Note: Descriptions are shown in the official language in which they were submitted.
W092/08726 P~T/US90/0~33
,
2~501~
RAT THYROTROPIN RECEPTOR GENE AND USES THEREOF
''
1 The invention described and claimed herein was supported in
2 part by the Department of Health and Human Services, National
3 Institutes of Health.
4 FIELD OF INVENTION
The invention relates to a substantially pure nucleotide
6 seguence that encodes the thyrotropin receptor; medicamenta and
7 therapeutic compo~iitioniY comprising ~aid 3equence or the receptor
8 expressed therefrom; me~hods of detecting ligand~i or molecules
9 that bind to said sequence or to said receptor; and therapeutic
methods of detecting ligands or molecules that bind to said
11 seguence or to said receptor.
, ''
12 BACKGROUND OF THE INVENTION
13 Thyrotropin, or thyroid stimulating hormone (TSH), is a
14 pituitary hormone that regulates the development and activity of
the thyroid gland. The thyroid secretes two principle iodine-
16 containing hormones, T3 (also known as triiodothyronine) and T4
17 (also known as thyroxine), which, among other roles, regulate
18 basal metabolism. Secretion of T3 and T~ is in turn regulated by
19 TSH.
As with other glycoprotein hormones, TSH is bound at the
21 surface of hormone-responsive cells, for example the epithelial ~
;
:
W092/0~726 PCT/US90/06533
2~9~13 -2- ~
1 follicular cells, by a speciflc integral membrane receptor.
2 Activated receptOrS stimulate and regulate adenylate cyclase
3 through G proteinS, such as GS and Gl, and the cAMP signal
4 regulates the eXpression of a variety of downstream genes and
effector functions, such as the breakdown of colloid to mobilize
6 stored ~ and T~ as well as the active synthesis of T3 and T~
7 Clinical correlates of abnormal binding of TSH to its
8 specific receptor may be manifest in a variety of syndromes. For
9 example, hypothyroidism or myxedema can result from a TSH
receptor that is unable to bind TSH, or if binding with TSH
11 occurs, the abnormal recepkor cannot send an appropriate message
12 to influence adenylate cyclase activity. Alternatively,
13 expr~ssion of the receptor may be down-regulated, thereby
14 producing a hypothyroid state, such as during oncogene
tran~formation. Another example is hyperthyroidism. A common
16 form of hyperthyroidism is Graves Disease wherein antibodies
17 that react with the TSH receptor mimic TSH and activate the
18 receptor thereby resulting in a tonic up-regulation of thyroid
19 function.
The in situ structure of the thyrotropin receptor remains
21 unclear because of a multiplicity of proteins which appear to
22 interact with TSH. Studies using nondenaturing conditions have
23 identified TSH-binding thyroid proteins or protein complexes with
24 estimated molecular weights of about 500, 300 and lSO kd whereas
studies using denaturing conditions, such as with sodium dodecyl
26 sulfate gel electrophoresis, have identified 50-70, 30-45 and
27 15-25 kd components. The latter studies resulted in a postulated
28 TSH receptor structure composed o~ 2 or 3 subunits.
. ::
. .
W092/0~726 3 2~P ~ T/US90/~6533
1 Akami~u et al. identified two proteins that interact with
2 thyrotropin, revealed by virtue of their TSH-dependent binding
3 to TS~-Sepharose. The two proteins, of 43 kd and 70 kd molecular
4 weight. were found to be ~-actin and a member of the hsp70
family, respectively. Biochem Biophys Res Comm 170:351-358
6 (1990).
7 Pure sources of the receptor are unavailable, primarily
8 because of the extraordinarily small number of receptors on
9 thyroid cells. Attempts to use TSH receptor antibodies to purify
the receptor have been unsuccessful.
11 Thyrotropin receptor genes have been cloned in two species,
12 dog and human. Parmentiex et al. cloned the dog gene using
13 degenerate oligonucleo~idas, corresponding to conserved regions
14 in the transmembrane segment of known receptors that interact
with G proteins, in the polymerase chain reaction. That procedure
16 first yielded a receptor-related clone (probably not TSH
17 receptor) which itself was used to probe a thyroid cDNA library.
18 That screen yielded a putative TSH receptor clone. Science
19 246:1620-1622 (1989).
Nagayama et al. were unsuccessful ln cloni~g a rat gene
21 using oligonucleotide probes corresponding to the rat LH/hCG (LH
22 is luteinizing hormone and hCG is human chorionic gonadotrophin,
23 other glycoprotein hormones) receptor sequence. Those authors
24 then used the same strategy of Parmentier et al. employing
transmembrane domain-related oligonucleotides to obtain clones
26 of the human gene. Transfectants showed increased levels of cAMP
27 upon exposure to TSH but not in reponse to hCG, ACTH or insulin
28 exposure. Biochem Biophys Res Comm 165:1184-1190 (1989).
- , ~
W092/08726 ~ PCT/US90/06533
2 ~ 9 ~ 4_ ~
1 Libert et al. used a clone containing the complete coding
.:. .
2 sequence of the dog TSH receptor gene to screen a human cDNA
3 bank. They obtained a full length clone and expression thereof
4 in transfected CoS cells. Biochem Biophys Res Comm 165:1250-
.
1255 (1989).
6 Misrahi et al. also cloned the human gene. Those authors
7 screened a cDN~ library with a full length porcine LH/hCG
8 receptor cDNA because of a structural similarity between LH and
9 TSH. Biochem Biophys Res Comm 166:394-403 ~1990).
A more favorable starting point for elucidating the
11 structure and function of the thyrotropin receptor would be to
12 study the receptor of a utile animal model. The FRTL-5 rat
13 thyroid cell line has become a widely used in vitro model of a
14 normal, functioning endocrine cell. The growth and function of
FRTL-5 cells depend on thyrotropin. The cells can be used to
16 measure and study the action of antibodies in patients with
17 autoimmune thyroid disease. Thus, defining the structure of the
18 rat TSH receptor and its function in the growth and properties
19 of FRTL-5 cells is critically important to a multiplicity of
research and clinical programs.
