Note: Descriptions are shown in the official language in which they were submitted.
W()92/04381 PCl/GB91/015~4
- ' - 2~9133~
NOVEL ANTIBODIES FOR TREATMENT AND PREVENTION OF
INFECTION IN ANIMALS AND MAN
BACKGRO~ND OF THE INYENTIQN
There has long been a need for effective agents for prevention and treatment
of infection in animals and man. Typical methods comprise administration
0 of chemical agents which inhibit the growth of microorganisms allowing the
immune system to eradicate the infectious agent. Whilst natural and
synthetic chemicals have been particularly effective as treatments for
bacterial infection, the emergence of resistant strains has proved frequent
and problematic. For viral infections, chemical agents have had limited
15 effect and the severity of disease is usually,correlated with immune system
status.
For many years, the effectiveness of ~erum from immune individuals on
prevention and treatment of infectious disease has been known. However, it
20 is well known that the antibodies ~nthin human immune sera which are
responsible for effective treatment, i.e., the neutralising antibody
component, are only &very small fraction of the total sera antibody.
Furthermore, the use of immune sera has been limited by low neutralising
antibody levels, by the scarcity of immune donors, by the cost of treatment
25 and more recently by the risk of adventitious spread of disease through
microorganisms in donor sera.
The development of monoclonal antibody technology provided the means for
development and production of pure m~ine monoclonal antibodies in large
30 q~ tities from cell lines devoid of pathogenic microorganisms. With this
technique it was possible to provide monoclonal antibodies which interacted
with pathogenic organisms, some of which monoclonal antibodies could
prevent the growth of the target microorganisms i~ infected mice.
Unfortunately, it is not possible to predict from in, ntro studies which
35 antibodies will be most effective at ~ vivo killing of microorganisms. Many
WO 92/04381 ~ O (~ j PCI/GB91/01~54
monoclonal antibodies with high binding affinity for their target in an in
tro setting are not effective in vo. In fact, in some cases where
antibodies are effective at preventing growth of the microorganisms under
laboratory conditions, they prove ineffective in the in vivo environment.
s
The impact and limitations of murine monoclonal antibodies for treatment
of infectious disease is illustrated by the case of respiratory syncytial virus
(RSV) infection. RSV is the major cause of lower respiratory tract infection
in infants in the first year of life and a significant cause of respiratory
lo disease in young cattle. In m~n, most attempts to vaccinate against RSV
infection have failed, and treatment of RSV infection with chemical drugs
such as ribavirin is only partially effective. Murine monoclonal antibodies
specific for RSV have been shown to be effective in prevention and
treatment of RSV in mice. However, the use of murine monoclonal
15 antibodies for treatment and prevention o~RSV in non-murine species is
potentially limited by the immune response of these species to the "foreign"
murine antibody, i.e., immune responses in humans against murine
antibodies have been shown to both immunoglobulin constant and variable
regions (human anti-mouse antibodies). Therefore, non-immunogenic
20 variants of monocloDal antibodies where the immunoglobulin constant and
var,iable regions contai~ amiDo acid sequences recognised as "self' by the
RSV infected recipient are needed for effective prevention and treatment of
RSV infection.
25 Recombinant DNA technology has provided the ability to alter antibodies in
order to substitute specific immunoglobulin (Ig) regions from one species
with regions from another. Patent Cooperation Treaty Patent Application
No. PCT/GB85/00392 (Neuberger et al and Celltech I~nited) describes a
process whereby the complementary heavy and light chain variable domain
30 of an Ig molecule from one species may be combined with the
complementary heavy and light chain Ig constant domains from another
species. This process may be used, for example, to alter murine monoclonal
antibodies directed against a specific human disease. Such alteration is
effected by substitution of l~e murine antibody constant region domains
35 with human IgG constant region domain~ to create a "chimeric" antibody to
WO 92/04381 PCI /GB91/01554
-3 2~9~33~
be potentially used for treatment of such hu~nan disease. However, such
chimeric antibodies will still potentially elicit an immune response in
humans against the murine (i.e, "foreign") variable regions.
British Patent Application Publication Number GB2188638A (Winter)
describes a process whereby antibodies are altered by substitution of their
complementarity detennining regions (CDRs) from one species with those
from another. This process may be used, for e~ample, to substitute the
CDRs from human heavy and light chain Ig variable region domains with
o alternative CDRs from murine variable region domains. These altered Ig
variable regions may subsequently be combined with human Ig constant
regions to create antibodies which are totally human in composition e~cept
for the subsitituted murine CDRs. Such mu~ine CDR-substituted
antibodies are likely to elicit a considerably reduced immune response in
humanA compared to chimeric antibodies ~ecause they contain considerably
less murine components. However, as stated in British Patent Application
Publication Number GB2188638A, merely replacing one or more CDRs with
complementary CDRs from another species which are specific for a desired
disease may not always result in an altered antibody which retains the
antigen binding capacity of complementary CDRs. The British Patent
Application propose6 that by "routine e2cperimentation or by trial and error",
a functional altered antibody with antigen binding capacity may be
obtained. However, no description of the nature of the routine
e~cperimentation or the trial and error process needed to obtain the desired
antibody i8 provided, and there is a suggestion that success*e replacements
of CDRs from di~erent sources should be attempted.
Esalnination of the three-dimensional structures of several IgGs has led to
~e conclusion that the Ig va~iable region~ of heavy and light chains each
comprise three looped structures (which include the CDRs) supported on a
sheet-like 8tructure termed the variable region ~amework. The
predominant definition of what comprises a CDR and what comprises a
framework is based upon amino acid sequences of a number of Igs.
wO 92/04381 2 0 ~ PCr/GB91/01554
In three dimensional configuration, the aforementioned loop structures and
CDRs between a mouse and human antibody do not correspond exactly
although there is considerable overlap. Therefore it appears that, in some
cases, the transfer of antigen binding specificity by replacement of CDRs
s may require the additional replacement of residues adjacent to the defined
CDRs. For e~ample, it has been hypothesized that, in certain cases,
variable region framework amino acid residues may be important in antigen
binding through direct interaction with CDRs (See, Amit et al., Science, 233
(1986) pp 747-7~3; Queen et al., Proc. Nath Acad. Sci., 86 (1989) pplO029-
lo 10033; and Protein Design Labs, Patent Cooperation Treaty PatentApplication Publication Number W09007861, published July 26, 1990). In
the Queen et al. reference, the authors selected human variable regions for
mu2ine CDR-replacement on the basis of ma~mum homology to the murine
variable region comprising the CDRs used for the replacement. In addition,
5 on the basis of computer modelling, the Q~een et al. authors utilized a
hl-man fr~mework for CDR replacement which included several murine
framework amino acids thought to interact with the murine CDRs. The
resultant altered antibody, whilst retaini~g antigen binding capacity,
contained additional murine f~amework amino acids. Such addtional
20 murine framework ~mino acids might contribute to an enhanced immune
response to the altered antibody i~ humans.
In addition, previous 6tudies (~ee, e.g., Riechmann,et al., Nature. ~
(1988), p323-327) have demonstrated that the use of reshaping can be used
2s to transfer in ~rQ high affinity binding from mouse to human antibodies,
but it has not previously been sho~,vn that it is possible to provide the
2i~ggn of properties required for preservation of effective prevention of
gro~vth of human respiratory syncytial virus (RSV) ~ ~n.
30 Therefore, there is a need for altered antibodies with minimal
immunogenicity for the prevention and treatment of infectious disease. In
addition, there is a need for a defined process to produce such altered
antibodies without radical alteration of va~iable region frameworks and the
associated effect on immunogenicity. The present invention provides
3s altered antibodies for prevention and treatment of infectious disease and a
wO92/04381 2 0 ~ 5 Pcr/GB9l/ols~4
process for their production by introducing only critical variable region
framework modifications.
RSV, which is in the genus Pneumovirus of the Paramyxovir~dae
5 family, i8 a major cause of lower respiratory tract infections in
young children. Primary infection gives an incomplete immunity,
and reinfection is frequently observed during childhood. The role of
immune mechanisms in the human disease have not been clarified.
Previous attempts to develop effective vaccines with attenuated or
lO killed RSV have met with failure, i.e., not only were the children
unprotected, but subsequent infections with RSV sometimes
resulted in more severe diseases than in non-immumzed controls.
RSV infection is also a major cause of resp*atory infection in young
cattle.
Recently, certain immunological and molecular information has
been obtained regarding the antigenic and functional properties of
RSV proteins. The RSV fusion protein (F) and the RSV attachment
protein (G) have been identified as the major viral antigens, and
20 their genes have been cloned and sequenced. I~vo antigenically
distinct subgroups of human RSV, designated A and B, have been
described. The anti~enic difFerences between A and B subgroups
reside mainly on the RSV G protein. In contrast, the RSV F protein
has a high degree of genetic and antigenic homology between the
25 two subgroups, and various strains within these subgroups.
Monoclonal antibodies (mAbs) directed against both envelope
glycoproteins (F and G) of RSV have been demo~strated to
neutralize the virus. (See, Walsh & Hruska, L Yiroloey. 47, 171-177
30 (1983); and Walsh et al., J. Gen. Viroloe~v. ~, 761-767 (1984)).
However, in vitro and in vivo studies with mAbs or with vaccinia
virus recombinants e~pressing F protein indicated that this protein
i8 the most important antigen in inducing cross-protective
immunity. (See, Johnson et al., ~L Viroloev. ~1, 3163-3166 (1987);
3s Olmsted et al., ~Q5~ ç~,~, 7462-7466 (1986); Wertz
WO 92/043XI 2 () lJ 1 ~ ~ ~ PCr~GB91/015~4
et al., J. VirOIQ~ ~, 293-310 (1987); and Walsh et al., Infection
Immunitv. ~ 756-7~8 (1984)). Several authors have identified
different antigenic sites in the F protein and have shown that at
least three of these antigenic sites are involved in neutralization.
5 Two or three neutralizing epitopes have been located on the F
protein in different ways. Using escape mutant viruses, Lopez et al.,
J~Virolo~v. ~, 927-930 (1990) have shown that tvo amino acid
residues (i.e., 262-Asn and 268-Asn) of the F1 subunit of the F
protein are essential for the integrity of a particular neutralizing
lO epitope. Another highly conser~ed neutralizing epitope has been
mapped with synthetic peptides to residues 221-Ile to 232-Glu of
the F1 subunit of the F protein by Trudel et al., L (~neral Viroloev.
~, 2273-2280 (1987). Finally, a recent analysis by the Pepscan
procedure identified an epitope at positions 483-Phe to 488-Phe of
lS the F1 subunit of the F protein, which epit~o~pe could correspond to
another neutralizing epitope. (See, Scopes et al., L General
Yirologv. ~1, 53-59 (1990)).
There is a need for the development of new therapies for the treatment and
20 prevention of R~V infection. A neutralizing and protective epitope of an
RSV viral antigen could prove useful in the generation of monoclonal
antibodie6 useful for the prophylaxi6 and~or treatment of RSV infection.
The pre6ent invention provides such a novel epitope on the RSV F protein
which is recognised by a neutralizing and protective antibody in vivo.
