs differ by
only l, 2, 3, or 4 codon changes. Examples include CAV
polypeptides with minor amino acid variations from the
amino acid sequences of native CAV polypeptides or any of
the above-described CAV polypeptides, in particular,
conservative amino acid replacements. Conservative
replacements are those that take place within a family of
amino acids that are related in their side chains.
Genetically encoded amino acids are generally divided
into four families: (l) acidic = aspartate, glutamate;
(2) basic = lysine, arginine, histidine; (3) non-polar =
alanine, valine, leucine, isoleucine, proline,
phenylalanine, methionine, tryptophan; and (4) uncharged
polar = glycine, asparagine, glutamine, cystine, serine,
threonine, tyrosine. Phenylalanine, tryptophan, and
tyrosine are sometimes classified jointly as aromatic
amino acids. For example, it is reasonable to expect
that an isolated replacement of a leucine with an
isoleucine or valine, an aspartate with a glutamate, a
threonine with a serine, or a similar conservative
replacement of an amino acid with a structurally related
amino acid will not have a major effect on the CAV
polypeptide.
The isolation and identification of CAV and
polynucleotide and polypeptide sequenc~s also enables the
development of diagnostic reagents and probes useful in
WO9~/05760 P~T/US9~/06~38
20$37~
19
Western blots, ELISA's or other diagnostic assays,
immunogenic or therapeutic compositions and immunogenic
compositions for the generation of antibodies and vaccine
compositions. These compositions may be useful in
diagnosis, treatment and prevention of CFIDS or related
diseases.
Thus, as another aspect of this invention, a
diagnostic reagent is provided which is useful in the
diagnosis of CFIDS or a related disease. As described in
more detail below, such a reagent can comprise CAV
polynucleotide sequences, including complementary
sequences thereto and the other sequences described
above. Such a reagent may also comprise a CAV
polypeptide sequence as described above. The CAV
sequences can be optionally associated with a detectable
ligand, a therapeutic or toxic molecule.
The polynucleotide or polypeptide reagent may
be capable of binding to a sequence present in the HTLV
II aaq protein and to a sequence present in CAV. The
reagent may also comprise a polynucleotide sequence
capable of hybridizing to an antibody to CAV. The
reagent may be in the form of a hybridization probe for
detection of CAV in patients. The reagent may be in the
form of a PCR primer to enable the amplification of other
sequences of C~V. The reagent may also be an antibody to
an epitope or antigenic site on the CAV sequence.
PCR primer sequences employing CAV
polynucleotide sequences as reagents of this invention
are at least about 10 bases in length, with an
intervening sequence of at least 100 bases to as large as
1500 bases therebetween, according to conventional PCR
technology. Larger sequences, up to about 3~
nucleotides, may also be employed as a practical upper
limit. However, it is possible that larger or smaller
sequence lengths may be useful based upon modifications
W~2~057fi~ PCT/US91/06~38
208~7~1
to the PCR technology. At present the length of the
primer is not a limitation upon the disclosure o~ this
invention.
In a similar fashion, hyhridization probes of
the invention are desirably at least 10 bases in length,
based on current technology. Typically, such probe
sequences are no larger than about 50 bases in length.
Probe lengths may more preferably range between 15 to 30
bases in length. However, it is possible that smaller or
larger probe sequences may be useful in the methods and
compositions of this invention. Probe length is not a
limit~tion of this invention, as one of skill in the art
is presumed to have the knowledge to design probes of
suitable length. Hybridization probes o~ this invention
may desirably be associated with detectable labels, as
described below.
For use in conventional assays as well as in
the assays described below, the primers and probes of
this invention may be capable of selective hybridization
to a target CAV sequence. "Selective hybridization" as
used herein may be defined as the ability of the probe to
detectably hybridize at a suitable stringency to a target
CAV sequence in a clinical sample from an infected
patient and not to detectably hybridize to other
sequencPs in the sample which are unrelated to CAV.
Se~uences which comply with this requirement may be
designed by one of skill in the art based on the
functional level of homology between the probe sequence
and the desired target CAV sequence. Only probes of
sufficient length and homology for the intended use will
selectively hybridize, the number of mismatches tolerated
increasing with the length of the probe. Typically,
probes will be at least 15 nucleotides in length~ more
preferably at least 20 and typically at least 25
nucleotides in length.
WO92/057hO PCT/US91/06238
208S ,` ~1
21
It should be understood that all of the
polynucleotide sequences and polypeptide sequences
described herein, whether for use as diagnostic or
therapeutic reagents, for research or otherwise may be
prepared by techniques known to one of skill in the art.
Such techniques include chemical synthesis (including
enz~matic synthesis methods), recombinant genetic
engineering techniques (including PCR), or various
combinations of these known techniques.
Conveniently, synthetic production of the
polypeptide sequences of the invention may be according
to the solid phase synthetic method described by
Merrifield in ~.A.C.S, 85:2149-2154 (1963). ~his
technique is well understood and is a common method for
preparation of peptides. Alternative techniques for
peptide synthesis are described in Bodanszky et al,
Pe~etide Synthesis, 2d edition (John Wiley and Sons:
1976). For example, the peptides of the invention may
also be synthesized using standard solution peptide
synthesis methodologies, involving either stepwise or
block coupling of amino acids or peptide fraqments using
chemical or enzymatic methods of amide bond formation.
[See, e.g. H.D. Jakubke in The_Peptides, Analysis.
Synthesis. ~ioloay, Academic Press (New York 1~87), p.
103-165; J.D. Glass, ibi-d., pp. 176-184; and European
Patent 0324659 A2, describing enzymatic peptide synthesis
methods.] These documents are incorporated by reference
herein.
All polynucleotide sequences and polypeptide
sequences of this invention may al o be prepared, and
modified if-desired, by conventional genetic engineering
techniques. Peptides may be prepared by known
recombinant DNA techniques, including cloning and
expressing within a host microorganism or cell a DNA
fragment carrying a coding sequence for the selected
W~92/05760 PCT/US91/06238
~ 9'~
22
peptide. Sys~ems for cloning and exprQssion o~ a
selected polypeptide in various microorganisms and cells,
including, for example, bacteria, mammalian c~lls, yeast,
baculoviruses and insect cells, are known and available
from private and public laboratories and depositories and
from co~nercial vendors. [See also, Sambrook et al,
cited above].
The CAV DNA obtained as described above or
modified as described above may be introduced into a
selected expression vector to make a recombinant molecule
or vector ~or use in the method of expressing CAV
polypPptides. Numerous types of appropriate expression
vectors are known in the art for mammalian (including
human) expression, insect cell expression, expression in
yeast, expression in fungus and bacterial expression, by
standard molecular biology techniques.
- These vectors and vector constructs contain the
CAV DNA sequences recited herein, which code for CAV
polypeptides of the invention, including antigenic or
immunogenic fragments thereof. The vector employed in
the method also contains selected regulatory sequences in
operative association with the CAV DNA coding sequences
of the invention. Regulatory sequences preferably
present in the selected vector include promoter
fragments, terminator fragments, polyadenylation
sequences, enhancer sequences, mar};er genes and other
suitable sequences which direct the expression of the
protein in an appropriate host cell. Introns with
functional splice donor and accPptor sites, and leader
sequences may also be included in an expression
construct, if desired. The resulting vector is capable
of directing the replication and expression of an CAV in
selected host cells. Expression constructs are often
maintained in a replicon, such as an extrachromosomal
W092~0S760 PCT/US91/06238
2 ~
23
element (e.g., plasmid) capable of stable maintenance in
a selected host.
The transformation procedure used depends upon
the host to be transformed, and various procedures are
known in the art. In order to obtain expression o~ the
CAV protein or polypeptide, recombinant host cells
derived from the transformants are incubated under
conditions which allow expression of the recombinant CAV
protein or polypeptide encoding sequence. These
conditions will vary, dependent upon the host cell
selected. However, the conditions are readily
ascertainable to those of ordinary skill in the art.
The resulting CAV protein or polypeptide
product may be puri~ied by such techniques as
chromatography, e.g., HPLC, affinity chromatography, ion
exchange chromatography, etc.; electrophoresis; density
gradient centrifugation; solvent extraction, or the like.
As appropriate, the product may be further purified, as
required, so as to remove substantially any host cell
proteins which are also secreted in the medium or result
from lysis of host cells, so as to provide a product
which is at least substantially free of host debris,
e.g., proteins, lipids and polysaccharides.
For expression of a CAV peptide or protein in
mammalian cells, expression vectors may be synthesized by
techniques well known to those skilled in this art. The
components of the vectors, e.g. replicons, selection
genes, enhancers, promoters, marker genes and the like,
may b~ obtained from natural sources or synthesized by
known procedures. See, Kaufman et al, J. Mol. Biol.,
159:511-521 (1982~; and Kaufman, Proc. Natl. Acad. Sci.,
USA, 82:689-693 (1985). Alternatively, the vector DNA
may include all or part of the bovine papilloma virus
genome [Lusky et al, Cell, 36:391-401 (1984)] and be
W092~05760 PCT/US9l/06238
208~ 7Gl
24
carried in cell lines such as C127 mouse cell.s as a
stable episomal element.
Selected promoters for mammalian cell
expression may include sequences encoding highly
expressed mammalian viral genes which have a broad host
range, such as the SV40 early promoter, mouse mammary
tumor virus LTR promoter, adenovirus major late promoter
(Ad MLP), and herpes simplex virus promoter. Non-viral
gene sequences, such as the murine metallothionein gene,
also provide useful promoter sequences. Examples of
enhancer elements include the SV40 ~arly gene enhancer
[Dijkema et al, EMBO J. 4:761 (1985)] and the
enhancer/promoters derived from the long terminal repeat
~LTR) of the Rous Sarcoma Virus [Gorman et al, Proc.
Natl. Acad. Sci., 79:6777 (1982)] and from human
cytomegalovirus [Boshart et al, Cell, 41:521 (1985)].
[See, also, Sassone-Corsi and Borelli, Trends Genet.,
2:215 (1986); Maniatis et al, Science, 236:1237 (1987);
and Alberts et al, Mol. Biol. of the Cell, 2d edit.
(1989)]. Examples of transcription terminator/
polyadenylation signals include those derived from SV40
~Sambrook et al, cited above].
Mammalian replication systems include those
derived from animal viruses, which require trans acting
factors to replicate. Examples of mammalian replicons
include those derived from bovine papillomavirus and
Epstein-Barr virus, papovaviruses, such as 5V40 [Gluzman,
Cell, 23:175 (1981)] or polyomavirus. Examples of such
mammalian-bacteria shuttle vectors include pMT2 [Kaufman
et al, Mol. Cell. Biol., 9:946 (1989) and pHEBO [Shimizu
et al, Mol. Cell. Biol., 6:1074 (1986)].
Methods for introduction of heterologous
polynucleotides into mammalian cells are known in the art
and include dextran-mediated transfection, calcium
phosphate precipitation, polybrene mediated transfection,
W092/057~0 RCT/US91/06238
2Q8$~
protoplast fusion, electroporation, encapsulation of the
polynucleotide(s) ir. liposomes, and direct microinjection
of the DNA into nuclei.
Mammalian cell lines available as hosts for
expression are known in the art and include many
immortalized cell lines available from tha ATCC,
including but not limited to, Chinese hamster ovary (CHO)
cells, HeLa cells, baby hamster kidney (BHK) cells,
monkey kidney cells (COS), human hepatocellular carcinoma
cells ~e.g., Hep G2), and a number of other cell lines.
The polynucleotide encoding CAV proteins or
polypeptide fragments can also be inserted into a
suitable insect expression vectar, and operably linked to
control elements within that vector. Vector construction
employs techniques which are known in the art.
Generally, the components of the expression system
include a transfer vector, usually a bacterial plasmid,
which contains both a fragment of the baculovirus genome,
and a convenient restriction site for insertion of the
heterologous gene or genes to be expressed; a wild type
baculovirus with a sequence homologous to the
baculovirus-specific fragment in the transfer vector
which allows for the homologous recombination of the
heterologous gene into the baculovirus genome; and
appropriate insect host cells and growth media.
Materials and methods for baculovirus/insect
cell expression systems are commercially available in kit
form from, inter alia, Invitrogen, San Diego CA ("MaxBac"
kit). These techniques are generally known to those
skilled in th~ art and fully described in Summers and
Smith, Texas Aqricultural Experiment Station Bulletin No.
