Note: Descriptions are shown in the official language in which they were submitted.
2~93~
HOECHST AKTIENGESELLSCHAFT HOE 92/F oss Dr.BO /wo
The complete gene (cefG) encoding the acetyl-CoA: deacetylcephalosporin C
acetyltransferase of Cephalosporium acremonium, its isolation and use.
The gene tcefG) encoding the acetyl-CoA: deacetylcephalosporin C
acetyltransferase (DAC-ATF) of Cephalosporium acremonium (syn. Acremonium
chrysogenum) C10 has been isolated. It contains two introns and encodes a
protein of 444 amino acids with a molecular weight of 49269 that correlates wellwith the molecular weight deduced by gel filtration (Mol. weight 52 000 + 1 000).
The cefG gene is linked to the cefEF gene (encoding the bifunctional
deacetoxycephalosporin C synthase/hydroxylase) but it is expressed in the
opposite orientation to the cefEF gene~ The isolated cefG complements the
deficiency of deacetylcephalosporin acetyltransferase e.g. in the non-producer
mutant C. acremonium ATCC 20371 and restores cephalosporin biosynthesis in
this strain. The cefG is therefore useful to improve cephalosporin C production.
The last step of the cephalosporin biosynthetic pathway involves the conversion of
deacetyl cephalosporin (DAC) to cephalosporin C by the enzyme DAC-ATF (Fig. I).
Until recently this enzyme was poorly known and has not been fully purified. TheEuropean published patent application EP-A1-0,450,758 claims isolation of the gene
encoding DAC-ATF. According to this European application DAC-ATF consists of
two subunits with a molecular weight of 27 000 + 2 000 dalton ~subunit) and
14 000 + 2 000 dalton (subunit 2) as measured by SDS polyacrylamide gel
electrophoresis. The probes used for screening of the DAC-ATF cDNA were taken
from the N-terminal portion of each subunit 1 and 2 which were determined to be
(subunit 1) Leu-X-Ala-Gln-Asp-lle-Ser-Leu-Phe-Thr-Leu-Glu-Ser-Gly-Val-lle-Leu-
Arg-...
(subunit 2) Asp-Ser-Gly-Asn-Ser-His-Arg-Ala-Gly-Gln-Pro-lle-Glu-Ala-Val-Ser-Ser-Tyr-Leu-Arg-Tyr-Gln-Ala-Gln-Lys-Phe-Ala-. . .
2~93~
X stands of a then unidentified amino acid and proved to be Asp. The DAC-ATF
encoding gene isolated with these probes was thought to code for a protein
molecule having 387 amino acids. A sligh~ly larger molecule starting wiSh Met-Ser-
Pro-Gln-lle-Ala-Asn-Arg-Phe-Glu-Ala-Ser held to be a pre-sequence before the Leu-
Asp-Ala-Gly-Asp... start determined for the amino-terminal portion of subunit, was
also described. Hence a DNA encoding the protein above or a slightly larger DNA
was used to construct plasmids suitable for introducing the allegedly complete
DAC-ATF gene into Cephalosporiurn strains.
Surprisingly it was found that the complete cefG gene encodes a protein of 444
amino acids with a deduced molecular weight of 49269 daltons. The nucleotide
sequence of this region shows an open reading frame (ORF) of 1332 basepairs
(bp) with a GC content of 56.8 % corresponding to a 1.4 kb transcript. The
nucleotide sequence of the complete cefG gene including the intergenic region with
the cefEF gene (see examples) and the 5' region of the cefEF gene is shown in
Table 1.
The cefG contains two introns. Computer analysis of the cefG nucleotide sequencerevealed the presence of two putative introns which showed very good homology
to the intron/exon junction sequences and internal c onsensus sequences involvedin the formation of the lariat intermediate in the splicing reaction of the introns. To
confirm the presence of the introns three oligonucleotides L, M, N (see below) were
used to hybridize with total RNA of G. acremonium. Probes L and M correspond to
sequences internal to the putative introns 1 and 2, respectively, whereas probe N
corresponds to a translated region (nucleotides 2016 to 2035 in Table 1).
~Iybridization results showed that probes L and M do not hybrizide with total RNA
of C. acremon!um whereas probe N gives a clear hybridization signal. These results
confirmed She presence of two introns that separate three exons extending from
amino acids 1 to 187, 188 to 302 and 303 to 444.