2s
Figure 1 shows tbe DNA sequence and corresponding amino acid sequence
of the RSV19 heavy chain vanable region (VH). The CDR sequences are
30 bosed. The first eight and last eleven amino acid6, as underlined,
con espond to sequences of the oligonucleotide primer6 used.
Figure 2 shows the DNA sequence and corresponding amino acid 6equence
of the RSV19 light chain variable region (VK). The CDR sequences are
WO 92tO4381 2 0 ~ PCI/GB91/01554
- 7 -
boxed. The first eight and last six amino acids, as underlined, correspond to
sequences of the oligonucleotide primers used.
Figure 3 shows the basic plasmid pHuRSV19VH comprising a human Ig
5 heavy chain variable region framework and CDRs derived from mouse
RSV19.
Figure 4 shows the basic plasmid pHuRSV19VK comprising a human Ig
light chain variable region framework and CDRs derived from mouse
0 RSVl9.
Figure 5 shows the derived Ig variable region amino acid sequences encoded
by RSV19VH, RSV19VK, pHuRSWH and pHuRSV19VK, and derivations
of pHuRSV19VH.
Figure 6 shows an ELISA analysis of the binding of HuRSV19VH/VK
antibody and its derivative, HuRSV19VHFN~/VK, to RSV antigen.
Figure 6A shows that there is little if any di~erence between the
20 ability of the RSV19 and HuRSV19VHFNSlHuRSV19VK antibodies
to bind to intact, non-denatured RS virus.
Figure 7 shows that mAb RSV19 binds to two synthetic peptides
consisting of, respectively, amino acid residues 417-432 and 422-
25 438 of the F protein.
.,~U~RY OF lrEIE INVENTIQ~
The present in~lention relates to altered antibodie8 in which at least parts of
30 the complementarity determining regions (CDRs) in the iight and/or heavyvariable domains of an acceptor monoclonal antibody have been replaced by
analagou8 parts of CDRs from one or more donor monoclonal antibodies,
and in which there may or may not ha~ve been minimal alteration of the
acceptor monocJonal antibody light and/or heavy variable domain
35 f ramework region in order to retain donor monoclonal antibody binding
WO 92/04381 PCI/G~391/01554
20913 ~
specificity, wherein such donor antibodies have specificity for
microorganisms, in particular specificity for respiratory syncytial virus
(RSV). The present invention also relates to a process for preparing such
altered antibodies; a pharmaceu~cal composition comprising a therapeutic,
s non-to~c amount of such altered antibodies and a pharmaceutically
acceptable carrier or diluent; and a method of prophylactically or
therapeutically treating a microorganism-induced disease state in a human
or animal in need thereof which comprises administering an effective
amount of such altered antibodies to such human or animal. Preferably the
o altered antibodies of the invention will be produced by recombinant DNA
technology. The altered antibody of the present invention may comprise a
complete antibody molecule (having full length heavy and light chains) or
any fragment thereof, such as the Fab or (Fab )2 fragment, a light chain or
heavy chain dimer, or any minimal recombinant fragment thereof such as
5 an Fv or a SCA (single-chian antibody) or ~,ny other molecule with the same
specificity as the altered antibody of the invention. Alternatively, the
altered antibody of the invention may have attached to it an effector or
reporter molecule. For instsnce, the altered antibody of the invention may
have a macrocycle, for chelating a heavy metal atom, or a to~n, such as
20 ricin, attached to it by a covalent briding structure. Alternatively the
procedure of recombinant DNA technology may be used to produce an
altered antibody of t;he invention in which the Fc fragment or CH3 domain
of a complete antibody molecule has been replaced by an enzyme or to~in
molecule. The remainder of the altered antibody may be derived from any
2s suitable human immunoglobulin. However, it need not comprise only
protein sequences from the human immunoglobulin. For instance a gene
may be constructed in which a DNA sequence encoding part of a human
immunoglobulin chain is fused to a DNA sequence encoLing the amino acid
sequence of a polypeptide effector or reporter molecule.
Another aspect of this Lnvention is the discoverv of a specific epitope of the F(fusion) protein of RSV which has been demonstrated to be a target for
monoclonal antibodies which both protect and cure mice of infection by RSV.
In addition, it has also been demonstrated that Fab fragments of such
3s monoclonal antibodies protect mice from in ~nvo infection. Thus, the present
WO 92/04381 PCr/GB91/01554
2~ 3''~
invention also relates to such specific epitope of the F protein of RS'~I;
monoclonal antibodies directed against such epitope; and Fab fragments of
such monoclonal antibodies. In addition, this invention relates to a
pharmaceutical composition comprising a therapeutic, non-to~ic amount of
s such monoclonal antibodies or Fab fragments and a pharmaceutically
acceptable carrier or diluent; and a method of prophylactically or
therapeutically treating RSV infection in a human or animal in need thereof
which comprises ad~unistering an effective amount of such monoclonal
antibodies or Fab fragment~. to ~.uch human or anim~l.
The present invention provides altered antibodies with specificity for
microorganisms, and the DNA coding for such antibodies. These antibodies
comprise Ig constant regions and variable regions from one source, and one
or more CDRs from a different source.
In addition, amino acid substitutions in the variable region frameworks are
described which are critical for antigen binding Affinity. The invention also
provides vectors producing the altered antibodies in mamm~ian cell hosts.
20 The present invention particularly applies to the provision of altered
antibodies vith the combination of properties required for the prevention
and trestment of infections in animals and msn. For esample, non-human
antibodies with specificity for micro organi~ms may be altered to produce
"humanised" antibodies which elicit a miDimal immune response in
2s humans. In particular, the in~ention provides "humanised" antibodies with
specificity for RSV which are shown to be effective in an animal model for
RSV infection in humans and to recognise a large variety of human clinical
isolates of RSV.
30 The present invention also provides a method for effecting minim~l
modification6 to the amino scids of variable region frameworks in order to
retain the antigen bin~ing capacity of CDRs from a different source. The
method involve~ stepwise alteration and testing of individual amino acids in
the variable region framework potentially critical for sntigen binding
wO 92/04381 2 ~ ~ 13 3 ~ Pcr/GB9l/0ls~4
- 10 -
affinity. The method avoids major introduction of framework amino acids
from the same source as CDRs.
DET~ILED DESCRIPrION OF THE INVENTION
As used herein, the term "humanized antibody" refers to a molecule having
its complementarity detennining regions (and, perhaps, minimal portions of
its light and/or heavy variable domain framework region) derived from an
immunoglobulin from a non-human species, the remaining immunoglobulin-
0 derived parts of the molecule being derived from a human immunoglobulin.
The present invention relates to altered antibodies in which at least parts ofthe complementarity detexmining regions (CDRs) in the light and/or heavy
variable domains of an acceptor monoclonal antibody have been replaced by
15 analagous parts of CDRs from one or more~donor rnonoclonal an~bodies,
and in which there may or may not have been minimal alteration of the
acceptor monoclonal antibody light and/or heavy variable domain
framework region in order to retain donor monoclonal antibody binding
specificity, wherein ~uch do~or antibodies have specificity for
20 microorganisms, in particular specificity for respiratory syncytial virus
a~SV). The present invention al80 relates to a process for preparing such
altered antibodies; a pharmaceutical composition oomprising a therapeutic,
non-toxic amount of such altered antibodies and a pharmaceutically
acceptable calTier or diluent; snd a method of prophylactically or
25 therapeutically treating a mic~oorganism-induced disease state in a human
or animal in need thereof which comprises administering an effect*e
amount of such altered antibodies to such human or animal.
The altered antibodies of the invention may be produced by the following
30 proce6s:
(a) producing, by conventional techniques, in an expression vector an operon
having a DNA sequence which encodes an antibody heavy or light chain
wherein at lea~t the CDRs (and those minimal portions of the acceptor
35 monoclonal antibody light and/or heavy variable domain framework region
WO 92/04381 PCl IGB91/01554
O ~
- 1 1 -
required in order to retain donor monoclonal antibody binding specificity) of
the variable domain are derived from a non-human immunoglobulin, such
as that produced by RSV19~ and the remaining immunoglobulin-derived
parts of the antibody chain are derived from a human imrnunoglobulin,
5 thereby producing the vector of the invention;
(b) producing, by conventional techniques, in an e~pression vector an operon
having a DNA sequence which encodes a complementary antibody light or
heavy chain wherein at least theCDRs (and those minimal portions of the
0 acceptor monoclonal antibody light and/or heavy variable domain
framework region required in order to retain donor monoclonal antibody
binding 6pecificity) of the variable domain are derived from a non-human
immunoglobulin, 6uch as that produced by RSV19, and the remaining
immunoglobulin-derived parts of the antibody chain are derived from a
5 human immunoglobulin, thereby producir3g another vector of the invention;
(c) transfecting a host cell by conventional techniques vnth the or each
vector to create the transfected host cell of the invention;
20 (d) culturing the transfected cell by conventional techniques to produce the
altered antibody of the invention.
The host cell may be transfected with t~1Vo vectors of the invention, the first
vector containing an operon encoding a light chain-derived polypeptide and
25 the second vector contaiDing an operon encoding a heavy chain-derived
plypeptide. Preferably the vectors are identical except in 80 far as the
coding sequences and selectable markers are concerned 80 to ensure as far
as possible that each polypeptide chain is equally expressed. Alternatively,
a single vector of the invention may be used, the vector in~luding the
30 sequence encoding both light chain- and heavy chain-derived polypeptides.
The DNA in the coding sequence~ for the light and heavy chain~ may
comprise cDNA or genomic DNA or both.
WO 92/04381 PCI/GB91/01554
2 ~
, ~
The host cell used to express the altered antibody of the invention is
preferably a eukaryotic cell, most preferably a mammalian cell~ such as a
CHO cell or a myeloid cell.
5 The general methods by which the vectors of the invention _ay be
constructed, transfection methods required to produce the host cell of the
inventio~, and culture methods necessary to produce the altered antibody of
the invention from such host cell are all conventional techniques. Likewise,
oncP produced, the altered antibodies of the invention may be purified
lo according to standard procedures of the art, including ammonium sulfate
precipitation, af~inity colllmns, column chromatography, gel electrophoresis
and the like.
An example of the altered antibody of the invention are humanised
5 antibodies derived from the murine mono~onal antibody RSV19 such as
HuRSV19VH/VK and HuRSV19VHFNS/H~V19VK which are described
in the Examples. Such antibodies are useful in treating, therapeutically or
prophylactically, a human ag~in~t human RSV infec~on. Therefore, this
invention also relates to a method of treating, therapeutically or
20 prophylactically, human RSV infection in a human in need thereof which
comprises administenng an effective, hllman RSV infection treating dose
such altered antibodies to fiuch human.
The altered antibodies of this invention may also be used in con,iunction
2s with ot~er antibodies, particularly human monoclonal antibodies reactive
with other markers (epitopes) respon8ible for the disease against which the
altered antibody of the invention i~ directed.