1555 (1987) (hereinafter "Summers and Smith").
An insect cell transfer vector contains
preferably a promoter, leader (if desired), one or more
CAV coding se~uence, and a transcription termination
W092/0~760 PCT/US9l/06238
2089~ ~
26
sequence. The plasmid usually also contains the
polyhedrin polyadenylation signal [Miller et al, Ann.
Rev. Microbiol., 42:177 (1988)]) and a procaryotic
ampicillin-resistance (amp) gene and origin of
replication ~or selection and propagation in E. coli.
Currently, the most commonly used transfer vector for
introducing foreign genes into AcNPV is pAc373. Many
other vectors, known to those of skill in the art, have
also been designed including pVL985 [See, Luckow and
Summers, Viroloqy, 17:31 (1989)].
Examples of promoters include sequences derived
from the gene encoding the viral polyhedron protein
[Friesen et al, "The Regulation of Baculovirus Gene
Expression," in: The Molecular Bioloqy of Baculoviruses
(ed. Walter Doerfler) (1986); EPO Publ. Nos. 127 839 and
lS5 476] and the gene encoding the plO protein [Vlak et
al, J. Gen. Virol., 69:765 (1988)].
DNA encoding suitable signal sequences can be
derived from genes for secreted insect or baculovirus
proteins, such as the baculovirus polyhedrin gene
[Carbonell et al, Gene, 73:409 (1988)]. Alternatively,
leaders of non-insect origin, such as those derived from
genes encoding human ~-interferon CMaeda et al, Nature,
315:592 (1985)]; human gastrin-releasing peptide [Lebacq-
Verheyden et al, Molec. Cell. Biol., 8:3129 ~i988)~;
human IL-2 [Smith et al, Proc. Nat'l Acad. Sci. USA,
82:8404 ~1985)]; mouse IL-3 [Miyajima et al, Gene, 58:273
(1987)]; and human glucocerebrosidase [Martin et al, DNA,
7:99 (1988)], can also be used to provide for secretion
in insects.
- Methods for introducing heterologous DNA into
the desired site in the baculovirus virus are known in
the art [See, Summers and Smith supra; Ju et al. (1987)
supra; Smith et al, Mol. Cell. Biol., 3:2156 (1983); and
Luckow and Summers (1989) supra]. After inserting the
wo ~2/n~760 PCr/US91/06238
2~897~1
27
DNA sequence encoding the CAV polypeptide or protein into
the trans~er vector, the vector and khe wild type viral
genome are transfected into an insect host cell where the
vector and viral genome are allowed to recombine. The
newly formed baculovirus expression vector is
subsequently packaged into an infectious recombinant
baculovirus. To identify recombinant viruses, a visual
screen is performed by plaquing the transfection
supernatant onto a monolayer of insect cells by
techniques known to those skilled in the art [~Current
Protocols in Microbiology" Vol. 2 (Ausubel et al. eds) at
16.8 (Supp. 10, 1990); Summers and Smith, supra; Miller
et al. (1989) supra]. Recombinant viruses are identified
by the presence of r~fractile occlusion bodies.
Recombinant baculovirus expression vectors have
been developed for infection into several insect cells.
For example, recombinant baculoviruses have been
developed for, inter alia: Aedes aegypti , Autographa
californica, ~ombvx mori, DrosoPhila melanoqaster,
Spodoptera fruqiPerda, and Trichoplusia ni [PCT Pub. No.
WO 89/046699; Carbonell et al, J._Virol., 56:153 (1985);
Wright, Nature, 321:718 (1986); Smith et al, Mol. Cell.
Biol., 3:2156 (1983); and see generally, Fraser et al, In
Vitro Cell. Dev. Biol.~ 25:225 (1989)].
Bacterial expression techniques and expression
system components are also known in the art. Among the
components of a bacterial expression vector or construct
include a bacterial promoter, a transcription initiation
region, an RNA polymerase binding site, a transcription
terminator sequence, a signal sequence and an operator,
^ as well as the desired CAV sequence. Constitutive
expression may occur in the absence of negative
regulatory elements, such as the operator. In addition,
positive regulation may be a~hieved by a gene activator
protein binding sequence. An example of a gene activator
WO 92/05760 PCI/US91/06238
~89761
28
protein is the catabolite activator protein (CAP), which
helps initiatP transcription o~ the lac operon in
Escherichia coli [Raibaud et al, Ann. Rev. Genet., 18:173
(1984)]. Regulated expression may therefore be either
positive or negative, thereby either enhancing or
reducing transcription.
Examples of promoter sequences include
sequences derived from sugar metabolizing enzymes, such
as galactosa, lactose (lac) [Chang et al, Nature,
198:105~ (1977)], and maltose; sequences derived from
biosynthetic enzymes such as tryptophan (~) [Goeddel et
al, Nuc. Acids Res., 8:4057 (1980); Yelverton et al,
Nucl. Acids Res., 9:731 (1981); U.S. Patent
No. 4,73~3,921; EPO Publ. Nos. 036 776 and 121 775]; the
g-lactamase (bla) promoter system [Weissmann, "The
cloning of interferon and other mistakes." In Interferon
3 (ed. I. &resser) (1981)~; bacteriophage lambda PL
[Shimatake et al, Nature, 292:128 (1981~ ] and T5 [U.S.
Patent No. 4,689,406] .
Synthetic promoters which do not occur in
nature are useful, e.g. the hybrid promoter described in
IJ.S. Patent No. 4,551,433, and the tac promoter [Amann et
al, Gene, 25~167 (1983); de Boer et al, Proc. Natl. Acad.
Sci., 80:21 (1983) ] . A bacterial promoter can include
naturally occurring promoters of non-bacterial origin,
e.g., the bacteriophage T7 RNA polymerase/promoter system
[Studier et al, 2. Mol. Biol., 189: 113 (1986); Tabor et
al, Proc. Natl. Acad Sci., 82:1074 (1985); see, also,
EPO Publ. No. 267 851].
In addition to a functioning promoter sequence,
an efficient ribosome binding site is also useful for the
expression of foreign genes in prokaryotes, e.g., the
Shine-Delgarno (SD) sequence of E. coli [Shine et al,
- Nature, 254:34 (1975) ~ ~
W092/05760 PCT/US91/06238
2~8~7~1
29
DNA encoding suitable signal sequences that
provide for secretion o~ the foreign protein in bacteria
can be derived from genes for secreted bacterial
proteins, such as the E. co~i outer membrane protein gene
(~) [Masui et al, in: Experimental Manipulation of
Gene Expression (19~3); Ghrayeb et al, EMBO J., 3:2437
(1984)] and the E. coli alkaline phosphatase signal
sequence (~g~) [Oka et al, Proc. Natl._ Acad. Sci.,
82:7212 (19~5); seet also, U.S. Patent No. 4,336,336]].
As an additional example, the signal sequence of the
alpha-amylase gene from various Bacillus strains can be
used to secrete heterologous proteins from B. subtilis
[Palva et al, Proc. Natl. Acad. Sci. USA, 79:55~2 (1982);
EPO Publ. No. 244 042]. The CAV proteins can also be
secreted from the cell by creating chimeric DNA molecules
that encode a fusion protein with the signal peptide
sequence fragment.
Examples of transcription termination sequences
are sequences derived from genes with strong promoters,
such as the ~E~ gene in E. coli as well as other
biosynthetic genes.
Expression constructs may be maintained in a
replicon, such as an ex~rachromosomal element (e.g., a
high or low copy number plasmid) capable of stable
maintenance in a host cell. Alternatively, the
expression constructs can be integrated into the
bacterial genome with an integrating vector. Integrating
vectors typically contain at least one sequence
homologous to the bacterial chromosome that allows the
vector to integrate. Integrations appear to result from
recombinations between homologous DNA in the vector and
the bacterial chromosome [see, e.g., EPO Publ. No. 127
328]. Integrating vectors may also be comprised of
bacteriophage or transposon sequences.
W09~/05760 PCT/US9~/06238
'20~97 ~
Alternatlvely, some of the above described
components can be put together in transformation vectors~
Transformation vectors are typically comprised of a
selectable marker that is either maintained in a replicon
or developed into an integrating vector. Selectable
markers can be expressed in the bacterial host and may
include genes which render bacteria resistant to drugs
such as ampicillin, chloramphenicol, erythromycin,
kanamycin ~neomycin), and tetracycline [Davies et al,
Annu. R~ev Microbiol., 32:469 (1978)]. Selectable
markers may also include biosynthetic genes, such as
those in the histidine, tryptophan, and leucine
biosynthetic pathways.
Bacterial expression and transformation
vectors, either extra~chromosomal replicons or
integrating vectors, have been developed for
transformation into many bacteria. See, e.g., the
vectors described in Palva et al, Proc. Natl. Acad. Scl.
USA, 79:5582 (1982); Shimatake et al, Nature, 292:128
(1981); Powell et al, Aepl. Environ. Microbiol., 54:655
(1988); Powell et al, AP~l. Environ. Microbiol., 54:655
(1988) and U.S. Patent No. 4,745,056].
Methods of introducing exogenous DNA into
bacterial hosts are well-known in the art, and typically
include either the transformation of bacteria treated
with CaC12 sr other agents, such as di~alent cations and
DMS0. DNA can also be introduced into bacterial cells by
electroporation. Transformation procedures usually vary
with the bacterial species to be transformed. See e.g.,
Masson et al, FEMS Microbiol. Lett., 60:273 (1989);
Miller et al, Proc. Natl. Acad. Sci., 85:856 (1988);
Chassy et al, FEMS Microbiol. Lett., 44:173 (1987);
Augustin et al, FEMS Microbiol. Lett., 66:203 (1990) and
numerous other references known to the art.
wo 92/0g760 P~r/ussl/0623g
2 ~ 7 6 1
31
Yeast expression systems are also known to one
of ordinary skill in the art. Typically, a vector or
expression construction for yeast expression includes a
promoter, leader tif desired), a CAV coding sequence and
transcription termination sequence. A yeast promoter
includes a transcription initiation region, an RNA
polymerase binding site (the "TATA Box"), a transcription
initiation site, an upstream activator s~qu~nce (UAS),
which, permits regulated (inducible3 expression.
Constitutive expression occurs in the absence of a UAS.
Regulated expression may be either positive or negative,
thereby either enhancing or reducing transcription.
Particularly useful promoter sequences,
include, e.g., alcohol dehydrogenase (ADH) ~EP0 Publ. No.
284 044], enolase, glucokinase, glucose-6-phosphate
isomerase, glyceraldehyde-3~phosphate-dehydrogenase (GAP
or GAPDH), hexokinase, phosphofructokinase, 3-
phosphoglycerate mutase, and pyruvate kinase (PyK) [EPO
Publ. No. 329 203~. The yeast PHO5 gene, encoding acid
phosphatase, also provides useful promoter sequences
[Myanohara et al, Proc. Natl. Acad. Sci. USA, 80:1
(1983)].
Synthetic hybrid promoters include the ADH
regulatory ~equence linked to the GAP transcription
activation region tU.S. Patent Nos. 4,876,197 and
4,880,734], the regulatory sequences of either the ADH2,
GAL4, GAL10, or PHO5 genes, combined with the
transcriptional activation region of a glycolytic enzyme
gene such as GAP or PyK [EP0 Publ. No. 164 556]. Non-
yeast origin sequences may function as promoters [See,
e.g., Cohen et al, Proc. Natl. Acad._Sci. USA, 77:1078
~1980); and Henikoff et al, Nature, 283:835 (1981)].
For intracellular expression in yeast, a
promoter sequence may be directly linked with the DNA
molecule. For secretion of the expressed protein, DNA
W092~057~0 PCT/US91/06~38
2~897~1
32
encoding suitable signal sequences can be derived from
genes for secreted yeast proteins, such as the yeast
invertase gene [EPO Publ. No. 012 873; JPO Publ. No.
62,096,086] and the A-factor gene ~U.S. Patent No.
4,588,684]. Alternatively, leaders of non-yeast origin,
such as an interferon leader, exist that also provide for
secretion in yeast [EPO Publ. No. 060 057]. A pre~erred
class of secretion leaders employ a fragment of the yeast
alpha-factor gene [See, e.g., U.S. Patent Nos. 4,546,083
and 4,870,008; EPO Publ. No. 324 274; and PCT Publ. No.