21 SUMMARY OF THE INVENTION
':
22 A first object of the instant invention is to provide
23 substantially pure nucleotide ~equences encoding a ' rat
24 thyrotropin receptor gene, and portions thereof.
A second object of the instant invention is to provide the
26 substantially pure polypeptide product produced therefrom, and
'~
W092/08726 PCT/US90/06;33
~ ~5~ ~9~013
1 portion~ thereof.
2 A third object of the ingtant invention i~ to provide
3 medicamant~ and therapeutic compoYitions comprisins said
4 nucleotide sequences, or portions thereof. or said product, or
portion~ thereof, produced therefrom.
6 A fourth object of the instant invention i8 to provide
7 assays employing said sequences, or portions thereof, for
8 detecting nucleic acids hybridizable thereto.
9 A fifth object of the instant invention is to provide assays
employing said product, or portions thereof, for detecting
11 ligands bindable thereto.
12 A sixth object of the instant invention is to provide uses
13 of said ~equences or of said products in the treatment and
14 management of disorders that arise from dysfunction of the
receptor.
16 A seventh object of the instant invention is to provide a
17 means of making antibodie~ to the thyrotropin receptor nucleotide
18 sequence and product produced therefrom. '
19 These and other objects have been achieved by the successful
cloning and expression of a rat thyrotropin receptor gene.
21 BRIEF DESCRIPTION OF THE DRAWING
22 Figure 1 depicts the nucleotide and amino acid sequence of
23 a rat thyrotropin receptor and flanking noncoding sequences.
24 Potential glycosylation sites are underlined and are referred
to in consecutive order with the amino terminal-most site denoted
26 as I. A potential phosphorylation site is denoted with the
W09~/0~726 PCT/US90/~6533
~ Vl~ -6- ~
1 underscored dashed line. TMl-TM7 denote hydrophobic regions of
2 the transmembrane domain. Wavy lines indicate approximate
3 endpoints of the probe u~ed for the inltial -~creen of the cDNA
4 bank.
Figure 2 presents at the top, a schematic drawing of the
6 receptor. MET represents the signal peptide region. The
7 highlighted region between amino acid re~idues 300 and 400
8 represents the peptide not found in the LH/hCG recptor. Roman
9 numerals represent putative glycosylation sites.
Below the schematic drawing and to the left are R series of
11 bars drawn to scale with the schematic drawing depicting the
12 extent of the deletion in the extracellular domain of the
13 mutants. The mutants maintained a normal transmembrane domain.
14 Numbers above the bars represent the first and last amino acids
deleted. Below the schematic drawing and to the right is a table
16 of data relating to the deletion mutants, that are identified in
17 the first column. TSH binding and cAMP response were determined
18 as described herein.
19 DETAILED DESCRIPTION OF THE INVENTION
;""'
In order to clone the rat gene, a cDNA library was
21 con~tructed using the FRTL-S rat thyroid cell line as the source
.,~,.:.. ~;....
22 of RNA. After clones were obtained, the recombinant receptor was
23 expressed and critical regions thereof were identified.
24 The FRTL-5 cell line (Which is available publicly from the
ATCC under accession number CRL 8305 and was deposited in
26 relation to Ambesi-Impiombato, U.S. Pat. No. 4,608,341 and Kohn
., - ~ ~. .
,
W092/087 6 PCT/US90/06533
~ ~7~ 2~
1 et al., U.S. Pat. No. 4,609,622) was derived from thyroid of
2 normal Fischer rats. The cell~ were maintained in culture a~
3 de~cribed in U.S. Pat. No. 4,609,622. Briefly, the cells were
4 cultured in Coon s modified Ham s F-12 medium supp1emented with
calf serum, TSH, insulin and variou~ other optional hormones.
6 The cells were incubated in a C02 environment at physiologic
7 temperatures. The epithelioid cells grew attached to the
8 cultureware surface, had a doubling time of 1-2 days and were
9 passed biweekly with a split ratio of between 5 to 1~. -
Templates of cDNA were synthesized using 5 ~g of rat testis
11 poly(A) RNA (Clontech), murine reverse transcriptase (Pharmacia)
12 and Pharmacia s protocol. A 286 base pair (bp) cDNA fragment
.. .
13 comprising transmembrane domains was amplified with Thermus
14 aquaticu~ DNA polymerase and 25 pmol of each of two 30-mer
oligonucleotide primers complementary to sites flanking the
16 region to be amplified and hybridizable to alternative strands.
17 Mulli~ et al., U.S. Pat. Nos. 4,683,195 and 4,800,159; Mullis,
18 U.S. Pat. No. 4,683,202. Oligomer A has the sequence (5 -
19 GGGCTCTACCTGCTGCTCATTGCCTCCGTG~3 ) and oligomer B has the
sequence (5 -CCCACAAGGGGCATCGTGGCGATCAGCG-3 ). Each cycle
21 compri~ed 1 minute at 94C for denaturation, 2 minutes at 55C
22 for hybridization and 3 minutes at 72C for extension The
23 amplified fragment was purified from 3% low melting agarose.
24 An FRTL-5 cDNA library waq constructed in ~gtll (Clontech),
with mRNA obtained using standard procedures from ceLl~
26 maintained for 7 days in the absence of TSH. Plaques were
27 ~creened u~ing the LH/hCG receptor transmembrane domain-derived
28 cDNA fragment described above, which was labelled by random
.
,.,, ,~ .. ...... . . . . . . . .. . . . .
W092/087~6 ~ PCT/US90/06~33
~ V 1~ -8-
1 priming. The initial screen was under low stringency conditions
2 (55C). Positive plaques were isolated, grown and rescreened
3 with the same cDNA fragment probe. The inserts of plaque-
4 purified clones were subcloned into the EcoRI site of either
pGEM-42 or 7Z (Promega) using gtandard methodologies. DNA
6 sequencing was by the dideoxy chain termination method.
