Note: Descriptions are shown in the official language in which they were submitted.
WO 9?~0618/ PCI'/US91/0672-
1. ~092~23 ~:
TRANSGENIC ANI~IALS WITH ALZHEI~ER'S AMYLOID PRECURSOR GENE
FIELD OF THE lNVENTlON
The present inven~ion relates to ~ransgenic animals useful as models for studying
Alzheimer's disease and useful for identifying compuunds for treating Alzheimer's disease. , :
S BACKGROUND OF THE INVENTION
Alzheimer's disease (AD) is the most common cause of dementia in late life. AD results
- in a progressive loss of intellectual func~ion charac~erized by progressive impairments in memory,
language, Yisuospatial skills and behavior. Those afflicted with AD eventually become unable to
speak or think or take care of themselves. AD is a terminal disorder, but patients generally die
of some complication that afflicts bedridden pa~ients. lt is estimated that in the United States, from
1.5 to two million people suffer t`rom this degenerative disorder of the central nervous system.
What causes AD and how its characteristic changes are brought about are not known.
There is no known treatment or cure for AD. The diagnosis of AD can only be inferred during
the patient's lifetime since no unique pattern of behavioral abnormalities has been established and
there is no satisfactory laboratory test short of a brain biopsy. An autopsy, however, shows highly
characteristic pathologic changes in the brain.
The clinical manifestations of AD are the result of a degeneration of neurons, particularly 1
in regions essential for memory and cognition, or thought processes. There is a loss of neurons
located in the basal forebrain cholinergic complex, several monoaminergic brainstem nuclei,
arnygdala, hippocampus and neocortex. There is a significant loss of neurons in certain more
primitive regions at the base of the brain, with consequent reduction in the amount of the
neurotransmitters, notably acetylcholine, normally released from the terminals of those neurons in
higher brain centers. ~ ~-
AD is associated with abnormal protein structures. The three major pathologic signs of -
AD are neurofibrillary tangles within neurons, amyloid surrounding and invading cerebral blood f
- vessels and amyloid-rich plaques proximal degenerating nerve terminals. Each of these signs I ~-
reflects an accumulation of proteinaceous structures not normally found in the brain.
Neurofibrillary tangles result from accumulation of proteinaceous deposits which forrn
abnormal fibers within the perikaryon of neurons. These accumulations of twisted filaments and
other abnormal structures are found within neuronai cell bodies and contribute to the degeneration
of nerve cell processes.
In addition to neurofibrillary tangles, ~ central feature of the pathology of AD is the
presence of deposits of amyloid within plaq~les and around blood vessels. The major diagnostic
Iesion of AD is the deposi~s ot abnormal amyloid proteins in in~racellular and extracellular
locations. The cellular dysfunction and death tha~ eventually result from these deposies are
common consequences of diseases termed "amyloidosis" . which are characterized by the deposition
Sl)BSrlTUTE SHEET
... , . . . . . ., .. , ~, ,. .. , .. --,, . .. , ., ., .. ,,., . . ~ . .
,.~ ,.,, ., .. ,~. . ,, . .. ,, ~ ...... . . ....... .... .. .
~VO ~2/0618/ X ~ PCr/l~S91/067~-
~ ~ooo
of abnormal fibri!lar proteins in these extracellular and intracellular spaces.
The term "amyloid" is applied to pathological accumulations within tissues of a protein-rich
mass notable mainly for its staining properties: when amyloid is stained with a dye called Congo
red and viewed under polarized light, it emits a greenish yellow glow, and under polari~ed light,
5 a redlgreen birefringence. Some amyloid is seen in the brain of most old people and in other
organs, such as the liver and kidney, of people with certain chronic diseases. Abundant serebral
arnyloid is, however, always associated with AD, where it is seen as deposits in and adjacent to
blood vessels and as a components of neuritic plaques. The abnormal proteins of the
neurofibrillary tangles also can exhibit the staining properties of arnyloid.
10The neuritic (or senile) plaque is the pathological structure whose presence signa!s AD to
the neuropathologist. Plaques are usually most abundant in the cerebral conex and hippocarnpus
and in ~e amygdala, a nucleus of cells near the hippocampus that seems to be particularly darnaged
in the disease. Within each region the plaques are localized in areas containing the axonal
terminals of neurons rather than their cell bodies. The consistent evidence that the fibrillar
15 deposits in plaques and cerebral vessels are amyloid fibers and that the paired helical filaments in
tangles ~re twisted, ~-pleated sheet fibrils, have led to the conclusion that AD is a form of cerebral
amyloidosis. This signifies that the above lesions may be directly or indirectly responsible for
neuronal cell death and represent an important stage of the pathogenetic process leading to AD.
Biochemical studies have revealed that the plaque core protein in AD is fo~ned from a
20 4500~alton protein. The protein is referred to as either amyloid A4, or as the ,B-protein. The full-
length protein consists of only 42 to 43 residues. The discovery of ,B-protein from amyioid-laden
cerebral vessels of patients with AD has provided a means tO begin decipbering the pathogenesis
of AD.
Considerable evidence has accumulated that most amyloid fibril proteins are forrned from
25 precursor proteins by proteolytic cleavage to produce ~-pleated sheet fibrils and that the precursor
proteins have an abnormal sequence or amino acid substitution. Based on these precedents, one
would expect the amyloid fibril ,B-protein of cerebrovascular amyloid, having a maximum of 43
amino acids, to be formed by proteolytic cleavage of a putative abnormal ,B-pro~ein precursor.
Proteolysis of the precursor to form ,B-protein is accepted: however, despite precedent, no evidence
30 for an abnormal ,~-protein precursor in AD has thus far been demonstrated. Cloning and cDNA
sequencing have indicated that the self-aggrega~ing amyloid protein of AD is encoded as part of
one of three larger precursor protein genes. Each protein is referred to as the Alzheimer's
Amyloid Precursor Protein (AAP Protein). The respective proteins have 695 residues (AAP695),
751 residues (AAP751), and 770 residues (AAP770). The AAP proteins are encoded by a unique
35 gene on chromosome 21. The various mRNAs are generated by alternative splicing of this gene's
primary transcript.
-- ~ .~1 IQ~rm !T~ eu~e~r
. . . -- . ~- . .~ . , . . - . . - . .. . - . : . . . : .. . . :
WO 92/06187 PCl'/US91/0672-
3l; 2~92~23
An interesting observation is that the brains of Down's patients who grow to adul~hood
degenerate in much the same way as those of Alzheimer`s patients. Bio- chemica} studies have
revealed that the plague core pro~ein in both Alzheimer's disease and Down's syndrome is the
identical ~B-pro~ein. Since the gene encoding AAP protein resides on chromosome 21,
overexpression of all AAP may affect the associated amyloidosis. Thus, any treatment to slow or
prevent the progression of AD may be usetul in the treatment of adult Down's pa~ients.
Presently, the only animal models available to study AD and screen compounds which may
be useful for treatment of AD are aged primates which exhibit age-associated memory deficits.
These animals display structural/chemical changes in the brain similar to those found in aged
humans, particularly those suffering AD. However, the usefulness of these animals is limited and
a better animal model is desired.
Among the uses foreseen for a bet~er AD anin~al model is the ability to use such a model
to screen compounds useful in prevent, slow or reverse the accumulation of amyloid in the brain.
IdeMification of such compounds could provide potential therapeutics for AD.
The present invention provides a transgenic animal useful as a model to study the ::
accumulation of amyloid in brain tissue. Furthermore, the present invention relates to a transgenic
animal useful in the identification of compounds which can prevent, slow or reverse the ~
accumulation of arnyloid in the brain. The present invention provides a transgenic animal useful ;
in the discovery of drugs for the treatment AD and for the prevention of brain tissue degeneration
in adults with Down's syndrome. According to the present invention, a transgeDic animal is :
provided which displays tissue-specific overexpression of a gene encoding AAP protein in the
regions of the brain where amyloid deposits are commonly found in patients with AD. Thus,
arnyloid deposits are produced in the transgenic animal models of the present invention in the sarne
panern as those occurring in AD pa~ients. The transgenic animals of the present invention
therefore provide an in vivo model which possesses a physical condition that closely resembles a
pathological condition of patients afflicted with AD.
!NFORMATION DISCLOSURE
Swanson, et al., "Novel developmental specificity in the nervous system of transgenic
animals expressing growth hormone fusion genes", Nature, Yol. 317, 26 September 1985, pp. 363-
366, report that transgenic animals expressing rat-growth hormone kGH~ under the control of the
mouse metallothionein I (mMtl) promoter express such proteins in a tissue specific pattern in
neuronal cells. Similar experiments were performed using transgenes containing mMtl promoter
controlling expression of a human growth hormone gene. Localized expression in neuronal tissue
of transgenic mice was observed. It is noted that neither meta!lothionein nor growth horrnone are .
35 locally expressed in the neuronal eells~which express these fusion genes. Fusion proteins
containing other structural genes under the control of the mMtl promoter did not exhibit similar
o~ ln~Tm ~
- . : . ., , . :
.
WO 92/0~18~ ~ 0 9 2 8 2 3 PCr/l'S9l/0672;
pattern of expressiom
Russo, A~ F~, et al~, "Neuronal Expression of Chimeric Genes in Transgenic Mice~,
Neuron, Vol~ 1~ June, 1988, pp~ 311 320, seports chimeric genes containing the mM~I promoter
linked to either rGH or hGH genes or the calcitonin/CGRP gene are expressed in very similar
patterns of neuronal regions. It is suggested that the ec~opic expression which is unexpected is due
to regulatory signals from multiple DNA elements; that is, the interplay between the mMtl
promo~er and the 3' region of growth hormone gene bring abou~ expression.
Evans, R.M. et al., "Inducible and Developmental Control of Neuroendocrine Genesn, s
Cold Springs Harbor Symp. Quant. Biol., Vol. 50, pp. 389-397, report that the localized pattern
of expression of fusion genes containing the mMtl promoter and 3' untranslated flanking regions
of growth honnone genes results from the combination of such gene elements in fusion genes.
Kang, J., et al., "The precursor of Alzheimer's disease amyloid A4 protein resembles a
cell-surface receptor", Nature, Vol. 325,19 February 1987, pp. 733-736, report the isolation and
sequence of a full length cDNA clone encoding a 695-residue precursor of the amyloid proteins
subunit A4.
Ponte, P., et al., "A new A4 amyloid mRNA contains a domain homologous to serine :
proteinase inhibitors", Nature, Vol. 331, 11 February 1988, pp. 525-52~, disclose a novel gene
encoding AD protein. The novel precursor is longer than the AAP~. It contains an additional
168 base-pair insert, encoding a 56 amino acid domain within the so-called extracellular region of
theprotein. -
Kitaguchi, N., et al., "Novel precursor of Alzheimer's disease arnyloid protein shows :-
protease inhibitory activity", Nature~ Vol. 331, 1I February 1988, pp. 530-S32, report a novel
precursor of the amyloid protein A4. This novel precursor is longer than AAP751. It contains an
additional 57 base pairs encoding a 19 amino acid domain of unknown function, inser~ed
irnmediately C-terminal to the insert in AAP751.
Selkoe, D. J., "Deciphering Alzheimer's Disease: The Amyloid Precursor Protein Yields
New Clues", Science, Vol. 248, pp. 1058~1060, provides a review of AAP genes and proteins.
It is reported that the gene occurs in three torms, AAP695 AAP751, and AAP770 and a dis
of the conversion from precursor to the amyloid ,~-protein is included.
Wurtman, R.J., "Alzheimer's Disease". Scientific American 252:62-74, provides a review
of six hypotheses which underlie the current focus on research on AD. The abnormal protein
model that is reported in the reference discusses the presence of amyloid deposits in the brains of
patients afflicted with Alzheimer's disease.
GleMer. G.G., "The Pathobiology of Alzheimer's Disease", Ann. Rev. Med. 40:45-51(1989), provides a review ot` the pathology of AD. The role of the ,~-pro~ein as the major
componen~ of amyloid fibrils of plaques and cerebral vessels and the paired helical filaments of
-,......
:`
- WO ~2/0618, . ~ . PC'r/~'S91/06727
neurofibrillary tangles is discussed.
Muller-Hill, B. et al, '`Molecular Biology of Alzheimer's Disease", Annu. Rev~ Biochem.,
~8:287-307 (1989), prnvide a review of the molecular biology of Alzheimer's disease. A
discussion of the genes encoding the ~-protein, ret`erred to as A4 amyloid, is included.
5 Additionally, the cDNAs of AAP protein, the ,enes encoding AAP protein, and the link of the
AAP protein with AD are discussed.