The altered antibodies of this invention may al~o be used as separately
30 administered compositions given in corlJunction with chemotherapeutic or
immunosuppres6ive agents. The appropriate combination of agents to
utilized can readily be determined by one of skill in the art using
conventional techniques. A8 an example of one such combination, the
altered antibody of the invention known as HuRSV19VHFNS/HuRSV19VK
W O 92/04381 PC~r/GB9t/0155~
2091~
- 13 -
may be given in conjunction with the antiviral agent ribavirin in order to
facilitate the treatment of RSV infection in a human.
One pharmaceutical composition of the present invention comprises the use
s of the antibodies of the subject invention in immunoto~cins, i.e., molecules
which are characterized by two components and are particularly usefill for
killing selected cells in vitro or in vivo. One component is a cytotoxic agent
which i8 usually fatal to a cell when attached or absorbed. The second
component, known as the "delivery vehicle" provides a means for delivering
0 the toxic agent to a particular cell type, such as cells comprising a
carcinoma. The two components are commonly chemically bonded together
by any of a variety of well-known chemical procedures. For esample, when
the cytotosic agent is a protein and the second component is an intact
immunoglobulin, the linkage rnay be by way of heterobifunctional cross-
5 linkers, e.g., carbodiimide, glutaraldehyde~and the like, Production ofvarious immunotoxins is well-known in the art.
A variety of cytotogic agents are suitable for use in immlmoto~ins, and may
include, among others,-radionudides, chemotherapeutic drugs such as
20 methotre~ate, and cgtotoxic proteins such as ribosom~l inhibiting proteins
(e.g., ricin).
The delivery component of the immunotoxin will in~lude the human-like
immunoglobulins of the present invention. Intact immunoglobulins or their
25 binding fragments, such as Fab, are preferably used. Typically, the
antibodies in the immunoto~ins will be of the human IgM or IgG isotype,
but other mammnlian constant regions may be utilized if desired.
The altered antibodies and pha~aceutical compositions of the invention
30 are particularly useful for parenteral administration, i.e., subcutaneously,
intramuscularly or intravenously. The compositions ~or parenteral
administration ~vill commonly comprise a ~olution of the altered antibody of
the invention or a cocktail thereof dissolved in an acceptable carrier,
preferably an aqueous carrier. A ~ariety of aqueous carriers may be
3s employed, e.g., water, buffered water, 0.4% saline, 0.3% glycine, and the
20~1~3~
wo 92/04381 PCr/Gs91/01554
- 14 -
like. These solutions are sterile and generally free of particulate matter.
These solutions may be sterilized by conventional, well known sterilization
techniques. The compositions may contain pharmaceutically acceptable
au~iliary substances as required to appro~imate physiological conditions
s such as pH adjusting and bu~ering agents, etc. The concentration of the the
altered antibody of the invention in such pha~aceutical formulation can
vary widely, i.e., from less t~an about 0.5%, usually at or at least about 1%
to as much as 15 or 20% by weight and will be selected primarily based on
fluid volumes, viscosities, etc., according to the particular mode of
0 administration selected.
Thus, a phsrmaceutical composition of the invention for intramuscular
injection could be prepared to contain 1 mL sterile buffered water, and 50
mg of an altered antibody of the invention. Similarly, a pharmaceutical
5 composition of the invention for intraveno~s infusion could be made up to
contain 250 ml of sterile Ringer's solution, and 150 mg of an altered
antibody of the invention. Actual methods for preparing parenterally
administrable compositions are well known or will be apparent to those
6killed in t~e art and are de~cribed in more detail in, for example,
20 ~mington's Pharma~utical Science, 15th ed., Mack Publishing Company,
Ea~ton, Pelmsylvania.
The altered antibodies of the invention can be lyop~ilized for storage and
reconstituted in a suitable carrier prior to use. This technique has been
25 shown to be effective with conventional immune globulins and art-known
lyophilization arld reconstitution techniques can be employed.
Depending on the intended result, the pha~maceutical composition of the
invention can be administered for prophylactic and/or therapeutic
30 treatment~. In therapeutic application, compositions are administerd to a
patient already suffering from a disease, in an amount sufficient to cure or
at least par~ally arrest the disease and it~ complications. In prophylactic
applications, compositions containing the present sntibodies or a cocktail
thereof are administered to a patient not already in a disease state to
35 enhance the patient's re~istance.
WO 92/04381 PCI/GB91/01554
2~ i3S-3~
- 15 -
Single or multiple a~ministrations of the pharmaceutical compositions can
be carried out with dose levels and pattern being selected by the treating
physician. In any event, the pharmaceutical composition of the invention
5 should provide a quantity of the altered antibodies of the invention
sufflcient to effectively treat the patient.
It should also be noted that the altered antibodies of this invention may be
used for the design and synthesis of either peptide or non-peptide
0 compounds (mimetics) which would be useful in the same therapy as the
antibody. &e, e.g., Saragovi et al., ~ ~, 792-795 (1991).
Another aspect of this invention is the disco~ery of a specific epitope of the F(fusion) protein of RSV which ha~ been demonstrated to be a target for
monoclonal antibodies which both protect :~nd cure mice of infection by RSV.
In addition, it has also ~een demonstrated that Fab fragments of such
monoclonal antibodies protect mice from in ~ri o infection. Thus, the present
invention also relates to such ~pecific epitope of the F protein of RSV;
monoc3onal antibodies directed against such epitope; and Fab fragments of
20 such monoclon~l a~tibodies. In addition, this invention relates to a
ph~ ceu1ical c~mposition comp ising a t~erapeu~c, ~on-tosic amount of
~uch mono~lonal an1ibodies or Fab ~agment~ aDd a pha~maceu~ically
acceptable carrier or diluent; and a method of prophylactically or
therapeutically treating RSV i~feetion in a human or animal in need thereof
25 which comprises administering an effective amount of such monoclonal
antibodies or Fab fragments to such human or animal.
The present invention provide~ altered antibodies with ~pecificity for
microorganism~, and the DNA coding for such antibodie~. These antibodies
30 comprise Ig constant regions and variable regions ~rom one source, and one
or more CDRs from a difference source.
In addition, amino acid substitution~ in the v~riable region f~neworks are
descri~ed which are cntical for antigen ~inding affinity. The invention also
3s provides vectors producing the altered antibodies in mammalian cell hosts.
WO 92/0438t PCI/GB91/OtS54
20~33~3
- 16 -
The present invention particularly applies to the provision of altered
antibodie~ with the combination of properties req~ured for the prevention
and treatment of infections in ~nimals and man. For e~ample, non-human
s antibodies with specificity for micro organisms may be altered to produce
"humanised" antibodies which elicit a minimal immune response in
hum~nR. In part;icular, the invention provides "humsniæed" antibodies with
specificity for RSV which are shown to be effective in an animal model for
RSV infection in humans and to recognise a large variety of human clinical
0 isolates of RSV.
The present invention also provides a method for effecting minim~l
modifications to the amino acids of variable region ~eworks in order to
retain the antigen binding capacity of CDRs from a dif~erent source. The
1S method involves stepwise alteration and te~sting of individual amino acids inthe variable region framework potentially critical for antigen binding
ai3inity. Ilhe method avoids major introduction of framework amino acids
from the saIne source as CDRs.
20 The following e~ nples are o~erred by way of illustration, not by limitation.
In the following examples all necessary restriction enzymes, plasmids, and
2s other reagent~ and materials were obtained from commercial sources unless
otherwise indicated.
In the following e2camples, u~les8 oth2rwise indicated, all general cloning,
ligation and other recombinant DNA methodology was perfo~ned a6
30 described in "Molecular Cloning, A Laboratory Manual (1982) eds T.
Maniatis et. al., published by Cold Spring Harbor Laboratory, Cold Spring
Harbor, New York (hereinafter referred to as "Maniatis et al.").
W~`92/0438l 2 0 ~ ~ ~ 3 ~ PCI/GB91/015~4
In the following examples, the following abbreviations may be employed:
dCTP deoxycytidine triphosphate
dATP deoxyadenosine triphosphate
dGTP deoxyguanosine triphosphate
dTTP deoxythysiodine triphosphate
DTT dithiothreitol
C cytosine
A adenine
T thymine
G guanine
DMEM Dulbecco's modified Eagle's medium
PBST Phosphate buffered saline containing 0.02~o
Tween 20 (pH 7.5)
ls ALTERED ANT~ODD3S
Examples 1-3 describe the preparat;ion of the altered antibodies of the
invention.
EX~b~PRODUCTION OF ALTERED ANTIBODIES SPECIElC FOR RS~I
The source of the donor CDRs utilized to prepare these altered antibodies
20 was a munne monoclonal antibody, RSV19, specific for the fusion (F)
protein of RSV. The RSV19 hybridoma cell line was obtained from Dr.
Geraldine Taylor, IDstitute for Animal Health, Compton Laboratory,
Compton, Near Newbury, Berks, RG16 0NN, England. Methodology for the
isolation of hybridoma cell lines secreting monocloDal antibodies specific for
2s RSV is described by Taylor et al., Immunolo~v. 52 (1984) pl37-142.
Cytoplasmic RNA was prepared by the method of Favaloro et. al., (1980)
Methods ~n Enz~noloev. ~ 5, p.718-749, from t~e RSV19 hybridoma cell
line, and ~DNA wa~ 6ynthesized u~ing Ig variable region primers as follows:
30 for the Ig heavy ~hain variable (VH) region, t;he primer
VHlFOR (5'TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG3'~
wa6 used, and
for the Ig light chain variable region (VK), the primer
VKlFOR (5'GTTAG~TCTCCAGCTTG&TCCC3')
3s was used.
WO 92/04381 PCI/GB91/015~4 - `
~ 0 ~ 1 8 -
cDNA synthesis reactions consist;ed of 20mg RNA, 0.4mM VHlFOR or
VKlFOR, 250mM each of dATP, dCTP, dGTP and dTTP, 50mM Tris-HCl
pH 7.5, 75mM KCl, 10mM Dl~, 3mM MgC12 and 27 units RNase inhibitor
(Phannacia, Milton Keynes, United Kingdom) in a totsl volume of 50ml.
Samples were heated at 70C for l0 minutes (min) and 810wly cooled to 42C
oYer a period of 30 min. Then, l00m MMLV reverse transcriptase (Life
Technologies, Paisley, United Kingdom) was added and incubation at 42C
continued for 1 hour.
0
VH and VK cDNAs were then amplified using the polymerase chain reaction
(PCR) as described by Saiki, et al., ience. ~ (1988), p487-491. For such
PCR, the primers used were:
VHlFOR;
VKlFOR;
VHlBACK (5'AGGTSMARCTGCAGSAGTCWGG3'); and
VKlBACK (5'GACATI CAGCTGACCCAGTCTCCA3'),
whereM=CorA,S=CorG,andW=AorT.
20 Primer~ VHlFOR, VKlFOR, VHlBACK and VKlBACK, and their use for
PCR-amplification of mouse Ig DNA, i8 described by Orlsndi et al., Froc.
~, ~. ~. ~, 86, 3833-3937 (1989).