~3~
Intron A of the C. acremonium cefG gene corresponds to a region that is missing in
the DNA of S. cerevisiae met2 gene. Intron B corresponds to a region with lit~leconservation in the met~ genes of either A. immersus or S. cerevisiae.
The 3'-noncoding region contains a classical MTAAA polyadenylation sequence
(nucleotide positions 2845-2852 in Table 1. Analysis of the 5' region upstream from
ATG start codon Table 1 reveals a sequence ~TACTAT, nucleotide positions
A T
1001 - 1006) related to the consensus "TATA" box ~TAT A ). No consensus
T A
"CMT" box (GGPyCMTCT) is observed. These sequences are used for
transcription initiation in higher organisms but are not always present in promoters
of filamentous fungi. A pyrimidine rich (66 %) stretch (nucleotides 865 - 895) which
seems to be characteristic of fungal promoters is present in the upstream region of
the cef(; gene.
Expression of the cefG gene in C. acremonium was accomplished via
complementation of a C. acremonium mutant deficient in DAC-acetyltransferase.
The cefG gene in the 7.2 kb BamHI fragment was subcloned in the fungal vector
pULJL~3 digested with BamHI and dephosphorylated. This construction was used
to transform C. acremonium ATCC20371, a cephalosporin-deficient mutant (Table
2) that accumulates DAC (Table 3) and is defieient in the DAC-acetyltransferase.The levels of cephalosporin C and DAC were measured in the untransformed
culture and in three transformants, C. acremonium 371.1, 371.2 and 371.3, and a
control clone C. acremonium 371P43 (transformed with the control vector pULJL43
without insert).
The results (Tables 2 and 3) show that by introduction of the complete cefG geneproduction of cephalosporin C takes place.
2~9~
The present invention concerns therefore the complete cefG gene and its use for
the improvernent production of cephalosporin C since large amounts of DAC are
know to remain unconverted to cephalosporin C in industrial cephalosporin-
producing strains.
Northern analysis with probes corresponding to the genes cefEF and cefG indicatethat, in 48 h cells, the relative intensity of hybridization is much smaller for the DAC-
acetyltransferase than for the expandase/hydroxylase transcript. Since the probes
were homologous in both cases and the same RNA preparation was used, these
results indicate that the cefG gene (encoding a late enzyme of the cephalosporinpathway) is still poorly expressed at 48 h of incubation. This late expression
correlates well with the late conversion of DAC to cephalosporin in cephalosporin
fermentations. The same difference in expression of the cefEF and cefG genes wasobserved in the low-producer strain GW19 and in the high cephalosporin producer
C. acremonium C10. Since both, the cefEF and cefG are expressed divergently
from the same promoter region, a differential mechanism of control of these lategenes of the pathway must occur.
The isolated complete cefG gene thus permits optimization of cefG expression by e.
g. transformation with plamids expressing this gene so as to increase conversion of
DAC to cephalosporin C.
The instant invention is further described in the examples and claims.
3 ~
Examples:
1. Isolation of the complete cefG gene
C. acremonium (G10, which is a high producer of cephalosporin C (Ramos, F.
R. et al., FEMS Microbiol. Lett. 35, p. 123 - 127 (1986)) was used as the sourceof DNA. A gene library of C. acremonium C10 was constructed in the ble-
EMBL3 vector as described before (Gutiérrez et al., J. Bacteriol. 173, p. 2354 -2365 (1991)). Screening oF phages for the cefEF gene was done with a 30-mer
oligonucleotide 5'-GGCMGTACTCGGACTACTCGACGTGCTAC-3' (probe K)
that was synthesized according to the nucleotide sequence of the cefEF gene
of C. acremonium (nucleotide positions 274 to 3D3; Samson et al.,
Bio/Technology 5, p. 1207 - 1214 (19~7)). Three other probes L
(5'GGATCGGTGCGCTTACC-3'), M (5'-TGAGCATCGACCGACGGCM-3') and N
(5'-TACTCCCCGTCCAGGTACl~-3') were used to confirm the presence of two
different introns in the cefG gene.
The oligonucleotides were labelled at their 5'-ends with polynucleotide kinase as
described previously (Diéz et al., J. Biol. Chem. 265, p. 16358 - 16365 (1990)).Southern hybridizations were carried out by standard procedures using a
prehybridization buffer containing 6 x SSC, 2 x l)enhardt's solution with 0.25 %SDS.