Price, D.L. et al., "Cellular and Molecular Biology of Alzheimer's Disease~, BioEssays,
Vol. 10, Nos. 2 & 3, February-March 1989, pp. 69-74, provide a review of the cellular and ~ -
molecular biology of Alzheimer's disease. Included is a discussion of the animal models presently
being used. The section entitled "Animal Models" reports the use of nonhuman primates, ~-
specifically aged Rhesus monkeys. The usetùlness and shor~comings of these models are reported.
- In addition, the use of transgenic mice as a potential animal model for AD is suggested. The
advantages of such transgenic mice models are outlined and research strategies using these mice
are proposed. However, at page 72, column 3, line 39, it is noted that a crucial problem exists
in designing a transgene which provides tissue specific expression. The present invention
overcomes this obstacle.
U.S. Patent Number 4,736,866 issued April 12, 1988 to Leder et al discloses a transgenic
non-human animal having a transgene comprising an activated oncogene sequence which increases
the probability of development of neoplasms in the animal.
Strojek R.M., et al, The Use of Transgenic Animal Techniques for Livestock
Improvement, Genetic Engineering: Principles and Methods, J.K. Setlow, Ed. Vol. 10 New York
(198&) reviews work in the area ot transgenic mice. Me~hods are disciosed and various transgenic
lines are described and discussed.
Skangos and Bieberich, Gene transfer into mice, Advances in Genetics, 24:285-322 (1987),
provide a review of work in ~he area ot' transgenic mice. A list of reported transgenic mice species
is included, listing various transgene constructs introduced into mice.
Palmiter, R.D. et al., Nature (London) 300:611-615 (1982) refers to a transgenic mouse
containing a recombinant gene comprising mMtl promoter and rGH sequences. The mMtl r
promoter is inducible by the presence of heavy metal. Thus, expression of the rat growth hormone
3û may be controlled.
- SUMMARY OF THE INVENTION
The present invention provides a transgenic rodent having a transgene comprising a mouse
metallothionein I (mMtl) promoter operably linked to a nucleotide sequence encoding Alzheimer
amyloid precursor protein (AAP protein) operably linked to a mammalian grawth (GH) hormone
3'-untranslated region. The present inven~ion also provides a recombinant DNA molecule
comprising a marnmalian Mtl promoter operably linked to a nucleotide sequence encoding AAP
:-' ~: : - .,. . :~ :: :
~YO 9~/061~ 2 0 9 2 8 2 3 -6- PCI /I IS91/067~-
protein operably linked to a mammalian GH 3`-un~ranslated region.
DETAILED DESCRIPTION
The maior impediment to etiological studies of Alzheimer's Disease (AD) and related dntg
development is the lack of any sui~able animal modeh With the increasing evidence in the
5 literature t}tat amyloid deposition is an early, if not primary event in AD pathogenesis, the present
invention relates to transgenic animals which will develop Alzheimer-type amyloid deposits in brain ' ~ -
regions corresponding to those effected in AD. These animals can be used as a basis for studies
of AD etiology and as a screening system t`or novel compounds designed to interfere with the
process of amyloid deposition. ~ - :
10To develop an animal model according to the present invention, transgenic animals are ~ i
produced which carry a transgene whose expression results in tissue-specific amyloid deposition.
Expression of the trartsgene must occur at a high level and in specific regions of the brain in order :~ -
for the transgenic animal to provide a suitable AD model.
As used herein, the term "ectopic expression" means expression of a transgene in neurons .::
. .
15within regions of the brain which do not correspond to regions normally directed by ~te control ~:
sequences, i.e. the promoter and the 3'-untranslated sequence.
As used herein, the term "ectopic regulatory sequences" means those genetic regulatory
sequences which when operably linked to a gene, facilitate the ectopic expression of the gene.
Transgenes according to the present invention referred to herein as "AAP transgenes" are
20 constructed to contain ectopic regulatory sequences operably linked to an Akheimer's Amyloid
Precursor gene (AAP gene).
As used herein, the term "Alzheimer's Amyloid Precursor gene" or "AAP gene" means
a nucleotide sequence which encodes an Alzheimer's Amyloid Precursor protein (AAP protein),
a protein that can be processed into Amyloid ,B-protein, or the amyloid ~-protein itself. AAP genes
25 include gnomic clones7 cDNAs, synthetically produced nucleotide sequences and combinatiorts
thereof. Conventions used to represen~ plasmids and fragments in Charts 7-13, though unique to
this application, are meant to be synonymous with conventional representations of plasrnids and
t}teir fragments. Unlike the conventional circular ftgures, the single line figures on the charts
represent both circular and linear double-stranded DNA with initiation or transcription occurring
3û from left to right (5' to 3'). Asterisks (~) represent the bridging ot` nucleotides to complete the
circular form of the plasmids. Endonuclease restric~ion sites are indicated above the line. Gene
markers are indicated below the line. - -
Transgenic animals carrying AAP transgenes mav be produced using techniques wellknown by those having ordinary skill in the art. Transgenic animals carrying AAP transgenes will
35 be genetically programmed to overexpress AAP genes in neurons of regions of the brain
corresponding to those regions in humans which are effected in AD~ in order to facilitate~the
, .
'.".
. Q~ ~m ~ ~u~ . l ~ ~
.. ' . ' ' ' ' .' . : ~ ,
WO 9~/06187 PCr/llS91/067~'
~7~ 209~823
development of amyloid deposi~s. Accordingly, such transgenic animals are useful in studying AD
and in drug discovery efforts~ As a screening tool~ the transgenic anirnals accarding to the present
invention can be used to identify compounds which are useful to prevent, impede or reverse the
progression of AD and the accompanying brain function loss and dementia brought upon by "~
amyloid deposition.
The ectopic regulatory sequences are modeled at`ter the chimeric promoter system originally
described by Swanson et al. Swanson placed the structural genes for both ra~ and human growth ' '
hormone ~GH) under the control of the mouse metallothionein-l (mMtl) promoter in transgenic
mice~ For unknown reasons, ectopic expression of GH occurred in the brains of these mice;
specifically, in neurons within regions later discovered to correspond to many of those primarily
effected in AD. The observation was made in constructions containing rat growth hormones (rGH)
sequences and in consts~ctions containing human growth hormone sequences (hGH). This was an
unexpec~ed observàtion since neither mMtl nor GH are normally expressed in these neurons. It
was subsequently found that when GH coding sequences were replaced by those for '
calcitonin/CGRP (calcitonin gene-related peptide), a similar pattern of ectopic expression was
obtained as long as the mMtl promoter and the GH 3'-untranslated region (3'-UTR) flanked the
cDNA. It therefore appears that some undet`ined interaction between these'sequences directs the ~ ~'
expression of inserted cDNAs in the neurons of brain regions of the brain that degenerate in AD.
The GH 3'-UTR from several species has been shown to provide similar results.
Accordingly, transgenes according to the present invemion may comprise any mammalian GH 3'- ' '
UTR sequences. ' ' ~
Essential to the present inven~ion is the ectopic expression of the gene introduced in t}le ~' :
transgenic animal. This ectopic expression is accomplished by the unexpected interaction of the '
promoter and 9he 3'-UTR of the ectopic regulatory sequences.
A transgenic animal according to the present invention will have the predisposition to
develop Alzheimer's-related brain amyloidosis. Thus, an essential feature of the present invention
is a transgene which contains a gene thal encodes a protein ot preprotein which, when expressed
ectopically, results in the brain amyloidosis condition.
The amyloid protein, also referred to as the ~-protein, is a 42~3 amino acid protein that
is originally expressed as a precursor protein. Three different forms of precursor proteins have
been identified. The dominant form in brain tissue is produced by translation of mRNA encoding
a 695 amino acid polypeptide. Two o~her forms have also been described: one contains 751
amino acids9 the other con~ains 770. The present invention uses any of the three precursor fonns
in the transgene. When expressed~ each precursor t'orm is su~sequently processed to generate the
amyloid deposit.
Each of the three precursors used contain a transmembrane domain. When the native AAP
:,
- . . . ~ R~Tm ~ r~ eL~
- . .. .. . - - ... : ~ . .,. :
WO 92/061Y/ PCr/l~'S91/0672,
2n9`2823 -8-
pro~ein is produced~ it is thought IO be par~ially secreted out of the celh Three contiguous Iysine
residues, c-terminal to the single domain effectively serves as a cytoplasmic anchor, preventing full
secretion of the molecule~ In addition to trans~-~,enes made using the native AAP coding sequences,
transgenes were also made using modified AAP coding sequences. Each of the three AAP coding
nucleotide sequences were subjected to mutagenesis to convert a codon in the transmembrane
domain into a stop codon~ The modified AAP coding sequences when expressed produce truncated
proteins that no longer contain the cytoplasmic anchor. These truncated AAP proteins are secreted.
The starting materials used to produce transgenes and transgenic animals according to the
present inveMion are readily available to one having ordinary skill in the art. Metallothionen-l
promoters are well known in the art. The mMtl promo~er is well known in the art and can be
purchased ~Nichols Institute) or readily obtained from natural sources by those having ordinary skill
in the art using well known techniques. Similarly, mammalian GH gene 3'-untranslated region
sequences are readily available. Such sequences are well known and can be purchased (Nichols
Institute) or readily obtained t`rom natural sources by those having ordinary skill in the art using
well known tecbniques. Any of the three torms of the AAP gene are also readily obtained from
natural sources by those having ordinary skill in the art using well known techniques. Chart 1
shows the amino acid sequence of AAP695. Chart 2 shows the cDNA nucleotide sequence
encoding AAP695. Chart 3 shows the amino acid sequence of AA~751. Chart 4 shows the cDNA
nucleotide sequence encoding AAP75 1. Chart 5 shows the amino acid sequence of AAP770. Chart
6 shows the cDNA nucleotide sequence encoding AAP770. This sequence can be used by one
having ordinary skill in the art to obtain a copy of the gene. Alternatively, one having ordinary
skill in the art can produce a transgene according to the present invention or one or more
components of the transgene by synthesizing the nucleotide sequences using well known nucleotide
sequence synthesizer technology.
2S Transgenic animals are animals which have integrated foreign DNA in their somatic cells
and germ cells. The most common way of introducing the toreign DNA into the animal is by
either microinjec~ion or retroviral intectic)n of the animal when it is in an embryonic state. The
foreign DNA then integrates itself into the genetic material ot`the animal after which it is replicated
along with the native genetic material of the animal during the development and life of the animal.
Addi~ionally, because the foreign DNA is integrated into the germ cell DNA, the offspring of such
an animal will contain copies of the toreign DNA. Transgenic animals according to the present
inventioD can be made following the procedure described in U.S. Patent No. 4,873.191 issued
October 10, 1989 to Wagner et al., which is incorporated herein by reterence.
The present invention provides an AAP operably linked to ectopic regulatory sequences.
3S Corstructs according to the present invention contain mammalian Mtl promoters operably linked
to AAP genes operably linked to mammalian GH3'-UTR sequences. Optionally, nucleotide
WO 9~/061S, PCr/US91/0672"
2 0~9 2 8 2 3
sequences encloded mammalian GH signal sequences, including the intron contained therein,
operably linked upstream of the AAP gene are included in the present invention. Rodent species,
especially rats, are particularly usefill~ since ra~s provide a wider array of behavioral and
physiological paradi~ms than mice~ Contempla~ed equivalents include transgenes that contain
ectopic regulatory sequences operably linked ~o incomplete fragments of the AAP gene such that
expression of the transgene results in t`ormation ot` amyloidosis conditions. Contemplated
equivalents of animal models according to the present invention include other non-human mamrnals
which comprise the ectopic AAP transgene and equivalents thereof.
Example I Production of transgenic mice with transgene pNAN
Construction of pNAN
The first transgene construct described herein is ret`erred to as pNAN. The transgene
contains coding sequences from AAP695 operably linked to and between the mMtl promoter linked :
to the sequence encoding the bovine growth hormone signal sequence, including the intron
contained therein, and the 3' flanking regions of the bovine growth hormone ~bGH) gene. The
transgene was constructed by inserting a fragment of AAP695 consisting bases 1923-2233 into a ;-
plasmid, pBGH-10, which contains the appropriate eclopic regulatory sequences.
The vector pBGH-10 is described in Kelder, B. et al. Gene 76:75-80 (1989) which is
incorporated herein by reference. pBGH-10 contains the bGH structural gene placed under the
control of the mMtl promoter.
AAP sequences used were subclones of AAP695 cDNA obtained from a human brain
cDNA library. The human brain cDNA library, and appropriate host cells were from Clor~tech
~H11003, lot ~'2aO2). Clone Lambda SADE-I was obtained from human brain cDNA library by
hybridization with oiigonucleotides BDG-I. BDG-2~ BDG ~1 and BDG-5.