For PCR amplification of VH, DNA/prLmer mi~tures consisted of 5ml
25 RNA/cDNA hybrid, and 0.5mM VElFOR and VFIlBACK primers, For PCR
amplifications of VK, DNA/primer rni~ctures consisted of 5ml RNA/cDNA
hybrid, and 0.5mM VHlFOR and V~lBACK primers. To these mi~ctures
was added 200 mM each of dAl~P, dC~P, dGTP and dl~, 10mM Tris-HCl
pH 8.3, 50mM KCl, 1.5mM MgC12, 0.01% (w/v) gelatin, 0.01% (vlv) l~veen
30 20, 0.01% (v/v) Nonidet P40 and 2 units Taq DNA polymerase (United
States Biochemicals-Cleveland, Ohio, USA). Sample6 were 6ubjected to 25
thermal cyc~es of PCR at 94C, 1 min; 60C, 1 min; 72C, 2 min; ending ~nth
5 min at 72C. For cloning and sequencing, amplified VH DNA was purified
on a low melting point agarose gel and by Elutip-d colnmn chromatography
(Schleicher and Schuell-Dussel, Germany) and cloned into ph~ge Ml3
wn 92/04381 ~, Q ~ pcr/GB9l/ols54
19
(Pharmacia-Milton Keynes, United Kingdom). The general cloning and
ligation methodology was as described in "Molecular Cloning, A Laboratorv
Manual (1982) eds T. Maniatis et. al., published by Cold Spring Harbor
Laboratory, Cold Spring Harbor, New York (hereinafter referred to as
s "Maniatis et al.". VH DNA was either directly ligated into the SmaI site of
M13 mpl8/19 ~Pharmacia-Milton Keynes, UK) or, following digestion with
PstI, into the PstI site of M13tgl31 (Amersham International-Little
Chalfont, UK). Amplified VK was similarly gel purified and cloned by the
following alternatives:
Pv uII digest into M13mpl9 (SmaI site)
P~NII and BglII digest into M13mpl8/19 (SmaI - BamHI site)
PvuII and BglII digest into M13tgl31 (EcoRV - BglII site)
BglII digest into M13tgl31 (SmaI - BglII site)
15 The resultant collections of overlapping clones were sequenced by the
dideoxy method (Sanger, et al., Proc. ~, Acad. ~, ~, 74 (1977) p5463-
5467) using Sequenase (United States Biochemicals-Cleveland, Ohio, USA).
From the sequence of RSV19 VH and VK domains, as shown in Figure 1 and
20 2 respectively, the CDR sequences were elucidated in accordance with the
methodology of Kabat et al., in Sequences of Proteins of Immunological
Interest (US Dept of Health and Human Services, US Government Prin~ng
Office, (1987)) u~lizing computer assisted alignment with other VH and VK
sequences.
Transfer of the murine RSV19 CDRs to human frameworks was achieved by
~ite directed mutagenesis. The primers used were:
VHCDR1 5'CTGTCTCACCCAGTGCATATAGTAGTCGCTGAAGGTGAA
GCCAGACACGGT3'
30 VHCDR2 5'CATTGTCACTCTGCCCTGGAACTTCGGGGCATATGGM
CATCATCATTCTCAGGATCAATCCA3 '
WO 92/04381 pcr/GB9]/ol5s4
~ Q ~ rj - 20-
VHCDR35'CCCTTGGCCCCAGTGGTCAAAGTCACTCCCCCATCTT
GCACAATA3'
VKCDR15'CTGCTGGTACCATTCTAAATAGGTGTTTCCATCAGTATGT
ACAAGGGTCTGACTAGATCTACAGGTGATGGTCA3'
s VKCDR25'GCTTGGCACACCAG~AAATCGGTTGGAAACTCTGTAG
ATCAGCAG3'
VKCDR35'CCCTTGGCCGAACGTCCGAGGAAGATGTGAACCTTGAA
AGCAGTAGTAGGT3'
lO The DNA templates for mutagenesis comprised human framework regions
de~ived from the crystallographically solved proteins, NEW ( described by
Saul, et al., L ~iQL S~h~, ~ (1978), p585-597) with a substitution of
amino acid 27 ~om serine to phenylalanine (See, Riechmann et al., IQ~, t.)
and REI (described by Epp et al, ~ L Biochem. 45 (1974), p513-524) for
lS VH and VK domains, respectively. M13 ba~sed templates comprising human
frameworks with irrelevant CDRs were prepared as described by
Riechmann et al., Nature. ~ (1988).
Oligonucleotide site directed mutagenesis of the human VH and VK genes
20 was based on the method of Na~aye et al., Nucl. ~ R&~l~ (1986)
p9679-9698.
To 5mg of VH or VK single-s~anded DNA in M13 was added a t~vo-fold
molar excess of each of the three VH or VK phosphorylated oligonucleotides
2s encoding the three mouse CDR (complementarity determining region)
sequence6. Pnmers were a~ealed to the template by hea~ng to 70C and
slowly cooled to 37C. To the annealed DNA was added 6u Klenow
fragment (Life Technologies, Pai~ley, UK); 6u T4 DNA ligase (Life
Technologies, Paisley, UK); 0.5mM of each of the following nucleoside
30 triphosphates (dATP, dGTP, dTTP and 2'~eo~ycytidine 5'-0~
thiotriphosphate) (thiodCTP); 60mM T~s-HCl (pH 8.0); 6mM MgC12; ~mM
DTT (Sigma, Poole, UK); and lOmM ATP in a reaction volume of 50ml. This
misture was incubated at 16C for 15 hours (h). The DNA was then ethanol
precipitated and digested with 5 units NciI (Life Technologies, Paisley, UK)
3s which Dicks t~e parental strand but leaves the newly synthesised st~and
W() 92/04381 PCI`/GB91/01554
2 ~ 3 ~
- 21 -
containing thiodCTP intact. The parental strand was then removed by
digesting for 30 min with 100 units exonuclease III (Pharmacia, Milton
Keynes, United Kingdom) in 50 ml of 60mM Tris-HCl (pH 8.0), 0.66mM
MgC12, and 1mM DTT. The DNA was then repaired through addition of 3
s units of DNA polymerase I (Life Technologies, Paisley, UK), 2 units T4 DNA
ligase in 50 ml of 60mM Tris-HCl (pH 8.0), 6mM MgC12, 5mM DTT, 10mM
ATP and 0.5mM each of dATP, dCTP, dGTP and dTTP. The DNA was
transformed into competent E. coli TG1 cells (Amersham International,
Little Chalfont, UK) by the method of Maniatis et al. Single-stranded DNA
o was prepared from individual plaques and sequenced by the method of
Messing (1983) Methods i.n ~zvmolo~r. .~01, p. 20-78. If only single or
double mutants were obtained, then these were subjected to further rounds
of mutagenesis (u~lizing the methodology described above) by using the
appropriate oligonucleotides until the triple CDR mutants were obtained.
1s
The CDR replaced VH and VK genes were cloned in expression
vectors (by the method of Maniatis et al.) to yield the plasmids
shown in Figures 3 and 4 respectively, and such plasmids were
termed pHuR5V19VH and pHuRSV19VK For pHuRSV19VH, the
20 CDR replaced VH gene together with the Ig heavy chain promoter
(Figures 3 and 4~, appropriate splice sites and signal peptide
sequences (E igures 3 and 4) were excised from M13 by digestion
with HindIII and BamHI, and cloned into an expression vector
containing the murine Ig heavy chain enhancer (Figures 3 and 4),
2s the SV40 promoter (Figures 3 and 4), the gpt gene for Relection in
mammulian cells (P'igures 3 and 4) and genes for replication and
selection in E,~i (E igures 3 and 4) . A human IgGl constant
region was then added as a BamHI fragment (Figures 3 and 4).
The construction of the pEuR~V19VK plasmid was essentially the
30 same except that the gpt gene was replaced by the hygromycin
resistance gene (Figures 3 and 4) and a human kappa chain
constant region was added (Figures 3 and 4).
lOmg of pHuR~V19VH and 20mg of pHuRSV19VK were digested
3s with PvuI utilizing conventional techniques. The DNAs were mixed
WO 92/04381 PCI~GB91/015~4 -`
- 22 -
together, ethanol precipitated and dissolved in 25ml water.
Appro~imately 107 YB2/0 cells (from the American Type Culture
Collection, Rockville, Maryland, USA) were gro~,vn to semi-
confluency, harvested by centrifugation and resuspended in 0.5ml
5 DMEM (Gibco, Paisley, UK) together with the digested DNA in a
cuvette. After 5 min on ice, the cells were given a single pulse of
170V at 960uF (Gene-Pulser, Bio-Rad-Ricbmond, Califo~ia, USA)
and left in ice for a filrther 20 min. The cells were then put into 20
ml DMEM plus 10~o foetal calf serum and allowed to recover for
0 48h. After this 'dme, the cells were distributed into a 24-well plate
and selective medium applied (DMEM, 10% foetal calf serum,
0.8mg;1ml mycophenolic acid, and 250mg/ml ~anthine). A~er 34
day6, the medium and dead cells were removed and replaced with
fresh selective medium. Transfected clones were visible with t~e
naked eye 10-12 days later.
The presence of human antibody in the medium of wells containing
transfected clones was measllred by conventional ELISA
techniques. Micro-titre plates were coated overnight at 4C with
20 goat anti-human IgG (gamma chain speeific) antibodies (Sera-Lab-
Ltd., Crawley Down, UK) at l mg per well. After washing with
PBST (phosphate buf~ered saline co~taining 0.02% l~veen 20
(p~I7.5)), lOOml of culture medium from the wells containing
transfectants was added to each microtitre well for lh at 37C. The
25 wells were then emptied, washed with PBST and either peroxidase-
conJugated goat anti-human IgG or pero~cidase-coDJugated goat
anti-human kappa constant region antibodies ( both obatined from
Sera-Lab Ltd., Crawley Down, UK) were added at 100 ng per well.
Plates were then incubated at 37C for lh. The wells were then
30 emptied snd washed with PBST. 340 mglml Q-phenylenediamine in
50mM sodium citrate, 50mM sodium phosphate (pH 5.0) and
0.003% (~r/v) H22 were added at 200ml per well. Reactions were
stopped after 1 to 5 min by the addition of 12.5% sulphunc acid at
50 ml per well. The absorbance at 492 nm was then measured
3s spectrophotometrically.