7 The full length rat thyrotropin receptor sequence encodes
8 a protein of 764 amino acids with an estimated molecular weight
9 of about 87,000, as shown in Figure 1. (The sequence was
deposited in the GenBank data base on 15 September 1990 and has
11 accession number M34842. It should be noted that in the coding
12 seguence, as noted in Figure 1 wherein the adenine of the ATG
13 codon for the first me~hionine of the extracellular domain is
14 considered nucleotide 1, the codon for the seventh leucine
residue at nucleotides 55-57 is CTG. The GenBank sequence lists
16 that codon as CTC, also a leucine codon.) The predicted protein
17 has a 21-23 residue hydrophobic region at its M-terminus which
18 is a signal peptide. Akamizu et al., Biochem Biophys Res Comm
19 169:947-952 (lg90~. There is a long extracellular domain
comprising at least five N-linked glycosylation sites and a
21 transmembrane region with seven hydrophobic domains.
22 After transfection into non-thyroid-derived cells, said
23 cells expressed a TSH-sensitive adenylate cyclase response and
24 the ability to bind labelled TSH. The activities were speciflc
for TSH, LH did not stimulate an adenylate cyclase response nor
. .
26 was LH bound by the transfectants. `~-
27 In Northern blots of FRTL-5 mRNA, two species of message
28 were noted. Cells exposed to TSH exhibited decreased levels of ~ `
'~!' .
.' ;.
~';~'..
~'' ''"'"'
W092/08726 2 ~ ~ ~ O 1 3 PCT/US90tO6;33
~ 9_
1 both specieq of message and the amount of mes~age was dependent
~ on TSH concentration. A similar down-regulation of the two mRNA
3 species was noted when cells were treated with forskolin, cholera
4 toxin or 8-bromo-cAMP, but no change was noted when the cells
were treated with a phorbol ester. Down-re~ulation also occurred
6 when cells were exposed to thyroid-stimulating antibodies, which
7 also increased cAMP levels. Exposure to antibodies that inhibit
8 TSH binding to the receptor increased TSH receptor mRNA levels.
9 Insulin, calf serum and insulin-like growth factor I up-
regulated TSH receptor expression. These observations may
11 account for the success of the cloning described herein because
12 RNA was obtained from cells maintained in medium containing
13 in~ulin and calf serum but no TSH.
14 The clone and the receptor protein produced therefrom find
utility in a variety of circumstances. For example, the
16 recombinant receptor can be used in assays for detecting ligands
17 capable of binding the receptor. Suitable ligands include
18 thyrotropin and anti-receptor antibodies.
19 Thus, recombinant receptor can be attached to a solid pha~e
support, such as the wells of a microtiter plate, plastic beads,
21 dip sticks, membranes and the like. Many such supports have a
22 natural affinity for proteins so attachment of the receptor
23 thereto is accomplished by merely exposing the support to an
24 aqueous solution comprising the receptor. Physiologic saline,
tissue culture medium, buffers and the like are suitable fluid
26 vehicles for preparing the aqueous solution. Attachment of the
27 receptor to the support can be enhanced if the 1uid phase is a
28 buffered solution with a pH of about 9. If mere exposure is
::,.
,, :' ' ' , ' ~ .' . '
~ .
W092t0~726 PCTJUS90/06S33
-10~
1 inadequate f~a~ m~ent, art-recognized attachment agents can
be ~3ed- Suitable agents include glutaraldehyde. poly-L-ly~ine
3 and des~ication.
4 After an incubation period to assure attachment, the support
is washed liberally. Optionally, non-specific sites on the
6 support are blocked with a non-cross-reactive carrier protein,
7 such as albumin or gelatin, or with a protein laden mixture, such
8 as serum or a non-fat dried milk solution. The blocking
9 solutions are preparable in the fluid vehicles disclosed above,
often as 0.1-30% solutions.
11 The receptor attached blocked support is exposed to a te~t
12 sample, often a body fluid sample, such as a blood or serum
13 sample, to determine the presence of ligand, and amounts thereof.
14 The support is incubated with the te~t sample for a period of
time to a~sure ligand-receptor binding. Then the support is
16 washed liberally and detection of bound ligand is conducted.
17 The means of detection can take a variety of forms. For
18 example, a readily known labelled second ligand, such as TS~, can
19 be exposed to the solid support following exposure o said
support to a test sample suspected of carrying a first ligand
21 bindable ~o the receptor, or part thereof. The amount of label
22 bound thereto is determined, such as by liquid scintillation
23 counting in the case of radiolabelling or by spectrophotometry
24 in the case of enzyme labelling, and measures inhibition of
binding of said known second ligand with the receptor, by a first
26 ligand, such as an anti-receptor antibody, in said te~t ~ample.
27 The amount of bound label is related inversely to the amount of
28 first ligand in the test sample.
.'; "'
.:
,-''. ':.,
WO9~/08726 ,~ ~3 ~ 3 PCT/US90/06~33
l Alternatively, a second labelled Ligand bindable to the
2 receptor bound first ligand on the Rupport is exposed to the
3 support and the amount of label bound thereto is determined.
4 Suitable second ligandR include an appropriate antibody, such as
an antibody to the receptor or to TSH. The amount of bound label
6 is related directly to the amount of ligand in the test 6ample.
7 Although solid support assays are preferred because of the
8 facility in performing the methods, other assays can be
9 configured without undue experimentation. Thus liquid phase
assays are practicable, as well as competition assays and those
11 where the recombinant receptor is labelled. There are many
12 variations in configuring an assay using the recombinant receptor
13 and the skilled artlsan can design an assay of choice within the
14 spirit of the invention. Suitable guidance can be obtained, for
example, in U.S. Pat. Nos. 4,486,530 and 4,520,113.
16 Truncated versions of the gene product are also useful.
17 For example, it i9 the extracellular domain that interacts with
18 TSH and with anti-receptor antibodies. Thus that polypeptide
l9 domain alone can be used in place of the intact receptor in the
uses disclosed herein. Truncated proteins can be obtained for
21 example, by chemical synthesis of the domain or part thereof,
22 chemical treatment of the intact protein to liberate a domain or
23 part thereof from the remainder of the receptor protein and by
24 altering the nucleotide coding sequence, such as by site-
directed mutagenesis or by subcloning an approprlate restrlctlon
26 fragment, so that only the extracellular domain or part thereof
27 is expressed.