Fragments of the gene subcloned into Bluescript~ KS(+) vector were
sequenced by generating ordered sets of deletions using the erase-a-base
system (Promega, Madison, W13 by digestion with exonuclease lll (S. Henitzoff,
Gene 28, p. 351 - 359 (1984)). Sequencing of the ordered sets of fragments
was carried by the dideoxynucleotide method using either Sequenase~ (U. S.
Biochemicals, Cleveland, Oh) or Taq polymerase (Prome~a, Madison, Wl) as
describ2d previously (Montenegro et al., Mol. Gen. Genet. 221, p. 322 - 330
(1 990)).
$
The results are summarized in Fig. 2 and Table 1. The complete cefG gene
could be located in a DNA region flanking the ce~EF gene. Clones carrying the
expandaselhydrolase (~fEF) gene were selected by hybridization with the 30
mer probe K (see above). Two clearly hybridizing phages F31 and F39 were
selected and purified. Both phages showed overlapping DNA inserts with a
common Sall band of 2.7 kb. A 7.2 kb BamHi fragment of phage F31 that
hybridized with probe K was subcloned in Bluescrip~ and mapped (Fig. 2). A
fragment around the Sstll si~e (300 bp) was sequenced confirming that the
cloned fragment included the expandase/hydrolase gene. In Fig. 2 the arrows
show ~he position and length of tha respective cefEF and cefG genes, which
are expressed in opposite orientations. The boxed area in the 7.2 kb BarnHI
fragment was sequenced. A 4.8 kb fragment A was subcloned with filled ends
in both orientations to give pBXR4.8A and pBXR4.8B. Table 1 shows the
nucleotide and deduced amino acid sequence of a 3.11 kb DNA region that
includes the complete cefG gene and the upstream and downstream intergenic
sequences. The ATG translation initiation triplet of the cefEF and cefG genes
are boxed. The polyadenylation sequence MATAM downstream from the cefG
gene and the intron consensus sequences are unclerlined. A pyrimidine stretch
in the promoter region and a TATA box-like sequence are overlined. Note that
the cefEF gene is expressed in the opposite orientation from the
complementary strand.
2 Expression of the complete cefG gene in a C acremonium mutant deficient in
DAC-ATF
The cefG gene in the 7.2 kb BamHI fragment was subcloned in the fungalvector pULJL43 digested with BamHI and dephosphorylated. This construction
was used to transform C. acremonium ATCC20371, a cephalosporin-deficient
mutant (Table 2) that accumulates DAC (Table 3) and is deficient in the DAC-
acetyltransferase (Fig. 3). The levels of cephalosporin C and DAC were
measured in the untransformed culture and in three transformants, C.
2~3 ~
acremonium 371.1, 371.2 and 371.3, and a control clone C. acremonium
371P43 (transformed with the control vector pUWL4~ without insert).
Results (Tables 2 and 3) indicate that C. acremonium 20371 does not produce
significative amounts of cephalosporin C either untransformed or when
transformed with the control plasmid pULJL43, bu~ instead it accumulated
considerable amounts of DAC. Transformants 371.2 and 371.3 (complemented
with the cefG gene) regained the ability to synthesize cephalosporin C and
instead they did not accumulate any detectable levels of DAC. Transformant
strain 371.1 formed cephalosporin C but still retained considerable amounts of
DAC suggesting that it may have low expression of ~he acetyltransferase gene
(see page 4 and the results of northern blots).
The non-producer mutant ATCC20371 showed a residual DAC-acetyltransferase
activity (with or without transformation with the pULJL43 plasmid vector) after
96 h of culture whereas the three transformed clones showed up to ~0 to 15-
fold higher levels of activity (Fig. 3). A good correlation was observed betweenthe conversion of DAC to cephalosporin C as deduced from comparison of
Tables 2 and 3, and the DAC-acetyltransferase activity in the different
transformants; transformant 371.3 showed lower levels of acetyltransferase than
the other transformants.