BDG-1 5'- ccaattmgatgatgaacttcatatcctgagtcatgtcg-3'
BDG-2 5'-gttctgcatctgctcaaagaact~gtaggttggattttcg-3'
BDG~ 5'-ctcggtcggcagcagggcgggcatcaacaggctcaacttc-3' ;
BDG-5 5'-cagagatctcctccgtcttgatatt~gtcaacccagaacc-3'
A subclone, pSADE-lB, was construc~ed t y inserting into pUC13 an EcoRI fragment from
Lambda SADE-I approximately 780 bp's extending from AAP6g5 bases 1941 to about 2700.
Plasmids described as shown in Chart 7.
SubcloneAAPsequences~rompSADE-lBwereinsertedwithinthebGHgeneofpBG}I-10.
The coding sequence for the entire bGH signal sequence was maintained, including the intron
contained within this region of the gene. The AAP sequences replaced codons #1-188 of mature
bGH, maintaining the last three bGH codons plusits termination codon and 3'-UTR.The inserted AAP sequence corresponded ~o AAP695 bases 1923-2233. Tl3is was accomplished
by appropriately adapting an EcoRI-Mael tragmen~ ~bases 1941-'233) from Lambda pSADE-lB,
, , .C~ IR~Tm IT~. ~LI-:CT . .
-. - - . ..
:
WO 92/061g, PC'r/l 'S91/0672-
2~g2823 ~10_
replacing the bCH segment in pBGH-10 trom ~he Narl site at position 648 to the Pvull site at
position 1942. lhe remaining AAP bases 1923-1940 were provided by the adaptors.
.~ To form the 5'-insertion site~ the bGH gene in pBGH-10 was cleaved with restriction
enzyme NarI. lhe AAP gene fragment trom pSADE-lB was cut with Mael. flush ended, and
cleaved with restriction enzyme EcoRI. The 3' end ot the p~GH-10 NarI fragment was linked to :
the 5' end of the pSADE-lB EcoRI tragment by inserting previously annealed oligos BDG~l and
BDG~2.
BDG~I 5'-cgaagtgaagatggatgcag-3'
BDG42 5'-aattctgcatccatcttcactt-3'
The ligation of the *agments and the ol igos resulted in the 5 insertion of AAP fragment into bGH.
To form the 3'-insertion site the bGH gene was cleaved wi~h the restriction enzyme Pvull. The
S' pBGH-10 PvulI fragmens was ligated to the 3' flush entled Mael fragment of pSADE-lB to form
the 3' insertion of AAP into bGH.
The methods performed to genera~e complete~l construct are well known. The order of
IS steps followed can be summarized as:
AAP:
1. Cut pSADE-lB DNA with Mael.
2. Flush-end pSADE-lB Mael fragments.
3. Cut fragments from step 2 with EcoRI.
Adaptors:
4. Phosphory~ate BDG-42 with T4 polynucleotide kinase.
5. Anneal phosphorylated BDG--12 with BDG~I.
AAP + adaptors:
6. Ligate annealed oligos to DNA tragments t`rom step 3.
7. Gel-purify appropriate292 base-pair tragment. ;~
pBGH-10:
8. Cut with Pvull ~ Narl.
9. Gel-purify appropriate fragment.
Final construction: ~;
10. Ligate fragments from steps 7 and 9.
- 11. Transform into E. coli.
12. Sequence junctions by lhe standard techniques. The bGH-AAP 5'junction was
sequenced from the EcoRI site at AAP position 1941. The AAP-bGH 3'junction was sequenced
from the Asp718 site in the bGH 3'-UT. .
The usefulness of pNAN construct was determined by in vitro transcription/translation of
the pNAN sequence. For this purpose. the in~ron interrupting the bGH signal sequence had to be
":
~Y~ 92/0618~ PCI /~lSgl /0672~ '
-"- 2~92823
removed, and the sequence to be expressed was placed wi~hin a vec~or~ pSP7'' (Promega), that is
suitable for sranscriptional analyses.
The plasmid pNAN was cut and ligated to annealed oligos BDG-78 and BDG-79.
BDG-78 5'-agcttaccagcta~gatggctgcaggccccca-3'
BDG-79 S'-gtccgggggcctgcagccatcatagctggta-3'
To surnrnarize the construction t`or transcription/translation experiments:
1. Isolate the 956 bp pNAN/Avall-Clal fragment.
2. Anneal oligos BDG-78 and BDG-79 creale a Hindlll site at their 5' end. '
' '
In a 3-way reaction, ligate these annealed oligos, the 956 bp fragment and pSP72 cut with '~
HindllI and ClaI.
3. Transform into E. coli and confirm by sequence analysis using the universal SP6
primer. This clone was called pSPNAN2.
Transla~ion of capped in virro-generated transcripts in the presence of 35S-Met yielded
radiolabeled protein which migrated at approximately 18-19 Kd on SDS-polyacryiamide gels.
When translated in the presence of microsomal membranes, the band shifted slightly but perceptibly --
toward a lower molecular weight. This indicates appropriate initiation and cleavage of the signal
sequence in the presence of the microsomal membranes.
To generate transgenic animals, the transgene segment was generated as follows. Asp718
sites exist within the mMtl promoter and the bGH 3'-UTR. The entire ~ransgene was liberated
from pNAN as an Asp718 fragment containing approximately 700 bp mMtl promoter, the 5'~
flanking sequence of the bGH gene, the bGH-AAP segments described aboYe, plus approxima~ely
` 260 base pairs bGH 3'-UTR. This fragment is introduced into mouse embryos using the methods
described in Wagner, T.E. et al, Microinjection of a rabbit ~-globin gene into zygotes and its
subsequent expression in adult mice and their oft'spring. Proc~ l~latl. Acad~ Sci. USA Vol. 78, No~
10 pp.6376~380, (Oct. 1981~, and U.S. Paten1 Number 4,873,191 issued Oct. 10, 1989 to
Wagner, both incorporated herein by ret`erence. .
Two hundred thirty oocytes were microinjected with the construct and transferred into nine
pseudo-pregnant female recipients. DNA was collec~ed from the tails of 60 offspring and four
were shown to contain the transgene ~three males, one t'emale)~ This was de~ermined by Southern
blot analysis of 10 ~lg DNA samples Ullt with Asp718, probed with radiolabeled pSADE-lB insert.
These four Fo mice were bred with non-transgenic cohorts and a similar analysis was done on tail
DNA obtain~d from the resulting Fl oft~pring to determine whether the transgene was transmitted
through ~e germ line. Two of these t'ounders did transmit the transgene and the resulting lines
were bred to homozygosity for the transgene array. Selected homozygous and heterozygous mice
were placed on 76 mM ZnS01, while others were maintained on water without zinc. Following
anesthetization by inhalation with merotane, brains were removed and R~T ~ exlracted.
WO 92~0618, PCT/I~'S91/067',
209~8~3 -12-
- Densitometric analysis of Northern blots probe~l with the pSADE-lB insert revealed that
homozygotes expressed 2-3 fold more transgene-coded RNA than heterozygotes. Moreover~ zinc
intake resulted in a 1 3 fold increase in transgene-coded RNA relative to littermates containing the
same transgene copy number which were mainlained without zinc.
5 Example2 AAP cDNAs and Modifications
Each of the three known AAP cDNAs were usecl as starting materials for constructions of ~ .
transgenes. In addition to using subclones of each torm of precursor, modifications were made to
each form to insert a stop codon in the AAP coding sequences ups~ream from the region of the
gene which encodes the cytoplasmic carboxyl terminus. When expressed, these modified AAP
10 subclones produce molecules lacking the cvtoplasmic anchor normally found in the AAP protein.
Thus, the modified genes will produce moditied pro~eins that are secreted.
For each AAP gene~ cDNA was first isolated from a human brain cDNA lambda phage
library using oligonucleotides BDG- I, BDG-2~ BDG-4 and BDG-5. The AAP-encoding cDNA was
then subcloned into-pUC13 plasmids to facilitate further manipulàtions. .AAP695 Plasmids: .
To generate a full length clone ot AAP695, the N-terminal portion was recovered by . ~
amplifying cDNA from Alzheimer brain RNA using PCR. The C-terminal ponion was recovered
by subcloning a cDNA obtained trom a human brain cDNA library. ;. ~ -
Lambda SADE-I which contains the AAP695 cDNA was obtained from human brain cDNA
library by hybridization with oligonucleotides BDG-I, BDG-2, BDG4 and BDG-5. Lambda
SADE-I extend from AAP695 bases 996 to approximately 2700. The 3'-terminus was not
accurately esta~lished but 1his was unnecessary tor turther work.
Two subciones were obtained t`rom Lambda SADE-I: pSADE-lA and pSADE-lB. In both
cases, the AAP695 sequence trom Lambda SADE-I was subcioned into the EcoRl site of pUC13.
Larnbda SADE-I was cut with EcoRI and the 517 bp EcoRI ~ragment extending from AAP695
bases 99~1942 was inserted into pUC13, generating plasmid pSADE-lA. Plasmid pSADE-lB is
the subclone of Lambda SADE-I EcoRI fragment into pUC13 which contains approximately 780
bp EcoRI fragment extending from AAP695 bases 1943 to about 2700.
Plasmid pSADE-3 which contains AAP~j95 bases 131-1243 was derived from single
stranded cDNA that was generated from Alzheimer brain RNA using BDG-75 as a primer, and
double-stranded cDNA generated by PCR using BDG-?4 and BDG-75 on cDNA template. The
AAP sequences were subcloned as an EcoRI tragment into pUC13. ~ -
BDG-74 5'-gggaattcccccgcgcagggtcgcg-3' -
BDG-75 5-gggaa~tcgat~ccactttctcctg-3'
Plasmid pSADE4 contains AAP695 bases 131-1942. The subcloned EcoRI inserts from
pSADE-3 and pSADE-1A were inser~ed in~o pBR322 cu~ with EcoRI in 3-way ligation to generate
. . '"' .
~` WO 9~/06187 2 ~ 9 2 8 2 3PCr/l 'S91/0672-
13
the insert that includes AAP695 bases 131-1942.
Plasmid pSADE-695 was constructed next. pSADE-695 contains AAP695 bases 131 to
about 2700 which constitutes essentially the t`ull length coding sequence. To construct pSADE-695,
EcoRI inserts from pSADE4 and pSADElB were subcloned into pBR322 cut with EcoRI. This
S was performed as a 3-way ligation.
Plasmid pSP695F contains the same AAP695 insert as pSADE-695 subcloned into pSP73.
Sense strand orientation reads 5' to 3' from the SP6 promoter. Piasmid pSP695R contains the
same AAP6gs insert as pSP695F except reverse orientation, i.e. sense strand orientation reads 5'
to 3' from the T7 promoter.
Plasmid pSP695R-TL-f was derived t`rom pSP695R. In order to remove the ATG codonbetween the 17 promoter and the AAP initiation codon, the plasmid was cut with Sall and HindIII,
flush-ended and religated. The Hindlll site was regenerated and the ATG codon was deleted.
Plasmid pSP695R-TL-s was engineered to encode a secreted form of AAP695 by rep!acing
the valine codon that is two positions downstream of the amyloidogenic domain (AAP695 amino `.
acid 640) with a termination codon. This functionally deletes the C-terminal 56 amino acids
including nine amino acids of the transmembrane domain, the cytoplasmic anchor and the eMire
cytoplasmic domain. To construct pSP695R-TL-s, the 565 bp EcoRI-Spel fragment of pSADE-lB
(AAP695 bases 1941-2504) was subcloned into M13mpl8 and mutagenized by site-directed
mutagenesis using oligo BDG-8G.
BDG-80 5'-catagcgacatagatcgtcatcacc-3'
The corresponding fragment was removed from pSP695R-TL-f by limit digestion with Spel plus
partial digestion with EcoRI. and replaced by this mutagenized fragment. In addition, sites for
Sphl, Pstl, Accl and Sall were also deleted.
Plasmids pSP695R-TL/\B-f and pSP695R-TlL~B-s are clones that contain a BamHI site
deletion at AAP695 position 1475. These were generated t`or use in the pSAR constructions. The
site is deleted without altering the coding sequence. A 1600 bp Sacl fragment was subcloned ~rom
pSP695R-TL-f into M13mpl9 (fragment extends trom Sacl site in vector polylinker through
AAP695 bases 131~1738), then mutagenized by site-directed mutagenesis with oligo DEL-2.
DEL-2 5'-gcatggtggaccccaagaaa-3'
llle Accl-Sacl fragment (AAP695 bases 373-173~) in pSP695R-TL-f and pSP695R-TL-s were
replaced with the corresponding mu~agenized tragment.