WO 89/02463].
Expression constructs are often maintained in a
replicon (e.g., a high or low copy number plasmid) which
may have two replication systems, allowing it to be
maintained in yeast for expression and in a procaryotic
host for cloning and amplification. Examples of such
yeast-bacteria shuttle vectors include YEp24 [Botstein et
al, Gene, 8:17-24 (1979)], pCl/l [Brake et al, Proc.
Natl. Acad. Sci USA, 81:4642-4646 (1984)], and YRpl7
[Stinchcomb et al, J. Mol. Biol., 158:157 (1982)].
Alternatively, the expression constructs can be
integrated into the yeast genome with an integrating
vector which typically contain at least one sequence
homologous to a yeast chromosome that allows the vector
to integrate, and preferably contain two homologous
sequences flanking the expression construct [Orr-Weaver
et al, Meth. Enzymol. 101:228-245 (1983)].
Typically, extrachromosomal and integrating
expression constructs may contain selectable markers to
allow for the selection of yeast strains that have been
trans~ormed including biosynthetic genes that can be
expressed in the yeast host, such as ADE2, HIS4, LEU2,
TRPl, and ALG7, and the G418 resistance gene. In
addition, a suitable selectable marker may also provide
yeast with the ability to grow in the presence of toxic
W~92/0~760 2a$~ ' ~1 PCTtUS9l/06238
compounds, such as metal. For example, the presence of
CUP1 allows yeast to grow in the presence of copper ions
[Butt et al, Microkiol Rev., 51:351 (1987)].
Alternatively, some of the above described
components can be put together into transformation
vectors, which typically comprise a selectable marker
that is either maintained in a replicon or developed into
an integrating vector, as described above.
Expression and transformation vectors, either
extrachromosomal replicons or integrating vectors, have
been developed for transformation into many yeast
strains. See, e.g., Kurtz et al, Mol. Cell. Biol., 6:142
(1986); Kunze et al, J. Basic Microbiol., 25:141 (1985);
Gleeson et al, J. Gen. Microbiol., 132:3459 (1~86); Das
et al, J. Bacteriol., 158:1165 (1984); De Louvencourt et
al, J. Bacteriol., 154:737 (1983) and numerous other
references known to the art.
~; Methods of introducing exogenous DNA into yeast
hosts are well-known in the art, and typically include
either the transformation of spheroplasts or o~ intact
yeast cells treated with alkali cations. Transformation
procedures usually vary with the yeast species to be
transformed. See, e.g., Kurtz et al, Mol. Cell. Biol.,
6:142 (1986); Gleeson et al, J._Gen. Microbiol., 132:3459
(1986); Das et al, J._Bacteriol., 158:1165 (198~); Cregg
et al, Mol Cell. Biol., _:3376 (1985), among others.
Fusion proteins provide another alternative to
direct expression of CAV proteins and polypeptides in
yeast, mammalian, baculovirus, and bacterial expression
systems. Typically, a DNA sequence encoding the N-
terminal portion of an endogenous protein (depending on
the host), or other stable protein, is fused to the 5l
end of heterologous coding sequences. Upon expression,
this construct will provide a fusion of the two amino
acid sequences. The resulting fusion protein optionally
W092/~57~0 PCTt~S91/~6238
2~8~76~
34
retains a cleavable sequence at the ~unction of the two
amino acid sequences for a processing enzyme to cleave
the host cells protein from the CAV gene [See, e.g.,
Nagai et al, Nature, 309:810 tl984) and EPO Publ. No. 196
056]. One example is a ubiquitin fusion protein that
preferably retains a site for a processing enzyme to
cleave the ubiquitin from the CAV protein. Through this
method, native CAV protein can be isolated [See, e.g.,
Miller et al, Bio!Technoloqy, 7O698 (1989)~.
Alternatively, the C~V protein or polypeptide
can be secreted from the selected host cell into the
growth media by creating chimeric DNA molecules that
encode a fusion protein comprised of a leader sequence
fragment that provides for secretion of the CAV protein
from the selected host cell. The adenovirus triparite
leader is an example of a leader sequence that provides
for secretion of a foreign protein in mammalian cells
[Birnstiel et al, Cell, 41:349 (1985); Proudfoot and
Whitelaw, ~Termination and 3' end processing of
; 20 eukaryotic RNA. In Transcri~tion and splicinq (ed. B.D.
Hames and D.M. Glover) (1988); Proudfoot, Trends Biochem.
SCi., 14:105 (1989) ] . Preferably, there are processing
sites encoded between the leader fragment and the foreign
gene that can be cleaved either in vivo or ln vitro.
Such leader sequence fra~ments are known to one of skill
in the art for the various selected host cells described
above.
The identification of the CAV polynucleotide
sequences and polypeptide sequences and the ultimate
sequencing of the entire CAV saquence permit the
development of suitable CAV-specific antibodies generated
by standard methods. As diagnostic or research reagents,
antibodies generated against these CAV sequences may be
useful in affinity columns and the like to further purify
CAV proteins. The antibodies of the present invention
W0~2/05760 PCT/US91/06~38
20897~
may be utilized for ~a vlvo and ln vitro diagnostic
purposes, such as by associating the antibodies with
detectable labels or label systems. Alternatively these
antibodies may be employed for ln _ vo and i~ vitro
therapeutic purposes, such as by association with certain
toxic or therapeutic com~ounds or moieties known to those
of skill in this art, e.g., ricin.
Antibodies to peptides encoded by the CAV
sequences, specifically to antigenic sites therein for
use in the assays of this invention may include
monoclonal and polyclonal antibodies, as well as chimeric
antibodies or "recombinant" antibodies generated by known
techni~ues. Additionally synthetically designed NAbs may
be made by known genetic engineering techniques [W. D.
Huse et al, Science, 246:1275-1281 (1989)~ and employed
in the methods described herein. For purposes of
simplicity the term Mab~s) will be used hereafter
throughout this specification; however, it should be
understood that certain polyclonal antibodies,
particularly high titer polyclonal antibodies and
~; recombinant antibodies, may also be employed in place
thereof~ It is generally desirable for purposes of
increased target specificity to utilize monoclonal
antibodies (MAbs), both in the assays of this invention
and as potential therapeutic agents. It may also be
preferred to "humanize" a non-human Mab by any of the
known techniques [See, e.g., U. S. Patent Nos. 4,634,664
and 4,634,666].
An anti-CAV antibody composition of this
invention preferably comprises an antibody that binds an
antigenic determinant of a CAV polypeptide which is (a) a
purified preparation o~ polyclonal antibodies; (b) a
monoclonal antibody composition; or (c) a recombinant
antibody composition.
W0~2~5760 PCT/~S91/06238
2 ~ 6 1
36
Preferably the present invention contemplates
the development of a MAb to CAV, which does not react
with other human retroviruses, e.g., HTLV II. In one
embodiment, the antibody is capable of identifying or
binding to a CAV antigenic site encoded by an above-
identified CAV DNA sequence. Such an antihody may be
used in a screening test.
A MAb may be generated by the now well-known
Kohler and Milstein techniques and modifications thereof
and directed to one or more antigenic sites on a CAV
polypeptide. For example, an isolated CAV sequence, or a
portion of the viral sequence encoding an antigenic site,
which differs sufficiently from that of HTLV I and HTLV
II and other viruses, may be presented as an antigen in
conventional techniques for developing MAbs. ~ cell line
secreting an antibody which recognizes an epitope on CAV
only, not on HTLV I or II or any other retrovirus, may
then be identified for this use. Similarly, a cell line
secreting an antibody which binds much more strongly to a
CAV epitope than to any epitope on another virus to
enable the antibody to distinguish between the virus
under suitable conditions may also be useful. One of
skill in the art may generate any number of Mabs by using
a CAV polypeptide sequence as an immunogen and employing
- the teachings herein.
Antibodies specific for epitopes on CAV may
also be used therapeutically as targeting agents to
deliver virus-toxic or infected cell-toxic agents to
infected cells. Instead of being associated with lahels
for diagnostic uses, a therapeutic agent employs the
antibody linked to an agent or ligand capable of
disabling the replicating mechanism of the virus or of
destroying the virally-infected cell. Such agents,
include, without limitation, ricin, diphtheria toxin or
other known toxic agents. The identity of the toxic
W092/05760 P~T/~S91/06238
2~97~1
37
ligand does not limit the present invention. It is
expected that preferred antibodies to peptides encoded by
CAV sequences may be screened for the ability ~o
internalize into the infected cell and deliver the ligand
itself into the cell, as described in detail in Canadian
Patent Application 2,016,830-7, published on November 16,
1990. This document is incorporated by reference for a
description of a screening technique known to ths art.
Both the antibodies and the probes of the
present invention may be associated with conventional
detectable labPIs. Detectable labels for attachment to
the antibodies (or to the probes referred to above)
useful in assays of this invention may also be easily
selected by one skilled in the art of diagnostic assays.
Where more than one reagent of this invention, e.g. probe
or antibody, is employed in a diagnostic method, the
labels are desirably interactive to produce a detectable
signal. Most desirably the label is detectable visually,
e.g., colorimetrically. Detectable labels for attachment
to reagents of this invention useful in the diagnostic
assays of this invention may also be easily selected by
one skilled in the art of diagnostic assays. Labels
detectable visually are preferred for use in clinical
applications due to the rapidity of the signal and its
easy readability. For colorimetric detection, a variety
of enzyme systems have been described in the art which
will operate appropriately. Colorimetric enzyme systems
include, e.g., horseradish peroxidase (HRP) or alkaline
phosphatase (AP)o Other such proximal enzyme systems are
known to those of skill in the art, including hexokinase
in conjunction with glucose-6-phosphate dehydrogenase.
Also, bioluminescence or chemiluminescence can be
detected using, respectively, NAD oxidoreductase with
luciferase and substrates NADH and FMN or peroxidase with
luminol and substrate peroxide.
WV~2/~5760 l'CT/US9l/06238
~397~1
38
Other conventional label systems that may be
employed include fluorescent compounds, radioactive
compounds or elements, or immunoelectrodes. These and
other appropriate label systems are known to those o~
skill in the art.
Similarly for diagnostic uses of the antibody,
polynucleotide sequence and polypeptide sequence reagents
of the present invention, a wide variety of known and
conventional components may be employed to immobilize the
reagent, where desired. Such immobilizing agents include
conventional solid supports, such as microtiter plates,
plastic, cellulose strips, beads, e.g., latex. Any
composition known in the art which may be employed for
immobilization of an antibody or nucleic acid or peptide
sequence may be similarly useful with the antibodias and
sequences of the present invention, primarily for
diagnostic uses, purification techniques and the like.
CAV polynucleotide sequences and polypeptides,
as well as anti-CAV antibodies of the present invention
may also be employed in an industrial method for the
production of blood and blood products which are free
from infection by CAV. The ability to screen blood
- samples infected by CAV enables producers and
distributors of blood productsl e.g, the American Red
Cross, to identify and discard donated blood samples
which are intended for use in transfusions or in the
isolation of plasma, therapeutically useful blood
proteins and blood cells. If unscreened, the use of such
blood and blood-derived products could contribute to the
spread of CFIDS.
Thus, another aspect of this invention is a
method for preparing blood and blood products free from
infection with CAV by screening a blood product for the
presence of CAV with a CAV polynucleotide or polypeptide
probe, or complement thereof, capable of indicating the
W092t0;760 PCT/US91/0623~
2~7 ~
3g
presence or absence of CAV. An analogous method involves
producing blood or blood products free from infection
with CAV by screening a blood sample with anti-CAV
antibodies, capable of indicating the presence or absence
of CAV.
These CAV sequences and/or anti-CAV antibodies,
optionally detectably labeled, may be employed in
conventional assay formats substantially identical to
those formats described herein for diagnostic purposes to
identify blood samples containing CAV. For example, one
screening method may employ all or a fragment of a CAV
polynucleotide sequence or a complement thereof as a
primer in a polymerase chain reaction performed on a
blood sample, wherein the ~mplification of said sequence
indicates the presence of the etiologic agent of CFIDS.