28 ~ecause of the low density of receptor on thyroid cells, it
W092/08726 PCT/US90/06~33~ :
2 ~ 9 ~ O 1 3 -12- ~
1 has not been po~ible to obtain specific high titer anti-
2 recPptor antibodies. The substantially pure receptor and parts
3 thereof can be uqed to obtain ~pecific antibody. As descibed
4 below, a rabbit polyclonal anti~erum was raised to a 16 re~idue
polypeptide fragment of the extracellular domain of the receptor.
6 Accordingly, monoclonal antibodies to the receptor can be made
7 by obtaining immune cells suitable for hybridization with known
8 myeloma fusion partners and practicing the fusion, cloning and
9 selection that typifies the making of mAbs.
The cloned sequence is useful for ~etecting nucleic acids
11 hybridizable thereto. Accordingly, a nucleic acid hybridization
12 assay, such as filter hybridization ~Southern blot), in situ
13 hybridization, dot/slot blot or a solutlon hybridization assay,
14 with the clone as probe can be used to determine presence of
complementary genomic sequences and message, for example. Those
16 procedure~ are useful, for example, in detecting hypothyroidism
17 resulting from a TSH receptor defect. The nucleic acid assays
18 may comprise an amplification step such as taught in Mullis or
19 Mullis et al. (supra) or in Kramer et al. (U.S. ~at. No~
4,786,600).
,
21 The cloned sequence is useful for correcting defects at the ;
22 level of the gene, transcription, translation or processing by, '~
23 for example gene replacement therapy. A~ described below, non- ; ;
24 thyroid cells that normally do not express the thyrotropin ;
receptor were transfected with the full length expressible
26 sequence. The transfectants expre~ed a functional TSH receptor,
27 bound TSH at the cell surface and exhibited a TSH-dependent
28 actlvation of cAMP synthesis. Thus cells from a patlent that
W092/08726 PCT/US90/06533
~ -13- 2~9a~3
1 does not expres~ -the TSH receptor or expresses a defective
2 receptor can be rem~ved, tran9fected in vitro. and sta~le
3 transfectant~ that express a functionaL receptor can be
4 introduced back into the patient. If normal tissue
transplantation barriers are surmounted, for example using a
6 syngeneic, or at leagt histocompatible thyroid cell line from
7 another individual or a cell line that does not express major,
8 and possibly minor histocompatibility antigens, it is possible
9 that replacement transfected cells need not come from the patient
in need of treatment.
11 Certain thyroid dysfunctions are treatable with compositions
12 comprising said nucleotide sequence or preferably said gene
13 product, or portions thereof, encoded thereby. The compositions
14 comprise a therapeutically effective amount of the nucleotide
sequence or gene product thereof and a pharmaceutically
16 acceptable carrier. The composition can be administered in any
17 of a variety of art-recognized mode~ including orally and
18 parenterally, preferably intramuscularly or intravenously.
19 Appropriate dosages are determinable by, for example, dose-
response experiments in laboratory animals or in clinical trials
21 and taking into account body weight of the patient, absorption
22 rate, half life, disease severity and the like. The number of
23 doses9 daily dosage and course o~ treatment may vary from
24 individual to individual.
Pharmaceutical formulations can be of solid form including
26 tablets, capsules, pills, bulk or unit dose powders and granules
27 but preferably are of liquid form including solutions, fluid
2~ emulsions, fluid ~u~pensions, semisolid~ and the like. In
W O 92/~8726 PC~r/US90/06533
~ ~ 9 ~ 14- ~ ~ ~
1 addition to the active ingredient, the formulation would comprise
2 suitable art-recognized diluents, carrlers, fillers, binders,
3 emulsifiers, surfactants, water-soluble vehicles, buffer~
4 solubilizers and pre~ervatives.
Methods of treatment include those known in the art for
6 administering biologically active agents. Such methods include
7 in v vo and ex vivo modalities. For example, a receptor-
8 containing solution can be delivered intraveously, by a pump
9 means attached to a reservoir containing bulk quantities of said
solution, by passive diffusion from an implant, such as a
11 Silastic implant and the like. Alternatively, treatment may
12 involve temporary removal of tissue and exposure thereof to the
13 claimed compositions before introduction back into the patient.
14 Thus during hemapheresis, plasmapheresis, transfusion or
dialysis, for example, the extracorporeal fluid is passed over
16 solid phase bound receptor to entrap ligands bindable to the
17 receptor. The fluid is then returned to the patient.
18 Delivery of the receptor ~equence is practiced by art-
19 recognized means such as electroporation, precipitation,
microinjection, liposome fusion, microparticle bombardment and
21 the like. Generally target cells are obtained, such as from the
22 patient in need of treatment or a cell line, the expressible
23 sequence i~ in~erted into said ce~ls and stable transformants are
24 seLected. Said stable transformants expressing said receptor are
introduced into the patient in need of treatment by direct
26 infusion into the tissue or by parenteral means.
27 The skilled artisan can determine the most efficacious and
28 therapeutic means for effecting treatment practicing the instant
'
W092/08726 P~T/~SgO/06~33
~ -15- 2~9~(3 ~ ~'
1 invention. Reference can also be made to any of numerous
2 authoritie~ and references including, for example, "Goodman &
3 Gilman ~ The Pharmaceutical Ba~is of Therapeutics" (6th ed.,
4 Goodman et al., eds., MacMillan Publ. Co., NY, 1980).
The invention will be described in further detail by way of
6 the following non-limiting Examples.