Plasmid pAAP-695/~B-f was constmcted by subcloning ~e Nrul-Spel fragment of
pSP695R-TL/~B-f (AAP695 bases 144-~5~4) in~o pGEM-5Zf(+)/EcoRV-Spel.
Plasmid pAAP~95/\B-s was cons~ructed bv replacing .the EcoRI-Spel fragment of pAAP-
695AB-f (AAP695 bases 1941-'~504) wi~h EcoRI-Spel fragment of pSP695-RTLAB-s. This was
then moved into thevector pGEM-5Zf(+) cleaved with EcoRV and Spel as an Nrul-Spel fragment,
_ ~ ,, ,,,, ,, ~, , .~ , C l IR~Tm 1~ ~!U~T
., . ~ .. -. . . - : . :~
. , ,, ~ ., . , ~
WO 9~/06187 PCT/US91/0677.
`;~og2823 -14- -_
deleting the Eco~V and Nrul sites~ but maintaining ~he Spel si~e and placing the- en~ire construct
irnmediately downstream of an Ncol si~e necessary for further steps in the construction.
AAP751 Plasmids
Plasmid pSADE-S which contains AAP7sl bases 131-1411 was derived from single -.
stranded cDNA that was generated t`rom Alzheimer brain RNA using BDG-75 as a primer, and ::
double-stranded cDNA generated by PCR using BDG-74 and BDG-75 on cDNA template~ '
BDG-74 5'-gggaat~cccccgcgcagggtcgcg-3'
BDG-75 5'-gggaattcgattccactttc~cc~g-3' -
The AAP se~quences were subcloned as an EeoRI tragmen~ in~o pUC13.
Plasmid pSADE-7 contains AAP751 bases 131 -2110. The subcloned EcoRI inserts from , . .
pSADE-5 and pSADE-lA were inser[ed in~o pBR3~2 cu~ wi~h EcoRI in 3-way liga~ion to generate
the insert that includes AAP751 bases 131 -2110.
Plasmid pSP751R-TL-f was c~)nstructed ~o replace a portion of AAP695 in pSP695R-TL
with a corresponding portion t'rom AAP751. The Accl-Xhol fragmen~ of pSP695R-TL (AAP695
15 bases 373-1056) was removed by limi~ diOes~ion wi~h Accl plus partial digestion with XhoI due to :
the presence of another Xhol site in the vector polylinker. This fragment was replaced by the
AccI-Xhol fragment of clone pSADE-5 (AAP751 bases 373-1224) to generate pSP751R-TL.
- Plasmid pSP751R-TL-s was engineered to encode a secreted form of AAP751 by replacing
the valine codon that is two positions downstream of the amyloidogenic domain (AAP695 amino
20 acid 640) with a termination codon. This functionally dele~es the C-terminal 56 amino acids
including nlne amino acids of the transmemhrane domain, the cytoplasmic anchor and the entire ~ .
cytoplasmic domain. To construct pSP751R-TL-s the 565 bp EcoRI-Spel fragment of pSADE-lB
(AAP69S bases 1941-2504) was subcloned into M13mpl8 and mu~agenized by site-directed
mutagenesis using oligo BDG-80~
BDG-80 catagcgacatagatcgtcatcacc
The corresponding fragment was removetl from pSP751R-TL by limit digestion with Spel plus
partial d;g~stion with EcoRI, and replaced by this mutagenized t'ragment, .~ .
Pla~smid pAAP-751 /\B-f was construeted by replacing the Asp718-Xhol fragment of pAAP-
695/\B-f (AAP695 bases 203-1056) wi~h Asp718-Xhol t'ragment of pSP751 R-TL-f ~AAP751 bases .- .
30 203-1225).
Plasmid pAAP^751aB-s was constructed hy replacing the Asp718-Xhol ftagment of pAAP-
695LB-s (AAP695 bases 203-1056) with Asp718-Xhol tragment of pSP75 IR-TL-f (AAP751 bases ::
203-1225).
AAP770 Plasmids
Plasmid pSADE-6 which contains AAP770 bases 131-1468 was deriYed from single ;
stranded cDNA Ihat was generated ~rom Alzheimer brain RNA using BDG-75 as a primer, and
n~eu~ ~ ~ .
- - ~ - I .
. ~ : . , , ., . . , . , ... .. . ~
W ~ 92/0618/ PC~r/~lS91/0672- `
` 15
doub5e-stranded cDNA generated by PCR using BDC~ 2~3s on cDNA template. The
AAP sequences were subcloned as an EcoRl t`rs8men~ in~o pUC13.
BDG~74 5'-gggaat~cccccgcgcagggtcgcg~3'
BDG-75 5'-gggaattcgattccactttctcctg-3'
S Plasmid pSADE-8 contains AAP770 bases 131-2167. The subcloned EcoRI inserts from
pSADE~ and pSADE-lA were inserted in~o pBR32~ cut with EcoRI in 3-way ligation to generatè
the insert that includes AAP770 bases 13]-2167.
Plasmid pSP770R-TL-f was constructed to replace a portion of AAP695 in pSP695R-TL
with a corresponding portion from AAP770. The Accl-Xhol fragmen~ of pSP695R-TL (AAP695
bas~s 373-1056) was removed by limit diges~ion with AccI plus partial digestion with Xhol due to
the presence of another Xhol site in the vector polylinker. This fragment was replaced by the
Accl-XhoI fragment of clone pSADE-6 (AAP770 bases 373-1224) to generate pSP770R-TL.
Plasmid pSP770R-TL-s was engineered to encode a secreted torm of AAP770 by replacing
the vaJine codon that is ~wo positions downstream of the amyloidogenic domain (AAP695 arnino
acid 640) with a termination codon. This func~ion~lly dele~es the C-terminal 56 amino acids
including nine amino acids of the transmembrane domain, the cytoplasmic anchor and the entire
cytoplasmic domain. To construct pSP770R-TL-s, ~he 565 bp EcoRI-Spel fragment of pSADE-lB
(AAP695 bases 1941-2$04) was subcloned into M13mpl8 and mu~agenized by site~irected
mutagenesis using oligo BDG-80.
BDG-80 5'-catagcgacataga~cg~ca~cacc-3'
The corresponding fragment was removed t`rom pSP770R-TL by lim~ digestion with Spel plus
partial digestion with EcoRI. and replaced by ~his mu~agenized fragmen~.
Plasmids pAAP-770/\B-t' were cons~ruc~ed by repiacing the Asp718-Xhol fragmen~ of
pAAP~95 AB-f (AAP695 bases 203- 1056) wi~h Asp718-Xhol t'ragmen~ of pSP770R-TL-f (AAP770
2~ bases 203-1281).
Plasmids pAAP-770L~B~s were cons~ructed by replacing the Asp718-Xhol fragment ofpAAP~95!~B-s (AAP695 bases 203- 1056) with Asp718-Xhol t'ragment of pSP751 R-TL-f (AAP770
bases 203-1281).
Examp!e 3 pSAR
Several transgenes were cons~ruc~ed con~ainin, nucleotide sequences from rat growth
hormone (rGH). A vector, pSAR~ was constnlcted which contains the mMsl promoter, the rGH
signal sequence including the intron contained therein, and the rGH3'-UTR. Plasmid pSAR
contains cloning sites which allow tor insertion of AAP coding sequences which can then be
expressed when the transgene cons~ruc~ed is 1ibera~ed and used to genera~e a transgenic animal.
In order ~o construct a ~ransgene according to the present invention using the rGH 3'-
untranslated sequences~ the growth hormone sequences mus~ be modified. Thus, 5 sevments of the
~m 1~ ~u~
- - - ,
WO 9~/061S, 2 0 ~ ~ 8 2 ~ P(~/US91/067'~ ' '
-16- ' " "' '
rGH gene were subcloned into t~ve differen~ plasmkls to t'acilitate manipula~ions. The five
subclones were modified and ligated back together to produce a modified rGH sequence. A mouse
mMtI promoter was then inserted upstream ot' the rGH material. The mMtl promoter was '
recovered from starting malerial and amplified using PCR technology which allowed for the ~'
5 generation of a Smal site at the 3` end which is not naturally present. This Smal site was useful
in the ligation of the mMtl promoter to the rGH sequence. To complete the transgene
construction, an internal portion of the rGH sequence was deleted and one of the six versions of
the AAP sequence was inserted in irs place. The inserted AAP sequence was then modified to
place it in proper reading frame for expression in transgenic ànimals. Charts 8-12 illustrate ~:
10 plasmids constructed to make pSAR.
The starting material for the rGH 3'-UT was a ra~ growth hormone structural gene clone
in bacteriophage Lambda-Charon 4A described in Chien, Y.-H. ~ E.B. Thompson, Proc~ Natl.
Acad. Sci. USA 77:4583-4587 (198û). Aliquots of this DNA were packaged using standard :-~
techniques, arnplified, and DNA was ex~rac~ed trom ~he resulting bacteriophage preparations~ The '
DNA was digested with both BamHI and Xhol. Fraaments which migrated on agarose gels at "'
about 5 Kb were purified. These t'ragments were subcloned into pSP73 (Promega) cut with the
BarnHI and Xhol (see Chart 8). Appropriate clones, designated pRGH; were identified by
hybridization with BDG-86. '
BDG-86 5'-caagaggctggtgctttccctgccatgccc-3' ~-
20 The pRGH clone was divided into five t'ragments of workable size and complexity to enable
appropriate modifications. Numbering was according to the rGH sequence coordinates~
#1 Xhol-Pvull fragment (407-789)
#2 Pvull-Pstl t'ragment (789-1714) ~:
#3 PstI-Pstl fragment ~ 1714-2564)
#4 Pstl-Pstl fragment (2564-376~) ';
#5 Pstl-BamHI fragment t3764-5644) ' ' ' ~`
Modifications were performed on Pstl~Pstl t'ragment #3 to enable insertion of the 3'-AAP
sequences, including the AAP stop codon, immediately upstream of the rGH 3'-UT. These ' ~ ~'
modifications were termed Step 1. The Pvull site within ~he 5th codon upstream of the rGH s~op
30 was selected as an insertion site. Since several Pvull sites exist within the rGH gene. it was
necessary to mutate this one to enahle insertion of the AAP eDNAs without fi3rther fragmentation "~
of rGH sequences in the cloning vector. Hpal w s chosen to replace Pvull. It was se}ected
because the enzyme used needed to cut uniquely within rGH. and generate a flush-ended terrninus
to enable proper insertion of ~he AAP cDNAs. Replacement of the Pvull site with a Hpal site was
35 accomplished using a PCR-based protocol.
New cloning vectors were generalecl tor ~his sec~ion. pSP72/\K was génerated by cutting
WO 92/0618, PCr/US91/06727
- 2~92823
pSP72 (Promega~ with Asp718~ ~1ush-encling and recircuiarizing. pSP7.!~H was generated by
cutting pSP72/\lC with Hpal ~ EcoRV and recircularizing~
The Step I segment was initially subcloned in Bluescript (Stratagene) as a Pstl fragment
re~erred to a~ pStep-PPP (see Chart 8~. The stra~eay u~ed t~ replace the Pvull site at rGH 2373
S employed PCR on two segments ~t` this clone.
The 5' Pstl-Pvull segment was mu~ated by amplifying the insert of pStepl in pStep-PPP
using oligos BDG-158 and BDG-156
BDG-156 5'-ggggaattcgttaactgctttccgcaaagcggcg-3'
BDG- 158 5 -cagccctaactgcagtctaggcca-3 ' - -
BDG-158 corresponds to the rGH sequence surrounding the Pstl site at posi~ion 1714~ BDG-156
contains the rGH antisense sequence surrounding position 2373 (downstream of the Pvull site), but
replaces the Pvull site with a Hpal site so that the amplified products contain the Hpal site in place
of the Pvull si~e~ BDG-156 also contains an EcoRI site downstream of the Hpal site to facilitate
clonirlg. This PCR-generated fragment was subcloned into pUC13-Smal as a blunt-ended fragment
to generate pStepl-5'. It was inserted in such an orientation that there was an EcoRI site in the
vector upstream of the 5'-end of this fragment, i.e. this fragment was now flanked by EcoRI sites.
Insertion was random, i.e. it w~s jR both orientations. This orientation was selected since it was
the one useful for the construct. The EcoRI si~e at the 5' end was supplied by the vector, since
it exists upstream of the Smal site used for insertion. The EcoRi site at the 3'-end was created
with the PCR primer, adjacent to the Hpal site on that primer.