Quantification of cephalosporin C and deacetyl-cephalosporin C was performed
as follows:
Cultures of the different strains and transformants of C. acremonium were
grown for production of cephalosprin C or DAC in defined production medium
as described previously (D. H.Zanca and J. F. Mart~n, J. Antibiot. 36, p. 700 -
708 (1983)). One ml of the culture broths was taken every 24 h and filtered
through Millipore 10 000 NMWL to remove molecules of molecular weight
above 10 000 dalton. Aliquots (50 ~I) of the filtered broth were used for
cephalosporin analysis in a Beckman System Gold HPLC equipped with a
2 ~
~Bondapack~ C18 column (300 x 4 mm). DAC and cephalosporin C were
eluted with a mixture of solvents A) 10 mM acetic acid-sodium acetate, pH 4.7
and B) acetonitrile (100 %) usin~ a ~radient of solvent B as follows:
time û ~5 min ~10 min ~20 min ~ 25 min
%solventB 0%~% ~5% ~5% ~0%
with a constant flow of 1.3 rnl/min. Under these conditions DAC eluted with a
retention time of 3.4 min and cephalosporin C at 12.8 min. Both compounds
were identified by co-elution in the HPLC with authentic samples of
cephalosporin C and DAC (provided by F. Salto, Antibioticos, S. A., Leon,
Spain).
The DAC-acetyltransferase activity was assayed in a reaction mi~ture containing
50 JJI acetyl-CoA 5 rnM (Sigma Chem. Co., St. Louis, Mo), 50 ~I DAC 5 mM [or
deacetyl-7-amino cephalosporanic acid (deacetyl-7-ACA)], 25 ~I MgSO4 50 mM,
and cell-free extract (100 g of protein) in 150 /ul of 50 mM potassium
phosphate buffer ph 7Ø The enzyme is able to convert the substrate analog
deacetyl-7-ACA to the acetylated derivative 7-ACA.
The mixture was incubated for 1 h at 37 C and the reaction was stopped by
quick cooling in ice and filtering the iced reaction mixtur~ through Millipore
10 000 NMWL filters. Fifty ~11 of the reaction mixture were injected in HPLC andthe cephalosporin C (or 7-ACA) were eluted using the followirlg program:
time 0 ~ 2 min ~10 min ~15 min ~ 20 min ~ 25 min
%solventB 0%~3% ~3% ~7% ~7% ~0%
7-ACA eluted with a retention time of 7.1 min whereas the deacetylated
substrate deacetyl-7-ACA showed a retention time of 2.5 min..
2~3~
3. Expression of the cefG gene in P. chrysogenum
Heterologous expression of the cefG gene was observed in P. chrysogenum
npe6. This is a mutant blocked in penicillin biosynthesis because it lacks
isopenicillin N acyltransferase. No DAC-acetyltransFerase was observed in this
strain whereas transformants npe6.T1 and npe6.T2 showed respectively 1.35
and 7.4 nkatals of DAC-acetyltransferase/mg of protein (Fig. 4). These two
transformants failed to synthesize cephalosporin although they carried genes
encoding both, the expandase/hydroxylase and the DAC-acetyltransferase. This
is an indication that the isopenicillin epimerase gene (missing to complete the
cephalosporin pathway) is not located on the 7.2 kb BamHI fragment used to
transform P. chrysogenum or at least it is not functional. Furthermore, they didnot produce penicillin what indicated that DAC-acetyltransferase can not replacethe isopenicillin N acyltransferase to synthesize penicillins.
1n2~93~9$
",'ABLE 1
l g r r a n r d a l t v a r k e e e s g n k f f d V C t e r a s t
TTcGGcGccGcccGcAATGccAGccGcTcGcAGTGccGGGAGAAGAGGAGGAGcGAAGGcAAGAAcTTTTTcAGTTGcGTGcAGAGTGcGcGGcTccAcA 100
h d d d v l g s e t l y f i g k t t v a e a l e t l v k g s k l d d
CCAGCAGCAGCTGGTCCGGCGAGAGCCAGTTCATCTTCTATGGGAACCACCACTGCSGGAGCCGCTCGAGCCACTCCTGGAACGGCGAGAACTCCAGCAG 200
r f v p v k s t m
CTCTGCTTTCTGCCCCTGGAACCTTCA ~
GTTGATGCTGTGGTTTTGAGCGATGACTTGAGAGGAGTACCCTCCACCAAACTTCTGCAACAGGAATTTA 300
ACGATTCACAAGATCCCAGTGAGAACGAAACCTTCTCAAACCCCTATATATATATCTCAAACCCCACCTCCTAGCTTACGCCCACCAACTCCTTTTTAGA 400
CAACTGCTACTTAGCCGTAAGTGACGCCCTGCTTCCCCTCAGCCTTCCCCGCACACCTCAATCTACCATTGTAAACCCACGAGTGTCTTGTGAAGTTTTG 500
TCAACCAATCATAACAACCCATCGAGTTCTCTTCTCGTTCTTCCTTCGCAGGACAATATCTATCCTGCATGCTCCCTGATCGTCGAGACCGCCATGGAAT 600
CGTGcAAGccTTAATTcrccGTAcAAGcTTccccATTcGGAcAAGATTGcGATGATGTGGATGcGGccTcTTTTAATAAGGAccTTcTTAAccGATGGTc 700
CGAGACTCCCTACCACCGGTCCATGTCCATACACCACCCACCCTCCACCTCCTATTACCAGCATCAGGCACCACAAAATGCGAACCACCATCCATCAAAA aoo
TCCACTCCAACGTCGAGTTGTGGGCTACTCGCCTTCTGATTCGCAAGCCCTCGGCGAGTCCACCTACTAGTAGCTTGGGAATAAACAGCAAGTTTCGCCG 900
CCAAAAGGGCTGCCCGGCATCCGATTCGATGCCATTGTACATCAAGTCGGAAATGGTGCTCCGTTTCCCCCTGGGGTGAGAGGGCGAAGGAGTAGTTCGA 1000
CcAGTcGcAGccGcAcccAGAGccGcAGGTTTTATcGGATGTTGcTTcGATccGATcGTATcccGcGcGGccTAGATcTTGcTAATAcGAcTcGGAcAGT 1100
TACTATTCCCCCCTTATGCCGACCCGCCGCCGCCCTCCATCCCCGCCAAGGCTTGTCCTCCATGATA ~ CTGCCGTCGGCCCAAGTGGCCCGTCTAAA 1200
--;--p S D q V a r l k
GCCGGACCCCTTTCCCCCGAGTCTCTCCCCGA~CCCGCACGGGGCCGTCACTTTCGCTGCCCTCCCTCCTTGTCATAACCTACCTATATTCTCATCCCGG 1300
p d p f p p s l s p i p h g a v t f e a l a p c h n ~ p i f s s r
CAAATGCTGCGGGATAGCCTCACCTACAGCCACACGTCGCCCACCATGTCGCCTCAGATCGCCAATCGCTTCGAGGCTTCGCTAGATCCCCAACACATAC 1400
q m l r d s l t y s h t s p t m s p q i a n r f e ~ s, l d 1~ q d i a
CCACAATATCGCTCTTCACACTGGAATCTCGCCTCATCCTTCGCGATGTACCCGTGGCATACAAATCGTGGGGTCGCATGAATGTCTCAAGGGATAACTG 1500
r i s l f t l e s g v i l r d v p v a y k s Y g r m n v s r d n c
CGTCATCGTCTGCCACACCTTGACGAGCAGCGCCCATGTCACCTCGTGGTGGccCACAcTGTTrGGccAAccCAGGGCTTTCGATACCTCTCGcTACTTc 1600
v i v c h t l t s s a h v t s Y ~ p t l f g q g r o f d t s r y f
ATcATcTcccTAAATTATcTcGGGAGccccTTTccGAGTGcTGGAccATGTTcAccGGAccccGATGcAGAAGGccAccGcccGTlcGGGGccAAGTTTc 1700
c l n y l g s p f g s a g p c s p d p d a e g q r p y g a k f p
CTcGcAcGAcGATTcGAGATGATGTTcGGTAGGTAAGcGcAccGATccAGcTTcTcTcAATArccAcTccTcAGGAcAATccAGGcTAAGcTTTccGTGT 1800
r t t i r d d v r
CCAAAAGTATTCATCGCCAGGTGCTCGACAGGTTAGGCGTCAGGCAAATTGCTGCCGTAGTCGGCGCATCCATGGGTGGAATGCACACTCTGGAATGGGC 1900