Wl' 92/04381 2 0 ~ 13 ~ ~ PCr/GB91/01554
- 23 -
The humanised antibody HuRSV19VH/VK, secreted from
transfected cell lines cotransfected with pHuRSVVH and
pHuRSVV~ was purified on Protein-A agarose columns
(Boehringer MaDnheim, Lewes, UK)) and tested for binding to RSV
virus in an ELISA assay. Antigen consisted of calf kidney (CK)
cells infected with RgV (A2 ~train of RSV obtained from a child in
Australia and described by Lewis et al., Med. L Austr~ , 4~, 932-
933 (1961)) and treated with 0.5% (v/v) NP40 detergent to yield a
0 cell lysate. A control cell lysate was similarly prepared using
uninfected CK cells. Microtitre plate wells were coated with either
infected or control cell lysate. Antigen coated plates were blocked
with PBST for 1 hour at 37C, washed with PBST, and thereaf~er
humanised antibody was applied (i.e., HuRSV19VH/VK). After 1
hour at 37C, the wells were emptied, washed with PBST and 200
ng goat anti-humaIl IgG antibodies (Sera Lab-Ltd., Crawley Down,
UK) added per well. After 1 hour at 37C, ~e wells were emptied,
washed Wit~l PBST and 200ml of a 1:1000 dilution of horseradish
peroxidase coDjugated rabbit anti-goat IgG antibodies (Sigma-Poole,
20 UK) were added. After 1 hour at 37C, the wells were emptied and
washed with PBST. To each well wa~ added 200ml substrate buf~er
(340mglml Q-phenyleDIediamine in 50mM sodium citrate, 50mM
sodium phosphate (pH 5.0) and 0.003% (v/v) H202). Reactions
were stopped by the addition of 50ml 12.5% sulphuric acid. The
25 absorbance at 492 nm was then measured. Antibody
HuBSW~ bound to RSV although ~vith an affinity less than
the murine RSV19 antibody.
EXAMPLE 2-PRODUCl~lON OF HIGH A~$ INITY ANT~ODIES SPECI~C
FOR RSV BY A METHOD DESlGNED TO ACHIEVE
~NIMAL. VARIABLE REGlON E RAM~OR~C
MODI~CATIONS GIVING RlSE TO HIGH AFFINITY
BINDING
The method of this invention involves the following order of steps
of alteration and testing:
WO 92/04381 2 0 ~ PCI`/GB91/01554
- 24-
1. Individual framework an~ino acid residues which are
known to be critical for interaction with CDRs are compared in the
primary antibody and the altered CDR-replacement antibody. For
s e~ample, heavy chain amino acid residue 94 (Kabat numbering- see
Kabat et al., cited above) i8 compared in the primary (danar) and
altered sntibodies. An arginine residue at this position i8 thought
to interact with the invariant heavy chain CDR aspartic acid
residue at position 101.
If amino acid 94 comprises arginine in the framework of the
primary antibody but not in the framework of the altered autibody,
then an alternative heavy chain gene comprising arginine 94 in the
altered an$ibody is produced. In the reverse situation whereby the
5 altered antibody framework compnses an a~rginine residue at
position 94 but the primary antibody does ~ot, then an alternative
heavy chain gene comp~ising the original amino acid at position 94
is produce~ Prior to any fi~rther analysis, alternative plasmids
produced on tl~is basis are tested for produc$ion of high ~ffinity
20 altered antibodies.
2. E ramework a~no ac3ds wit~in 4 residues of the CDRs
as defined according to Kabat (see gabat et al., cited above) are
compared in the p~imary antibody and altered CDR-replacement
25 antibody. Where differences are present, then for each region (e.g.,
upstream of VHCDR1) the specific am~o acids of that region are
substituted for those in the corresponding region of the altered
antibody to pro~ide a small number of altered genes. Alternative
plas~ds produced on t~is basis are then tested for production of
30 high affinity antibodies.
3. Fra~newor~ residues in the primary and altered CDR-
replacement ~ntibodies are compared and residues with major
dif~erences in charge, size or hydrophobicity are highlighted.
35 Alternative plasmids are produced on tbiB basi~ with the ~dividual
WO 92/04381 2 0 v~ 1 3 3 a PCI`/GB91/01554
- 25 -
highlighted amino acids represented by the corresponding amino
acids of the primary antibody and such alternative plasmids are
tested for production of high affinity antibodies.
5 The method is exemplified by the production of a high affinity
altered antibody derivative of HuRSVVH/VK (See, Example 1)
specific for RSV. Comparison of VH gene sequences between
RSV19VH and pHuRSV19VH (See, Figure 5) indicates that 3 out of
4 amino acid differences occur between amino acids 27 to 30 and
0 between amino acids 91 to 94. Thus, pHuRSV19VHN~ and
pHuRSV19VHFNS were produced with framework ~mino acids 27
to 30 and 91 to 94 in the former, and amino acids 91 and 94 in the
latter, represented as in the primary RSV19VH. Using
oligonucleotide site directed mutagenesis as described in E~ample
5 1, the following oligonucleotides were used for mutagenesis of the
HuRSV19VH gene in M13:
pHuRSV19VHNIK- 5'ATATAGTAGTCmMTGlTGAAGCCAGA
CA3'
pHuRSV19VHFNS - 5'CTCCCCCATGAATrACAGAAATAGA
20 CCG3'
Humanised HuRSV19VH~NS/HuRSV19VK antibody was tested in
an ELISA a6say as detailed in E~ample 1 for analysis of binding to
RSV antigen prepared firom detergent-estracted, virus-infected
2s cells. Figure 6 shows thatthe substitution of VH residues 91 to 94
in HuRSV19VH/VK with VH residue~ from mouse RSV19VH
partially restored antigen binding levels. Additional analysis of
HuFNS bindu~g properties was performed using an ELISA assay in
which intact Type A RS virus (Long strain) va~ used as the
30 antigen. The data from 6uch additional aDalysis ~as shown in
Figure 6A) show that there is little if any difference between the
ability of the RSV19 and HuR~V19V~NS/HuRSV19VK antibodies
to bind to intact, non-denatured RS virus. This additional analysis
also showed detectable binding of HuRSV19VH/VK to intact virus,
3s although of a mucl~ lower magnitude than was seen with either
WO 92/04381 PCl/GB91/01554
2 ~ 26-
RSVl9 or HuRSV19VHFNS/HuRSV19VK. Thus, the data from this
additional analysis suggests that the affinity for the native antigen
was restored in the HuRSV19VHFNS/HuRSV19VK mAb.
Specificity of HuRSV19VHFNS/HuRSV19VK for RSV F protein was
5 shown by conventional Western blot analysis using a truncated
soluble F protein construct e~pressed in CH0 cells.
EX~LE 3-SPECIPICITY AND BIOLOGICAL ACIIVITY OF AN ALTERED
ANTIBODY SPECIEIC FOR RSV.
In order to ascertain the potential clinical usefillness of a
huma~ised antibody ~pecific for RSV, an immunofluorescence
analysis of binding to 24 RSV clinical isolates was undertaken. The
isolates were obtained from children duling the winter of 1983-84
15 by the Bristol Public Health Laboratory (B~istol, England) and
represented both of the maJor subgroups of RSV. 13 isolates were
serotyped as subgroup A and 11 isolates as subgroup B. HeLa or
MA104 cells infected with RSV isolates were grown in tissue
culture. When the cells showed evidence of cytopathic effect, 20 ml
20 of 0.02% (w/v) disodium EDTA (ethylenediaminetetra-acetic acid)
(BDX Chemicals Ltd., Poole, U~ in PBS and 3ml of 0.25% (w/v)
trypsin in PBS were added and the cell Bu8peI~ion ~potted into
wells of ~l~;-coated slides (polytetra~uoroethylene coated slides)
(Hendley, Essex, UK). After 3 hours at 37C, the slides were dried
25 and fised in 80% acetone. Cells were overlaid with monoclonal
antibody (i.e., either humanised antibody,
HuRSV19V~NS/HuRSV19VK, or the murine antibody RSV19) for
1 hour at room temperature. After extensive washing, either
fluorescein-co~uugated rabbit anti-mou~e IgG (Nordic Laboratories-
30 ISlburg, The Netherlands) or fluorescein-conjugated goat anti-
human IgG1 (Southern Biotechnology, Birmingham, Alabama,
USA) was added, snd the incubation wa~ repeated. After filrther
washing, cells were mounted in glycerol and e~camined uIIder W
light.
WO 92/04381 PCI`/GB91/01554
20~ 335
- 27 -
Table I shows the results of comparative immunofluorescence for
the humanised antibody, HuRSV19VHFNS/HuRSV19VK, and the
murine antibody RSV19. This data indicates that 100% of clinical
isolates are recognised by both the humanised and murine
5 antibodies. Such data demonstrates that the hllm~nised antibody
has the potential for recognition of most clinical isolates comprising
both of the major RSV subgroups.
W O 92/04381 PCT/GB91/01554
T~BLE I
~indinq ot Hu~anised Anti-RSV to Clinical Isolates
Extent o~ Fluorescence*
Isolate Number HuRSV19VHFNS/HuRSVl9VR Murine RSV19
SubcrouD A
V818 ++++ ++++
V795 ++++ +++~
V00401 ++ +++
V00214 + ++
V00764 ++ +++
V743 ++ +++
V316 ++ ++
V369 ++++
V1249
V04692 +++ +++
V1248 + +
V01232 ++ ++
V729
Sub~roup B
~00634 + ++
V4715 ++
V00463 + ++
.V4112 ++ ++
V00165 ++ ++
V00422 ++ ++
V837 +++ +++
VOO900 ++ ++
4677 +++ +++
4424 ++ ++
V01231 +
+,++,+++ and ++++ refer to relative numbers of fluorescing
cells observed and represent the proportion of cells infected
WO 92/04381 2 0 ~13 3 ~ PCr/GBgl/0l554
- 29 -
The humanised antibody, HuRSV19VH~N~HuRSV19VK, was next
tested for biological activity in vitro in a fusion inhibition assay. A
suspension of MA104 cells was infected with RSV at an m.o.i.
(multiplicity of infection) of 0.01 PFU (plaque forming units) per
cell. Af~er 1 hour at 37C, 2ml of cells at 105/ml were distributed to
glass coverslips in tubes. Af~cer a further 24 hours at 37C, the
culture medium was replaced by medium containing dilutions of
humanised antibody, HuRSV19VHFNS/HuRSV19VK. 24 hours
later, coverslip cultures were fi~ed in methanol for 10 minutes and
0 stained with May Grunwald stain (BDH Chemicals Ltd., Poole,
UK). Table II shows the effect of increasing concentrations of
HuRSV19VHFNS/HuRSV19VK in inhibiting the frequency of giant
cells. The data represented in the following Table II demonstrates
the biological activity of the humanised antibody
HuRSV19VHFNS/HuRSV19VK in inhibiting Type A RSV induced
cell fusion. It should be noted that additional studies showed that
the fusion inhibition titres for RSV19 versus
HuRSV19VHFNS/HuRSV19VK were comparable, providing
additional evidence that affinity for the native viral antigen was
fully restored in HuRSV19VHFNS/HuRSV19VK The h~ nized
antibody HuRSV19VHFNS/HuRSV19VK has also been shown,
(using methodology aIlalOgOU6 to that ut;ilized above for showing
inhibition of Type A RSV induced cell fusion), to exhibit a dose
dependent inhibition of Type B RSV (strain 8/60) induced giant cell
fusion.
wo 92/04381 2 '~ PCr/GB91/0l554
- 3() -
TABLE II
Inhibition of RSV Induced Cell_Fusion by Uumanised Anti-Rsv
Concentration of Averaqe number of
~uRSV19VHFNS/HuRSV19VK Number of Giant Cells~ Nucleii
( uq /~
100 44 4 5
71 4.0
3 8
12.5 67
6.3 89
3.1 87
1.6 164
0.8 201
0 4 292
0.2 219
o 239,259 14,13.5
0 (no virus) 10
Scored as the number of cells ~ith 2 or more nucleii in 20 fields
~ith a 25x sbjective ~icroscope lens
WO 92/04381 PCI/GB91/01554
2 0 ~ 13 ~ .~
- 31 -
The humanised antibody, HuRSV19VHFNS/HuRSV19VK was next
tested for biological activity ~ vivo in an RSV-mouse infection
model. BALB/c mice (obtained from Charles Rivers: specific
pathogen free category 4 standard) were challenged intranasally
5 with 104 PFU of the A2 strain of human RSV (as described by
Taylor et al., Infection ~1 ImmunitY. 43 (1984) p649-655). Groups
of mice were administered with 25mg of humanised antibody either
one day prior to virus infection or 4 days following infection.
lo Administration of antibody was either by the intranasal (i.n.) or
intraperitoneal (i.p.~ routes. 5 days after RSV infection, mice were
sacrificed and lungs were assayed for RSV PFU (see, Taylor et al.,
Infection ~sl Immunitv. 43 (1984) p649-6~5). The data in the
following Table III shows that HuRSV19VHFN~HuRSV19VK at a
l5 single dose of 2Smg per mouse is e~tremely~e*ective in prevention
and treatment of RSV infection.