- The 3'-segment was mutated by amplifying the insert of pStepl-3' using oligos BDG-157
and BDG-159. BDG-159 corresponds to a cloning vector sequence 3' to the insen. BDG-157
contains the rGH sense strand sequence surrounding position 2373 (upstream of the Pvu site), but
replaces the Pvull site with a Hpal site so that the amplified products contain the Hpal site in place
of the PvuII site. BDG-157 also ~enerates an EcoRt site upstream of the Hpal site to facilitate
cloning. This PCR-genérated fragment was cut wi~h Ps~l + EcoRI and cloned into pSP72~KH cut
with Pstl ~ EcoRI.
3DG- 157 5 '-cccgaat~cgt~aac"ctgtgctttctaggcacacac-3 '
BDG~159 5'-gacgttgtaaaacgacggccagt-3'
Oligos BDG-156 and BDG-157 were ùesigned so that the ~wo PCR-generated Step I
segments could be cut with Hpal and ligated~ together to yie!d the appropriate Pvull to Hpal
modification at rGH position 2373. This was accomplished by cutting pStep 1-5' and pStep 1-3'
with EcoR1 and Hpal. The 5' portion ~f traoment ~3 trom pStepl-5' was subcloned into the 3'
portion contained in pStepl-3' to generate the tinal Stepl plasmid, pStepl-PHP.
Modifications on the Xhol-Pvull fraument (407-789)~ termed Step 2 modifications were
performed to permit insertion of the 5' AAP terminus near Ihe t~rs~ rGH codon downstream of the
WO 9~06187 PCI/I~IS9l/0672,
209~823 -18-
rGH signal pept.dase cleavage si~e~ This was accomplished by genera~ing an Ncol site in rG}I.
The AAP sequences were then cloned in~o this site hy using the immediately upstrearn Ncol site
in vector pGEM-SZf(+), in the pAAP series o~` constructs~ These constructs were further modified
by insening appropriate oligonucleotide ad~ptors be~ween the engineered rGH Ncol si~e and the
5 natural AAP Asp718 site, so that the AAP sequence will begin with the first ~odon of the mature
protein, expressed as a tusion with ~he tlrst 5 rGH residues. This is designed so that the rGH
signal sequence should be clipped within an rGH milieu.
pStep2 is the Xhol-Pvull rGH segment (coordinates 407-789) containing the engineered
Ncol site at coordinate 736, cloned as a flush-ended PCR-generated fragment into pUC13-Smal
10 (see Chart 9). To construct pStep~, the 382 bp Xhol-Pvull tragment was cloned into M13 cut
with Xhol and Smal. The Ncol site was engineered by site-directed mutagenesis using oligo BDG-
112. -
BDG-112 5 -CcctgccatgaccE~g~ccao-3'
The mutated insert was ~hen excised trom ~he M13 clones by PCR from using primers
15 BDG-122 & 123 to preserve Xhol sile and regenera~e the Pvull site.
BDG-122 5'-cagcagccagctggt ,cagg~gc~gggctc-3'
BDG-123 5'-tccagcaccctcgagcccagattccaaact-3:
The PCR-generated segment was se(luenced to ensure its integrity. The Xhol-PvulIfragment was subcloned into M13/Smal-Xhol. and the correct sequence confirmed through the
20 region going into the final construct, including the presence of the engineered Ncol site.
No modifications to the nucleotidé sequence were required for the Pvull-PstI fragment
(789-1714j and the Pstl-Pstl fragment (2564-3764). However. both tragments were inserted into
different vectors.
In step 3, plasmid pS~ep3 which contains the rGH Pvull-Pstl fragment (coordinatés 789-
25 1714) was cloned into similarly-cut pSP72 ~see Chart 9).
In step 4, plasmid pStep4 which con~ains the rGH Pstl tragment (coordinates 2564-3764)
cloned into Pstl cut Bluescript M13+-SK (see Chart 9).
Modifications were pertormed on the Pstl-BamHl fragment (3764-5644) to constructpStepS. pStepS was produced when the rGH Pstl-BamHl tragment (coordina~es 3764-5644) was
30 cloned into similarly-cut pSP72AKH. Ncol and Asp718 sites were mapped within this rGH
segment at positions 4760 and 5470, respectively. These sites must be deleted to enable
- . appropriate cloning of AAP sequences. Since ~hese are approximately 3000 bases away from the
termination codon, it was fel~ tha~ some mo(lifiea~ions at these sites within ~he 3'-UTR are unlikely
to be detrimental to the expression~l specifici~v of the transgenic constructs. lllese sites were
35 individually eliminated by cutting wilh th~ enzvme. tlush-ending and recircularizing (see Chart 9).
Once modification were pertormed on ~he five subclones. the fragments were relinked to
.~1 IR~Tm ITF ~:Fr j . .
WO 92/06187 ~ V 9 2 8 2 3 PCT/US91/0672?
.19_ :.
produce a modified Yersion ot` the orivinal rGH sequence. The a~tachment and modifications of
plasmids from steps 1-5 was performed sequentially and produced a series of plasmids.
Plasmid pStep23 results t`rom liga~ion ot` subclone Xhol-Pvull insert t`rom pStep2 into
similarly-cut pSIep3, generating a plasmid ontahlhlg rGH ~:wr(linates 407-1714 (see Chart 10).
S Fragment I is then combined with pStep23 and a portion of the plasm~d is deleted. Then
fragments 4 and 5 are added. ln order to subclone the rGH segments from steps 4 and 5 into the
Step231 construct, the Pstl site at position 171~ must be deleted. This is not problematic since the
rGH region between coordinates 736-~373 is deléted in all pSAR-AAP constructs. However, the
Pstl site at position 469 within ~he pStep23 segment mus~ be maintained. Therefore, the following
10 steps were done in order:
1. Generate two subclones which separate the Pstl site at position 469 in pStep23 from the
remainder of the pStep23 insert at a site unique within pRGH (Bglll-Pstl 1271-1714).
2. Subclone the pStepl insert into this plasmid an~l do the necessary deletion.
3. Subclone the pStep45 insert into this plasmid.
4. Add back the missing pStep23 sequences.
To accomplish this plasmid pStep23-XB is constructed. PStep23-XB is a subclone of pStep23
which contains the Xhol-Bglll fragment of pStep23 (rGH coordinates 407-1271) in~o similarly-cut
pSP72 (see Chart 10). -
The remaining fragment of pStep23 is pStep23-BP, the subclone containing the Bglll-Pstl
fragment of pStep23 (rGH coordinates 1''71- 1714) inserted into similarly-cut pSP72 (see Chart 10).
The step l fragment is ligated to the pStep23-BP to form pStep23-BP-I. The step 1
~ragment is the Pstl fragmen~ of pStepl-PHP (rGH coorclinates 1714-2S64). It is inserted into
similarly-cut pStep23-BP. Orientation cuntirme~l by analytical restriction digestions. Clone
contains rGH coordinates 1271-2564 (see Chart 10).
Plasmid pStep23-BP-I~ is pStep23-BP-I with the necessary deletion. In order to delete
the rGH region containing Pstl- 1714~ pS1~p~3-BP- I was cut with Styl and Asp718, flush-ended and
recircularized. This deleted the re~ion betweerl rGH coor~linates 1396-1907 and recreated an
Asp718 site at the recircularized junction (see Chart 10).
pStep45 is the combination of t`ragments lirom steps 4 and 5. To forrn pStep45. the Pstl
fragment from pStep4 was subclone(l into similarly-cut pStepS. Orienration confirmed by analytical ~ -
restriction digestions. pStep45 contains rGH coordinates 2564-5644 (see Chart 11).
pStep23-BP-1/\45 resulte~l ~rom a 3-way ligation ot. I ) the Bglll-Pstl insert trom pStep23-
BP-I/\ (rGH coordinates 1'71-'56~): ') the BamHI-Pstl(partial) insert from pStep45 (rGH
coordinates 2564-5604); and 3) phosphatased BamHI-Bolll-cu~ pSP~. Orierltation confirmed by
analytical restriction digestions. Clone euntains rGH coor(linates 1~71-5604 with 1396-190~
deleted (see Chart 11). ;
.: .
WO 92/061~ ~ 2 0 9 2 8 2 3 PCT/I 'S91/0672-
pStep231L45 was generated by the tollowing s~eps:
1. Cut pStep23-XB and pStep23-BP~ S wilh Bglll.
2. Ligate these two Bglll-cut plasmids.
3. Cut ligated DNAs wilh Xhol ~ B~mHI ~nd puril~ the 4726 bp fragment (rGH coordinates
407-5644 with 1396-1907 deleted).
4. Clone this Xhol-BamHI fr~gment in~o similarly-cut pGEM-I IZf(-), generally pStep231A45
(see Chart 11).
This completed the rGH segment of the pSAR construction. The rGH sequence could now
appropriately be combined with the mMtl promoter to provide a vector in which AAP sequences
10 c~n be inserted to form a working transgene.
The next step was to comhine the mouse metallothionein-l promoter with the rGH
segments. The starting plasmid tor the metallothionein component was pXGHS (Nichols Institute)
(see Chart 12).
The desired junction betw~n mMtl and rGH was generated by flush-ending the rGH Xhol
15 terminus and recreating the remaind~r ~f the junction using PCR on the mMtl clone.
PCRutilizingprimersBDq-68andBDG-213amplifiedanapproximately2100bpfragment
fiom pXGHS containing pUC12 polylinker seqnence (from pXGH5) at the 5'-end and the
appropriate junction sequence at the 3'-end.
BDG~8 5'-gttttcccagtcacgac-3'
BDG-2i3 5'-ggga~c~gg~gaagctggag-3'
The fragment was cu~ with EcoRI and cloned into pSP731EcoRI-SmaI generating plasmid
pSP73mMtl; the EcoRI site was snpplied by the amplified polylinker sequence from pXGH5, and
the Smal site is supplied by flush-end Iigation ot the amplified sequence (contains half an Smal site)
to the Smal site of pSP73. The Asp718 site must then be deleted from this mMtl segment since
25 it will interfere with the cloning ot AAP sequences into pSAR, but the change is irrelevant to the
transgenic constructs since it will not be in-:luded within the transgenes (see Chart 12).
Thus,.to make a construct from the plasmids describetl that contains the mMtl promoter
sequence upstream from the 3'VTR sequence o~' rGH, the t'ollowing plasmids were constructed.
To construct plasmid pmMtl/\K, mMtl sequence amplified from pXGH5 with primers
30 BDG-68 and BDG-213 was cul with EcoRl and cloned into EcoRI-Smal-cut pSP73. The Asp718
site at mMtl position 1100 was deleled by cu~ting with Asp718. flush-ending and recircularizing
(see Chart 12). . ~ -
Plasmid pSAR was Ihen constrllc~ed. The EcoRI-Smal insert trom pmMtl/\K was
subcloned into pStep231LM5 cu~ with Xhol. ~lush-ended. then recut wilh EcoRI. This generated
35 the completed pSAR cloning Yec~or (see Chan I ). The sequence of the PCR-generated stretch
of mMtl promoter was confirmed.
W O 92~0618~ P ~ /~S91/06727
~1- 20921823
Insertion of AAP sequence into pSAR
To insert AAP fragmen~s in~o pSAR~ AAP clones pAAP-(695,751,770)~B/(f,s) were cut
with Mael~ This cut the AAP clones a~ AAP ~ermina~ion codon and wi~hin pGEM5-Zf(+). Mael
fragments were llush ended, recut wi~h Ncol~ and subcloned into pSAR cut with Ncol and Hpal.
S The following plasmids were cons~ruc~ed:
pSAR-695NM/f,s: AAP-695 filll length and secre~ed constructs from pAAP-695LB-s in
- pSAR, not yet adap~ed for expression.
pSAR-751NM/f,s: AAP-751 t`ull length and secre~ed cons~ructs from pAAP-751LB-s in
pSAR, not yet adapted for expression.
pSAR-770NM/f,s: AAP-770 t`lll leng~h and secreted construcls from pAAP-770/\B-s in
pSAR. not yet adapted for expression. Collectively these plasm}ds are ret`erred to herein as pSAR-
NM.
The region between the Ncol site in the 5' rGH segment and Ihe Asp718 site in the AAP
segment had to be remo~ed an~ replaced by appropriate adaptors tO place the AAP sequences under
proper control of the mMtI promoter and rGH signal sequence. This was accomplished as follows:
pSAR-NM was cut with Ncol and Asp718 and Ncol-Asp718 annealed adaptors BDG-173
;~- & BDG-174 were subcloned therein.