7 EXAMPLE 1
8 From 8 x 105 plaques screened at low stringency with the rat
9 LH/hCG receptor-related probe described above, 20 FRTL-5 rat
thyroid cell clone were obtained. Eighteen, with insert ~izes
11 of 1.4-4.2 kilobases (kb), contained transmembrane domain
12 sequences exhibiting about 70% amino acid sequence identity with
13 the comparable region of the rat LH/hCG receptor. Compared to the
14 LH/hCG receptor, the two largest clones, 4.2 and 2.4 kb in length
(4A2 and 16B1, respectively) had an incomplete 5 end.
16 To obtain a full length clone, a 177 bp probe of the 5 end
17 of 16B1 was synthesized using 10 ng of pGEM-7Z (Promega) carrying
18 the 16B1 insert and oligo primer C with the sequence (5 -
19 CGCTATACAACAATGGATTTACTTCTT-3') and primer D with the sequence
(5 -GAAGAGCAGTAACGCTGGTGGAAGACA-3'). That probe was used to
21 rescreen the bank and revealed a 2.8 kb cDNA clone (T8AFB) with
22 characteristics compatible with its encoding the full-length TSH
23 receptor and only a small portion of the 3 noncoding sequences.
24 The nucleotide sequence of T8AF~, 2834 bp long, contains an
open reading frame encoding a protein, Mr 86,528, with 764 amino
W092/087~6 S ~ ~ PCT/US90/06533
2~9' -16~ ~
1 acids. The first in-~rame ATG is followe~ by codOns specifying
2 a hydrophobic sequence defined a~ a gignal peptide in the LH/hCG
3 receptor. Akamizu et al., supra. There is a long hydrophilic
4 region with five potential N-linked glycosylation sites followed
by a region with seven hydrophobic, membrane-spanning domains and
6 a cytoplasmic region containing a potential protein kinase C
7 phosphorylation site. The TAA stop codon is followed by a
8 polyadenylation signal at ~ucleotide~ 26~6-2691. There is a
9 stretch of amino acidg present in the TSH receptor that i5 not
found in the LH/hCG receptor.
ll The homology between the entire coding regions defined by
12 the rat TSH and LH/hCG receptors is relatively low, 64% and 48%
13 for nucleotide~ and amino acids, re~pectively. The homology in
14 the transmembrane region is slightly greater, 60% and 70%,
respectively. The overall amino acid homology with the human and
16 dog TSH receptors is 86% and 89%, respectively.
17 EXAMPLE 2
18 Transfection experiments with C05-7 cells (which is a
19 publicly available non-patented cell line with ATCC accession
number CRL 1651), or other non-thyroid cell, used a commercially
21 available electroporation device and the technique recommended
22 by the manufacturer (Bio-Rad). The expression vector was
23 constructed by subcloning the EcoRI T8AFB cDNA insert into the
24 EcoRI site of SV40 promoter-driven pSG5 (Stratagene).
The cells (about 1~7 per ml), which were washed and
26 resuspended in 0.8 ml of sucrose/phosphate buffer, were incubated
W092/08726 PCT/US90/06;33
~ 17- 2 ~ 1 3
1 with the pla~mid DNA ~80 ~g in 10 ~1 of water) for 10 minute9 in
2 an ice-water bath before being pulBed wi~h 330 V and 25 ~F. The
3 cells then were plated in dishe~ at 1.5-4 x 1o6 cells per di~h.
4 Cell viability wa~ ~50% after electroporation. After a 40-48
hour stabilization culture period, TSH-8timulated cAMP production
6 and TSH binding were mea~ured.
7 Highly purified bovine TSH (NIDDK-bTSH-I-l, 30 units/mg) and
8 LH (USDA-bLH-B5, 2.1 units/mg) were obtained from the hormone
9 distribution program of the National Institute of Diabetes and
Digestive and Kidney Disease~. TSH was radioiodinated and
11 binding thereof was measured using standard techniques, for
12 example as described in Tramontano & Ingbar (Endo 118:1945-1951
13 (1986~) with the exception that the incubation and wash buffer
14 was modified Hanks' balanced salt solution (wherein NaCl is
replaced by 222 mM sucrose) containing 0.5% bovine serum albumin
16 and 20 mM Hepes at pH 7.4. The incubation mixtures contained
17 about 4 x 106 cpm of l25I-labeled TSH (120 ~Ci/~g) and unlabeled
18 TSH or LH. Specific binding was caLculated by subtracting values
19 obtained in the presence of 0.1 ~M unlabeled TSH.
Level~ of cAMP were a~sayed using a standard technique, for
21 example as described in Kohn et al. ( supra) . Briefly, the test
22 sub~tance, for example TSH or thyroid stimulating antibody, was
23 added to the culture medium or to cells washed and maintained in
24 Hank'~ balanced salt golution or the modified Hank'~ balanced
salt solution described above, along with a cAMP
26 phosphodiesteraseinhibitor, such as3-isobutyl-1-methylXanthine.
27 After a brief incubation of 0.5-3 hours the cells were separated
28 and the amount of cAMP in the medium wa~ determined, and in cell
,::
W092/08726 ~ 3 PCT/U~90/06533
-18- ~
1 ly~ates if de9ired- Presen~e of cAMP was determined by
2 commercially available radioimmunoai~isay kit~i(for example DuPont
3 or New England Nuclear). Cell pellets were in each case
4 solubilized with 1 M NaOH for protein determinations. Protein
was measured using a commercially available kit with bovine serum
6 albumin as standard (Bio-Rad).
7 When T8AFB in the correct orientation was transfected into
8 COS-7 cells, the expressed protein caused the cells to become
9 sensitive to TSH in c~M~ assays. The relative increase in total
c~MP induced by 0.1 nM TSH in the transfected cells was 5-fold
11 above basal (>20 pmol/mg of protein). By comparison, LH did not
12 increase significantly levels of cAMP above basal level when
13 tested at a lO-fold higher (1 nM) concentration. COS-7 cells
14 transfected identically with constructs containing the cDNA
insert in the opposite orientation did not have a TSH-induced
16 increase of adenylate cyclase activity.