W O 92/04381 PCT/GB91/015~4
2 ~ 91 3 3 5 -32-
TAiBLE III
Prevention and Treatment of RSV Infection in Mice by Humanised Anti-Rs~
Antibodv Treatment
Day* Route~ _ loq1O PFU per qram of lunq~
-l i.p <1 7
<l 7
<l.7
<l 7
<l 7
-l i.n <1 7
<l.7
<l 7
<l 7
<l 7
+4 i.p <1 7
<l 77
<l.7
+4 i.n. <1.7
l.7
<l 77
<l.7
antibody 4 47
4.32
4.64
4.61
4.55
-l refers to ad~inistration of HuRSVl9VHFNS/HuRSYl9VK antibody l day
prior to RSV infection, ~4 refers to adoinistration of antibody 4 days
post infection
i.p. - intraperitoneal, i.n. - intranasal
virus PFU is expressed as the virus titre from dilutions of lO~ /v)
lung homogenates (see Taylor et al., loc. cit.) adjusted to PFU per
gra~ of lung. <1.7 log,o PFU per gram ~eans that no virus ~as detected
in the starting dilution of lung ho~ogenate 10%.
WO 92/04381 2 0 9 L 3 ~ ~ Pcr/GB9l/0l554
- 33 -
HuRSV19VHFNS/HuRSVl9VK was also shown to be active in vivo
when administered prophylactically to mice challenged with Type B
RSV (strain 8/60) using methodology similar to that described
above. In addition, the humanized antibody HuRSV19VH/VK was
5 also shown to be acl;ive ~, ~yQ when administered prophylactically
to mice challenged with Type B RSV (strain 8/60) using
methodology similar to that described above.
This invention also relates to a method of preventing human RSV
o infection in a h1~m~n in need thereof which comprises
administering to such human an effective, human RSV infection
inhibiting dose of an altered antibody of this invention for which
RSY19 or RSV20 was the donor monoclonal antibody.
15 This invention also relates to a method of ~herapeutically treating
human RSV infection in a human in need thereof which comprises
administering to such human an effective, human RSV infection
therapeutic dose of an altered antibody of this invention for which
RSVl9 or RSV20 was the donor monoclonal antibody.
To effectively prevent RSV infection in a human, one dose of
appro~nately 1 mg1kg to approximately 20 mg/kg of an altered
antibody of this invention for which RSV19 or RSV20 was the donor
monoclonal an~body, such as HuRSV19VH/VK or
25 HuR~V19VHFNS/HuRSV19VK should be administered
parenterally, preferably i.v. (intravenously3 or i.m.
(intramuscularly); or one dose of appro~omately 200 u~/kg to
appro~imately 2 mg/kg of ~uch antibody ~hould be administered i.n.
(intranasally). Preferably, ~uch dose should be repeated every six
30 (6) weeks starting at the beginning of the RSV season (October-
November) until the end of the RSV season (March-April).
Alternatively, at the beginning of the RSV season, one dose of
appro~cimately 5 mglkg to approximately 100 mg/kg of an altered
antibody of this invention for which RSVl9 or RSV20 was the donor
3s monoclonal antibody, such as HuRSV19VH/VK or
WO 92/04381 PCI`/GB91/01554
~3 J ~ ~ 34
HuRSV19VHFNS/EIuRSV19VK, should be administered i.v. or i.m.
or one dose of approximately 0.5 mg/kg to appro~imately 10 mg/kg
of such antibody should be administered i.n.
To effectively therapeutically treat RSV infection in a human, one
5 dose of appro~imately 2 mg/kg to approximately 20 mg/kg of an
altered antibody of this invention for which RSV19 or RSV20 was
the donor monoclonal antibody, such as HuRSV19VElVK or
HuRSV19VHFN~EIuRSV19VK 6hould be administered
parenterally., preferably i.v. or i.m.; or appro~nately 200 uglkg to
10 approximately 2 m~/kg of such antibody ~hould be a-lmin;stered i.n.
Such dose may, if necessary, be repeated at appropriate time
intervals until the RSV infection has been eradicated.
The altered antibodies of the invention may also be a~ministered by
5 inhalation. By "inhalation" is meant intra~asal and oral inhalation
administration. Appropriate dosage forms for such adrninistration,
such as an aerosol formulation or a metered dose inhaler, may be
prepared by conventional techniques. For e~ample, to prepare a
composition for administration by inhalation, for an aerosol
20 container with a capacity of 15-20 ml~ 10 mg of an altered
antibody of thiB invention with 0.2-0.2% of a lubricating agent, such
as polysorbate 85 or oleic acid, and disperse such mi~cture in a
propellant, fiuch a freon, preferably in a combination of (1,2
dichlorotetrafluoroeth~ne) and difluorochloromethane and put into
2s an appropriate aerosol container adaped for either intranaszl or
oral inhalation admini~tration. As a further e~ample, for a
compo~ition for administration by inhalation, for an aero601
container with a capacil~y of 15-20 ml: Dissolve 10 mg of an altered
antibody of this invention in ethanol (6-8 ml), add 0.1-0.2% of a
30 lubricating agent, 6uch 8B poly60rbate 85 or oleic acid; and disper~e
such in a propellant, such as freon, preferably a combination of (1.2
dichlorotetrafluoroethane) and difluorochloromethane, and put into
an appropriate aerosol container adapted for either intranasal or
oral inhalatioD administration.
W~ 92/04381 2 0 ~ ~ 3 3 ~ Pcr/GBgl/01s~4
- 35 -
The preferred daily dosage amount to be employed of an altered
antibody of the invention to prophylactically or therapeutically
treat RSV infection in a human in need thereof to be administered
by inhalation i8 from about 0.1 mg to about 10 m~/kg per day).
Natural RSV infect~on8 have been reported in cattle, goats, sheep
and chimpanzees. Thus, for esample, utilizing the methodology
descnbed above, an appropriate mouse antibody could be
"bovinized", and appropriate framework region residue alterations
o could be effected, if necessary, to restore specific binding affinity.
Once the appropriate mouse antibody has been created, one of skill
in the art, using conventional dosage determination techniques, can
readily determine the appropriate dose levels and regimens
required to effectively treat, prophylactic~lly or therapeutically,
5 bo~ine RSV infection.
Examples 1-3 show that altered a~ltibodies for prevention and
treatment of infection can be produced with variable region
~ameworks potenii~lly recognised as "self' by recipients of the
20 altered antibody. ~IGnor modifications to the variable region
frameworks can be implemented to effect large increases in antigen
binding without appreciable increased immunogenicity for the
recipient, Such altered antibodie6 can effectively prevent and
eradicate infection.
~hus the pre6ent invention provides an altered antibody in which
complementarity dete~miniDg region6 (CDRs) in the heavy or light
chain variable domain6 have been replaced by ~n~logous parts of
CDRs from a different source re6ul~ng in antibodies po~6e66ing the
30 combination of propertie~ required for ef~ective prevention and
treatment of infect;iou6 disease in Pnim~ls or man. Suitably, the
entire CDR~ have been replaced. Preferably, the variable domains
in both hea~y and light chains have been altered by CDR
replacement. Typically, the CDRs from a mouse antibody are
35 graflced onto the framework regions of a human antibody. The
WO 92/04381 PCl/GB91/01554 .
- 36-
altered antibody preferably has the structure of a natural antibody
or a fragment thereof.
A preferred antibody is one directed against respiratory syncytial
virus (RSV), preferably one specific for the fi~sion (F) protein of
RSV. A particularly preferred antibody of this kind has the
following N-termin~l variable domain amino acid sequences (see
the Amino Acid Shorthand Table immediately following) in its
heavy and light chains:
heavy:
QVQLQESGPGLVRPSQTLSLTCTVSGFT
~(or NIK)DYYhEnWVRQPPGRGLE~G~DPEN
DDVQYAPKFQGRVl~LVDTSKNQFSLRLSSVTAAD
TAVYCAR(or FCNS)WGSDFDHWGQGTI~7TVSS
light:
DIQLTQSPSSLSASVGDRVTITCRSSQTLVHTDGNTY
LEWYQQKPGAPKLLrYRVSNRFSGVPSRFSGSGSGT
DFTFTISSLQPEDLATYYCQSHLPRTFGQGTKVErK
Table Amino Acid Shor~hand
Three-letter One-letter
2s Amino Acid abbreviation symbol
Alanine Ala A
Arginine Arg R
Asparagine Asn N
Aspartic acid Asp D
Cysteine Cys C
Glutamine Gln Q
Glutamicacid Glu E
wn 92/04381 2 0 9 ~3 J~; PCT'/GB91/01554
Glutamicacid Glu E
Glycine Gly G
Histidine His H
Isoleucine He
o Leucine Leu L
Lysine Lys K
Methionine Met M
Phenylalanine Phe F
Proline Pro P
Serine Ser S
Threonine Thr T
Tryptophan Trp W
Tyrosine Tyr Y
Valine Val Y
30 It will be understood by those skilled in the art that such an altered
antibody may be further altered by changes in variable domain
amino acids without necessarily affecting the specificity of the
antibody for the fusion (F) protein of RSV, and it iB anticipated that
even as many as 25% of heavy and light c~ain amino acids may be
35 substituted by other amino acids either in the variable domain
frameworks or CDRs or both. Such altered antibodies can be
effective in prevention and treatment of resp*atory syncytial virus
(RSV) infection in animals and man.
40 The invention al60 includes a recombinant plasmid containing the
coding eequence of the altered antibody of the inven~on, and a
WO 92/04381 ~ ~) 9 ~ PCr/GB91/01554
- 38 -
mammalian cell-line transfected with a recombinant plasmid
containing the coding sequence of the altered antibodies hereof.
Such a vector is prepared by conventional techniques and suitably
comprises DNA sequences encoding immunoglobulin domains
s including variable region framework~ and CDRs derived from a
different source and a suitable promoter operationally linked to the
DNA sequences which encode the altered antibody. Such a vector is
kansfected into a transfected mammalian cell via conventional
techniques.
The invention further comprises a method for effecting ~ninimal
modifications within the variaWe region frameworks of an altered
antibody necessary to produce an altered antibody w~th increased
binding affinity comprising the following steps:
(a) analysis of framework amino acids known to be critical for
interaction with CDRs, and production and testing of altered
antibodies where single framework amino acids have been
substituted by the corresponding amino acids from the same source
20 as the CDRs;
(b) analy8i8 of f~nework amino acids adjacent to CDRs, and
production and testing of altered antibodies where one or more of
the amino acids within 4 residues of CDRs have been substituted by
2s the corresponding amino acids from the same ~ource of the CDRs;
(c) analysis of framework residues within the altered antibody,
and production and testing of altered antibodies where ~ingle amino
acids bave been substituted by the corresponding amino acids with
30 major differences in charge, size or hydrophobicity from the same
source of CDRs.
The following Examples relate to the novel RSV F protein epitope of
the invention.
~V~92/04381 2 0 ~ . PCI/GB91/01554
- 39 -
SPECIFIC RSV F PROTEIN EPITQPE
The following e~amples demonstrate that two monoclonals which
protect and cure mice of ir~ vivo infection by RSV recognize a linear
5 epitope within the F protein of RSV (which linear epitope may be
part of a conformational epitope) and which cont~ins amino acid
residue~ 417 to 438 of the F protein coding sequence including an
essential arginine residue at position 429, or any immunoprotective
portion thereof, such as, but not limited to amino acid residues 417-
o 432 of the F protein coding sequence, and amino acid residues 422-
438 of the F protein coding Eequence. This novel epitope (which
may be referred to herein as "epitope 417~38"~ is a suitable target
for screening for other neutralizing epitopes, for protective and
therapeutic agents against RSV, and in particular, for monoclonal
antibodies aga~nst this epitope. Knowledge~of this epitope enables
one of 6kill in the art to define synthetic peptides which would be
suitable as vaccines against RSV. Epitope 417~38 i8 also useful for
generating monoclonal antibodies which will be useful in the
treatment, therapeutic andlor prophylactic, of human RSV infection
20 in humans.
The present in~re~tion also applies to the use of Fab fragments
derived f~om monoclonal aIltibodies directed against such novel
epitope as protective and therapeutic agents against in vivo
2s infection by viruses, and particularly relateR to the protection
against RSV.
The invention also includes a recombinant plasmid containing the
coding ~equenoe of a monoclonal antibody generated against the
30 417-438 epitope, and a mammalian cell-line transfected with a
recombinant plasmid containing such coding sequence. Such a
vector is prepared by conventional techniques and ~uitably
comprises DNA ~equence~ encoding immunoglobulin domains
including variable region f~ameworks and CDRs and a ~uitable
3s promoter opera~onally li~ked to the DNA sequences which encode
wo 92/04381 pcr/Gs9l/ol554
ri
- 40 -
the antibody. Such a vector is transfected into a mammalian cell
via conventional techniques.
~;,~
Thi6 e~ample shows the production of murine monoclonal
antibodies against the F protein of RSV which protect and cure
mice of infection.
lO Murine monoclonal antibodies (mAbs) 19 and 20 were produced as
follows. BALB/c mice (obtained from Charles Rivers-specific
pathogen free) were inoculated intranasally (i.n.) on two occasions,
3 weekR apart, with 1~c104 PFU of the A2 strain of human (H) RSV
(described by Lewis et al., 1961, ~. J. A~lstralia. 48, 932-933).
5 After an interval of 4 months, the mice we~e inoculated
intraperitoneally (i.p.) with 2x107 PFU of the 127 strain of bo~ine
(B) RSV (isolated at Institute for Animal Health, Compton, Near
Newbury, Berks, England~. Three days aPcer inoculation, the
immune splenocytes were filsed with N~1 myeloma cells (see,
20 William8 et al., 1977, Cell. 12, 663). The resulting hybridomas were
screened for antibody to RSV by radioimmunoassay a~d
immunofluore~cence a~ de~cnbed pFenou~ly (Taylor et. al., 1984,
Immg~lQ~, ~, 137-142), clo~ed twice on soft agar (as described
by Ko~ler et. al., "lmmunologic Methods", pp397-402, ed. I.
2s Lefkovitz & B. Perris, Academic Press), and t~e resulting cloned
cells were inoculated into BALB/c mice to produce ascitic fluid as
described previously (aee, Taylor et al., 1984, Imml~olQ~y. 52, 137-
142).
30 The specificity of the mAbs for viral polypeptides was determined
by radioimmunc precipitation of (35S~metbionine or (3H)-
glucosamine labelled RSV-infected cell lysates as described
previou~ly (aee, Kennedy, et al., 1988,5L ~n YirQl, ~1, 3023-2032)
and by immunoblot~ng (see, Taketa et al., 1985, Electrophoresis. fi,
3~ 492 497). Ihe antigens used in immunoblotting were either He~2
w(~ q2to4381 2 ~ ~ 1 3 3 5 pcrt~s91/ols54
- 41 -
cells (obtained from the American Iype Culture Collection,
Rockville, Maryland, USA) infected with the A~ strain of HRSV or
primary calf kidney (CK) cells (produced at the Institute for Animal
Health, Compton) infected with the 1~7 strain of BRSV. Uninfected
s He~2 or CK cells were used as control antigens.
The immunoglobulin isot~tpe of the mAbs was determined by
immunodiffusion using a radial immunodiffusion kit (Serotec,
~idlington, Oxfordshire, UK).
0
The properties of mAbs 19 and 20 are shown in the following Table
A.
WO 92/04381 PCI`/GB91/01554
2 0 '~
- 42 -
D ~ c~ c _ c~
< _ ~ ,:~ t~ ~ ~ _ ~ > ,~ < .'- O
~ ~ ~ 9
WO 92/04381 2 ~ 9 13 ~ ~ P~/GB91/01554
- 43 -
Immune precipitation of radiolabelled RSV (by the method of
Brunda et al, (1977) J. Immunol. 119~ 193-198) indicated that mAbs
19 and 20 recognized the fusion (F) glycoprotein. This was
confirmed by a Western blot of non-reduced and reduced Iysates of
s cells infected with RSV. The blots were probed with HRP-
conjugated goat anti-mouse IgG (Kpl, Gaithersburg, Maryland,
U5A). mAbs 19 and 20 recognized the 140k F protein dimer and
the 70K monomer present in the native F protein antigen and the
46K F1 fragment in antigen denatured by boiling in 2-
0 mercaptoethanol. Both mAb 19 and 20 were identified as IgG2a,and their ELISA titres against the A2 and 8/60 strains of HRSV
were similar to the ELISA ~tres against the 127 strain of BRSV,
indicating that the epitopes recognized by these mAbs were
conserved amongst strains of human and bovine RSV. Both mAB
5 19 and 20 neutralized RSV infectivity and~nhibited the formation
of multinucleated giant cells in MA104 cells infected with RSV. In
contrast to mAb 19, mAb 20 lysed RSV-infected cells in the presence
of rabbit complement. The failure of mAb 19 to lyse RSV-infected
cells was not due to failure to bind to the surface of virus-infected
20 cells since mAb 19 stained 88% of such cells. The failure of mAbl9
and compIement to ly6e virus-infected cell~ indicates that antibody
and complement-mediated ly8i~ is not important in 1~e in vivo
protection mediated by this antibody. The ability of mAbs 19 and
20 to protect against RSV infection was assessed by challenging
2s mice i.n. with appro~nately 104 PFU of RSV 24 h after i.p.
inoculation of mAbs 19 and 20. The lungs of untreated mice killed
5 days after challenge contained 5.5 logloPFU of RSV/g tissue
whereas viru~ was not detected in the lungs of mice given either
mAb 19 or 20.
ExAMPL~ 5
This esample describes methods of isolatin!g mutant~ of RSV which
are resistant to inhibition by mAbS 19 and 20 generated in
3s E~cample 4.
WO 92/04381 2 Q 9 1 ~ i PCI /GB91/01554
Mutant RS viruses refractory to neutralization by mAbs 19 and 20
were produced using a plaque reduction technique with the A2
strain of HRSV as follows. Confluent monolayers of CK cells, in a
s tissue culture flask, were infected with the A2 strain of HRSV at a
MOI of 0.1. Starting 24 hours after infection and continuing for 3
to 5 days, the culture medium was replaced daily w th fresh
medium containing lQ% mAb. Virus was harvested when a
cytopathic effect was observed. Virus prepared in this way was
l0 mi~ed with an equal volume of either undiluted mAb 19 or 20, or
medium alone for 1 hour at room temperature and inoculated onto
CK monolayers in 35mm multi-well plates (Nunc, Kamstrup,
Riskilde, Denmark). After 1 hour incubation at 37C, the plates
were overlaid with medium contain~ng 0.25% agarose and 10% mAb
or mediurn alone. Cultures were incubated at 37C in 5% CO2 in
air for 7 days before adding the vital stain, 0.3% 3~4,5-
Dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide in 0.15M
NaCl, to the overlay to visualize virus plaques.
20 Putative mutant viruses were removed in agar plugs from plates
which contained single plaques, diluted in medium, mi~ced with an
equal volume of mAbs 19 or 20 and inoculated onto CK monolayers
in 35 mm multi-well plates as before. Putat*e mutant viruses were
plaque picked again and inoculated into tubes containing coverslips
25 of calf testes cells. Aflcer 4 to 6 days incubation, the coverslips were
removed and stained with mAb 19 and 20 and FITC-labelled rabbit
anti-mou6e Ig (Nordic Labs, Tilburg, The Netherlands). As a
positive control, cover~lips were stained with poly~lonal bovine
antiserum to R~V (produced at Institute for Animal Health-
30 Compton form a gnotobiotic calf hyperimmunised with RSV), andFITC-labelled rabbitt anit-bovine Ig (obtained from Nordic
Immunology, Tilburg, The Netherlands). RS viruses that failed to
react by immunofluorescence to mAb 19 or 20 were classed as
mutant viruses and were used to infect monolayers of Hep-2 cells to
3s produce antigen for ELISA. Thus, 3 to 4 days after RSV infection,
wo 92/04381 2 0 91.~ ~ ~; PCl/GB91/01554
cells were scraped into the medium, spun at 400 g for 5 mins,
resuspended in distilled water, and treated with 0.5% (v/v) NP40
detergent to yield a cell lysate. A control cell lysate was made in a
similar way using uninfected Hep-2 cells. The binding of a panel of
5 mAbs to the F protein of RSV to the mutant viruses was examined
by ELISA. Microtitre plate wells were coated with ~0 ul of either
infected or control cell lysate overnight at 37C, ~cubated with
blocking buffer consisting of 5% normal pig serum in PBS and
0.05% Tween 20 for 1 h at room temperature and washed ~x with
lo PBS/IWEEN. Serial dilutions (three times) of the mAbs were
added to the wells and the plates were incubated for 1 hour. After
washing 5 times with PBS/Tween, HRP-conjugated goat anti-mouse
IgG (Kpl, Gaithersburg, Maryland, USA), diluted 1:2000, was
added to each well. Af~er a final washing, bound conjugate was
5 detected using the substrate 3,3',5,5'-tetramethylbenzidine (TMB),
(obtained from ICN Immunobiologicals, Illinois). Mutant viruses,
selected for resistance to mAb l9, failed to react in ELISA with both
mAbs 19 and 20. Similarly, mutant viruses selected for resistance
to mAb 20 failed to react with mAbs 19 and 20. All other mAbs
20 tested reacted with the mutants to the same e~tent as to parent
HRSV, strain A2. These results are illustrated in the following
Table B.
WO 92/04381 PCrtGB91/01554
; ~.. ., ;, :
- 46 -
TABLE B
T~ble s Binding of an~i-F mAbs ~o antibody escape mulants of RSV.
_
Mutants seiecled with indicat~d mAb
mAb PaAre2.-1t = 19 ! 20
C4848f C4909/1 C490216 ¦ C4902Wa C4'902Wb C4902Wc
; t ~ ~ ~
.~. . . . J
WC '043S1 2 ~ 3 ~ PCl /GB91/01554
- 47 -
E~MPLE 6
This example describes the identification of an amino acid sequence
within the F protein which binds protective monoclonal antibodies
5 and demonstrates that arginine 429 is essential for binding
protective mabs to this amino acid sequence.
Poly~A)+ RNAs, isolated firom cells infected ~,vith either the A2
strain of HRSV or each of the mutants described in E~cample 5,
0 were used to sequence the F protein mRNA. These sequences were
determined by the dideoxy method (cited above) using 6'-32P-
labelled oligonucleotide primers, synthesized according to the
previously reported F-protein sequence of the Long strain of RSV
(see, Lopez, et al., 1988, Yin~ ~. 10, 249-262), followed by a
5 chase with terminal deo~ynucleotide trans~erase (see, DeBorde, et
al., 1986, ,~nal ~ioch~m. l~Z, 275-282). Three mutants were
selected with mAb 19 and three were selected with mAb 20. All
such mutants showed a single transversion (C to G) at nucleotide
1298 compared with the parent A2 strain. This nucleotide
20 substitution changes the amino as:id residue at position 429 of the F
protein from argin~e to serine. Since mAbs 19 reacted in Western
blot with the Fl ~ubunit, it is likely that the antibody-binding site
i6 determined by a linear sequence of contiguous amino acids in
which residue 429 of the Fl subunit plays an essential role.
2s Synthetic peptides corresponding to amino acids residues 417-432,
422438, 417-438 and 421450 of the F protein were examined for
their ability to resct with mAbs 19 and 20 in ELISA. mAbs 19 and
20 reacted with peptides 417-432 tF417), 417-438 and with 422-438
(F422) but not with peptide 431-450. The binding of mAb 19 to
30 peptides 417-432 and 422-438 (2ug/well) either coated onto
microtitre plate wells overnight at 37C ("dry") or coated onto ~e
wells for lh at room temperature ("wet") is shown in Figure 7. It
should be noted that mAb 20 gave essentially the same results.
WO 92/04381 2 0 9 13 3 ~ PCr/GB91/015'
- 48 -
Exam~le 7
5 This example shows that Fab fragments derived from mAbs 19 and
20 can protect and treat mice infected by RSV.
mAbs 19 and 20 were pu~fied from ascitic fluid using Protein A
Sepharose (Pharmacia, Milton Keynes, United Kingdom).
l0 Approxir~ately 10 mg of purified mAb 19 and 20 were incubated
with 0.5 ml of immobilized papain (Pierce-Oud-Beijerland, The
Netherlands) for 5 h and overnight respectively at 37C with
constant mi~ing. The resulting Fab fragments were re~overed on
an immobilized Protein A column (Pierce). The purified IgG and
lS the papain cleaved fragments were analyz~d by SDS-PAGE under
reducing conditions. The purified IgG showed bands at 53,000d
and 23,000d, corresponding to Ig heavy and light chains. The
Protein A fractions containing Fab fragments showed bands at
approximately 2~,000d and the fraction containing the Fc
20 fragments showed 3 distinct bands corresponding to the heavy and
light chains of the undigested IgG and also ~e Fc fragment at
appro~imately 28,000d. The purified IgG and the papain cleaved
fragInents were evaluatad for anti-RSV activity by ELISA with
HRSV strain A2 infected and uninfected Hep-2 cells as antigen, and
2s HRP-goat a~ti-mouse Fab (Sigma Chemical Co., St. Louis, Mi,
USA) and HRP-goat anti-mouse Fc (ICN ImmunoBiologicals,
Illinois). The ELISA showed that the Fab fragments of mAbs 19
and 20 were not contaminated with undigested Ig. These data are
illustratad in the following Table C.
WO '04381 2 0 ~1~ 3 3 PCl/GB91/01554
- 49 -
TABLE C
Table C Prophylactic and therapeutic eff~cts of Fab f aglr.ents on RS~' infection in mice.
ELISA titre (log10) ¦ D5 RSV ti~e in lungs
Antibody ¦ Anti-Fc Anti-Fab ¦mAb d-l¦ mAb d~
19 4.4 4.3 < 1.7 (0/5)< 1.7 (0/4)
19 Fab <2.0 . 4.6 ~< 1.7 (0/5)¦ < 1 7 (0/5)
None ~4 . 6 . 0.06
15.1 15.1 ~ ~<1.7 (0/5)l <1.7 (1/5)
20 Fab <2.0 4.8 < 1.7 ('7/5)< 1/7 (2/5)
None ¦4.5 0.08
l l
Antibo~y titre measured by ELISA using RSV/A2 and ~nug~n
WO 92/04381 PCI`/GB91/015
? ~ r~
- 50 -
The concentration of antibody in undigested mAbs 19 and 20 were
adjusted to give ELISA titres similar to those of the Fab fragments
and examined for their ability to protect against RSV infection in
BALB/c mice. Groups of ~ mice were inoculated i.n. with
5 undigested, purified mAb 19 or mAb 20 or Fab fragments (from
mAb 19 or rnAb 20) either 1 day before or 4 days after i.n.
inoculation with appro~imately 104 PFU of the A2 strain of HRSV.
Control mice were inoculated with HRSV only. Five days after
virus challenge, mice were killed and the lungs assayed for RSV
lO PFU on secondary CK cells as described previously (see, Taylor et
al., 1984, Infect Tmmun- 43, 649-655). Fab fragments of mAbs 19
and 20 were highly effective both in preventing RSV infection and
in clearing an established infection.
5 This invention relates to the 417438 epito~e. This invention also
relates to monoclonal antibodies generated against the 417-438
epitope. Such monoclonal antibodies are produced by conventional
techniques and inc3ude, without limitation, murine monoclonal
antibodies, human monoclonal antibodies, and bovine monoclonal
20 antibodies. Such monoclonal antibodies may comprise a complete
a~tibody molecule (having full length heavy and light chains) or
any fragment thereof, such as the Fab or (Fab')2 fragment, a light
chain or heavy chain dimer, or any rninimal recombinant fragment
thereof such as an Fv or a SCA (single-chian antibody) or any other
2s molecule with the same specificity as the monoclonal antibody.
This invention also relates to a pharmaceutical composition
comprising a monoclonal antibody generated against the 417-438
epitope and a pharmaceutically acceptable carrier or diluent.
This invention also relates to a mlethod of preventing hnm~n RSV
infection in a human in need thereof which comprises
administering to such human an effective, human RSV infection
inhibiting dose of a monoclonal antibody generated against the 417-
3s 438 epitope.
wO ~04381 2 0 9 13 3 ~ PCT/GB91/01554
This invention also relates to a method of ~herapeutically treatinghuman RSV infection in a human in need thereof which comprises
administering to such human an effective, human RSV infection
5 therapeutic dose of a monoc}onal antibody generated against the
417~38 epitope.
To ef~ectively prevent RSV infection in a human, one dose of
approximately 1 mg/kg to approximately 20 mg/kg of a monoclonal
0 antibody generated against the 417-438 epitope should be
administered parenterally, preferably i.v. (intravenously) or i.m.
(intramuscularly); or one dose of appro~nately 200 u~/kg to
appro~imately 2 mglkg of such antibody should be administered i.n.
(intranasally). Preferably, such dose should be repeated every six
5 (6) weeks starting at the beginning of the ~SV season (October-
November) until the end of the RSV season (March-April).
Alternatively, at the beginning of the RSV season, one dose of
approximately 5 mglkg to appro~imately 100 mglkg of a monoclonal
antibody generated against the 417-438 epitope should be
20 administered i.v. or i.~ or one dose of appro~nmately 0.5 m~/kg to
appro~imately 10 mg/kg of such antibody should be administered
i.n.
To effectively therapelltically treat RSV infection in a human, one
25 dose of appro~cimately 2 mg/kg to approa~imately 20 mgll~g of a
monoclonal antibody generated against the 417-438 epitope should
be adnunistered parenterally., preferably i.v. or i.m.; or
appro~imately 200 uglkg to approximately 2 mg/kg of such antibody
should be administered i.n. Such dose may, if nece~sary? be
30 repeated at appropriate time intervals until the RSV infection has
been eradicated.
A monoclonal antibody generated against the 417438 epitope may
also be administered by inhalation. By "inhalation" i8 meant
3s intranssal and oral inhalation administration. Appropriate dosage
WO 92/04381 PCI'/GB91/015'
2 ~ 5 52
forms for such administration, such as an aerosol formulation or a
metered dose inhaler, may be prepared by conventional techniques.
For example, to prepare a composition for administration by
inhalation, for an aerosol container with a capacity of 15-20 ml: Mix
s 10 mg of a monoclonal antibody generated against the 417-438
epitope with 0.2-0.2% of a lubricating agent, such as polysorbate 85
or oleic acid, and disperse such misture in a propellant, such as
freon, preferably in a combination of (1,2 dichlorotetrafluoroethane)
and difluorochloromethane and put into an appropriate aerosol
o container adaped for either intranasal or oral inhalation
administration. As a further e:~ample, for a composition for
administration by inhalation, for an aerosol container with a
capacity of 15-20 ml: Dissolve 10 mg of a monoclonal antibody
generated against the 417-438 epitope in ethanol (6-8 ml), add 0.1-
0.2% of a lubrica~ng agent, such as polysorbate 85 or oleic acid; and
disperse such in a propellant, such as freon, preferably a
combination of (1.2 dichlorotetrafluoroethane) and
difluorochloromethane, and put into an appropriate aerosol
container adapted for either intranasal or oral inhalation
administration.
The preferred daily dosage amount to be employed of a monoclonal
antibody generated against the 417438 epitope to prophylactically
or therapeutically treat RSV infection in a human in need thereof to
be administered by inhalation is from about 0.1 mg to about 10
mg/kg per day.