h r q v l d r l g v r q i ~ o v v g o s m 9 9 m h t l e Y a
CTTcTTTccTccccAcTAccTccGAAAGATTGTGcccATcGcGAcATcATGcccTcAcAcccccTGGTGcGcAGcTTcGTTccAcAcAcAcAGccAGTGc 2000
f f g p e y v r k i v p i a t s c r q s g Y c a B I f e t q r q c
ATCTArCATGACCCCAACTACCTGGACGGCCACTACGACCTACACGACCACCCTCTCCGCGGCCTCGAAACAGCGCGCAAGATTCCGAATCTCACCTACA 2100
i y d d p k y l d g e r d v d d q p v r g l e t a r k i a n l t y k
AGAccAAAccTcccATcGAcGAGcGcTTccATATGccTccAccAcTccAAGccccTcAGTTTATAGATGccTTGcccTcGcTccAtccTcAcAGcTAATc 2200
s k p a m d e r f h m ~ p g v q R
AGACCGAACCCCCTCCTACCCCGGAATATCAGCAGCCACGATCCCAACAAGGAAATCAACGCCACAGACAGCGGCAACAGCCACCCTCCTCGCCACCCCA 2300
g r n i s s q d e k k e i n g t d s g n s h r a g q p i
TTGAAGccGTATcTTccTATcTccGcTAccAGGcccAGAAGTTTGccGcGAGcTTcGAcGccAAcTGcTAcATccccATGAcAcTcAAGTTccAcAcccA 2400
e s v s s y l r y q c q k f s o s f d a n c y i s ~ t l It f d t h
CGACATCAGCAGAGGCCGGGCAGCATCAATCCCGGACGCTCTGGCAATGATTACACAACCAGCCTTGATCATTTGCGCCAGGTCAGACGGTCTGTACTCG 2500
d i s r g r a g s i p e a l a m i t q p o l i i c 1I r s d g l y s
TTTGACGAGCACGTTGAGATGGGCCCCACTATCCCAAACACTCGTCTTTGCCTGCTCGACACGAATCACGGTCATGACTTCTTTCTAATCCAAGCGGACA 2600
f d e h v e m g r s i p n s r l c v v d t n e ~ h d f f v m e o d k
AGGTTAATGATGccGTcAGAGGATTccTcGATcAGTcATTAATGTGAGGcTATGGAGGTGTcAGccTGccGGTGcGcGTAcTTGccAGGGTGATcGATGT 2700
v n d o v r g f l d q s l m .
ACTCTCAGATAGTCTCCATGTGAGTATGGATTTCGCTCTTTCCCCTCCGATATACCCACTCTCACCCCATCTCGCAGTACGTATCAGAACACCAGCTCAG 2800
GCCTTCTCGTAAAGTAGGTTG7GTCAATAGATTCATAAAGCGTCAAATAAAGCCCAAAGTCCCAGTAGACTCATCCCATCGCAAGTCTCACAGGGTCGAC 2900
TCGGCAGATTCGAGGCATTCTACCACATTGTCCAGGCATTGAGGCGCAGACTTCACCCATCCAACTCGGCCAGAGGAGCCAGGCAAACCATCTCACCCTA 3000
GGCTCCATCCAAACATCCCTCGCTCAACTCACCAAGCTCATTGCCAACGAGGTGAAAGAAAATAGAACCTACCGCAGGCAGGCCCGTATCCTACTAACAC 3100
CGTCCAATAA 3110
2~3~8
Table 2
Complementation of the deficiency of cephalosporin C
biosynthesis of mutant G. ~oremonium M20371 wrth
~he cefG gene in several transformants
Cephalosporin C: (~Lg/ml) a~
_ .. A
Strains Oh ~4 h 48h 72h 96h
C. auemonium M20371 O O O O 2.7
C. acremonium 371.p43 O O O 9.7 15.4
C. acremonium 371.1 O O 11.5 4.3 111.3
C. acremonium 371.2 O O 17.8 47.3 124.4
C. acremonium 371.3 0 0 66.0 13.3 64.3
12 ~ 9 ~3
Table 3
Accumulation of deacetylcephalosporin G by C. acremonium
M20371 and different clones transformed with the cefG gene
-
Deacetylcephalosporin C (~g/ml) at
Strains 0 h24 h 48h 72h 96h
C. acremonivm M20371 0 0 0 37.0 19.7
C. acremonium 371.p43 0 0 29.7 101.4 28.3
C. acremonium 371.1 0 0 72.6 88.4 53.6
C. acremonium371.2 0 0 3.4 0.3 0
C. acremonium371.3 O O O O O