17 The development of a TSH-sensitive adenylate cycla~e
18 re~ponse in the transfected COS-7 cells was accompanied by the
19 appearance of specific binding of TSH. Binding of 125I-labeled
TSH to C05-7 cellqi transfected with the in~iert in the correct
21 orientation, but not in the opposite orientation, exhibited a
22 curvilinear i otherm similar to that of FRTL-5 thyroid cells
23 (Tramontano & Ingbar, supra) and wa9 inhibited 50%, 75% and >90%
24 by 0.3, 3 and 30 nM unlabeled TSH, respectively, but was not
inhibited by 10 nM LH. The Kd values for the high-ainity and
26 low-affinity binding sites were estimated at about 1.3 x 10l M
27 and 5.1 x 10-8 M, respectively. Those values compare favorably
28 with the values that were obtained for FRTL-5, 5.9 x 10l M and
: ' '
...
W092/08726 -19- 2 ~ 9 ~ ~ ~ 3 PCT/US9~/06533
1 1.7 x 10-8 M, respectively, by Tramontan & Ingbar (supra).
2 EXAMPLE 3
3 Poly(A) RNA's from FRTL-5 cells were prepared u5ing
4 standard procedures. The RNA's were separated by size and
transferred to Nytran membranes (Schleicher & Schuell) using
6 standard Northern blot methods, see for example Zarrilli et al.
7 (Mol Endo 3:1498-1508 (1989)) and Isozaki et al. (Mol Endo
8 3:1681-1692 (1989)). The probes used were the purified inserts
9 from clone T8AFB, 16B1 or 4A2 and as a controll a ~-actin cDNA
(kindly provided by B. Paterson, National Cancer Institute). The
11 final wash of the filters was in 1 x SSPE (0.15-0.18 M NaCl/10
12 mM phoi~phate, pH 7.4/0.5-1.0 mM EDTA) containing 0.1% SDS at
13 65C. Quantitation of RNA amounts was inferred from
14 densitometric scanning (LKB laser densitometer) of the hybridized
bands with the value obtained in the lane containing RNA of cells
16 not exposed to TSH at time zero serving as an arbltrary reference
17 value.
18 Northern analyses of poly(A)+ RNA from F~TL-5 cells
19 identified two mRNA species, 5.6 and 3.3 kb in size. The same
two mRNA's were detected barely in poly(A)~ RNA of rat ovary and
21 were not detected in rat testis, brain, liver, lung or spleen
22 (RNA samples obtained from Clontech). A probe derived from the
:
23 midportion of the extracellular domaln of the T~FB clone
24 hybridized with both species of transcripts. A 0.7 kb cDNA probe
derived from the 3 nontranslated portion of clone 4A2 hybridized
26 with only the 5.6 kb transcript. That suggests that the 5.6 kb
' ":' :.~
. ~
W092/0872~ 2 ~ 20- PCT/USsO/0~;33
1 mRNA transcript is larger primarily because it contains a longer
2 3 noncoding reyton.
3 EXAMPLE 4
.....
4 Poly(A) RNA from FRTL-5 cells maintained in the absence of
TSH for 7 days had significantly higher levels of the 5.6 kb and
6 3.3 kb transcripts than did cells maintained in the presence of
7 TSH, suggesting that TSH down-regulated expression of the gene.
.~ , .
8 Down-regulation was rapid, 3-4-fold within 8 hours of TSH
9 challenge, and was dependent on TSH concentra~ion. A comparable '
down-regulation was found when cells were exposed to cholera
11 toxin, forskolin or 8-bromo-cAMP, compounds known to affect the
12 adenylate cyclase complex. Down-regulation was not found when
13 cells were exposed to phorbol 12-myristate 13-acetate. Mea~ured
14 at the same time and under the same conditions, TSH binding to
cells decreased about 60% whether TSH, cholera toxin, forskolin,
16 or 8-bromo-cAMP was the agent. The addition of insulin, insulin-
17 like growth factor-I or calf ~erum to FRTL-5 cells that had been j~
18 maintained for 7 days with no TS~ or insulin and little (about
19 0.2%) or no calf serum, up-regulated the TSH receptor gene and
wa~ required for down-regulation by TSH or compounds known to
21 affect the expression of the adenylate cyclase complex.
22 Patients with autoimmune thyroid disease have circulating
23 antibodies that increase cAMP level~ or that inhibit TSH binding.
24 Representative antibodies were obtained from diaqnosed patients
using Protein G (Genex) and the manufacturer 8 recommended
-26 procedure or a standard procedure for immunoglobulin purification
27 by affinity chromatography. Stimulating antibodies were
':
. ~ .. .... , . .. .. ~ .. .. ...... ........ ... . ..... . ... . .. . . . . .
W~92/0~726 PCT/US90/06~33
( -21 2~3013
1 identified by their ability to induce cAMP using the assay
2 described above with FRTL-5 cells and with the immunoglobulin at
3 a concentratiOn of 1 mg/ml.
4 Antibodies that inhibit TSH binding were identified using
a solid pha~e a~say. BriefLy, microtiter plates optionally were
6 precoated with O.l ml of a 20 ~g/ml poly-L-lysine (Mr 70,000 from
7 Sigma) solution prepared in water for one hour at room
8 temperature. The solution was replaced with O.1 ml of thyroid
9 membranes, obtained by standard procedures, diluted appropriately
in 20 mM Tris-acetate, pH 7.O. Controls consisted of wells
11 containing 0.5% bovine serum albumin (BSA) in place of membranes.
12 After 4 hours or more of incubation at 4C, the wells were wa~hed
13 with buffer comprising 0.5% BSA in 20 mM Tris-acetate, pH 6.7 for
14 30 minutes at room temperature. The buffer wa~ replaced with a
te~t sample diluted appropriately in the same buffer and the
16 plate~ were allowed to incubate. The wells then were exposed to
17 labelled TSH, incubated, washed and bound label determined. The
18 inhibition activity is related directly to the decrease in
19 labelled TSH bound when compared to the decrea~e obRerved with
IgG from a normal individual.