Another screening step comprises employing all
or a fragment of a CAV polynucleotide sequence as a
hybridization probe in a hybridization assay performed on
a blood sample, wherein the hybridization of said
sequence indicates the presence of the etiologic agent of
CFIDS. Still another screening step comprises contacting
a blood sample with a CAV polypeptide or protein, wherein
said peptide or protein represents an antigenic site
capable of forming an antigen-antibody complex with any
anti-CAV antibody in the sample. The use of such assays
or modifications thereto are within the skill of the art
given this disclosure.
A further aspect of tha present invention is an
ln vitro cell culture containing a CAV polynucleotide
sequence. Such a cell culture may be a mammalian cell,
bacterial cell, yeast or insect cell~infected with CAV.
Such a cell culture may be a recombinant host cell
containing only selected CAV polynucleotide sequences, so
that the virus is not capable of replication therein.
W092/05760 PCT/US91/06238
~8~
Also provided by this invention are hybridoma
cell lines generated by presenting a CAV polypeptide or a
fragment thereof as an antigen to a selected mammal,
followed by fusing cells of the animal with certain
cancer cells to create immortalized cell lines by known
techniques. The methods employed to generate such cell
lines and antibodies directed against all or portions of
a human CAV protein or recombinant polypeptide of the
present invention are also encompassed by this invention.
This invention also encompasses permissive cell
lines infected with CAV and capable of producing
infectious CAV progeny. As described in detail in
Example 1, two human cell lines, a T cell lymphoblastoid
and a B cell lymphoblastoid cell line, have been
developed which produce infectious v rus progeny ln
yitro. Another cell line, Human Macrophage Monocyte Cell
Line U937, which is available from the ATCC has also been
identi~ied as supporting the growth of CAV. Such cell
lines when cultured under suitable conventional
conditions are capable of generating large quantities of
virus for further research and vaccine development use.
As still a further aspect of the invention,
methods for confirming a suspected CFIDS diagnosis may
now be based on the presence of such above-described CAV
nucleotide sequences, polypeptide ~equences and
antibodies. The presence of CAV can be detected
utilizing a variety of assays and immunological
techniques known in the art for detecting viruses,
including detecting these viral proteins, nucle~c acids,
and antibodies directed against the virus. CAV
polynucleotide fragments which are sufficiently lacking
in homology with comparable gene sequences of other
retroviruses may enable the identification of such
nucleotide sequences tor peptides encoded thereby) in the
W~9~/05760 PC~/US91/0~238
20897~1
41
body tissues and fluids of suspected CFIDS patients,
confirming diagnosis of the infection.
The term "body fluids" as used herein is
defined as including, without limitation, the following
cell-containing materials: whole blood or fractions
thereof, serum, urine, semen, vaginal secretions, saliva,
tears, cerebrospinal fluid, and breast milk. Also
included in this definition, for completeness, are
selected human cell types, including T cells and non-T
cells. Preliminary data indicate that the presence of
this virus may also be detected in granulocytes,
eosinophils or basophils. This virus may also be
detectable in muscle and skin tissue samples. While the
following description of this invention refers to serum
samples and peripheral blood mononuclear cells (P8MC) as
body fluids, the application of the methods and
compositions of this invention are not limited to these
particular fluids.
Preferred embodiments of diagnostic methods
useful to detect the presence of CAV, however, utilize
particularly the techniques of polymerase chain reaction
[Saiki et al, Science, 239:487-491 (1988)] and
hybridization assays [see, e.g., Sambrook et al,
"Molecular Cloning. A Laboratory Manual.", Cold Spring
Harbor Laboratories, Cold Spring Harbor, 2nd edition
(1989)]. These documents are incorporated by reference
herein for descriptions of PCR and assay techniques.
Particularly desirable hybridization assays include
Southern blot and liquid hybridization, which are known
in the art as represented by their descriptions in the
latter reference.
The assay formats referred to above are
preferably employed in the method of this invention with
a CAV polynucleotide sequence-derived PCR primer or
hybridization probe according to this invention.
WOg2/057~0 PCT/US91/06238
2 0 ~
42
One embodiment of a method of this invention
involves the PCR technique as well as modifications
thereof which are known to those of skill in the art.
According to this embodiment, samples o~ selected patient
body fluids are collected. The patients may be desirably
selected for such diagnostic testing by having symptoms
which are recognized to be associated with CFIDS,
although asymptomatic patients may also be kested~ DNA
is extracted from the selected body fluid, e.g., white
blood cells. Techniques for preparing such extracts are
well-known in the art [See, for example, Sambrook et al,
cited above]. The sample DNA is used as a template and
primers derived from CAV sequences are employed in the
PCR technique.
As an example, it was originally observed that
certain HTLV II qaq gene sequences appeared to share a
high degree of homology with several putative CAV
polynucleotide sequences, as described in Example 3.
Several desixable sequences which may be useful as PCR
primers and hybridization probes are found within ths
nucleotide sequence spanning nucleotide #813 to #1214 of
the HTLV II qaq ~ene. These sequences were first used to
amplify CAV sequences and isolate the virus from patient
body fluids. For example, as illustrated in Table III
below, an HTL~ II ~ sequence from nucleotide #1214 to
#1187 may b~ useful as a preferred antisense primer for
PCR. This primer is known as g-2-1. An HTLV II qag
sequence from nucleotide #~13 through #838 is useful as a
PCR qaq sense primer. This primer is called g-2-2. A
sequence of HTLV II g3~ from nucleotide 1080 through 1105
is also useful as a hybridization probe.
W092~0~760 PCT/US91/06238
2~8~
43
Table III
~T~-V I
1375 1353
gag antisense primer GGTACTGCAGGAGGTCTTGGAGG
841 864
gag sense primer CGACCGCCCCGGGGGCTGGCCGCT
1080 1101
gag probe GATCCCGTCCCGTCCCGCGCCA
7701 7680
tax antisense primer TCTGGAAAAGACAGGGTTGGGA
7575 7596
tax sense primer CAATCACTCATACAACCCCCAA
7652 7677
tax probe TACATGGAACCCACCCTTG5GCAGCA
HTLV II
12~4 1187
gag antisense primer, GAAGCTTTGCGTGGTGGTGGGTTCCACG
g-2~1
~ hinD III site) 813 838
gag sense primer, (TAAGCTT) CAAATCCACGGGCTTTCCCCAACTCC
g-2-2
1080 1105
gag probe GTCTCCCCTAGCGCCCCCGCCGCCCC
7g20 7900
tax antisense primer ATAGGGGAGAAGTCCTGTACA
7602 7620
: tax sense primer CGCCTTCCCCGAACCTGGC
7819 7846
tax probe ACAGTCATA~TCCTCCCG~AGGACGACC
.
::
W092/0576~ PCT/US91/0623X
2~7~1
44
It should be noted that the nucleotide
numbering of the HTLV II genomic sequence referred to
throughout this specification is identical to the
numbering system published by K. Shimotohno et al, cited
above, ~or the complete proviral HTLV II genome. The
nucleotide sequence of HTLV I re~erred to in the examples
below is numbered according to M. Saiki et al, cited
above. The latter two re~erences are incorporated by
reference herein as sources of sequence information known
and available to one skilled in the art.
Primers or probes based on other retroviruses,
e.g., HTLV I-derived probes such as those identified in
Fig. l, or non-hybridizing HTLV II-derived probes, or
probes based on sequences of the known non-C type
retroviruses, e.g., MPMV, may also be employed as
controls. For example, another diagnostic method
involving PCR techniques may employ the tRNA lysine
primer binding site 5' TGGCGCCCAACGTGG~GC 3' as a
"sense" primer, and an MPMV-derived primer
5' GCTACGGCAGCCATTACTTG 3' as an "antisense" primer. A
probe from an MPMV intervening region and having the
sequence 5' GATACTTGTCCTTGGTTTCCGCA 3' may then be
employed in hybridization.
Such a PCR reaction would also indicate MPMV
infection of humans, but it is not presently believed
that MPMV can infect humans. An alternative method step
would be to perform a hybridization with another MPMV
sequence which is not homologous to an CAV sequence under
specific hybridization conditions to rule out MPMV
infection. If CAV is present in the DNA isolated from
the sample, the CAV polynucleotide sequences or fragments
thereof, will be ampli~ied, but not the control
nucleotide sequences.
However, as above mentioned, use of HTLV II
sequences or other retroviral sequences, e.g., MPMV,
W092/05760 PCT/US91/06238
20$9~Sl
having some homology to CAV in diagnostic methods is less
preferred because a separate method step would have to be
employed to distinguish the isolated or identified virus
in the body fluids of a suspected CFIDS patient from the
other Xnown retrovirus. Other HTLV II sequences
different from the above-described HTLV II-derived probe
and primer sequences may be employed to rule out the
presence of HTLV II infection. The method of the present
invention employing PCR may be sequentially performed
with HTLV II sequences and HTLV I sequences which do not
produce amplified products using the patient's sample
DNA, for example, sequences from HTLV II tax which are
not homologous with CAV nor detectable in CFIDS patients.
These supplemental tests would eliminate the possibility
of a co-infecting presence of these HTLV with CAV.
CAV primer se~uences which are unique for CAV,
and which do not bind to other viruses are preferred in
such assays. Such sequences can be identified by a viral
taxonomist.
Following PCR amplification, a Southern blot or
other hybridization technique may be employed, using a
labeled CAV polynucleotide-derived hybridization probe.
Probes which are less desirable, as referred to above,
may contain a sequence homologous to a nucleotide
sequence in the HTLV II g~ gene.
Hybridization of the probe with the product of
PCR amplification will occur in the presence of CAV
nucleotide sequences in the body fluid. No hybridization
will occur in the absence of a C~V nucleic acid sequence
which is not significantly homologous to other reported
retrovirus sequences in available databases. For a
positive diagnosis, the hybridization of the above
sequence to the patient sample may desirably be above
about 90%. The occurrence of hybridization will indicate
a confirmed diagnosis of CFIDS.
W092/057~0 PCT/US91/06238
~,o~9 ~ 6~ -`
Another embodiment of a diagnostic method of
the present invention to determine the presence o~ a CAV
infection is ~n ~1~ hybridization to scrQen a patient
sample for the presence of CAV RNA sequences. As
described in more detail in Example 5 below, cells,
typically PBMC, are isolated rom a patient. If PBMC are
the sample, the cells may be activated as described
above. The cells are cultured under conventional
conditions and examined for the expression of mRNA of
CAV.
Polynucleotide sequences of CAV, or sequences
complementary thereto may be used in this method. Probes
for this hybridization technique may be generated from
transcription of CAV in a plasmid, as described in detail
in Example 4, or by other methods, as described herein
before. As described above for the hybridization and
primer sequences, it is possible that some HTLV II-
derived ~ag gene nucleotide sequences may also prove
useful in identifying this CAV viral mRNA according to
this embodiment of the present method.
Using high stringency conditions, labelled
probes to the CAV se~uences are used to probe the sample
mRNA. Preferable high stringency conditions include an
incubation temperature of 52C. Conventional labels can
also be employed in this embodiment, such as are
described above. A presently preferred label is 35S . The
embodiment described in detail in Example 5 below employs
HTL~ II-derived sequences. This ln situ test may be
combined with the other PCR and immunological tests to
confirm the positive CFIDS result.
The CAV peptide fragments, as well as the PCR
primers produced as described above, may also be employed
in diagnostic assays which rely on protein immunogens as
targets for sera recognition. For example, the invention
provides a method of using CAV peptides o the invention
W092/0~760 PCT/U~91/06238
20897 ~1
as diagnostic agents useful for identifying CFIDS
patients. In one assay format, the reactivity of CAV
peptides to biological fluids or cells of CFIDS patients
can be assayeA by Western blot. The assay is ~referably
employed on patient sera, but may also be adapted to be
performed on other appropriate fluids or cells, for
example, macrophages or white blood cells. In the
Western blot techniqu~, a C~V peptide, purified and
separated by a preparative gel, is transferred to
nitrocellulose and cut into multiple strips. The strips
are then probed with sera from CFIDS patients or
controls. Binding of the CFIDS sera to the protein is
detected by incubation with an appropriately labelled
antibody, e.g., an alkaline phosphatase tagged goat anti-
human IgG followed by the enzyme substrate BCIPlNBT.
Color devel~pment is stopped by washing the strip in
water. Only sera of CFIDS patients would react with the
peptide. Healthy humans would not react to the CAV
peptide.
In another embodiment the present invention
also provides ~or determining the presence of CAV by
examining cell-containing body fluid samples from
patients for evidence of exposure to CAV. A CAV peptide
may be used in a diagnostic method to detect an antibody
to CAV in the body fluids of a CFIDS patient. For
example, CAV peptides of this invention may be used in an
ELISA based assay~ A typical ELISA protocol would
involve the adherence of antigen (e.g., CAV peptide) to
the well of a tray. The serum to be tested is then
added. I~ the serum contains antibody to the antigen, it
will bind. Specificity of the reaction is determined by
the antigen absorbed to the plate. Only sera from CFIDS
patients would bind to the plate; sera from healthy
patients would not bind.
W0~2/05760 PCT/US91/06238
2089761 `-`
48
Body fluids of CFIDS patients have shown
reactivity with antigens of HTLV I by Western blot.
Patient body fluid samples, e.g., serum samples or
cerebrospinal fluid, can be isolated from patients
suspected of having CFIDS. For example, these samples
may be us d in protein immunoblots, typically called
Western blots, with viral proteins of HTLV I and HTLV II.
The viral proteins which have been electrophoretically
separated are exposed to sample body fluids.
Usiny conventional techniques known in the art,
viral proteins which are immunoreactive or cross-reactive
with antibodies in the samples are visualized as bands on
a gel. As described below in Example 3, body fluid
samples, e.g., blood or serum samples, from CFIDS
patients contain antibodies which react with at least
three protein bands on the blot which are the products of
at least two HTLV genes, qaq and env. Moreover, the
majority of CFIDS patients have serum antibodies to a P27
protein on the HTLV-I Western blot. P27 is presumably a
product of the tax gene.
PBMC can be activated according to means known
in the art such a phytohemagglutinin, phorbol myristic
acid, concanavalin A and OKT3 MAb. Using standard
immunological tests, preferably well-known
immunohistochemical tests, the presence of an antigen
which reacts with a preferred antibody can be determined.
One such suitable antibody is K-1 (available from Dr.
Fulvia Veronese) [E. DeFreitas et al, AIDS Research and
Human Retroviruses, supra~. This K-1 monoclonal antibody
is capable of reacting with both HTLV I and HTLV II ~aq
gene products.
If the patient's PBMC or other cell type has an
antigen which is recognized by an antibody (which is
itself known to recognize qag of HTLV I and II),
indicating the possible presence of CAV, further tests
W092~057~0 PCr/US91/06238
2~9r7 ~1
49
employing CAV sequences or antibodies specific for an
epitope encoded by those sequences, can be performed to
eliminate the possibility that the antigen is the g~g
gene of ~TLV I or HTLV II. For example, to eliminate the
presence of HTLY I as the source of the antibody
response, a MAb which is specific for HTLV I aaq protein
and does not cross-react with HTLV II g~ may be used in
this method. A suitable antibody is 13B12 [Sse, e.g., T.
J. Palker et al, J. Immunol., ~ 2393-2397 (1986)].
This antibody is used to test body fluids, e.g., PBMC, of
patients whose sera contains antibodies reactive with at
least three HTLV proteins on immunoblots.
Viral proteins in the cells from body ~luids of
patients who are infected with HTLV I will immunoreact
with such specific antibody. In contrast, CFIDS patients
who are infected with CAV, do not provide PBMC which
immunoreact with an HTLV I specific antibody. This same
type of eliminating step may ~e employed in the method of
this invention with an antibody capable of recognizing an
epitope on HTLV II, which epitope is not present on HTLV
I or CAV. Although such an antibody is not presently
available, the development of a suitable antibody,
preferably a MAb, is contemplated by this invention and
may be employed in the method.
Yet another assay format which may employ the
reagents of this invention and be useful in the diagnosis
of CFIDS is a particle agglutination (PA~ assay, of which
there currently exist three (3) specific types. These
assays are used for the qualitative detection of
antibodies to various antigens when coated to a support.
Thus sequences of the invention containing antigenic
sites of CAV may be coated to a support. Alternatively
antibodies to CAV antigenic sites may be coated to a
support. In the former situation, the sample is tested
for the exis~ence of antibodies to the CAV antigen. In
W092/05760 ~Cr/US9~/06238
2~7~ 50
the latter situation, the clinical sample is tested for
the existence of antigen capable of binding to the anti-
CAV antibody. The following discussion refers to the
former situation. However, one of skill in the art could
similarly prepare the assay so that the antibody is
immobilized on the support and the existence of the
antigen in the sample is detected.
The first and original assay is the
hemagglutination assay using red blood cells (RBCs~. In
the hemagglutination assay, RBCs are sensitized by
passively adsorbing antigen (or antibody) to the RBC~ To
perform the assay, sensitized RBCs are placed in a 96-
well microtiter plate. A small quantity of serum diluent
is added to each well, followed by test and control serum
in designated wells. When test serum from a patient is
added to a well, if specific antigen antibodies are
present in the serum, the antigen-antibody interaction
will cause the RBCs coated with the purified antigen to
agglutinate. Interpretation of the results can be done
with the naked eye. A negative result is scored when no
reaction occurs between the antigen coated RBC and the
added serum sample, as visually observed in the 96-well
plate by a solid round dot formed by gravity~ A positive
result is indicated by a somewhat spread out pattern as
the antibody interacts with the antigen coated RBC and
binds to one or more antigen coated RBC, thus holding the
RBCs at a distance from each other. ~ strong positive
result occurs when there is very strong reactivity and a
clear visual pattern of "clumps" or agglutination is
observed.
To eliminate potential non-specific reactions,
which can occur with sensitized RBCs, two artificial
carriers have been developed. The most common of these
are latex particles which are available in a variety of
sizes and colors, however, they are usually white. The
W092/0~76~ PCT/US91/06238
2~8~
51
newest technology utilizes a gelatin agglutination
method, exemplified in the Serodia-HIV kit for the
detection of HIV antibody [Fujirebio Inc.]. The
principles involved with both of these artificial
carriers are based on passive agglutination utilizing as
carriers either the latex or gelatin particles which are
coated with purified antigens. The actual assay is run
and scored in a similar manner as described above in the
RBC based assay.
In a comparison test performed by Kobayashi et
al., Clin. Viroloqv, 14:454-458 (1986), the gelatin
agglutination method was tested along side an
immunofluorescence (IF) assay and a commercially
available ELISA. The gelatin agglutination test showed
excellent reproducibility in a single assay and good
correlation with the IF and ELISA tests having fairly few
discrepancies in results. The gelatin agglutination
results were achieved without any special instruments or
equipment, and a definitive result was obtained in two
hours.
In still another aspect, the invention provides
a diagnostic method for detecting CAV in a patient sample
by a conventional reverse transcriptase assay as
described in Example 10 below. This assay may be
performed on body fluids of a suspected CFIDS patient,
sing a polyriboadenylate template primer and the
divalent cation Mn++. No other known human retrovirus
employs this primer or cation in this assay.
The methods, probes, primers and antibodies
described herein may be efficiently utilized in the
assembly of a diagnostic kit, which may be used by health
care providers for the diagnosis and/or treatment of
CFIDS. Such a diagnostic kit contains the components
necessary to practice one or more of the assays described
above for the detection of the CAV nucleic acid in body
W0~2/0S76~ PCT/US91/06238
2089761
52
sample of suspected CFIDS patients. Thus, for example,
such a kit may contain primer sequences as described
above comprising a CAV sequence or fragments thereof, or
sequences of other retroviruses, e.g., MPMV, for
performing PCR on sample body fluids. A kit may also
contain the hybridization probe sequences described above
for the performance of a Southern blot, liquid
hybridization or other hybridization technique. Further
components of the diagnostic kit of this invention may
include nucleotide sequences of other retrovirus genes
(HTLV I and II, and MPMV) for use in eliminating the
possibility of the presence of those specific viruses.
Still additional components to a diagnostic kit
csntemplated by the present invention include CAV
polypeptides, antibodies specific for an epitope of CAV,
antibodies to HTLV I and HTLV II qaq, or antibodies
specific for other retroviruses which do not bind to CAV
epitopes.
Other conventional diagnostic kit reagents such
as positive and negative controls, vials and labelling
systems for the hybridization assays may also be
included, as well as the enzymes and other reagents
necessary for the performance of the PCR technique.
Where the detectable label present in the kit ls designed
for non-visual detection, e.g., for radioimmunoassay, the
standard components necessary for this assay (controls,
standards and the like) are included in the kit.
Another aspect of the present invention
involves the detection and isolation of the complete CAV.
According to this aspect, an amplified and isolated
nucleotide sequence of CAV obtained by the PCR technique
as above described is itself employed in the design of
additional primers. Example 4 reports the sequencing of
a putative CAV fragment which was obtained using primers
g-2-1 and g-2-2, identified above. Previously identified
W092/~5760 PCT/US91/06238
20$9761
C~V viral fragments may be used as primers or probes to
obtain and identify additional sequence of CAV.
These primers are used to isolate larger
portions ~f the viral sequence using the inverse PCR
technique, such as described in O. Ohara et al, Proc.
Natl Acad. Sci.. USA, 86:5673-5677 (1989) and H. Ochman
et al, Genetics, 120:6~1-623 (1988). Employing such
techniques which are known and routine to one of skill in
the art provided with a substantially isolated virus
permits the isolation and characterization of the entire
nucleic acid sequence of CAV.
In another aspect the present invention
provides a vaccine composition comprising an effective
amount of a non-infective CAV DNA or peptide sequence
which is capable of eliciting a T cell or B cell response
from the host's immune system to CAV infection; This
vaccine may also include all or a portion of a CAV DNA
sequence or peptides referred to herein. It is expected
that at least one of the CAV polypeptide sequences (or
fragments thereof) may provide either an antigenic or
immunogenic peptide. These peptides, once identified,
may be used as vaccine components.
one exemplary system for generating a vaccine
is described in European patent application No. 2.90,246
wherein a peptide encoded by the CAV DNA sequence may be
substituted for the peptide in a vaccine composition
employing fatty acids, liposomes, and adjllvants. Other
vaccine constructs are known to those of skill in the
art, and may be prepared using a peptide of CAV to
generate a CFIDS vaccine. The above published European
patent application is incorporated herein by reference
for disclosure of an exemplary vaccine composition.
Another vaccinal agent of the present invention
is an anti-sense RNA sequence generated to a CAV nucleic
acid sequence. This sequence may easily be generated
W~92~Q5760 PCT/US91/0623g
2ass7sl
54
synthetically by one of skill in the art. Such an anti-
sense RNA sequence upon administration to an infected
patient should be capable of binding to the RNA o~ the
virus, thereby preventing viral replication in the cell.
An alternative vaccine agent includes a synthetic peptide
generated to the envelope protein of the virus. These
peptides can be easily developed once the entire CAV is
sequenced. An additional concept for vaccine development
once the virus is completely sequenced includes praparing
synthetic peptides which are capable of binding to the
host cell's receptor for CAV.
Therefore, also included in the invention is a
method of vaccinating humans against infection with CAV
by administering an effective amount of a vaccine of this
invention to a selected patient. The vaccine
preparations including one or more of the peptides
described-herein are administered in a suitable dose.
The vaccine may be administered parenterally or by other
conventional means.
The preparation of a pharmaceutically
acceptable vaccine, having due regard to pH, isotonicity,
stability and the like, is within the skill of the art.
Conventional adjuvants may also be employed in the
vaccine composition, e.g., aluminum hydroxide gel. The
dosage amount and regimen involved in a method for
vaccination will be determined considering various hosts
and environmental factors, e.g. the age of the patient,
time of administration and the geographical location and
environment.
The following examples illustrative various
aspects of the present invention. Example 1 describes
permissive cell cultures producing CAV and the
morphometric analysis of CAV in infected cells. Example
2 describes a double-blind screen of antibody to purified
HTLV I by Western immunoblot. Example 3 describes
W092/0~760
detection of retroviral DNA in PBMC of CFIDS patients by
PCR using HTLV I and II derived primer sequences.
Example 4 describes the purification and sequencing
techniques used to obtain a putative partial viral
sequence from a CFIDS patient's ampli~fied DNA. Example 5
describes the detection by ln ~i~ hybridization of
cellular RNA related to H~LV I and II in activated PBMC
~rom CFIDS patients. Example 6 describes the detection
in activated PBMC from certain CFIDS patients of an
expressed HTLV-specific g~g protein in vitro as detected
~y a M~b and immunohistochemical staining. Example 7
describes the determination of the apparent CAV tRNA RBS.
Example 8 describes the possible characteristic qaq
proteins of CAv, and Example 9 indicates the nuclear
location of putative gLa~ proteins of CAV. Example 10
describes a reverse transcriptase assay, suggesting that
CAV has the characteristics of a non-C type retrovirus.
For performance of thes~ experiments, patient
body fluid samples were obtained from clinical practices
in North Carolina and New York. The investigators were
all blinded by coded samples in each experiment.
Exam~le 1 - Mor~hometric Anal~sis of CFXDS Retrovirus
Both ~-9 ~TCC No.HTB 17~) (Fig.3) lymphoblastoid T cells
(obtained from the American Type Culture Collection,
Rockville, Maryland) and B-Jab ~Fig. 4) lymphoblastoid B
cells (obtained from William Hall, M.D~, Ph.D. of Cornell
University) were cocultured for 21 days at 37C in 5%
CO2/95% air in RPMI 1640 medium with 10% fetal calf serum
with leukocytes of CFIDS patients.
The cultures were examined by transmission
electron microscopy after the cells were fixed (see Figs.
3 and 4). Viral particles were visualized in hoth types
of cocultures. Electron-dense circular virions, some
with electron-luscent cores and others with electron-
i~
~,~, , .
'i. ' ' `
W0~2~760 PCT/US91/06238
2~8976~ `
dense cores, were seen associated with the roughendoplasmic reticulum and inside large abnormally
distended mitochondria inside the cells. All particles
were the same shape and size, 46-50 nm (460-500A). No
extracellular virus was observed. No forms budding from
the cytoplasmic membranes were observed.
These observations suggest that CAV is a non-C-
type animal retrovirus for threa reasons: First, human
C-type viruses like HTLV I and HTLV II do not appear to
form intracellular virions. The only human C-type
forming intracellular particles is HIV and these are only
found intracisternally in conjunction with budding forms.
Circular C-type virions are usually formed as the virus
buds from the cell's cytoplasmic membrane. Second,
neither HTLV I, II, nor HIV virions have ever been found
inside mitochondria. Third, the diameter and morphology
of these virions suggest that they may be Primate D-type
retroviruses or Spuma viruses.
Example 2 - Western Blot Transfers
Proteins of HTLV I from sucrose-banded purified
virus are separated by polyacrylamide gel
electrophoresis. After electrophoretic separation,
proteins are transferred to nitrocellulose paper in a
Transblot electrophoresis cell [BioRad Laboratories] at
60 volts, 0.25 amps for 4 hours following manufacturer's
instructions. The nitrocellulose sheet is cut in strips,
washed to saturate free binding sites with blocking
buffer containing 20mM Tris, 500 mM NaCl (pH 7.5) and 3%
gelatin. The sheet is reacted overnight at 4C with
anti-virus antibody (13B12) or patient sera or CSF.
After thorough washing with 20 mM Tris, 500 mM
NaCl, and 0.05% Tween-20 (TBS), strips are reacted with
conjugate (peroxidase-labeled goat anti-mouse or anti-
human IgG) for 1 hour at room temperature. Strips are
W~2/0576~ PCT/US91/06238
~2~7 ~1
s~
washed again and developed for 10-15 minutes with freshly
prepared solution containing 1 part of 4 chloro-1-
naphthol in methanol (0.3%), 5 parts of 100 mM Tris
(pH7.6) and H20~ to final concentration 1:3000. This
system can detect less than 100 ng specific proteins.
Strips with molecular weight markers are used to
determine molecular weights of viral pro~ein.
Table IV below reports the detection of serum
antibodies to HTLV I by this Western Immunoblot in adult
CFIDS patients. Positive rssults occurred in 41% (15/37)
of CFIDS patients. Csntrol sera was positive in only 6
(1/16) of individuals. Positivity was determined using
the American Red Cross criteria of antibody reactivity
for at least two viral gene products. The one positive
healthy control was the only non-Caucasian in this study.
._
Table IV
Positive Neaative
CFIDS patients 15* 22
(37 individuals)
Healthy & other diseases 1 15
(16 individuals)
*Significant at P S.001.
Example 3 - CAV Retroviral Sequences Detected in CFIDS
Patients by Polymerase Chain Reaction
Detection of possible CAV r~troviral DNA in
PBMC of CFIDS patients was performed by polvmerase chain
reaction using HTLV I- and II- derived primer sequences.
HTLV I tax region (7575-7701 bp) and other regions (HTLV
I qaq, HTLV II qaq and HTLV II tax) were amplified from
the blood of CFIDS patients. The sequences of these
primers and probes are reported above in Table III. DNA
from HTLV I-infected white blood cells from TSP patient
number 13-4 was used as positive control. DNA from one
W092/05760 PCT/US9l/06238
20897 ~ ~
58
HTLV II human T cell line Mo-T and from a retro~iral-
negative cell line U937 (both available from the American
Type Culture Collection, Rockville, Maryland, USA) were
employed as negative controls.
DNA was extracted from cell lines by
SDS/Proteinase-K digestion of cells followed by phenol-
chloroform and ethanol precipitation. DNA concentrations
were estimated using the Warburg equation rWarburg, D &
Christiemy, W., Biochem 2 310:384 (1942)] by measuring
the absorbance at 260 and 280 nm corrected for the
background at 320 nm. Two micrograms of DNA were
amplified in 30 repetitive three step cycles, l minute
incubation at 95C, 1 minute incubation at 55C and 2
minute incubation at 72C. All amplifications were
carried out in a Perkin-Elmer Cetus Thermal Cycler. The
100 ~1 of PCR reaction mixture contained 2 ~g of sample
DNA, 278 ~M each dATP, dCTP, dGTP, dTTP, 0.8 ~M of each
primer 10 mM Tris (pH 8.3), 50 mM XCl, 1.5 mM MgCl2, 0.01%
(w/v) gelatin and 2.5 units of Thermus Aquaticus
polymerase (Taq) enzyme [Perkin Elmer, Cetus].
The reaction mixture was overlayed with mineral
oil to prevent evaporation and was denatured at 94C for
7 minutes before the Taq polymerase was added. Primer
pairs were nurleotide #7575-7696(+), nucleotide ~7701-
7680, and analyzed with nucleotide #7652-7677
oligonucleotide probe (see Table I).
Amplified DNA was analyzed by electrophoresis
on 1.2~ agarose gel and transferred to Nytran nylon
membrane tS~S Nytran] by blotting. The filter was soaked
with 2xSSC for 5 minutes at room temperature, and baked
at 80C for 2 hours under vacuum. The prehybridization
buffer consists of ~XSSC, 1.0% SDS, 50% formamide, 5X
Denhardt's solution and 150 ~g/ml herring sperm DNA. The
filter was prehybridized overnight at 37C and then
hybridized overnight with 12xlO6cpm of 32P-labelled oligo
W092/05760 PCT~US91/06238
2~89 ~1
probe in prehybridization buffer. Filters were then
washed with: 1) 2XSSC and 0.1% SDS (two times for 20
minutes at room temperature), 2) 0.2XSSC and 0.1% SDS (20
minutes at room temperature), and 3) O.lXSSC and 0.1% SDS
(30 minutes at 37C) and autoradiographed ~or 5-7 days.
The results of the same PCR analyses of blood
samples from adult CFIDS patients was compared with
persons with whom they live or closely associate, e.g.,
roommates and friends (called Exposure Controls). Non-
exposure controls are healthy persons selected at random
who have not come into contact with CFIDS patients nor
experienced symptoms associated with CFIDS. Viral
controls included the human cell lines Mo-T (HTLV II-
infected) and MT-2 (HTLV I-infected). Both cell lines
are available from ATCC. These results are reported in
Table V below. Similar PCR analyses were performed on
pediatric CFIDS patients as reported in Table VI below.
The retroviral DNA was also detected with Southern
blotting using labeled oligonucleotides.
This data demonstrates that retroviral
sequences related to HTLV II qaa, but not HTLV I aaq or
tax, were detected in the CFIDS patients. Additionally
the positive results seen in the Exposure Controls
support the possibility that this CAV is capable of
casual transmission ko non-infected persons, as is the
case with many non-human retroviruses. These data also
indicate that presence of HTLV II g~ sequences does not
identify only symptomatic individuals.
W09~/~5760 PCT/U~91/0~238
2B~97 S~
Table V
Samples Primers and labeled Oliqonucleotides
HTLV 1 HTLV II HTLV II Western
Patientsqaq qaq tax Blot
PCl 0 + o +
PC4 0 + o o
PC5 o + o +
PC7 0 + 0 +
PC9 ' O O O
PC11 o + o o
PC12 0 +
PC13 0
PC14 0 +
PC15 0 +
PC18 o + o +
Ratio positive 0/11 9/11 (82%) 0/11 5/11 (36%)
Ex~osure controls
PC2 0
PC3 o + o +
PC6 o 0 o o
PC10 o + o +
PC16 o 0 o o
PC20 0 +
PC21 0 +
PC22 o + o +
PC23 o o o o
PC24 o 0 o o
PC25 0
PC26 o + o o
PC27 0
PC28
Ratio positive 0/14 6/14 (43%) 1/14 t7%) 4/14 (28%)
Non-exposure controls
' 0/10 0/10 0/10 0110
Viral controls
MT-2 + o o
Mo-T 0 + +
W092/057~0 PCT/US91/0623B
' 2~9761
61
Table VI
Samp~Q~ Primers and labeled Oliqonucleotides
HTLV 1HTLV II HTLV II Western
Patients qaq gag ~t~~31Ot
4-~ O + 0 +
4-4(2) 0 + 0 +
3-4 0 o O +
10-4 0 + 0 +
13-16 o o o o
5-16 0 + o +
8-16 0 + o +
1-16 o + o +
13-2 0 +
13`2(2) o + o o
9-2 0 ~ 0
20-2 0 0
2-2 + +
1-16 o + o +
10-18 0 + 0 +
19-4 0 + 0 +
12-2 o + o o
10-2 0 0
10-10 0 0 0 0
Ratio positive O/19 14/19 (74%) 0/19 11/19
(58%)
Exposure controls
11-5 o o o +
3-6 0 0 0 0
13-3 O 0 O 0
1-12 0 + +
13-2(3) 0 ~
9-23 0 + 0 o
12-Z3 0 0 +
Ratio positive 0/7 2/7 (29~) 0/7 3/7
(43~)
Non-ex~osure_controls
0/10 OtlO .0/100/10
Viral controls
MT-2 +
Mo-T 0 + +
WO9~/0576() PCr/US91/06238
7 ~ ~
62
ExamPle 4 - DNA Purification and Segue~L~
A putative, partial viral DNA sequence was
obtained by the procedure described below ~rom CFIDS
patient NY1-12 using the HTLV II qaq specific primers g-
2-1 and g-2-2 of Table III.
DNA purification is performed upon the PCR
amplified DNA obtained as described above in Example 3
using the ~ene Clean kit [Bio 101, La Jolla, CA] with
minor modifications, as described below. The PCR
amplified DNA is run in 3% Nusieve [FMC, Rockland, ME)
agarose mini-gel in lxTAE buffer. Using long wave
ultraviolet light, the band is visualized and excised.
The excised band is then placed in a pre-weighed 1.5 mL
tube and the weight of the agarose determined.
The liquid contents of the 7 mL screwcap tube
from the Gene Clean kit are added to 140 mL distilled,
deionized (dd) water and mixed with 155 mL of 100~ EtO~
to ensure that the water content of the solution is less
than 50~. This solution can be stored in a freezer at
-20C between usas.
When readv to be used, 2~ - 3 volumes of NaI
stock (6M) solution is added to the agarose and the
mixture is incubated at 45C - 55C for 5 minutes to
dissolve the agarose, with mixing after 2 minutes.
Glassmilk suspension (5 ~L~ i5 added and the mixture is
placed on ice for 5 minutes, with mixing every 1-2
minutes to keep the glassmilk suspended. The silica
matrix with the bound DNA is pelleted by microfuging for
5 seconds. The NaI supernatant is then transferred to
another tube. If any undissolved agarose remains, the
pellet may be rewashed with NaI. The pellet is then
washed 3 times with ice cold NaCl/EtOH/H20 (NEW) (10-50
volumes or 200-700 ~l). The pellet is resuspended by
pipetting back and forth while digging with the pipet
tip. After the supernatant from the third wash has been
~092/~5760 PCTt~S91/0623g
20~97~1
removed, the pellet is suspended again and the last of
the wash removed with a fine tipped pipette.
The washed, white pellet is then resuspended
with the buffer Tris-EDTA (TE) (water or a low salt
buffer can be substituted) about equal to the volume of
the pellet (usually approximately 7 ~1). The mixture is
incubated at 44-55C for 2 - 3 minutes and centrifuyed
for 30 seconds to obtain a firm pellet. The supernatant
containing the DNA is then removed and steps of
resuspending with TE, incubating, centrifuging and
removing the supernatant are repeated.
To obtain the annealing template and primer for
the sequencing reaction, 1 ~1 of primer (20 ng/~l) and 8
~1 of gene cleaned DNA, obtained as described above, are
combined in a centrifuge tube, boiled for 3 minutes and
snap chilled in ice water for 60 seconds. 1 ~1 of lOX
reaction buffer is then added to the combined primer and
DNA, mixed by flicXing and allowed to stand at room
temperature for 10 minutes.
In a 96 well plate with columns labelled G, A,
T or C~ add 2.5 ~1 of the dd GTP termination mix in the
well labelled G. Similar amounts of ATPI TTP, and CTP,
respectively are added to the wells labelled A, T, and C,
respectively. The plate is then pre-warmed to 37C for
at least one minuteO
~ abelling mixture is diluted to a concentration
of 1:50 and sequenase is diluted to a concentration of
1:8 in ice cold lXTE. The following ingredients~
alpha 32P-ATP, 2 ~1 of the 1:50 dilution of labelling
mixture, 1 ~1 of 0.1 M DTT, and~2 ~1 of 1:8 dilution of
sequenase are added to the annealed template primer and
buffer mixture, mixed well and incubated at room
temperature for 5 minutes to complete the labeling
reaction.
W09~/05760 P~T/~S91/~6~38
2o89~l
64
When the labellin~ reaction is complete, 3.5 ~l
of the reaction mixture is aliquoted to each of the wells
labelled ~G, A, T, C], using separate tips. The
incubations are continued for a total of 3-5 minutes, up
to a maximum of 30 minutes. The reaction is then stopped
by adding 6 ~l of 10 mM EDTA and may be stored for 1-2
days (32p) or 1 week t35S) at -20C.
On the 96 well lid, 1.5 ~l of the reaction is
mixed with 2 ~L of formamide dyes. The lid is then
incubated in an oven on a water bath at 80C, snap
chilled on ice water, and 6% acrylamide gel is loaded.
Using 0.6xTBE as the running buffer, the gel is
run for an hour prior to use in order to heat it up to
50C. This is accomplished by running at 90W constant
power (voltage limit = 2900 V, current limit = 50 mA).
Samples are loaded sequentially at 0, 2 and 4.5 hours and
run at 90 W constant power. After the last loading, the
gel is run for another 90 minutes (total run time = 6
hours) and the gel apparatus i5 laid flat down on the
bench with the front (shorter) glass plate down. The
back glass plate is removed and a sheet of Whatman #l
paper is laid on the gel and is wetted by spraying with
distilled H2O. The filter paper with gel attached is
removed, covered with Saran Wrap and used to expose Kodak
XAR film. Exposure is carried out at -70C for 12-72
hours as appropriate. The autoradiograph can then be
read.
Figs. lA and lB illustrate the partial putative
CAV viral DNA sequences obtained. Upon analysis on
GenBank and EMBL, the putative CAV sequences of Figs. lA
and lB have not been found to be significantly similar to
the sequences of any known retrovirus. Thus, these
sequences suggest that CAV may not be identified as any
other known human or animal virus.
W092/05760 PCT/US9~/~6~3g
~089~
The sequences of Figs. lA and lB do, however,
share some significant homology with a small portion of
~TLV II ~a~ gene sequences, which were originally
employed to amplify the virus from patient body tissues
and fluids, using the polymerase chain reaction (81.5%
homologous). Because these nucleotide fragments are
less than ~2% homologous with comparable qaq gene
sequences of other retroviruses, the identi~ication of
such nucleotide sequences (or peptides encoded there~y)
in the body tissues and fluids of suspected CFIDS
patients, may confirm diagnosis of the infection. The
entire sequences of Fig. lA and Fig. lB are be used in
obtaining the PCR primers or hybridization probes
according to this invention.
~ CAV peptide may be encoded by all or a
fragment of a DNA sequence of Figs. lA or lB. It is
anticipated that a nucleotide sequence of Figs. lA or lB
is, in part, a coding sequence for peptides and proteins
of CAV. Six putative CAV peptide sequences which appear
in Figs. 2A through 2F are determined by translating the
nucleotide sequences of Figs. lA or lB into three reading
frames for each sequence, beginning with the 5'
nucleotide number 1, 2 or 3, respectively, of Fig. lA and
Fig. lB. Fig. 2A illustrates a reading frame beginning
with nucleotide l of Fig. lA. Fig. 2B is a reading frame
beginning with nucleotide 2 of Fig. lA. Fig. 2C is a
reading frame beginning with nucleotide 3 of Fig. lA.
Fig. 2D illustrates a reading ~rame beginning with
nucleotide 1 of Fig. lB. Fig. 2E illustrates a reading
frame beginning with nucleotide 2 of Fig. lB. Fig. 2F is
a reading frame beginning with nucleotide 3 of Fig. lB.
In Fig. 2A through F, an asterisk represents a
putative STOP codon. It is possible that single base
errors in reading the nucleotide sequences of Figs. lA or
lB may indicate STOP codons where a codon for a native
W092/0~760 PCT/US91/06238
~89~ S~
66
amino acid should be encoded. There~ore, CAV peptide
sequences may comprise fragments of the follow~ng encoded
sequences which occur betwesn stop codons, as well as
smaller fragments thereof.
It is expected that at least one of the peptide
sequences (or fragments thereof) encoded by a nucleotide
sequence of Figs. lA or lB may provide either an
antigenic or immunogenic peptide~ These peptides
reported in Figs. 2A through 2F as well as other peptides
identified by the complete sequencing of CAV may be used
as vaccine components.
Exam~le 5 ~ In Situ Mybridization
Viral RNA related to HTLV I and II was
identified by ln situ hybridization in activated PBMC
from CFIDS patients, but not controls, as follows.
Freshly isolated PBMC were cultured in cluster
plates ~Costar] in RPMI 1640 with 10% fetal calf serum
(FCS) containing an optimal mitogenic concentration of
purified OKT3 MAb [Ortho] and 10 U/ml recombinant IL2 for
3 days. Cell concentrations were adjusted to 2X105 ml-
in complete growth media with 50 ng/ml recombinant IL2
[Sandoz, Vienna, Austria] for 7 days then spun onto glass
slides fixed with paraformaldehyde, and stored in 100%
ethanol.
In situ hybridization was carried out using 35S-
labelled RNA probe specific for the 5' region (qaq) of
HTLV I and II. The sizes o~ transcribed labelled
riboprobes were 506 bp for HTLV I and 400 bp for HTLV II.
Probes were hybridized at 1-2X108d.p.m. ml-l at a
temperature of 52C and autoradiographed for 4-8 days.
All cells lines were hybridized using the sAme conditions
in the same laboratory, and cells were examined using a
double-blind code.
WOg2/057~0 PCTtVS91/06238
2 ~
67
Table VII provides the data on the detection o~
retroviral RNA in adult CFIDS patient~ and in exposure
controls by this m ~i~ hybridization wlth the HTLV I
qaq probe and ~TLV II g~ probe.
W092/05760 PCT/US91/06238
.~
20~97Sl
68
Table VII
Detection of Retroviral qaq mRNA by in situ
Hybridization of Activated PBMC from Adult CFIDS*
HTLV I HTLV II HIV
CFIDS Patientsqaq g~ qag
PC1 0 ~1 0
PC4 o o o
PC5 0 +1 0
PC7 o o o
PC9 ~1 +1 0
P~11 +1 +2 0
PC12 . +2 +2 0
PC13
PC14 o o o
PC15
PC18 0 ~2 0
-
Ratio positive 3/11 = 27% 5/11 = 55%
Expo_ure controls
PC2 o 0 0
PC3 0 0 0
PC6
P~10 0 +1 0
PC16 o 0 0
Ratio positive 1/5 = 20%
Vir~us_controls
MT-2 cells (HTLV I) +4 0 0
Mo-T cells (HTLV II) 0 +4 0
HIV-infected H9 cells 0 0 +4
*Scale used to score samples: ~+ = 100-50% positive cells; 3+
= 50-1% positive cells; 2+ = 1-0.1-% positive cells; 1+ = 1-
0.01~ positive cells; 0 = < 0.01% positive cells.
WOg2/05760 PCT~US91/06238
20897~1
69
HTLV mRNA-positive cells were detectPd in 45~
of adult CFIDS patients tested when the HTLV II qaq probe
was used. Only one of five exposure controls contained
these infected cells. PBMC from two of eleven CFIDS
patients also contained RNA that reacted with HTLV I qaq
probe while none of five controls did. These data show
that PBMC from a proportion of CFIDS patients are
actively transcribing viral qaa mRNA ln vitro. This RNA
appears to be more homologous to HTLV II qaq in most
patients but also shows homology to HTLV I qaq in several
patients. Control cells infected with prototypic HTLV I
(MT-2) or prototypic HTLV II (Mo-T) show no such aq mRNA
cross-reactivity. This indicates that this CAV is not
HTLV I or HTLV II.
Example 6 - Detection of HTLV gaq Protein via Antibody
To detect the CAV nucleotide sequence in the
PBMC of suspected CFIDS patients using antibody, the
method described in DeFreitas et al, cited above, was
performed.
Cytospun cells were air dried for 2 hours and
fixed with cold acetone for 10 minutes. They were then
incubated for 30 minutes with 20 ~11 of optimally diluted
ascites containing MAbs to HTLV I p24 ~from Dr. Fulvia
Veronese, Litton Bionetics, Bethesda, MD], HTLV II p24,
or HIV pl5 protein rfrom Thomas Palker, Duke University,
Durham, NC].
In addition, MAb to HIV p24 was supplied by Dr.
Micah Popovio, NCI, Bethesda, MD. Positive control rells
included MT2, Mo-T2, and H9-T cells infected with HTLV I,
HTLV II, and HIV respectively. Cells were labelled with
immune complexes of alkaline-phosphatase and anti-
alkaline phosphatase (APAAP) according to the method of
J. Cordell et al, J. Histochem. Cytochem., 32:219-225
(1984) using reagents obtained from Dako, Santa Barbara,
.
W092~05760 PCT/US91/06238
213~y '~bl
CA. Uninfected Hs cells and cerebrospinal fluid-derived
T cell lines from healthy donors served as the negative
cell controls. Tests or nonspecific binding of the
second antibody and the APAAP complex were included.
Tables VIII and IX report the results of this
assay.
W092/0~760 PCT/U~91/06238
2~89761
.. ..
71
~ABLE VIII
Expression of Protein Related to_HTLV qaq In Activated
PBMC from Adult CFIDS Patients by Immunohistochemistry*
PBMC from Presence of qag protein-positive cells
HTLV I and II ~TLV I
CFIDS (K1 MAb) ~13Bl2 M~b~
PC1 0
PC4 ~1 0
PC5 0 o
PC7 +1 0
PCg O O
P~11 +1 0
PC12 +1 0
PC13 o o
PC14 o o
PC15
Ex~osure controls
PC2 0
PC3 +1 0
PC6 o o
PC10 +1 0
PC16' o o
Non-exposure controls
Viral controls
MT-2 (HTLV I) +4 +4
Mo-T (HTLV II) +4 0
*Scale used to score samples: 4+ = 100-50% positive cells; 1+
= 1~0. 01% positive cells; O = < O . Olg6 positiYe cells.
.
W~92/~57~0 PCT/US91/~6238
208~7~1 72
~LE IX
ExPression of Protein Related to HTI.V qaq,In Activated
PBMC from Pediatric CFIDS Patients by Immunohistochemistry*
PBMC from Presence of qaq protein-positive cells
HTLV I and II HTLV I
CFIDS (K1 MAb~ ~13B12 MAb~
4-4 +1 0
4-4(2) 0 0
10-4 o 0
13-16 0 0
5-16 o 0
2-2
1-16 o 0
10-18 +1 0
12-12 +1 0
Exposure controls
9-23 0 0
18-23(2) 0 0
18-23 o 0
2-23
2-2(2)
Viral controls
MT-2 (HTLV I) +4 +4
Mo-T (HTLV II) +4 0
*Scale used to score samples~ 4+ = 100-50~ positive cells; 1+
= 1-0.01% positive cells, 0 = < 0.01~ positive cells.
W092/05760 PCT/US91/0623B
2~897&1
An HTLV-specific g~ protein was detected at
low frequency in inactivated PMBC from CFIDS patients by
a MAb K1 specific for the qaq region of HTLV I and II
using immunohistochemical staining. The MAb specific for
HTLV I aa~ (13B12) did not react with any cells from
CFIDS patients. This demonstrates that a viral gene
product is expressed in at least a subpopulation of CFIDS
patients and that this protein is not HTLV I encoded.
Exam~le 7 - tRNA Primer Bindinq Site
Two primexs were designed for use in the PCR
technique: the sense primer was the DNA sequence of tRNA
site for proline (#766-783) while the antisense was the
HTLV II ~3~ region bases (#1187-1214). Products
generated from cell lines MT-2 (HTLV I), Mo-T ~HTLV II),
and more than 20 CFIDS patients were probed by Southern
blot hybridization with radiolabeled 18-mer probe which
corresponded to a DNA sequence intervening the two
primers for both viruses.
The results showed that while MT-2 and Mo-T DNA
were amplified via the tRNA binding site for proline, all
CAV DNA samples were negative. Thus, CAV is apparently
not a known human C-type virus (except for HIV).
When the same experiment was performed using
the tRNA primer binding site for lysine as the "sense"
primer strand for PCR (5' TGGCGCCCAACGTGGGGC 3~) and the
"antisense" strand primer was derived from a prototypic
monkey D type retrovirus ~MPMV) (5' GCTACGGCAGCCATTACTTG
3'), the primers amplified two different sized products
from MPMV-infected cells which were visible when probed
with an intervening oligonu~leotide derived from MPMV
(GATACTTGTCCTTGGTTTCCGCA). The products were 360 bp and
250 bp. Ten of ten CFIDS patient DNA samples amplified
and probed using this system showed the same sized
products.
W092/0S760 PCT~US91/05238
20~97Sl
74
Thus, the CFIDS retrovirus, CAV, apparently has
a primer binding site for the tRNA of lysine. This
result suggests that CAV is not HTLV I or II and suggests
that it is either a type of lentivirus, primate D-type
retrovirus, or Foamy (Spuma) virus, all of which use a
tRNA lysine primer.
Example 8 - Characterization of q~y~Proteins of CAV
Peripheral blood leukocytes were activated in
culture with OXT3 Mab [Ortho Pharmaceuticals] and
recombinant IL-2 for five days. After replacing complete
media with cysteine- and methionine-free media on day
six, cells were labeled with 35S-methionine and cysteine
for 16-18 hours. After disruption of cells, labeled
proteins containing ~ antigenic determinants were
precipitated with mouse Mab K1 which reacts with aaa
proteins of HTLV I, II, STLV and Staph A.
Precipitates were boiled in SDS to remove the
antigen-antibody complexes from the Staph A, and the
protein complexes electrophoresed through 12% and 15%
polyacrylamide gels with 0.1% SDS and 2-mercaptoethanol
for 16-18 hours at constant amperage. After gels were
dried and exposed to X-ray film for 12-15 days, sizes of
radiolabeled proteins from CFIDS patients and controls
were calculated from standard curves generated using
labeled molecular weight markers which were co-
electrophoresed.
The results show that the precipitated g~
proteins from HTLV I and II infected cell lines in 12%
PAGE are 24 kD and 45 kD. On the same gels, ten out of
ten CFIDS-derived CAV qaq proteins are 27-28 kD, 45 kD,
55-56 kD and 76 kD. No aa proteins were precipitated
from healthy controls.
on the 15~ PAGE, lower molecular weight qaa
proteins could be visualized from CFIDS patients. In
W092/05760 PCT/US~/06238
2~897~
addition to p27-2~, pll-12 (11-12 kD), and pl3-14 (13-14
kD) were visualized. No such bands were present in MT-2
or Mo-T lysates, or in healthy controls.
These data suggest that the CFIDS retrovirus
CAV is not HTLV I or II. Animal retroviruses that have
been shown to express aaq proteins of these molecular
weights are: primate D-type retroviruses; primate C-
type, e.g. SSAV, GALV and BaEV; lentiviruses, e.g. EIAV
(but not HIV); mouse B-type e.g. MMTV; avian C-type
retroviruses, e.g. ASLV, REV; and perhaps Foamy (Spuma)
viruses, although the g~g proteins of this latter group
have not been analyzed directly but only by DNA seguence
extrapolation.
Example 9 - Location of qaq Proteins in Nucleus
Leukocytes from the above-mentioned CFIDS
patient samples are reacted with K-l Mab and
immunostained by goat-anti-mouse alkaline phosphatase
(APAAP). More than 50% of patient samples tested (and
none of controls) revealed cells staining for qaq
proteins. Most importantly, the staining is found in
both the cytoplasm and nucleus of the positive cells.
The only known retroviruses to display nuclear staining
for viral proteins are the Foamy virus group.
Examp~e~10 - Reverse_Transcriptase AssaY
A reverse transcriptase assay was performed as
follows. CAV was culture* in cell lines B-Jab H-9 and V-
937 (all positive by PCR for HTLV-II gag region). The
virus was harvested through three cycles of freezing at -
B0C. Culture fluid was subsequently thawed and
centrifuged at 1,000 xg for 10 minutes at 4C to remove
intact cells.
The viral particles were pelleted by running at
a speed 25,000 rpm for 90 minut~s in a Beckman SW28
WOg~/0~760 PCT/US91/06238
76
20~97~1
rotor. The pellet was suspended in S00 ~l (to make lOOx
concentration) of TNE buffer (10 mM Tris/HCl pH 8.0, 100
mM NaCl, 1 mM EDTA). The bu~`fer can be tested
im~ediately or stored ~rozen at -20C. Either 25 ~l or
50 ~l of lysate in buffer, as indicated in Table X below,
was used in each assay tube.
The reaction mixture of reverse transcriptase
activity [I. M. Verma, J. Virol., 15:843-854 (1975); I.
M. Verma, ?. Virol., 15:121-126 (1975)] in 100 ~l
contained 50 mM Tris/HCl, pH 8.0, 40 mM KCl, 5 mM
dithiothreitol, 0.05% Triton X-100, 0.2~ Nomidet P-40,
100 ~g/ml bovine serum albumin, 40 ~g/ml template-primer
complex and varying amounts of divalent cation (Mg+~ or
Mn++) to achieve the concentration as indicated in Table
IX below.
The exogenous template-primer complex was
selected from either polyriboadenylate-
oligodeoxythymidylate (poly.rA-oligo.dT) or
polyribocytosylate-oligodeoxyguanidylate (poly.rC-
oligo.dG) CPharmacia, Piscataway, NJ].
After 5 minutes on ice, 1.5 ~M [3H]-labelled
deoxyth~midine triphosphate (dTTP; 43 Ci/mmole) or 6.6 ~M
[3H]-labelled deoxyguanosine triphosphate (dGTP; 11
Ci/mmole) ~Amersham, United Kingdom] were added in the
mixture and incubated at 37C ~or ~0 minutes. The
reaction was stopped by the addition of ice cold 10 mM
~odium pyrophosphate and 15% trichloracetic acid tTCA).
After lS minutes at 0C the precipitated [3H]-labelled
polythymidines Spoly T) and polyguanidines (poly G)
synthesized in this reaction was collected on a glass
microfiber filters (Whatmann GF/C, 2.4 cm) presoaked in
5% TCA. The filters were washed ten times with ice cold
5% TCA and dried. 3H-~CA-precipitable material (i.e.
double stranded nucleic acid) was counted with Econofluor
scintillation fluid by a Packard liquid scintillation
WV92/OS760 PC~/USgl/06238
2~897~
counter. The data in the following table is expressed as
counts per minute per reaction vial.
Reverse transcriptase (RT) of every retrovirus
prefers a unique exogenous template-primer, a divalent
cation (either Mg+~ or Mn++), and a labelled substrate to
polymerize DNA from RNA [See, e.g., "RNA Tumor Viruses",
second edition, eds. R. Weiss, N. Leich, H. Varmus and J.
Coffin, Cold Spring Harbor Lab Press, Cold Spring Harbor,
NY (1984)]^
The results of the RT study demonstrated that
the CFIDS-associated CAV growing in established cultures
apparently does not show the characteristics of a C type
retrovirus reverse transcriptase, e.g., an RT af HTLV-I
or HTLV-II. RT of HTLV-I (as illustrated by the MT-2
cell lysate of the table) and HTLV-II prefer a template-
primer of poly ~C-oligo(dG) with Mg++ (~ 30 mM); CAV
appears to prefer a template-primer of poly~A-oligo-(dT)
with Mn++. Among the retroviruses that show the same RT
characteristics as that of CAV (poly ~A-oligo(dT)
template-primer and Mn++ preferences) are the Spuma
(foamy) virus and the monkey D-type retroviruses.
WO 92~05760 PCr/US91/06238
2 0 8 ~ 7 ~ 1 73
TA8LE X
~NA-dependent DNA polymer~e (rever3n tran~criptase; RT) activity
CAV Template- Divalent'H-labelled 'H-TCA
precipitable
Cu~turo~ prlmer cation~ub~trat~~roduct la~L
25 yl polyyA-oligo-(dT) Mg++ (SmM)'H-TTP (l.S ym) 1,572
SO yl polyyA-oligo-(dT) Mg++ (SmM)'H-TTP (1.5 ym) 752
25 yl polyyA-oligo-(dT)Mg++ (lOmM) 'H-TTP (1.5 ym) 862
50 ~1 polyyA-oligo-(dT)Mg++ (lOmM) 3H-TTP (1.5 ym) 430
25 yl polyyA-oligo-(dT)Mn++ (0.5mM) 'H-TTP (1.5 ym) 20,737
50 ~1 polyyA-oligo-(dT)Mn++ (0.5mM) 'H-TTP (1.5 ym) 13,011
25 ~1 polyyA-oligo-(dT)Mn++ (2.0mM) 3H-TTP (1.5 ym) 17,157
50 yl polyyA-oligo-(dT)Mn++ (2.0mM) 3H-TTP (1.5 ym) 13,579
25 ~1 polyyC-oligo-(da) Mg++ (lomM) 3H-dGTP (6.6 ym) N.D
50 ~1 polyyC-oligo-(dG~Mg++ (lOmM) 3H-dGTP (6.6 ~m) 30
25 yl polyyC-oligo-(dG)Mg++ (30mM) 3H-dGTP (6.6 ym) 491
50 yl polyyC-ollgo-(dG)Mg++ (30mM) 3H-dGTP (6.6 ym) 604
25 yl polyyC-oligo-(dG)Mn++ (0.5mM) 'H-dGTP (6.6 ym) 117
50 yl polyyC-oligo-(dG)Mn++ (0.5mM) 3H-dGTP (6.6 ym) 573
25 yl polyyC-oligo-(dG)Mn++ (2.0mM) 3H-dGTP (6.6 ym) 171
50 yl polyyC-oligo-(dG)Mn++ (2.0mM) 3H-dGTP (6.6 ym) 105
HTLV-I culture
50 yl polyyC-oligo-(dG)Mg++ (30mM)3H-dGTP (6.6 ym) 14,366
50 yl polyyC-oligo-(dG)Mn++ (2mM) 3H-dGTP (6.6 ym) 608
W092~05760 PCT/US91/06238
20897~1
73
Numerous modifications and variations of the
present invention are included in the above-identified
specification and are expected to be obvious to one of
skill in the art. For example, use of other appropriate
CAV genomic sequences as PCR or hybridization primers and
probes is contemplated, as well as the use of other assay
techniques and antibodies, and the use of other viral
peptides for therapeutic agents. Such modifications and
alterations to the compositions and processes of the
present invention are believed to be encompassed in the
scope of the claims appended hereto.
.: .. ,1 .