BDG 173 5'-catgc~ggaa-3'
; BDG 174 5'-gtacttccag-3'
The following plasmids were construc~ed:
pSAR-695/(f,s): Final AAP-695 t`ull length and secreted constructs from pSAR-695NMlf,s,
properly adapted for expression.
pSAR-751/(f,s): Final AAP751 f~ll length and secre~ed constructs from pSAR-751NM/f,s,
- properly adapted for expression.
2S pSAR-~t70/(f,s): Final AAP-170 full len~th and secretéd constructs from pSA~-770NMlf,s,
properly adapted for expression.
To generate transgenic animals, the transgene segment was generated as follows: pSAR-
695/(f,s) was cut with Bgil and BamHI. The entire transgene was liberated. The pSAR~95/(f,s)
Bgll-BamHI transgenes were microiniel:ted tertilized mouse ali following the directions in U.S.
Patent 4,873,191. pSAR-695/f was injected into 6~8 eggs yielding 101 pups, and pSAR~95/s into
57û eggs yielding 94 pups. Of the îOI pSAR-695tt pups, 41 were shown to be potential founders
by Southern blo~ analysis of DNA ex~rac~ed trom ~ils. Of the 94 pSAR-695/s pups, 29 were
similarly shown to potential founders.
Example 4 Mouse Brain Analvses
The brains of sacrificed ~rans!enic mice are each analyze~l as tollows. Northern blot and
ribonuclease protec~ion assays on RNAs ex~rac~ed trom brain ~issue are performed to evaluate gross ~;
-~,
.. . ~. .. .. .. . . .. ~ gllR ~ R U ~
.-- . . :- .,. -: . . .. . : .. . ., .:, . - . - .: . ~ . .. .. . . . . - . . .. . . . . . -
WO 92/0618/ PCr/US9~/06727
~0~2823 ~
transgene expression at the RI~IA level. Western blot analyses using several antisera that recognize
the AAP region encoded by the pNAN transgene are pertormed on protein extracted from brain
tissue to evaluate gross transgene expression at the protein level. In sirl~ hybridizations are
performed on seclions of brain tissue to evaluate regional and cellular-specificity transgene
S expression at the RNA level~ Immunocytochemistry studies on sections of brain tissue are
performed to evaluate regional and cellular-specificity ot transgene expression at the protein level.
By histological methods including but not restricte~l to Congo red~ Thioflavin T, Thioflavin S,
silver staining methods are pertormed to evaluate neuronal and other pathological abnormalities.
,
.~ : ''
; ~ s~R~m l R~
WO 92/061B7 PCrlUS91/0672,
`23~ ~92823
Chart I
; 1 ~LPGLALLLL M WT~R~LEY PrD~NAGLLA EPQIA~FCGR EN~MNVQN¢
51 KW~SDPS~TK TCIDTKE~IL QYCQEYYP~L QIrNYYEANQ PYTIQNWCKR
1~ GRKQCKTHPH FVIPYRCLVG EFYSDALLVP DKCKFLHQER ~DVCETHLHW
1~1 HTYAKE~CSE KSTNLHDY~ LLPCGIDKFR CVEFVCCPLA EESDNVDSAD
201 ~EEDDSDVWW GG~DTDYADG SEDKVVEVAE EEEYAEYEEE EADDDEDDED
2fil GDEVEEEAEE PYEE~TERTT SIATTTTTTT SYEEVYRVP TTAASTP~AV
301 DKYLETPGDE NEH~HFQ~K ERLEAKHRER ~SQV~REWEE AERQAKNLPK
3~1 ADKK~VIQHF QEKVESLEQE ~ANERQQLVE T~ARYE~L NDRRRLALEN
i 4~1 YITALQAVPP RPRHYFN~LK K W R~EQKDR QHTLKHFEHV R~VDPKKAAQ
~1 IRSQY~THLR VIYER~N~SL SLLrNYP~VA EEIQDEVDEL LQKEQNYSDD
~01 VLAN~ISE~R ISYGND~L~P SLTETKTTVE LLPVNGEFSL DDLQPWHSFG
E;Ei 1 ~DSV~ANTEN EVEPVDARPA ADRCLTTRPG SGLTNIKTEE ISEYKh~DAEF
B01 RHDSGYEYHH QKLYFFA~DV GSNKGAIIGL ~VG~VVIArY IVITLV~LKK
B~l KQYTSIHHGY YEYDAAVTPE ERHLsK~QqN GYENPTYKFF EQ~QN~
'; ', .
- ':
' ,:;.
''.'.''';'~
....
R~ ~ e ~
WO9~061~/ PCT/US91/06727
20'J2~2'~ ~4 ;
- Chart~
1 ~tttcctcg gc-gc~t~g ~eQ~ga~csc gc~agg3gc gtgc~cggg~
51 cccc~ g- cg~c~cg~t ~c~c~cg~ gc~a-8c~s ~acgc~gcgg
101 ~tcccactc~ c~c~gca~cg c-ctcg~tgc CCC~C8~-89 ~tc~cg~tgc
161 tgcccg~ttt ~c~c~gctc ct~ct~ccg cct~gacg~c tcga~c~ct~
201 ~-ggtacccs ct~atggta~ t~ct~gcct~ ct~gctga~c ccc~g~tt~c
251 cat8ttct9t ~8ca~ct9a ~cat8c~cat gaJt9tCC~ aat~gsagt
301 0gg~ttc~g~ tcc-tcagg~ accaaa~cct ~catt~atsc c~gg~aggc
361 atGct~c~gt ~ttgccaag~ ~tct~ccct ~actgca~- tcDccaAtgt
~1 ggtaga-3cc ~cc3~cc~g t0accatcc~ ~actggt~c a~gcggggcc
~51 gcaagc-~t~ cs~gacccat ccccocttt~ tgsttcccta ccgct~ctta
5~1 gttggtgagt ttgt~-gt~a tgcecttctc ~ttcc~c~ agtgcaaatt
551 cttacaccag g~ g-tg~ atgttt~cga ~ctc~tctt c~ctggcaca
~1 ccgtc~cc~a 4g~g~cat~c ~gt~ D9a gt~cc~-ctt ~c~t~actac
B51 ~gc~tgtt~c tgccct~c~s ~att~-caag ttcc~a~g~ t~2gttt~t
7~1 ~t~ttgece~ ct~ge~a~g ~a~t~e~ t~t~ttet ~et~-t~e~g
751 ~ atg~ ctc~g~t~tc t~gtgg~gcs ~c~eac ~ctatgca
8~1 aat~gga~tg ~ c~a~t n~ta~asgt~ ~c~8~-99 a~8~t9aC
861 t~a~t~a-a ga~as~a~ cc~at~t~s c~agg~cgat ~3~gat~t~
01 ~t~8t~ aa~g3g~ct ~ag~a~ccct ac~a~g3agc cacaga~aas
8~1 accacc~c- tt~cc~cc~c eseeacc~ce sccac~ga~t ct~tgg~
1~1 g~t~ttc~a gttcctacaa ca~c~gcca~ t~cccct~at gce~ttgaca
1051 a0tatctc~a gacacc~gg ~t~g~at~ ~catgccca ttteca~aaa
1101 ~ce~a~ a gactt~ c c~caccg~ ~o~ at~t eccag~tcat
1161 ~a~--t~ 9~9D99C~9 -c~tc~gc ~a~actt~ cctaaa~ctg
9~e ~t~tccag ~Jtt~CC~ a~
1251 c~g~--g~a~ cca~c~ acagca~c~ 9t~a~DC-C ~cat~cca~
13~ tg~gcc atgctc~t~ acc~ccgcc~ cct~gccct~ ~a~act~cs
1351 te~cc~ctct ~eagact~tt cctcctc~c c~c~tcac~t ~ttca~tatg
~ .~ 11 R ~Tl~n !T~ ~ ~
WO 92~061~, PCr/US91/06727
2092823
Chlr~C~ntdl
~al ct~ g~ tccgcgc 9~c~99~ g-c~ac~c ~c~ccc~
14~1 ~c-~ttc~-~ c~t~t~c~c~ t~g~g~tcc c~g~gcc gc~c~g~cc
15~1 gg~ccc~Qt t~t~-c~c-c c~ccgt~tg~ ttt~tg~gcg ck~g~t~
1551 tctctctccc t9ctct~ca~ cgtgcctgc~ ~t~ccg~gq ~gattcagga
~6~1 tg~-~ttg-t ~8ctgcttc a8~a9~8ca a~ctattc~ ~tg~cgtct
1~51 tggcca~c3t 8~tt~9tsa~ cc~8g~tca 8tt~cg~a~ c~at~ctctc
17~1 tgcc-tctt tgacc~8asc gs~acc~cc ~t~gagctcc ttccc~tgaa
1751 tgg~gagttc ~gcct~gacg atctcc~gcc ~tggcat~ct tttgggQctg
18~1 ~ctct~tgcc agccaacac~ 8aa3acga~ ttgagcctgt tgatgcccgc
1851 cctgct~ccg ~cc~gg~ct ~acc~ctcg~ ccsggttctg ggttgacaaa
1901 t~tcaag~cg gaggagatct ctga9gtgaa g~tggatgc~ ~sattccgac
1961 atgactc-gg stit~aagtt catcatcaaa aattggt9tt cttt~cagaa
2~01 8atgt~8~tt caaac~a~gg t~caatc~tt ggactc-tgg tgggcggtgt
2~51 tgtc-t~c~ ~cagtD~tc~ tc-tcacctt ggtgatgctg ~agaDgaaac
21~1 agt-c-catc c~ttcatcat ggtgtg~tgg ag~ttgacgc cgctgtcacc
2151 cca~a~ga~c gCCDCCtgtC c~at~c~ c~ga3cggct ~cg3a~tcc
22al -cct-ca~g ttctttg~gc ~tgc~gaa cta~accccc gccac~gcag
225~ cctctg~-gt tgg-c~gcaa~ ~DCC~tt~Ct tc~ctaccc~ tcggt~tcca
2301 ttt~t-~a~t a~tgtgg~a~ ~a~aca~cc cgttttatga tt~ctc~tt
2361 atc~cctt~t ~c~ct~ ct~t~cac~ gt~atgec tgaacttg~
2~1 tta~tccac~ c~tcagta~t gtattc~tatc tctctttac~ ttttgg'ctc
2~51 tat-CtJC t tOttd~t~g~ ttttgtgtac tataaaga~t tta~ctgt~t
2~1 c~--c~-g~g ~ -9~ ttctctcct~ ~tt-tttatc ~c~t~cccc
26~1 St~gccagtt 8t~tattatt ctS~tg~ttt ~tgaccca~t taa~tcctac
2~01 tttsc~t-S9 Ct~tD-g~-~ cg~t99g~g~ t~cttc~tgt ~ac~t99~
2861 gttc~gct~c ttctctt~cc taa~t~ttcc tttcct~atc ~ctatgcatt
2~01 ttA~agtta- ~c~ttttt-- gt~tttca~ tgcttt~ a~attttttt
27Sl tcc-t~-ctg c-tttt-ctg t~c~gattgc tgcttctgct ~t~ttt8t~a
28~1 tat~8~tt a~ag~at~c ~cscgttt~t ttcttcgt~c ctgttttatg
2~51 t~cac~caSt ~c~tt~a~ acttcaagct tttctttttt t~tccacgta
. : -, ., .:. ., , .. - . . - . .. .. ;, ~ . .. .. .....
WO92/0618/ PCT/US91/067
-26-
2 ~ 9 2 8 2 3 Chi~rt ~ ~Cont`d)
'
.- 2g01 tctttgggtc tttgata~ag ~aa~gaatcc ctgttcattg taagcacttt
2951 t~cggggcgg gtggggaggg gt5ctctgct ggtcttcast taccaagaat
3~1 tctccaa~ac a~ttttctgc 3ggntgattg tacagastca ttgcttatga
3051 cstgatcgct ttctac~ctg tatt9cataa ataaatt~aa tssaataacc
3101 ccgggcaaga cttttcttt~ saggstgact acagacatta astastcgaa
3151 gtsattttgg gtggggagsa gaggca~att csattttctt taacczgtct
3201 gaagtttcat ttatgataca aaagaagatg asaatggaag tggcaatata
3251 Dggggatgag gaaggc~tgc ctgg-caaac ccttctttta ag3tgtgtct
33gl tcaattt~ta taaaatggtg ttttcatgta a~taaataca ttcttggagg
3351 agc
' ~
: ,
. .
,
.. ,.,. ~ .
.