21 When IgG preparations from patients with Graves di~ease
22 were tested, those antibodies, which increased cAMP levels as
23 does TSH, also down-regulated TSH receptor mRNA levels to that
24 comparable to what is found in cells expo~ed to TSH. IgG
preparations from patients with primary hypothyroidism, which
26 have inhibitory activity, increased TSH receptor mRNA levels
27 about 2-fold over ba~eline. Reactivity of both types of
28 antibodies with FRTL-5 cells was a~sociated with the presence of
W092/08726 ~ PCT/US90/06~33
-~2-
1 the TS~ receptor on the cell a~ both typeq of antibody reacted
2 with FRTL-5 cells but not with FRT rat thyroid cells. ~ERT is a
3 continuously growing line that, like ERTL-5, i9 derived from
4 Fischer rats and ha9 an apparentlY normal adenylate cyclase
complex gensitive to cholera toxin and for~kolin (Ambesi-
6 Impiombato ~ Coon, Int Rev Cytol Supp 10:163-171 (1979), Ambesi-
7 Impiombato, supra and Kohn et al., supra). FRT c~lls did not
8 expresq the two species of TSH receptor mRNA s in Northern
9 blots.)
EXAMPLE 5
11 The technique of site-directed mutagenesis enabled the
12 identification of critical sites on the extracellular domain
13 including sites that are important for TSH binding, that impart
14 TSH binding specificity on the receptor, ~pecies specificity and
antibody binding sites. For example, two sites on the
16 extracellular domain are important for TSH receptor function and
17 stimulating antibody action, but not for high affinity TSH
18 binding; a third site is important immunologically but is not
19 important functionally and is not important for either inhibiting
or Ytimulating antibody interaction; and a fourth site adjacent
21 to the third contributes more to receptor function than to TSH
22 binding.
23 Oligonucleotide mediated site-directed mutagenesis was
24 performed using t~e T7-GEN In Vitro Mutagenesi~ kit of U.S.
Biochemical Corp. Two phosphorylated oligos which imparted new
26 restriction sites unique to the full length clone or vector were
W092/08726 PCT/~S90/06333
~ -23- h~flJ13
1 annealed with a single strand preparation of the EcoRI T8AFB
2 construct ingerted into M13mpl8.
3 To derive mutant~ of potential glycosylation site~, the
4 asparagine residue (AAT) was converted to glutamine (CAG) using
a 27-mer complementary to the target sequence and having the CAG
6 codon located centrally. A second ~trand comprising methylated
7 cytosine was generated with T7 polymerase and T4 ligase. After
8 removal of the parental strand with MspI (or Sau3AI), HhaI and
9 exonuclease III, competent cells were transfected with the ln
vitro synthesized, mutated single stranaed DNA. Restriction
11 mapping and dideoxy sequencing validated mutations in the
12 re~ulting clones.
13 The EcoRI inserts in correct orientation of positive clones
14 were used to produce 9 deletion mutants after reconstruction and
subcloning. Mutant Ml lacked amino acids 37-121 (where the first
16 residue is the initiating methionine~; M2 lacked amino acids 110-
17 307; M2A lacked amino acids 173-231 M2B lacked amino acids 233-
18 265; M2C lacked amino acids 268-303; M3 lacked 308-410; M3A
19 lacked 338-399; M3B lacked 339-367 and M3C lacked 374-400 (~ee
Eigure 2).
21 The M3B transfectant was able to bind TSH and showed induced
22 cAMP ~ynthesis upon reaction with TSH or thyroid ~timulating
23 antibody. M3A and M3C transfectants showed no TSH binding or
24 TSH-induced increase in cAMP response. The M3 mutant showed a
low level of TSH binding capability. An interpretation of the
26 data is the deletion which preserves TSH binding and function,
27 amino acids 339-367, defines a region that is not critical for
28 receptor function, nor for stimulating or inhibiting antibody
W092/08726 ~13 (~ r ~1~ PCT/US90/06;33
~ 24- ~
1 binding. Adjacent regions, amino acids 308-339 and 367-399
2 define regions that contribute ~o TSH binding and receptor
3 f~nction since the M3 mutant did show some binding capability
4 and lacked that peptide. The region defined by amino acids 308-
339 appears to be more important to receptor function than to TSH
6 binding.
7 Deletion mutants spanning portions of the extracellular
8 domain that included potential glycosylation sites (Ml, M2, M2A,
9 M2B and M2C) and lacking the hydrophobic signal peptide region
(amino acids 5-23) did not exhibit TSH binding nor did TSH
11 elevate cAMP levels in transfected COS-7 cells. To further
12 define the actual sites responsible for the loss of function in
13 Ml, M2, M2A, M2B and M2C, mutant~ with individual carbohydrate
14 deletions (I through V) were created. Carbohydrate units II,
III and V did not influence TSH binding or rece~tor function.
16 In contrast, carbohydrate units I and IV limited TSH binding but
17 did not influence the TSH-induced or ~timulating antibody-
18 induced increase in cAMP.
19 EXAMPLE 6
.
20 Amino acids 339-367 are part of a region found on the TSH ;
21 receptor and not on the LH/hCG receptor. The TSH receptor-
22 specific region contains a stretch of hydrophilic amino acid
23 residues. It is known that certain amino acids and combinations
24 thereo are like~y to be immunonogenic and the probability of
immunogenicity of the stretch of hydrophilic amino acids in the
26 TSH receptor is high. A si~teen residue peptide (Tyr-Tyr-Val-
'' '
W092/08726 PCT/US90/06533
~ 25- 2 ~9a ~ 13
1 Phe-phe-Glu-Gl~-Gln-Glu-Asp-Glu-Ile-Ile-Gly-phe-cysi commercially
2 synthesized under contract) from this region was tested on FTRL-
3 5 cells and COS-7 cells transfected with the full length TSH
4 receptor cDNA. It wa~ found that the 16-mer had no effect on TSH
binding, Ts~-induced c~MP synthesis, stimulating antibody-
6 induced cAMP synthesis or the binding of inhibiting antibodies.