WO 92/061~7 PCI/I~'S9t/0672,
~92823
Char~3
1 ~LPGL~LLLL A~TARALEV PTDGNAGLLA EPQIA~FCGR LNMH~NVQNG
51 KWDSDPSGTK TCIDTKEGIL QYCQEVYPEL QITNVYEANQ PVTIQN~CKR
1~1 &RKQCKTHPH FVIPYRCLVC EFVSDALLVP DKCKFL~QER MDVCETHLHW
151 HTVAKETCSE KSTNLHDYGM LLPCGIDKFR GVEFVCCPLA EESDNYDSAD
2~1 AEEDDSDYWW ~GADTDYADG SEDKVVEYAE EEEVAEVEEE EADDDEDDED
261 GDEYEEE~EE PYEEATERTT SIATTTTTTT ESVEEVVREV CSEQAET~PC
301 RAMISRWYFD VTEGKCAPFF YGGCGGNR~N FDTEYC~V CGSA}PTTAA
351 STPDAVDKYL ETPGDENEHA HFQKAKERLE ~KHRERMSQY MREWEEAERQ
401 ~KNLPKADKK AYIQHFQEKV ESLEQEAANE RQQLVET~A RVEAMLNDRR
~51 RLALE~YITA LQAVPPRPRH YFNVLKKYVR AEQKDRQHTL KHFEHYRMYD
501 PKKA~QIRSQ V~THLRVIYE RYNQSLSLLY NVPA~AEEIQ DEVDELLQKE
~51 QNYSDDVLAN VISEPRISYG NDALMPSLTE TKTTVELLPV NGFFSLDDLQ
B~l PWHSFGADSV P~NTENEVEP VDARP~ADR~ LTTRPGS~LT NIKTEEISEV
B51 KMDAEFRHDS ~YEYHHQKLV FF~EDV~SNK GAIIGL~VCG VVIATVIVIT
7~1 -LYMLKKKQYT SIHHGVVEYD AAYTPEERHL SKMQQNGYEN PTYKFFEQMQ
751 N~
:'' ''
'' ~ ~'.
.. ' , .. '
,................................................................. ''
":
;, , .;~ ; ~IIR ~ ~ R ~ ~ . .
W~92/~61~7 PCT/~IS91/0672,
-~8 "
2 ~ ~ 2 8 2 3 Cha~4
1 agtttcctc~ gcaQcggtag gcgag~c~c gc~g~a~c gt~c~cgg~3
61 cccc~gag- c~gcg~c~gt 8~C39C9C99 ~cag-gca~g g~c~cggc~g
101 ~tccc-ctc9 cac~gc~cg c~ctcggtgc cccgcgca~g gtc~c~atgc
151 t~cccg~ttt ~gcact~ctc ct~ct~ccg cctggacg~c tcg~c~ctg
201 gaggt~ccca ctgatg9taa tgctggcctg ctggctgaac cccagattgc
261 c~tgttctgt g~cag~ctg~ acatgc~c~t ~a~tgtccag aatgg~aa~t
3~1 gg~ttca~a tccatcaggg accsaaacct gcsttgatac caaggaa~gc
351 atcctgca~t att9ccsaga sgtctaccct gaactgcaga tcaccaatgt
4~1 ~gt~ga-~cc a~cca~cca~ tg~ccatcca ga~ctg~tgc agc~gcc
461 gcaa~c~tg caag~cccat ccccacttt~ tgattcccta ccgctgctt~
501 gttggtgagt ttgta~gtga tgcccttctc gttcctgaca agtgcnaatt
551 cttscaccsg gaga~g-tgg atgtttgcga aactcatctt cactggcaca
BBl ccgtcgccaa aga~acatgc astgagaaga gtaccaactt gcatgactac
~51 ggcat~tt0c t~ccctgcgg aattgacaa3 ttccgaggsg taga3tttgt
7~1 gt~ttgccca ctggct~a~g s~gt~acaa tgtg~attct gct~at~cg~
751 3gga~at~ ctcgg~tgtc tggt~3ggcs ~ageasac~c agactatgca
801 gatgggagtg s~acaaast agtag~agt3 gcaga~gagg aagaagtggc
851 tgas~tg0as ~aagaagaag ccgat~atga c~aggacgat gaggatg~tg
901 atgaggtaga~gaagaggct gaggaaceet acgsagaagc cacagagaga
9Gl cc-ccagca tt~cc~cc-c c-cc~ccacc ~cc~caga~t ct~tgg~aga
1001 g~t~gttcga gaggtgt~ct ctgaacaagc cgD~aegggg ccgt~ccgag
1051 caatgatctc ~c~ct~gtac tttgat~tga ctgaagggaa ~tgtgcccca
1101 ttcttttaca gcggatgtgg cggcaaccgg aacascttt~ acacagaaga
1161 ~tactgc-t~ gccgt~t~tg gcagc~ccat tcctaca~c~ ~ca~cc~gt~
1201 cccct~atgc c~tt~scaa~ t2tctcgag3 cacctgg~ga tga~aatgaa
12~1 cat~cccatt tccag3aa~c caaagagag~ cttgaggcca a~csccgaga
1301 ga~Jt~cC cag~tcat~a ~a~aat~gga s~agsca~aa cgtcaa~caa
1361 agaacttgcc taaa~ctgat aagaag~cag ttatccagca tttcca~ga~
. ~ ....... ... .. . ~IIR~TI~ITF ~UF~T .
WO92/0618/ PCT/U591/06727
29- 2092823
Chart4(Con~'d) ~ ~ ~
~ JD - ~t99~t C~tg~CJ ~g-~9CJgCC ~cg~g~g~c ~9c~gct99t
1461 ~9-g-C-C~C ~tggcc~9-g tggd~gCC~t 9CtCJ~tg~C cgccgccgcc
~1 t~gecct~g~ ct~tc cc~ctct9c ~ggctuttcc tcc~c~9cct
1551 c~c~cgtgt tc~t-t9ct ~l~g~tat ~tce~c~e-g ~c~3~D~
1801 c~ac~scac ~ccct-~ge ~ttC~D~C~ tgt~c~c~tg atg~-tccc~
1861 ~ agcegc tc~g-tcegg tccc-g~tt~ t~cac~cct cc~tgtg~tt
1~01 t~t~c9c- tga~tcD~tc tetetcset~ etetac~e~ ~cctgc~gt
~9CC~2~9~g ~ttc~9~t9 ~9ttgst9- gct9ette~g ~JJg~9CbD~
18~1 act~ttc~a t~ac~tctt~ ~cc~-cat~a tt-gtg~acc ~ag~tcagt
1861 t~cg~3~cg ~tgCtCtCDt gcc~tctttg ~ccg~9ac9~ ~qJC~CC9t
1901 ~g~ctcctt cccgt~atg gag~ttc~g cct~gac~at ctccagccgt
1~51 ~cattcttt tg~ggct~e tetgt~ee-~ ee~Je~c~g~ es~agtt
~0~ gect~tt~ ~tgceegecc tgc~gee~c cg~g~ctg~ ce-eteg-ec
2~61 ~ggttctgg~ tt~c~s~t~ tc~s~cg~ gga~atctct ~gtga~g~
2101 tg~atgcagn ~ttccg~c~t gactcoggat t~ ttc~ tc~tc~o~a~
2161 ttg~tgttct tt~c~g~a tgt~ggt~c~ ~c~ tg c~tc-tt~
22~1 ctc~t~gt~ 88e~g~gtt~ tc~t~gc~c ~t~atc~tc dtCscctt~g
22Sl tg~tgct~ g~-~c-g t~ tc~ ttc-tc~t~g ~gtggt~-g
23Q1 gttgacgce~ ct~tc~cccc a~gg~c~c c-cctgtcc~ agat~c~c~
2361 ~cggct3c ç-~a-tec~s cct-ca-~tt cttt~-~c~ ~tgc~aact
24~ acccccgc C2CD~C~CC tctg~ttg ~c~ca~-a cc~ttgcttc
2461 sct~cccatc g~tgtcc~tt tat~J~t~a tgtgg~aa~ c~accc~
2601 tt~t~t~att t-ctc~tat c~ccttttn~ c~gct~tgct ~t~cac~ag
2~1 ta~tDcctg ~cttg~tt a~tccacsc~ tc~gt~tgt attctatctc
2~1 tcttt~catt tt~atctcta t~ctac-tt~ tta~tg~t ttgt~toct9
2861 t~aa~-ttt getgt~te~ aet-~t~e~ t~s~ta~att etctectgat
2701 t~ttt~te~e ~t3~eeeett ~ee~tt~t ~tatt~ttet tgt~gttt~t ;~
2761 g~e~e-~tt~ ~gtcetsett t~c~t-tget tt-ag~te~ at8~8at~
2aal ette~tgtga aegtg~ t te~etgc~t etctt~eet~ ~t~ttect~
2861 tect~ateae t~tgc-tttt aa~gt~ae atttttaa~t tttcD~at~ -
'
...: . .
~m~u~ ~.. . . ;
W092~0618, PCT/US9l/0672-
-30-
2092823 Ch~rt~fCont'~l
.
28al cttta~-~a~ ~ttttttttc c~tgact~c~ tttt~ctgt~ c~gattgct~
2~51 cttct9ct-t tttgt9at~ tagB3~ttaa 9Og~atac-c acgtttgttt
3B~l cttc~tgcct gttttatgt9 c-c~c~tt3g ~cattg~g~c ttc~agcttt
3051 tctttttttg tccsc~tatc ttt9ggtctt tgfltaaa~a~ aa~aatccct
31~1 gttcatt~ta agc~ctttt~ cggggcgggt ggggaggggt gctct~ctg~ -
3161 tcttc--tt- ccaa~aattc tccasaaca~ ttttctgcag 8at~att8ta
32~1 cag~atc~tt Qcttatgaca tg~tcgcttt ctacactgt~ ttacataaht
3251 a~attaaata a~ata~cccc ~g~caagact tttctttgaa ~gatgactac
3301 ag~cattaa- t~tc~sagt aatttt~ggt ggg~aaga g~cagattca
3361 attttcttt~ Dccagtctga agtttcattt at~atacaao agaa~atgaa
34~1 aatggaagt~ gcaatataag ~ggatga~a a~gcat~cct g~acaaaccc
3461 ttcttttaa~ atgtgtcttc attt~tata aaat~gt~t~ ttcatgtaaa
3501 tssatacatt cttg~gag c
,
':
':
~VO 9~/06187 PCr/~'S91/0672,
-31-
Ch~r~ 5 20~2823
.
1 ~LP~L~LLLL ~A~TARALEY PTDGN~GLLA EPQIAMFCGR LN~H~NVQNG
~1 KWDSDPSGTK TCIDTKEGIL qYCQEVYPEL 4ITNVVEANQ PVTIQNWCKR ~ ~
lBl GRKQCKTHPH FVIPYRCLVG EFVSDALLVP DKCKFLHQER MDVCETHLHW .
1~1 HTYAKETCSE ~STNLHDYG~ LLPCGIDKFR GVEFVCCPLA EESDNVDSAD :~:
2~1 AFEDDSDVWW GGADTDYADG SEDKVVEYAE EEEYAEVEEE EADDDEDDED -`~-:
2~1 GDEVEEEAEE PYEEATERTT SI~TTTTTTT ESVEEYYREV CSEQAETGPC --~
301 RAMISRWYFD VTEGKCAPFF YGGCCGNRNN FDTEEYCMAV CCSAMSQSLL .:
361 KTTQEPLARD PVKLPTTAAS TPDAYDKYLE TPGDENHAH FQKAKERLEA
4~1 KHRER~SQV~ RE~EEAERQ~ KNLPKADKKA VIQHFQEKVE SLEQEAANER :`-
461 QQLVETH~AR VEA~LNDRRR LALENYITAL QAVPPRPRHV FNMLKKYVRA
501 EQKDRQHTLK HFEHVR~VDP KK~AQIRSQY MTHLRVIYER ~NQSLSLLYN
661 VPAVAEEIQD EVDELLQKEQ NYSDDVLANM ISEPRISYGN DALMPSLTET
6~1 KTTVELLPV~ GEFSLDDLQP WHSFGADSYP ANTENEVEPV DARP~ADRGL
B61 TTRPGSCLTN IKTEEISEVK ~DAEFRHDSG YLYHHQKLYF FAEDVGSNKG
701 AIIGL~VGGV VIATYIVITL V~LKKKqYTS IHHGVYEVDA AVTPEERHLS
761 KMQQNGYENP TYKFFEQ~QN ~
, , : . . . .' ,. .. ' ' ' ' ,.' ' :'.,'. ':"''. .. ' ' ' , ,' ,' ' ,: - ' .'' ' ' ,, '.' ~ ': , ,
WO 92/061g7 PCT/US91/0672,
2~9'~ ~3 32- ~
Chart6
1 D8tttCctC8 gc~8cggt~9 gcg~ c~c 8C8~89~9C gtgc~cgggg
61 ccccggg-g- cggc~qc~t ggc~c~cg~ ~c~g~gc~g ~cgcg~c~g
101 atcccactcg cac~gca8cg c~ctc3gt~c ccc,qc~cag~ ~tcgc~tgc
1~1 tgcccggttt ~gc~ctgctc ct~c~g~ccg cct~3~cg~ tc~ggcgct~
2~1 Qaggtaccca ctg~t~t9a t~ctg~cctg Gt99Ct~C CCCagatt8c
251 c-tgttctgt ~gcsgsct~a ~c~tgcacst ~aat0tccag ~stgggaagt
3~1 gq~ttcaga tccatcaggs acczaaacct gcattgat~c caaggaaggc
~61 ~tcct9c-9t tt~cc~ag~ 9tct~ccct ~ctgc-~- tC~CCJAtgt
4~1 ggta~aagcc aaccaaccag tgacc~tcca gaactggt~c aa~c~gggcc
451 gcasgcagt0 caagacccat cccc~ctttg t0attcccta ccgctgctta
~1 gttggtgPgt ttgt~agtga t~cccttctc gttcctg~ca a~tgc~satt
6~1 cttacaccag 0agaggat~g atgttt~cga aactcatctt cact~gc3ca
~1 ccgtcgccs- agagacat~c agtga~aaga ~taccabctt gcatgactac
B~l ggcatgttgc tgccctgcgg aattBacaa~ ttccgag~gg tagagttt~t
7~1 ~t~ttgccc- ctggctg~ J~tg~C~ t~tggattçt gct~tgcgg
761 aggag~at~ ctcggat~tc t~tQ~8~C~ g~cagac~c ~ctat~c~
801 gat~g~a~tg aagacaa~gt ~S~ta~saSIt~ ~ca~a~ g sag~gt~gc
851 tghg~t~gaa gsagaagaag ccgdtg2tga c~a~sc~at gag~atggt~
9~1 atgag~ta~s ggaagag~ct gaggaaccct acgaa~aa~c cacaga~ag~
~61 ~ccacca~c~ ttgccaccac c~ccacc~cc accaca0agt ctatg~ag~
1~01 ggt3gttc~ ga~g~gt~ct ctga~c~agc c~acgg~ ccgtgccg~
1~1 caat~atctc cc~ctggtac ttt~atgt~a ct~a~g~ga- ~t~tgcccca
11~1 ttctttt~c~ ~c99atgt9~ c~c~acc~ aacaacttt~ acacagaaga
1151 g~act~catg gccgtgt~tg ~ca~c~ccat ~tcccaaa~ ttactcaag~
1201 ctacccag~a acctcttgcc c~3~n~cct~ tta~acttcc tacaaca~c~
1251 9CC89t~CCC ct~tgcc~ ~s~ca~ t cte~g~c~c ctg~gg~t~3
13~1 ~aat~aacat ~cccatttcc agaaagccaa agsga~gctt g~ccaa~c
1361 acc~a~a~a~ aatstccca~ ~tcatgagag aatg~gaag~ ~cagaac~t
RcT m ITC cuc~r
W092/06187 PCT/US91/0~727
-33-
Chclrt 6 (C~nt~d) 2 ~ ~ 2 8 2 3
~ C--9C~ Ctt9CCta~ ~9Ct9~t-D9 ~g~e-gtt- teeagcattt
1451 ccagg-a~a~ ~tg~aa~ctt t~ ca~ a~c~gcc~Dc g-~s~c~ae
1601 ~c~q~t~ ac-c-c~t0 gCC-9~9t8~ cc~t~ct c--t~cc~c
1551 c9Cc~cct~8 ecet~ ct~c~tc~c getetge~ etgtteetee
1~1 teggeete~t c~e~t~ttc~ at~t8ct~a~ ga~tDtgte c~e~e~ e
1861 2g~a~-C~ ~c~c~c~cc ct~ c~tt te~c~t~t gc~c~tg~t~
1701 Satecc~ a~cc~ctca 8atCc8gtcc ca~tt~t~ c~c~cctcc~
1751 t~t~-ttt~t g~8C8C~t88 ~tca8tctct ctccct~ctc t~caac~tge
1801 ctge3~tg~e cg~ga~g~tt ca~gat~a~ ttgat~agct ~cttc~aa6
1861 ~a~ca~a~et attca~at0~ estcttg~ee a~catgatt~ ~tgaarcs~y
1901 gatc~tt~c g~a~ac~t~ ctctcat~cc tctttgacc ~ c~
1961 ccaccgtg~a ~ctccttccc ~t~s~t8~ ttc-gcct g~acg~tcte
2~01 cagcc~tg~c attcttttg~ ~gctg~ctct gt3cca~cc~ ac~cagaa~a
2051 c~aagtt~ag cetgttgat~ ccc~ccct~c tgccg~ccg~ ctgacc~
2101 ctc~-cc~g~ ttctgg~tt~ e-~at-te~ cg~ga gatctctg-
~2151 ~tga-~at~ at~ca~tt cc~c~t~ac tcagg-t-t~ -gttcatc-
22~S ~c~ tt~ g~ttc~tg c~g2-~ka~ ag~ttc-~c a-Ag~t~c~
2261 tcattg~act catg~t~g~e ~t~ttgte~ ta~cg~cs~t gatc~tc~te
23~1 acctt~gt~a tgct~aa~a ~acagt~ sc~tc~ttc atcDtg~t~t
2361 ~gtg~a~gtt g~c~ccget~ tcaccce~ g~aac~c~-c ct~tccaa~a
24~1 tgcagcagaa c~gctacgaa aatccaacct acaagttctt tgagcagat~
24~1 C3~4~Ct-9- CCCCC~CC~C 3gc~gcctct ~aagttggac ~gc~acc~
2601 tt~cttcaet ~ceeatcg~t gteeatttat a~aataatgt ggga~aaae
2661 a-aeee~ttt t0t~attt~e teatt~tege ettttgaea~ etgtgetgta
2~01 ~e~e~gta~ ~tgeetg3ae tt~3attast ceacaçatea Bt~at~tatt
2~51 etate~etet ttaeatttt~ ~tetetatDe taeat~att~ at~tttt~
2701 t~taet~taa a~a3ttt-~e t~tateaa~e tagt~eat~a ata~attcte
2761 tect~attat ttateaeata ~eeeetta~e eagtt~tat~ ttattettgt
28~1 g~tttgt9~e CC~tD - 9~ ec~e~t~e ~-tgct~t- ~9~-te9-t~
2861 ~ at~ett eatgt~aaey t~ga~ttea ~et~ettete ttgeetaagt
~.... .
WO92t0618/ PCT/US91/0672
3~ ~
2 9 9 ~ ~ ~ 3 Ch~lrt6(C~nt'd)
29~1 ~t~cctttcc t9atc~ct-t 8c~tttt~ att~J~c~tt ttt~gt~tt
2961 tc~t~ctt ta~a~a8Jtt ttttttcc~t ~act~c~ttt t~ctgtacag
3a~1 attgctgctt ctgct~t~tt t~t9~t~tD~ ~a~tta2gag gst~cacscg
3~61 tttgtttctt c~tgcctgtt tt-tgt~c-c ~cattaggc~ ttg~acttc
31~1 aagcttttct ttttttgtcc ac~t~tcttt sggtctttga t~aagsaa39
3151 aatccctgtt c~tt8t~8c ~cttttacgg ggc~ggtggg ~aggggtgct
3201 ct~ctggtct tcaatt~cc- agaattctcc ~a2~caattt tctgcag~at
3251 ~attgt-c-~ aatcattgct tat~acatga tcgctttcta cactgtatta
3301 c~taaatsaa ttaaataa~a tsaccccgg~ caagactttt ctttgaag~a
3351 tgact-caga cattaaataa tcgaagtaat tttgggt~gg ~agsagaggc
34~1 agattCaDtt ttctttaacc astctgaast ttcatttat~ stacaaaa~a
34bl agat8aaaat ggaRgt~gc~ Dt-taaggg~ atgag~aagg cstgcctgga
35~1 c~a~cccttc tttta~atg tgtcttca-t tt8tataaaa tggtgttttc
3561 ~tgtaa-t~a tacattctt ggagga~c
WO 9~/06187 PCI/IJS91/067~-
: -35- 2 `~ 9 2 8 2 3 ~
Char~ 7 :
pBGH- l O
Asp718 NarI PvuII Asp718 .:.
* I , I I .. * ~ ~:
¦mMtI promoter¦ bGH
' ''~' ' '
- 15
pSADE-lB . .
EcoRl MaeI EcoRl :~
1 ' ~ 1 :; '
* , ~ *
AAP 6 9 5
'-':',.
- 25 :
pNAN
Asp718 AvaI EcoRI ClaI Asp718
*
ImMtI promoter¦bGH5 ' ~AAP695 (Adaptors), AAP695 (pSADE) ~ bGH3'
~ :.
:
.:,
.. . .
,
W O 92/06187 PCT/~tS91/067'/
2092823 -36~ "
~h~ :,.,
pRG8
Xhol PvuII BglII StyI PstI PvuII PstI PstI ~col A~p718 BamHI ~
~ 2 1 #3 1 #4 1 #5 1 ..
~~~~----rGH~
pStep-PPP
Ec~Rl PstI PvuII PstI
* ~ *
, #3 1 :~
pStep-1-5'
EcoRl PstI HpaI EcoRl ~ :~
~ *
1 5~#3 1 . ~ .
.,:
~.
pStepl-3'
EcoRl HpaI PstI
, ,:
* ~ *
t . . __ .. ~ ,
1 3' #3
pStep-P~P
EcoRl PstI HpaIPstI
* I ! ! ! *
~ #3 t
._ .. ~ . . . ~ . - - .. ~ .il IR~Tm IT~ QUE~T 1 .
" , . . ..
- . ., . . . .- . . ..
W092/061~, PCT/~;S91/067~-
` -37~ 292~23 ~
~hart 9
pStep2
Xhol NcoI PvuII
: 1 #l ~ :
:
, .
pStep3
Xhol PvuII BglII Styl Pstl ~ ::
15* I ! ! 1 ' * --
: ~ ~2 ' ::~
., ~.
;. . ., -,
pStep4
Pstl Pstl ,~:~
* ~ I * ; :.
1 ~4
: 25
pStep5
: Pstl BamHl
: ~:: 30
* ~ ~ *
.
'
':.'.',.
'",'~
, . .
.,. ,. ~:
.: ':
', - '~:
.
. .
... , ~ : . .. . .. .... ~ . . : j ~l lR~rm lT~ ~ur~T . .
WO92/061~/ PCT/~'S91/067~-
38~
? ~ ~ Chart 1 o
~ J ~
pStep23
. S Xhol Ncol PvuII BglII Styl Pstl
* 1 L ' I I I *
` - I #1 ' ~2(frag)
' " '
pStep23BP
BglII Styl PstI ;~
* ~ ! . *
' #2(frag 2)
pStep23XB
Xhol Ncol PvuII BglII
- - , ., , .1 ._ *
#2(frag 1)
pStep23BP-l -
BglII Styl Pstl Asp718 HpaI Pstl
-1 1 1 1
#2(~rag 2) ' #3 ~ _*
, :
~1 40 pStep23BP-la
BglII Asp718 HpaI Pstl
*_ I _ - , I *
I #2(frag 2)/3
: .
WO92/06187 PCT/US91/0672,
:``~ 39 ~g282~ `
Chart ll :.
, ,:
pStep45 `
Pstl Pstl BamHI :-
* _ l _ _ _ J _ * ~` I #4 1 #5
~ ~ ~
. :~
pStep23BP-lQ45 :~
BglII Asp718 HpaI Pstl Pstl BamHI
20* -- ~ -*
I #2(frag 2)/3 1 #4 1 #5
',~
:
30 pStep231~\45
Xho NcoI PvuII 8glII Asp7}8 HpaI PstI PstI B mHI .--
:: ~ ! ! '. ' ' ! ! ! ~ :
1 ~ #2/3 , #4 1 #5
', ',
. ':
'' ~'.,
.
'`
~ .
' .
-el lQ~Tm ~
WO 92/061~7 PCT/I_'S91/0672~
2092823 ~o
Chart 1 2
.
pXG4 5
EcoRI Asp718 SacI
, .
* I I I * ~ .
mMtl I -~
::
1 5
pSP7 3mMtI
EcoRI Asp718 .SmaI
* I ! '.*
mMtI
~:`
pmMtI~k
EcoRI SmaI
* I I *
1 mMtI
pSM
Eco~I Xhol NcoI PvuII BgIII Asp718 HpaI PstI PstI BamHI
j mMtI ~ rGH
'