7 The 16-mer readily produced antibodies within three weeks
8 of injection into rabbits using an immunization schedule
9 recommended by Hazelton Laboratory. The resulting antisera were
reactive in an ELISA, as described below, using the 16-mer a~
11 antigen as described below. Furthermore, the antibodie~ bound
12 to FRTL-5 cells, which express TSH receptor, but not to FRT
13 cell~, which do not expre~s TSH receptor. - ;
14 Eor the ELISA, protein antigen was bound to the wells of a
microtiter plate by dilution of antigen in bicarbonate buffer,
16 pH 9.6, containing about 0.1% BSA ~Calbiochem) at a concentration
17 of about 5-20 ~g/ml, and adding 100 ~l of the solution to the
18 wells. The plate was incubated at 37C for about 2 hour~. The
19 plates were washed with PBS-T (phosphate-buffered saline
containing 0.05% Tween-20). The test sample, for example
21 antipeptide antibody, patient serum or patient IgG preparation,
:,
22 wa~ diluted appropriately in 1% BSA in PBS-T and next added to
23 the wells. The plate was incubated for about 90 minutes at room
24 temperature and then washed as described above. An appropriate
amount of a detection moIecule diluted with 1% BSA in PBS-T was
26 added to the wells, the plate was incubated for about 90 minutes,
27 washed and the amount of peptide-reactive material in the test
28 sample was determined. Suitable detection molecules include an
W092/08726 ~ PCT/US90/06533
-26- ~
1 avidin-biot1n system or an appropriate antibody radioactively
2 labelled or enzyme conjugated (avai~able, for example, from Zymed
3 or Amersham). In the ca~e of radiolabelling, a gamma or liquid
4 scintillation counter is used to determine the amount of well
bound label. In the case of enzyme labelling, a suitable
6 substrate is added to the well and appropriate detection is
7 effected, for example by luminometry or spectrophotometry.
8 The peptide was used in the ELISA to determine the presence
9 of reactive antibodies in IgG preparations from a variety of
patients including those with Graves Disease. Preparations from
11 29/34 patients with Graves' Disea~e reacted positive in the assay
12 whereas samples obtained from 22 patients with non-thyroid
13 diseases ~including rheumatoid arthritis, systemlc lupus
14 erythematosus and non-autoimmune thyroid disease, such as
adenoma) and from 15 normal individuals were non-reactive with
16 the peptide.
~ .':
17 Publications and references referred to and recited herein
18 are expre3sly incorporated by reference.
19 While preferred embodiments of the instant invention have
been de~cribed, it will be apparent to those skilled in the art
21 that many changes and modification~ can be made to the products
22 and processes without departing from the ~pirit of the invention.
23 For example, it is clear that changes can be made to the
24 nucleotide or amino acid sequence without affecting the
capability thereof to hybridize to homologous sequences or to
26 serve as a functional receptor. Thus a functional equivalent
W092/08726 PCT/US90/06i33
~ 27- 2 ~9a O~3
1 of a nucleic acid fragment can be defined in terms of capability
2 of hybridization or in term~ of capability of expressing a
3 polypeptide product therefrom that comprises residues of a rat
4 thyrotropin receptor A functional equivalent of a polypeptide
can be defined in term9 of carrying a function normally
6 associated with the intact protein, such a~ a peptide that
7 defines an antibody binding site, a peptide that comprises the
8 extracellular domain or a peptide that comprises a carbohydrate
9 binding site on said extracellular domain.
The described embodiments are thus to be considered
11 illu~trative and not restrictive. The scope of the invention is, ;
12 ther~fore, indicated by the appended claims rather than the
13 foregoing description. All changes that come within the meaning
14 and range of equivalency are to be embraced within the scope of
the invention.
.,,: ::,--..
.
W O 92/0872~ PCT/US90/06~33
PCT Apsl1~ant~s Guid~ - vol~ nnex ~4~ f,~
-28~ ~NEX M3
_ _ . _ _ .
I~ el~OOR6ANlSl4~S
6 ~ 24 d ~ ~ ~ ~ . .
d~
_ _
American Type Culture Collection (ATCC)
, _ .
A~ ~ C~) ' : :
12301 Parklawn Drive
Rockville, Maryland 20852 :~
~nited States of America _
O_d_~ ~
17 ~ay 1983 (17.05.83) CRL 8305 . .
. AllO T~OlllaL l-lC~1011--' (~ ~ tl ~ ~_1~. 'rllh 1~_~ b c~ U_l U
. -- . - -- - I '.
.,
. .
. -- - .
e. O~A~D TATSS 1~0 ~1 I~IIC~ ~111~ ~ In 11~- _ ~ ~ ~ ~ ) .,
~ . ;'
-
)
': ,
.: . ,
L ~ ~hl~ h~ ac~ h~ cb~ ~ ~ ~ O~
, (~
(~ ff~ _ '
O Th- ~ i ~< (b~ Ih- _~ ~ ~o i ~W
- ~_ ., j,
~Ad~l ~ - _
_ _ . _ _ _ . . . -- .
f~ f~O11
,
W O 92/08726 PCT/VS90/06533 ~:
PCT ADpl tcant ~ 5 G li~e - Volun~ nn~x ~13
-29- ~ M3
_ . _ . . . .
~l~gOO~C~ 5 ~, '.
~o~ d~_ r~ 16 ~_ 18~ _ ~n~-
. n~no~l o- ~or
t~ .
.
American Type Culture Collection (ATCC)
'': '
12301 Parklawn Drive
Rockville, Marvland 20852
_ United States or America _ ::
A~ . ~ . .
Unknown CRL 1651
_ . t~ ~
. .
_ _
. : :
_
'~`
.....
,,'
_ _ _ _ ~.
1. ~t~-rd~rJ~rcr~ r.~ r~r~ Ur~ e~ ~r~~
J~ - ~ ~'4--
~o~ ~ . ~ '. '
O Tb~ ~ Id rr~ ~Ir~ t~ rl ~n~ tt~ Ird~ 11~ ~ ~ r r~
_ ._~ :_ ':.. ,'.
I~d 0~1 r
. ~ .
on~ o ~ r ~
.,:
