Note: Descriptions are shown in the official language in which they were submitted.
W092/08~89 2(~5~3 PCT/US91/08703
MEASLES VIRUS RECOMBI~ANT POXVIRUS VACCINE
C~oSS REFERENC~ TO RELATED ~PPLICATIONS
This application is a continuation-in-part of
copending application Serial No. 07/621,614 filed November
20, 1990.
FIELD OF ~HE INVENTION
The present invention relates to a modified
poxvirus and to methods of making and using the same. More
in particular, the invention relates to recombinant
poxvirus, which virus expresses gene products of a
Morbillivirus gene, and to vaccines which provide protective
immunity against Morbillivirus infections.
Several publications are referenced in this
application by arabic numerals within parentheses. Full
citation to these references i5 found at the end of the
specification immediately preceding the claims. These
references describe the state-of-the-art to which this
invention pertains.
BACRGROUND OF THE INVENTION
Vaccinia virus and more recently other poxviruses
have been used for the insertion and expression of foreign
genes. The basic technique of inserting foreign genes into
live infectious poxvirus involves recombination between pox
DNA sequences flanking a foreign genetic element in a donor
plasmid and homologous sequences present in the rescuing
poxvirus (Piccini et al., 1987).
Specifically, the recombinant pox~iruses are
constructed in two steps known in the art and analogous to
the methods for creating synthetic recombinants of the
vaccinia virus described in U.S. Patent No. 4,603,112, the
disclosure of which patent is incorporated herein by
reference.
First, the DNA gene sequence to be inserted into
the ~irus, particularly an open reading frame from a non-pox
source, is placed into an E. coli plasmid construct into
which DNA homologous to a section of DNA of the poxvirus has
been inserted. Separately, the DNA gene sequence to be
inserted is ligated to a promoter. The promoter-gene
:
W092~087~9 PCr/US~1/08703--
2(!~'r;i~33 2
linkage is positioned in the plasmid construct so that the
promoter-gene linkage is flanked on both ends by DNA
homologous to a DNA sequence flanking a region of pox DNA
containing a nonessential locus. The resulting plasmid
construct is then amplified by growth within E. coli
bacteria (Clewell, 1972) and isolated (Clewell et al., 1969;
Maniatis et al., 1982).
Second, the isolated plasmid containing the DNA
gene sequence to be inserted is transfected into a cell
culture, e.g. chick embryo fibroblasts, along with the
poxvirus. Recombination between homologous pox DNA in the
plasmid and the viral genome respectively gives a poxvirus
modified by the presence, in a nonessential region of its
genome, of foreign DNA sequences. The term "foreign" DNA
designates exogenous DNA, particularly DNA from a non-pox
source, that codes for gene products not ordinarily produced
by the genome into which the exogenous DNA is placed.
Genetic recombination is in general the exchange
of homologous sections of DNA between two strands of DNA.
In certain viruses RNA may replace DNA. Homologous sections
of nucleic acid are sections of nucleic acid (DNA or RNA)
which have the same sequence of nucleotide bases.
Genetic recombination may take place naturally
during the repliGation or manufacture of new viral genomes
with n the infected host cell. Thus, genetic recombination
between viral genes may occur during the viral replication
cycle that takes place in a host cell which is co-infected
with two or more different viruses or other genetic
constructs. A section of DNA from a first genome is used
interchangeably in constructing the section of the genome of
a second co-infecting virus in which the DNA is homologous
with that sf the first viral genome.
However, recombination can also take place between
sections of DNA in different genomes that are not perfectly
homologous. If one such section is from a first genome
homologous with a section of another genome except for the
presence within the first section of, for example, a genetic
marker or a gene coding for an antigenic determinant
--. :. ' , ' `, ' ' '
W092/0X789 2~9~,~3~ PCT/US91/08703
inserted into a portion of the homologous DNA, recombination
can still take place and the products of that recombination
are then detectable by the presence of that genetic marker
or gene in the recombinant viral genome.
Successful expression of the inserted DNA genetic
sequence by the modified infectious virus requires two
conditions. First, the insertion must be into a
nonessential region of the virus in order that the modified
virus remain viable. The second condition for expression of
inserted DNA is the presence of a promoter in the proper
relationship to the inserted DNA. The promoter must be
placed so that it is located upstream from the DNA sequence
to be expressed.
Canine distemper virus (CDV) and measles virus
(MV~ are members of the Morbillivirus subgroup of the family
Paramyxovirus genus (Diallo, 1990; Kingsbury et al., 1978).
The viruses contain a non-segmented single-stranded RNA
genome of negative polarity. Canine distemper is a highly
infectious febrile disease of dogs and other carnivores.
The mortality rate is high; ranging between 30 and 80
percent. Dogs surviving often have permanent central
nervous system damage (Fenner, et al., 1987). Similarly,
measles virus causes an acute infectious febrile disease
characterized by a generalized macropapular eruption. The
disease mainly affects children.
The characteristics of Morbilliviruses have
recently been reviewed by Norrby and Oxman (1990) and Diallo
(199O). As reported for other Paramyxoviruses (Avery and
Niven, 1979; Merz et al., 1980) two structural proteins are
crucial for the induction of a protective immune response.
These are the membrane glycoprotein hemagglutinin (HA),
which is responsible for hemagglutination and attachment of
the virus to the host cell, and the fusion glycoprotein (F),
which causes membrane fusion between the virus and the
infected cell or between the infected and adjacent
uninfected cells (Graves et al., 1978). The order of genes
in the MV genome has been deduced by Richardson et al.
(1985) and Dowling et al. (1986). The nucleotide sequence
' ' -. :, ' ` ''' . ' ,
,, , - , :
' ?
''
W092/087X9 - PCT/US91/08703_
ZC!'~ 5~3 `
of the MVXA gene and MVF gene has been determined by
Alkhatib and Briedis (1986) and Richardson et al. (1986),
respectively.
CDV and MV are structurally similar and share a
close serological relationship. Immunoprecipitation studies
have shown that antiserum to MV will precipitate all CDV
proteins (P, NP, F, HA and M). By contrast, antiserum to
CDV will precipitate all MV proteins excPpt the HA
glycoprotein (Hall et al., 1980; Orvell et al., 1980;
Stephenson, et al., 1979). In light of this close
serological relationship, it has previously been
demonstrated that vaccination with MV will elicit protection
against CDV challenge in dogs (Gillespie et al., 1960; Moura
et al., 1961; Warren et al., 1960). Neutralizing antibodies
against CDV have been reported in human anti-MV sera (Adams
et al., 1957; Imagawa et al., 1960; Karzon, 1955; Karzon,
1962) but neutralizing antibodies against MV have not been
found in anti-CDV sera from dogs (Delay et al., 1965;
Karzon, 1962; Roberts, 1965).
MV HA and F genes have been expressed in several
viral vectors including vaccinia virus (Drillien et al.,
1988; Wild et al., 1991), fowlpox virus (Spehner et al.,
1990; Wild et al., 1990), adenovirus (Alkhatib et al., 1990)
and baculovirus (Vialard et al., 1990). In these studies,
authentic MV proteins were expressed which were functional
in hemagglutination (Vialard et al., 1990) hemolysis
(Alkhatib et al., 1990; Vialard et al., 1990) or cell fusion
(Alkhatib et al., 1990; Vialard et al., 1990; Wild et al.,
1991) assays. When inserted into a vaccinia virus vector,
the expression of either the HA or the F protein was capable
of eliciting a protective immune response in mice against MV
encephalitis (Drillien et al., 1988). Similarly, expression
of the F protein in a fowlpox virus vector elicited
protective immunity against MY encephalitis in mice (Wild et
al., 1990). No protection studies were reported with other
vectors.
European Patent Application No. 0 314 569 relates
to the expression of an MV gene in fowlpox.
Wog2/087~s ,~?~,~Cj~ PCT/US91/08703
Perkus et al. (1990) recently described the
definition of two unique host range genes in vaccinia virus.
These genes encode host range functions which permit
vaccinia virus replication on various cell substrates in
vitro. The genes encode host range functions for vaccinia
virus replication on human cells as well as cells of rabbit
and porcine origin. Definition of these genes provides for
the development of a vaccinia virus vector, which, while
still expressing foreign genes of interest, would be
severely restricted in its ability to replicate in defined
cells. This would greatly enhance the safety features of
vaccinia virus recombinants.
An attenuated vector has been developed by the
sequential deletion of six non-essential regions from the
Copenhagen strain of vaccinia virus. These regions are
known to encode proteins that may have a role in viral
virulence. The regions deleted are the tk gene, the
hemorrhagic gene, the A-type inclusion gene, the
hemagglutinin gene and the gene encoding the large subunit
of the ribonucleotide reductase as well as the C7L through
KlL sequences defined previously (Perkus et al., 1990). The
sequences and genomic locations of these genes in the
Copenhagen strain of vaccinia virus have been defined
previously (Goebel et al., 1990 a,b). The resulting
attenuated vaccinia strain is designated as NYVAC.
The technology of generating vaccinia virus
recombinants has recently been extended to other members of
the poxvirus family which have a more restricted host range.
The avipoxvirus, fowlpox, has been engineered as a
recombinant virus expressing the rabies G gene (Taylor et
al., 1988b). This recombinant virus is also described in
PCT Publication No. W089/03429. on inoculation of the
recombinant into a number of non-avian species an immune
response to rabies is elicited which in mice, cats and dogs
is protective against a lethal rabies challenge.
Both canine distemper and measles are currently
controlled by the use of live attenuated vaccines (Fenner et
al., 1987; Preblud et al., 1988). Immunization is
,
. . .
.~ . .. ,- :
, ' :' '' : ,.
' :
: -
W092/087X9 2~!~5L~, Pcr/usgl/o87o~
`~ ` ` 6
reco~mended for control of CDV using a live attenuatedvaccine at eight weeks of age and again at 12 to 16 weeks of
age. Although immunity to CDV is life-long, because of the
highly infectious nature of the agent and the severity of
the disease, annual revaccination is usually recommended.
One problem with the current policy of continual
revaccination is that CDV immune mothers pass neutralizing
antibody to offspring in the colostrum. It is difficult to
ascertain when these antibody levels will wane such that
pups can be vaccinated. This leaves a window when pups may
be susceptible to CDV infection. Use of a recombinant
vaccine expressing only the measles virus glycoproteins may
provide a means to overcome the inhibitory effects of
maternal antibody and allow vaccination of newborns. In
fact, it has been demonstrated that CDV-specific antibodies
in pups that suckled CDV immune mothers did not prevent the
development of MV-specific antibodies when inoculated with a
MV vaccine (Baker et al., 1966).
Other limitations of the commonly used modified
live CDV vaccines have been previously documented (Tizard,
1990) and are linked to the ability of these vaccine strains
to replicate within the vaccinated animals. These
deleterious effects are most notable when the CDV vaccine
strain is co-inoculated with canine adenovirus 1 and 2 into
dogs resulting in immunosuppression, thrombocytopenia, and
encephalitis (Bestetti et al., 1978; Hartley, 1974; Phillips
et al., 1989). The modified live CDV vaccines have also
been shown to induce distemper in other animal species
including foxes, Kinkajous, ferrets, and the panda (Bush et
al., 1976; Carpenter et al., 1976; Kazacos et al., 1981).
Therefore, the use of a recombinant CDV vaccine candidate
would eliminate the continual introduction of modified live
CDV into the environment and potential vaccine-associated
and vaccine-induced complications which have arisen with the
use of the conventional CDV vaccines.
The use of poxvirus vectors may also provide a
means of overcoming the documented inhibitory effect that
maternal antibody has on vaccination with presently utilized
WOs2/0X789 ~ PCT/US91/08703
53?.
live attenuated CDV strains in dogs. Pups born to mothers
previously immunized at a young age with a poxvirus
recom~inant may avoid the interference of CDV-specific
maternal antibody. Additionally, the ability of both
vaccinia virus and canarypox virus vectors harboring MV HA
and F genes to elicit these responses and the lack of
serological cross-reactivity between the two poxviruses
provides a further advantage in that one vector could be
utilized early in the pup's life and the other later, to
boost CDV-specific immunity. This would eliminate the
release of live attenuated CDV strains into the environment,
an event linked to the occurrence of vaccine-induced and
vaccine-associated complications (Tizard, l990).
It can thus be appreciated that provision of a
Morbillivirus recombinant poxvirus, and of vaccines which
provide protective immunity against Morbillivirus
infections, would be a highly desirable advance over the
current state of technology.
OBJECTS OF THE INVENTION
It is therefore an object of this invention to
provide recombinant poxviruses, which viruses express gene
products of Morbilliviruses, and to provide a method of
making such recombinant poxviruses.
It is an additional object of this invention to
provide for the cloning and expression of Morbillivirus
coding sequences, particularly measles -~irus coding
sequences, in a poxvirus vector, particularly vaccinia virus
or canarypox virus vectors.
It is another object of this invention to provide
a vaccine which is capable of eliciting Morbillivirus
neutralizing antibodies, hemagglutination-inhibiting
anti~odies and protective immunity against Morbillivirus
infection and a lethal Morbillivirus challenge, particularly
providing cross-protection of dogs against canine distemper
using a measles virus recombinant poxvirus vaccine.
These and other objects and advantages of the
present invention will become more readily apparent after
consideration of the following.
'
W092J08789 2~,Q~3 PCT/US91/0870.~
STATEMENT OF THE INVENTION
In one aspect, the present invention relates to a
recombinant poxvirus containing therein a DNA sequence from
Morbillivirus in a nonessential region of the poxvirus
genome. The poxvirus is advantageously a vaccinia virus or
an avipox virus, such as canarypox virus. The Morbillivirus
is advantageously measles virus.
According to the present invention, the
recombinant poxvirus expresses gene products of the foreign
Morbillivirus gene. In particular, the foreign DNA codes
for a measles virus glycoprotein, advantageously measles
virus hemagglutinin glycoprotein and measles virus fusion
glycoprotein. Advantageously, a plurality of measles virus
glycoproteins are co-expressed in the host by the
recombinant poxvirus.
In another aspect, the present invention relates
to a vaccine for inducing an immunological response in a
host animal inoculated with the vaccine, said vaccine
including a carrier and a recombinant poxvirus containing,
in a nonessential region thereof, DNA from Morbillivirus,
particularly measles virus. Advantageously, the DNA codes
for and expresses a measles virus glycoprotein, particularly
measles virus hemagglutinin glycoprotein and measles virus
fusion glycoprotein. A plurality of measles virus
glycoproteins advantageously are co-expressed in the host.
The poxvirus used in the vaccine according to the present
invention is advantageously a vaccinia virus or an avipox
virus, such as canarypox virus.
BRIBF DESCRIPTION OF THE DRAWINGS
A ~etter understanding of the present invention
will be had by referring to the accompanying drawings, in
which:
FIG. 1 schematically shows a method for the
construction of plasmid pSPM2LHAVC used to derive
recombinant vaccinia virus vP557 expressing the MV
hemagglutinin gene;
-:- . : - : .
- ~ .
:
W092/08~9 ~ 3 PCT/US91/08703
FIG. 2 schematically shows a method for the
construction of plasmid pSPMFVC used to derive recombinant
vaccinia virus vP455 expressing the MV fusion gen~;
FIG. 3 schematically shows a method for the
construction of plasmid pRW843 used to derive recombinant
vaccinia virus vP756 expressing the MV hemagglutinin gene;
FIG. 4 schematically shows a method for the
construction o plasmid pRW850 used to derive recombinant
vaccinia virus vP80~ expressing the MV fusion gene;
FIG. 5 schematically shows a method for the
construction of plasmid pRW800 used to derive recombinant
canarypox virus vCP40 expressing the MV fusion gene;
FIG. 6 schematically shows a method for the
construction of plasmid pRW810 used to derive recombinant
canarypox viruses vCP50 expressing the MV hemagglutinin gene
and vCP57 co-expressing the MV fusion and hemagglutinin
genes;
FIG. 7 schematically shows a method for the
construction of plasmid pRW852 used to derive recombinant
canarypox virus vCP85 expressing the MV hemagglutinin gene;
FIG. 8 schematically shows a method for the
construction of plasmid pRW853A used to derive recombinant
canarypox virus vCP82 co-expressing the MV hemagglutinin and
fusion genes;
FIG. 9 schematically shows a method for the
construction of plasmid pSD460 for deletion of thymidine
kinase gene and generation of recombinant vaccinia virus
vP4lO;
FI~. lO schematically shows a method for the
construction of plasmid pSD486 for deletion of hemorrhagic
region and generation of recombinant vaccinia virus vP553;
FIG. ll schematically shows a method for the
construction of plasmid pMP494~ for deletion of ATI region
and generation of recombinant vaccinia virus vP618;
FIG. 12 schematically shows a method for the
construction of plasmid pSD467 for deletion of hemagglutinin
gene and generation of recombinant vaccinia virus vP723;
,
. - : '. : ~
'.:
.,
WO9~0X7#9 2~ 63;~, Pcr/us9~Jo870~
FIG. 13 schematically shows a method for the
construction of plasmid pMPCSK1~ for deletion of gene
cluster [C7L - KlL] and generation of recombinant vaccinia
virus vP804;
FIG. 14 schematically shows a method for the
construction of plasmid pSD548 for deletion of large
subunit, ribonucleotide reductase and generation of
recombinant vaccinia virus vP866 (NYVAC); and
FIG. 15 schematically shows a method for the
construction of plasmid pRW~57 used to derive recombinant
NYVAC virus vP913 co-expressing the MV hemagglutinin and
fusion genes.
DETAILED DESCRIP~ION OF THE INVENTION
A better understanding of the present invention
and of its many advantages will be had from the following
examples, given by way of illustration.
Exam~le 1 - GENERATION OF V~CC~NI~ VIRUS R~COMBINANTS
CONTAINING THE MEASLES HEMAGGL~TININ GENE
The rescuing virus used in the production of both
recombinants was the Copenhagen strain of vaccinia virus
from which the thymidine kinase gene had been deleted. All
viruses were grown and titered on VERO cell monolayers.
The early/late vaccinia virus H6 promoter (Rosel
et al., 1986; Taylor et al., 1988a,b) was constructed`by
annealing four oYerlapping oligonucleotides, H6SYN A-D. The
resultant H6 sequence is as follows:
Vaccinia Virus H6 Promoter (SEQ ID NO:1/SEQ ID NO:2):
HindIII
5'AGCTTCTTTATTCTATACTTAAAAAGTGAAAATAAATACAAAGGTTCTTGAGG
GTTGT
AGAAATAAGATATGAATTTTTCACTTTTATTTATGTTTCCAAGAAC$CCCAACA
GTTAAATTGAAAGCGAGAAATAATCATAAATTATTTCATTATCGCGATATCCGTT
AAGTT
CAATTTAACTTTCGCTCTTTATTAGTATTTAATAAAGTAATAGCGCTATAGGCAA
TTCAA
.
. '
WO 92/n87X9 '2~ ~?. : PCT/US~1/08703
11
TGTATCGTAC-3'
ACATAGCATGAGCT-5'
XhoI
Referring now to Figure l, the annealed H6SYN
oligonucleotides were ligated into pMP2LVC digested with
XhoI/HindIII to yield plasmid pSPl3l. The plasmid pMP2LVC
contains the leftmost 0.4kbp of the vaccinia virus
(Copenhagen strain) HindIII K region within pUCl8. The
construction of pMP2LVC was performed as follows: a 0.4kbp
HindIII/SalI fragment from the HindIII K region was isolated
and blunt-ended with the Klenow fragment of the E. col i DNA
polymerase in the presence of 2mM dNTPs. This fragment was
inserted into pUCl8 which had been digested with PvuII. The
resulting plasmid was designated pMP2VC. The plasmid pMP2VC
was linearized with ~I. Synthetic oligonucleotides
MPSYN52 (SEQ ID NO:3) (5'-ATTATTTTTATAAGCTTGGA-
TCCCTCGAGGGTACCCCCGGGGAGCTCGAATTCT-3') and MPSYN53 (SEQ ID
NO:4) (5'-
AGAATTCGAGCTCCCCGGGGGTACCCTCGAGGGATCCAAGCTTATAAAAATAAT-3')
were annealed and inserted into the leftmost of the two SspI
sitas located within the vaccinia virus sequences. The
resultant plasmid pMP2LVC contains a multiple cloning region
in the intergenic region between the XlL and X2L open
reading frames.
Annealed oligonucleotides 3Pl (SEQ ID NO:5) (5'-
GGGAAG-ATGGAACCAATCGCAGATAG-3') and 3P2 (SEQ ID NO:6) (5'-
AATTCTATCTG-CGATTGGGGTTCCATCTTCCC-3') containing the extreme
3' sequences of the HA gene and a sticky EcoRI end were
ligated to a l.8kbp XhoI/SmaI fragment from pMH22 containing
.
W092/087~9 z~9~ ` PCT/US91/08703_
12
the remainder of t~e HA gene and pSP131 digested with XhoI
and EcoRI. The resultant plasmid was designated pSPMHA11.
The plasmid pMH22 was derived from a full length cDNA clone
of the measles HA gene by creating a XhoI site at the ATG
initiation codon ~Alkhatib et al., 1986).
A 1.9kbp HindIII/EcoRI fragment from pSPMHA11,
containing the measles HA gene, was isolated and blunt-Pnded
with the Klenow fragment of the E. coli DNA polymerase in
the presence of 2mM dNTPs. The isolated fragment was
inserted into pMP409DVC (Guo et al., 1989) digested with
BqlII and blunt-ended by treatment with mung bean nuclease.
Insertion into this vector yielded plasmid pSPMHA41. The
XhoI site between the H6 promoter and the initiation codon
of the HA gene was removed by oligonucleotide directed
double strand break mutagenesis (Mandecki, 1982) using
oligonucleotide HAXHOD (SEQ ID NO:7) (5'-
ATATCCGTTAAGTTTGTATCGTAATGTCACCACAACGAGACCGGAT-3'). Plasmid
pSPM2LHAVC was generated by this procedure. Insertion
plasmid pSPM2LHAVC was used in in vitro recombination
experiment~ with vaccinia virus vP458 as the rescue virus to
generate recombinant vP557. vP458 contains the E. coli lac
Z gene in the M2L insertion site of vP410. This vaccinia
virus recombinant contains the measles HA gene in the M2L
locus of the genome, replacing the lac Z gene.
Bxam~le 2 - GENERATION OF VACCINIA VIRUS RECONBINANTS
CON~AINING TXE ME~SLES FUSION GENE
Referring now to Figure 2, annealed
oligonucleotides 3PA (SEQ ID NO:8) (5'-
CCTAAAGCCTGATCTTACGGGAACATCAAAATCCTAT-
:
,
.
.
~O 92/08789 ZC?'~ 3 P Cr/US91/0870313
GTAAGGTCGCTCTGATTTTTATCGGCCGA-3') and 3PB (SEQ ID No:9) (5'-
AGCTTCGGCCGATAAAAATCAGAGCGACCTTACATAGGATTTTGATGTTCCCGTAAG-
ATCAGGCTTTAGG-3') containing the 3' end of the measles
fusion gene, a vaccinia virus early transcription
termination signal (Yuen et al., 1987) and EaaI and HindIII
ends were ligated to a lX~p SalI/HaeIII fragment from pCRF2
(obtained from C. Richardson, National Research Council of
Canada (Biotechnology Institute), Montreal, Canada H3A lA1)
and pUC8 digested with SalI and HindIII. The resulting
plasmid pMF3PR14 contains the 3' end of the lkbp fragment of
the measles fusion gene.
Annealed oligonucleotides 5PA (SEQ ID N0:10) (5 ' -
GGGATGGGTCTCAAGGTGAACGTCTCTGCCATATTC-3') and 5PB (SEQ ID
N0~ '-ATGGCAGAGACGTTCACCTTGAGACCCATCCC-3'~, containing
a 5' SmaI site and a 3' BstXI site, were ligated to a 820bp
BstXI/SalI fragment from pCRF2 and pUC8 digested with SmaI
and SalI. The resultant plasmid pSPMF5P16 contains the 5'
portion of the measles fusion gene. The 820bp SmaI/SalI
fragment from pSPMF5P16 and the lkbp SalI/EaqI fragment from
pMF3PRl4 were ligated into pTP15 digested with SmaI and
EagI. The plasmid pTPl5 (Guo et al., 1989) contains the
vaccinia ~irus early/late H6 promoter flanked by sequences
from the HA locus of the vaccinia virus (Copenhagen strain)
genome. The resultant plasmid containing the measles fusion
gene juxtaposed 3' to the H6 promoter within the HA
insertion plasmid was designated pSPHMF7.
Oligonucleotide directed mutagenesis was performed
on pSPHMF7. Initially an in vitro mutagenesis reaction
(Mandec~i, 1982) was performed to create a precise ATG:ATG
. . .:
', : ' ' ' :
W092/08789 Z ~ ~f;i~ ~?~ PCT/US91/08703_
14
linkage of the H6 promoter with the measles fusion gene by
removing the SmaI site using the oligonucleotide SPMAD (SEQ
ID NO:12) (5'-TATCCGTTAAGT-TTGTATGGTAATGGGTCTCAAGGTGAACGTCT-
3'). This resulted in the generation of pSPMF75M20.
Subsequently, the BalII site at the 5' end of the H6
promoter was removed using oligonucleotide SPBGLD (SEQ ID
NO:13) (5'-AATAAATCACTTTTTATACTAATTCTTTATTCTATACTT-
AAAAAGT-3') according to a known procedure (Mandecki, 1982).
The rèsultant plasmid was designated pSPMFVC. This plasmid
was used in in vitro recombination experiments with vaccinia
virus vP410 as rescue virus to generate vP455.
Example 3 - INMUNOP~ECIPITATION ANA~YSIS
In order to determine that recombinants vP455 and
vP557 expressed authentic proteins, immunoprecipitation
experiments were performed essentially as described (Taylor
et al., 1990). Briefly, VERO cell monolayers were infected
at lO pfu per cell with either parental or recombinant
viruses in the presence of 35S-methionine. The fusion
protein was specifically precipitated from the infected cell
lysate using a rabbit antiserum directed against a carboxy
terminal fusion peptide. The hemagglutinin protein was
specifically precipitated from the infected cell lysate
using a polyclonal monospecific anti-hemagglutinin serum.
With respect to immunoprecipitation using a fusion
specific serum, no radiolabelled products were detected in
uninfected VERO cells, parentally infected VERO cells, or
cells infected with the HA recombinant vP557. In cells
infected with the fusion recombinant vP455, the fusion
precursor Fo with a molecular weight of approximately 60 kd
`' ~, ~ .
.
,
W092/087X9 2 ~ ~ 3 PCT/US91/08703
and the two cleavage products F1 and F2 with molecular
weights of 44 kd and 23 kd were detected. Similarly, with
respect to immunoprecipitation of the glycosylated form of
the HA protein with a molecular weight of approximately 75-
77 kd, no products were detected in uninfected VERO cells,
parental infected cells, or VERO cells infected with vP455.
In addition, immuno~luorescence studies indicated
that both proteins were expressed on the infected cell
surface.
ExamDle 4 - CELL FUSION EXPERIMENTS
A characteristic of Morbillivirus
cytopathogenicity is the formation of syncytia which arise
by fusion of infected cells with surrounding uninfected
cells followed by migration of the nuclei toward the renter
of the syncytium (Norrby et al., 1982). This has been shown
to be an important method of viral spread, which for
Paramyxoviruses can occur in the presence of hemagglutinin
specific antibody (Merz et al., 1980). This ability has
bee~ assigned by analogy with other Paramyxoviruses to the
amino terminus of the F1 peptide (Choppin et al., 1981;
Novick et al., 1988; Paterson et al., 1987).
In order to determine that the measles proteins
expressed in vaccinia virus were functionally active, VERO
cell monolayers were inoculated with parental or recombinant
viruses vP455 and vP557, respectively, at 1 pfu per cell.
After 1 h absorption at 37C the inoculum was removed, the
overlay medium replaced, and the dishes incubated overnight
at 37C. At 18 h post-infection, plates were examined with
a microscope and photographed. No cell fusing activity was
"' '' ''' ' ' ~ ' ' ~
: . .
.: :: ' ;
092t08789 Z ~ PCT/US9l/08703
16
evident in VERO cells inoculated with parental virus, vP455
or vP557. However, when vP455 and vP557 were co-inoculated,
efficient cell fusing activity was observed.
This result has recently been confirmed by Wild et
al. (1991) who determined that syncytium formation in a
variety of cell lines infected with measles/vaccinia virus
recombinants required expression of koth fusion and
hemagglutinin genes. The result, however, is in contrast to
a previous report (Alkhatib, 1990) which described cell
fusion in 293 cells infected with high multiplicities of an
adenovirus recombinant expressing the measles fusion
protein. Similarly, it has been reported (Vialard et al.,
1990) that cell fusion was observed in insect cells infected
with a baculovirus recombinant expressing the measles fusion
protein but only when incubated at pH 5.8. In neither case
was the fusion activity enhanced by co-infection with the
appropriate recombinant expressing the measles hemagglutinin
protein. Variables which may be involved in the fusion
process are cell type (Giraudon et al., 1984), pH of medium
(Vialard et al., 1990) and level of expression of the fusion
protein (Norrby et al., 1982).
~xample 5 - SEROLOGIC~L TESTS
The technique for virus neutralizing (VN) antibody
testing was previously described in detail (Appel et al.,
1973). Testing for CDV-VN antibody titers was made in VERO
cells with the adapted Onderstepoort strain of CDV. Testing
for MV-VN antibody titers was made in VERO cells with the
adapted Edmonston strain of MV. The results of the
serological tests are shown in Table 1.
.
WO92~0R789 2C!~ PCT/USg1 /08703
17
Dogs immunized as described in Example 6 with
either the vaccinia parental virus or vP455 expressing the
measles fusion protein did not develop neutralizing antibody
to MV. ~ogs immunized with either vP557 expressing the HA
protein or co-inoculated with both recombinants vP455 and
vP557 did develop neutralizing antibodies after one
inoculation. Levels of antibody were equivalent to those
induced by inoculation with the attenuated Edmonston strain
Of MV.
,,. ., ~........ . . . - .
~, ~ - . . . .
.- . . .
.. - - - . ' "~
:
,
WO 92/08789 PCr/US91/0870~
2~!n~5'?~ 18
r~
o V V V V ~ ~ ~J C
C D CD V V V V ~
~ ,~ O~ O O _
u 0 t~l v V v v ~ v v .C S h
.~ ~: ~1 ~r a~
a ,, '' v v v ~ .
E ._~ o o o o t~l l~ t~ ~ .,~
U t` V V V V '~ .~ V
o VV VV VV VV
~ . ~ o ~~
N O . . ~ o
~1 ~ ~ 1 ~ ~ 0 0
a ~ r
a~) ~
~0 ~0
~o 1~ .
.~ .~ ~ O O O o~
C N D ~ ~ V V
. l . ', . ' :
,. ~ ~ ' '. ' .
- . :
- , . - .. . .:
:' ' ,, ~ : .
: . ' ' ~ . .
W092/08789 2(!956~3 PCTIUS91/08703
19
ExamPle 6 - ANIMAL PROTECTION STUDIES
In order to determine whether expression of the
measles virus proteins in dogs inoculated with the
recombinants was sufficient to induce a protective immune
response against CDV challenge, fourteen l0 week old
specific pathogen free beagle dogs were studied. Blood
samples were collected at the initiation of the experiment
and repeatedly thereafter. Four groups with two dogs in
each group were immunized with two injections three weeks
apart. The first group received vaccinia virus only. The
second group received vaccinia virus with an insert for the
F protein of measles virus (vP455). The third group
received vaccinia virus with an insert for the HA antigen of
MV (vP557), and the fourth group received a combination of 2
and 3. Each dog was inoculated with approximately 4 x 108
pfu of vaccinia virus in l ml amounts (0.6 ml subcutaneously
and 0;4 ml intramuscularly). Two control dogs received 105
50% tissue culture infectious doses (TCID50) of the
attenuated Edmonston strain of MV intramuscularly (l ml
amount) and two control dogs received 104 TCID50 of the
attenuated Rockborn strain of CDV subcutaneously two weeks
befo~e challenge with virulent CDV. Two control dogs
remained uninoculated before challenge.
All dogs were challenged by intranasal inoculation
of l ml of tissue culture fluid containing 104 TCIDso of the
Snyder Hill strain of virulent CDV two weeks after the last
inoculation. The clinical reactions of the dogs were
monitored by daily observations and recording of body
temperature and by biweekly recording of weight gain or
losses. Circulating blood lymphocytes were counted before
challenge and on days post challenge (dpc) 3, 5, 7 and l0.
Virus isolation from buffy coat cells by co-cultivation with
dog lung macrophages (Appel et al., 1967) was attempted on
dpc 3, 5, 7 and l0. Blood samples for serological tests
were collected before vaccination and in weekly intervals
until time of challenge, and on dpc 7, l0 and 20.
The results of challenge are shown in Table 2.
- . ,
-
. : :
:,,.- ' '
"
WO 92/08789 2~9~'~5~ PCr/US91/0870~
2'0
~: ooll ~11111 11~
:~ , ~
0 1,
Z ~; Z Z Z o I
h H ~0
o ~ S~2 O o ~ h
C 3 ~ C I I ` o z a ~ c, I ~ u
I o ~ C
¦ u ~ ~ '' I ' ~ ~ a a ~ '` ~
` ~ z 1` ~D Z ~) Z Z ~ ` : 3
~¦ ¦ ~ ~ ~ ~
~ ~o o ~ O .~ .
3 0 3 ~ ~ r z z z ~ Z Z ~ ~ q c
~ o ~ ~8~
-
3 æ o o~o t ~o
_1 ~ ~ 1 U~ U
U h I I I I aa aa aa aa ~ ~ .
~o a ~ ~r ~ ~ z z z zz æ z z -I ~ o
O h S ~
O ~ _ ~ ~ ~ ~ h
~ ~ j a ~:
U . ? ~ o _ _ _ _ _
., ,, . . : . .: , .
- - : .
,
' ':' :
'., ~' ' .
.... :. . . ..
... ./-
W O 92/08789 Z~c;5,,~ ~ ~ PC~r/US91/08703
21
Non-immunized control dogs and dogs vaccinated
with parental vaccinia virus developed clinical signs of
severe disease and were euthanized when dehydration was
evident~ Both dogs immunized with vP455 showed some signs
of infection with CDV including weight loss, elevated body
temperature, and lymphopenia although these symptoms were of
shorter duration than were seen in control dogs.
Nonetheless, both dogs survived lethal challenge with CDV.
Dogs inoculated with vP557 or co-inoculated with both
recombinants showed minimal signs of infection and survived
challenge. Dogs inoculated with either attenuated Edmonston
strain of MV or the attenuated Rockborn strain of CDV also
survived challenge with minimal signs of disease.
Exam~le 7 - ADDIT~ONAL VACCINIA/ME~SLES CONSTRUCTS
Referring now to Figure 3, a second vaccinia virus
recombinant containing the measles HA gene within the tk
locus was generated ~vP756) using insertion plasmid pRW843.
pRW843 was constructed in the following manner. A 1.8kbp
EcoRV/SmaI fragment containing the 3'-most 24bp of the H6
promoter fused in a precise ATG:ATG configuration with the
HA gene lacking the 3'-most 26bp was isolated from
pS~M2LHAVC. This fragment was used to replace the 1.8kbp
EcoRV/SmaI fragment of pSPMHAll to generate pRW803. Plasmid
pRW803 contains the entire H6 promoter linked precisely to
the entire measles HA gene.
In the confirmation of previous constructs with
the measles HA gene it was noted that the sequence for codon
18 (CCC) was deleted as compared to the published se~uence
(Alkhatib et al., 1986). The CCC sequence was replaced by
oligonucleotide mutagenesis via the Kunkel method (Kunkel,
1985) using oligonucleotide RW117 (SEQ ID N0:14) (5'-
GACTATCCTACTT-
CCCTTGGGATGGGGGTTATCTTTGTA-3').
Pro 18
Single stranded template was derived from plasmid pRW819
which contains the H6/HA cassette from pRW803 in pIBI25
(IBI, New Haven, CT.). The mutagenized plasmid containing
the inserted (CCC) to encode for a proline residue at codon
- - , , :
:-
- . .
... . :..... . :
W092/087X9 2~ `5~3 PCT/US91~08~03
22
18 was designated pRW820. The sequence ~etween the HindIII
and XbaI sites of pRW820 was confirmed by nucleotide
sequence analysis. The HindIII site is situated at the 5'
border of the H6 promoter while the XbaI site is located
230bp downstream from the initiation codon of the HA gene.
A l.6kbp XbaI/EcoRI fragment from pRW803, containing the HA
coding sequences downstream from the XbaI and including the
termination codon, was used to replace the equivalent
fragment of pRW820 resulting in the generation of pRW837.
The mutagenized expression cassette contained within pRW837
was derived by digestion with HindIII and EcoRI, blunt-ended
using the Klenow fragment of E. coli DNA polymerase in the
presence of 2mM dNTPs, and inserted into the SmaI site of
pSD573VCVQ to yield pRW843. The plasmid pRW843 was used in
in vitro recombination experiments with vP618 as the rescue
virus to yield vP756. Parental virus vP618 is a Copenhagen
strain virus from which the thymidine kinase, hemorrhagic
and A-type inclusion genes have been deleted. Recombinant
vP756 has been shown by immunoprecipitation analysis to
correctly express a hemagglutinin glycoprotein of
approximately 75kd.
Referring now to Figure 4, a second vaccinia virus
recombinant (vP800) harboring the measles fusion gene in the
ATI locus of the genome was generated using insertion
plasmid pRW850. To construct pRW850, the following
manipulations were performed. The plasmid pSPMF75M20
containing the measles fusion gene linked in a precise
ATG:ATG configuration with the H6 promoter was digested with
NruI and EaqI. The l.7kbp blunt ended fragment containing
the 3'-most 28bp of the H6 promoter and the entire fusion
gene was isolated and inserted into pRW823 digested with
NruI and XbaI and ~lunt-ended. The resultant plasmid pRW841
contains the H6 promoter linked to the measles fusion gene
in the pIBI25 plasmid vector (IBI, New Haven, CT.). The
H6/measles fusion expression cassette was derived from
pRW841 by digestion with SmaI and the resulting l.8kbp
fragment was inserted into pSD494VC digested with SmaI to
yield pRW850. The plasmid pRW850 was used in in vitro
.. ,.
,
:
~: :
WOs2/087~9 ~ PCT/US91/08703
recombination experiments with vP618 as the rescue virus to
yield vP800. Recombinant vP800 has been shown by
immunoprecipitation analysis to express an authentically
processed fusion glycoprotein.
ExamDle 8 - ~SSESSMENT OF ME~SLES NEUTRALIZING ~NTIBODY
IN GUINEA PIGS ~ND RABBITS INOC~LATED WI~X
VP455
Two rabbits were inoculated intradermally at 5
sites with a total of 1x108 pfu of recombinant vP455
expressing the measles fusion protein. Both rabbits were
boosted with an identical inoculation at week 12. Serial
bleeds were collected, and at week 14, two weeks after the
boost, the rabbits were tested for the presence of serum
neutralizing antibodies.
Four guinea pigs were inoculated subcutaneously
with 1x108 pfu each of recombinant vP455. An identical
booster inoculation was given at 21 days. Serial bleeds
were collected.
The presence of measles virus serum neutralizing
antibody was assessed using a microtiter test (Appel et al.,
1973) using 10 TCID50 of virus per microtiter well. The
results are shown in Table 3.
.
Wo 92/08789 Z~ ?. PCr~US91/n8703
24
J~
z z z z
.~ . ~ a o o E~ E~
I~ ~ I z z
o ~ ~ z
~-~/ O ~ l G
a ..
? ~ a z z z z z
0 o a a a ~ a ~ ~ o
o .~ ~ ~ ~ ' ~
~ J~ ~ -80
.,~,,, ,,, ., ~ . . . , .
. .
W092/08789 PCT/US91/08703
2~ 5"`~
Example 9 - GENERATION OF MEAS~ES VIRUS RECOMBINANT
CANARYPOX VIRUS
Measles/canarypox virus recombinants were
developed using a similar strate~y to that previously
described for fowlpox virus (Taylor et al., 1988a,b).
Plasmids for insertion of the measles F and HA .
genes into canarypox virus were generated as follows.
Referring now to Figure 5, the 1.8kbp blunt-ended
BqlII/EaaI fragment from p~PMF75M20 containing the H6
promoted measles F gene was inserted into the blunt-ended
EcoRI site of pRW764.2. Plasmid pRW764.2 contains a 3.4kbp
PvuII fragment from the canarypox genome having a unique
EcoRI site which has been determined to be non-essential for
viral replication. The resultant plasmid containing the
measles F gene was designated pRW800 and was used in
recombination experiments with canarypox as the rescuing
virus to generate vCP40.
Referring now to Figure 6, the 1.8kbp EcoRV/SmaI
fragment from pSPM2LHA containing the 3'-most 28bp of the H6
promoter fused in a precise ATG:ATG configuration with HA
was inserted between the EcoRV and SmaI sites of pSPM~A11.
The resultant plasmid was designated pRW803. A 2kbp
HindIII/EcoRI fragment of pRW803 containing the H6 promoted
measles HA gene was blunt-ended and inserted into the blunt-
ended BalII site of plasmid pRW764.5. Plasmid pRW764.5
contains an 800bp PvuII fragment of the canarypox genome
having a unique BqlII site which has previously been
determined to be non-essential for viral growth. This
insertion created plasmid pRW810 which was used in
recombination tests to generate vCP50.
Insertion of the measles F and HA sequences
individually led to the development of recombinants vCP40
and vCP50, respectively. In order to create a double
recombinant, the single F recombinant vCP40 was used as a
rescue virus for insertion of the HA gene contained in
pRW810. This led to the development of double recombinant
vCP57.
.. . . .
W092/0X789 PCT/US91/08703_
z~9~5~s 26
ExamDle 10 - IMMUNOPRECIPI'rA~IO~ AN~LYSIS
In order to confirm that recombinants vC~40, vCP50
and vCP57 expressed authentic proteins, immunoprecipitation
analysis was performed using mono-specific sera directed
against either the HA or F proteins. A co~rectly processed
fusion polypeptide was specifically precipitated from
lysates of cells infected with vCP40 and vCP57. The fusion
precursor Fo with a molecular weight of approximately 60kd
and the two cleavage products F1 and F2 with molecular
weights of approximately 44 and 23kd, respectively, were
detected. No fusion specific products were detectable in
uninfected CEF cells, parentally infected CEF cells or CEF
cells infected with the HA recombinant vCP50. Similarly, a
glycoprotein of approximately 75kd was specifically
precipitated from CEF cells infected with the single HA
recombinant vCP50 and double recombinant vCP57. No HA
specific products were detected in uninfected cells,
parentally infected cells or cells infected with fusion
recombinant vCP40.
Example ll - CELL FUSION EXPERIMENTS
In order to determine that the measles virus
recombinants were functionally active, cell fusion assays
were performed. VERO cell monolayers were infected with l
pfu per cell of CP parental or recombinant viruses and
examined for cytopathic effects at 18 hours post infection.
No cell fusing activity was evident in VERO cells inoculated
with parental, vCP40 or vCP50 viruses. However, when VERO
cells were inoculated with the double recombinant vCP57 or
when cells are co-infected with both vCP40 and vCP50,
efficient cell fusing activity is evident.
Ex~mple 12 - 8EROLOGICAL ~EST8
Dogs inoculated as described in Example 13 with
the canarypox/HA recombinant vCP50, vaccinia/HA recombinant
vP557, the canarypox/HA/F double recombinant vCP57 or co-
inoculated with vP455 and vP557 developed significant serum
neutralizing antibody to measles virus after one
inoculation. Neither of the two dogs inoculated with the
canarypox/F recombinant vCP40 developed neutralizing
': ' . ' :' '
W092/OX789 2~ ~5~3 PCT/US91/08703
27
antibody after one or two inoculations. The results of the
serological tests are shown in Table 4.
In addition, guinea pigs inoculated with the vCP40
recombinant did develop low but reproducible levels of serum
neutralizing antibody.
- .
Wo 92/08789 z~9r ~33 PCr/US91~0870~_
28 '
O O
,~ c~
oq ~ o O ~ o o u~ ~r o ~ O O O ~ ~
~ . ~) V V V V 'i r'~ ~ N ~ C:
J~ ~ O O ,~ o o o~ ~ o ~ u) o ~
.~ c~ v~ q v v ~ v 3
n ~ g
U ~ N r` O O 1~ 0 0 ~ O O ~ Ul
0 la :~ ~`1 V V V V V V N
E~ N U~ O O ~ t` O O 1` N . O 1~ a~ ~ I,q
O ~3 N t~ N ~i N
4 ~ ~ ~ ~
Q t` O O ~` I` O O O O O a- ~ Ll g
N -i N ~I N ~1
OO OO OO O0. 0 0 0
~ o V V V V V V '/'i V V V ~
,~ . (a N ~,
Z ~ O ~ ~ ~ U) N ~
a ~ ~ ~ ~ ~ ~
:~ . h U Rl
lo ~ cuc
~:: ~^ O o t~ 0~ o E~
, K
..
-
'' . ~
WO 92/087X9 2C?~ PCI/~1S91/08703
29
Example ~ 3 - P~NIMAL PROTECTION 5TUDIES
In order to determine whether non-replicating
canarypox vectors expressing measles virus proteins would
induce a protective immune response against CDV challenge,
ten week old specific pathogen free beagle dogs were
inoculated with canarypox parental and recombinant viruses.
Two dogs were inoculated simultaneously with two
subcutaneous injections of lx10 8 pfU of each recombinant at
three week intervals. For comparison, one dog was
inoculated in the same regimen with each of the single
vaccinia virus recombinants vP455 and vP557 and a
combination of both. One dog was also inoculated
intramuscularly with one dose of 105 TCID50 of the attenuated
Edmonston strai~ of MV. One dog was inoculated
subcutaneously with one dose of 104 TCID50 of the attenuated
Rockborn strain of CDV. Dogs were challenyed two weeks
after the final inoculation via intranasal inoculation with
a lethal dose of 104 TCIDsoof the virulent Snyder Hill
strain of CDV. Clinical reactions of dogs were monitored
daily. The results are shown in Table 5.
.
2~!9~5~
WO 92~087~9 ~ ` PC~/US91/0870
30~
,~ .
u ~ g--
~ H .
C ~ ~ 00 ~ 00 O
O ~ Ul
~a c.~ :~ ,
n~ ~v 5 0 0 0 ~ ~ 5 ~ .
E~ ~ ~ ~5 ~ ~ O
V o W o o o ~ ~ ~ ~O O c
U~ o o~
C~ h O ~ ~ ~ . ~1.~
_1 ~ I O z z O z zz z Z ~ Z V 3
c ~ r ,~
.~ O
N O _ `~ _ ~ h
.~ Z ~ ) 0-3
~ I X ~ a~
~ ~; ~c~ ~ Q
O r h O O ~ ;O ~ ~ `:
~1 H a ~ ~ 4 _ o _
..
-
WO92/08789 2C~S~3 PCT/US91/08703
31
No adverse reactions to vaccination were noticed
in any of the dogs during the course of the experiment. The
two dogs immunized with parental canarypox virus and two
non-immunized control dogs showed severe disease after
challenge with virulent CDV. All four dogs became
depressed, showed elevated body temperature, weight loss,
lymphopenia and severe dehydration. Dogs immunized with
CDV-Rockborn developed serum neutr~lizing antibodies against
CDV but not against MV prior to challenge and survived
challenge, symptom free. Dogs immunized with attenuated MV
developed serum neutralizing antibodies to MV but not CDV
prior to challenge, and survived challenge with mild signs
of infection. Dogs inoculated with vCP50, vCP57, vP557 or
co-inoculated with vP455 and vP557 developed significant
serum neutralizing antibody to MV after one inoculation and
survived challenge with only minor signs of infection.
Example 14 - ADDITIONAL CANARYPOX/MEASLES CONS~RUC~S
Referring now to Figure 7, to generate a canarypox
virus recombinant expressing the MV HA gene the following
insertion plasmids were created. A l.8kbp EcoRV/EcoRI
fragment from pRW837 containing the 3'-most 26bp of the H6
promoter linked precisely to the measles HA, was ligated to
a 3.2kbp EcoRV/EcoRI fragment from pRW838. The pRW838
derived fragment includes the 5' portion of the H6 promoter
and C5 locus flanking arms. Plasmids pRW83a and pRW831 (see
below) were derived as follows.
An 880 bp PvuII canarypox genomic fragment was
inserted between the PvuII sites of pUC9. the resultant
plasmid was designated pRW764.5. The nucleotide sequence of
the 880 bp canarypox fragment was determined using the
modified T7 enzyme SequenaseTM Kit (United States
Biochemical, Cleveland, OH) according to manufacturer's
specifications. Sequence reactions utilized custom
synthesized primers tl7-l8 mers) prepared with the Biosearch
8700 (San Rafael, CA) or Applied Biosystems 3800 (Foster
City, CA). This enabled the definition of the C5 open
reading frame.
W092/087~9 z~9~ ~ PC~/US91/0870~_
32
To specifically delete the C5 open reading frame,
pRW764.5 was partially cut with RsaI and the linear product
was isolated. The RsaI linear fragment was recut with BqlII
and the pRW764.5 fragment with a RsaI-BqlII deletion from
position 156 to position 462 was isolated and used as a
vector for the following synthetic oligonucleotides: RW145
(SEQ ID NO:15): (5'-ACTCTCA-
AAAGCTTCCCGGGAATTCTAGCTAGCTAGTTTTTATAAA-3') RW146 (SEQ ID
NO:16): (5'-
GATCTTTATAAAAACTAGCTAGCTAGAATTCCCGGGAAGCTTTTGAGAGT-3')
Oligonucleotides RW145 and RW146 were annealed and inserted
into the pRW764.5 RsaI-BglII vector described above. The
resulting plasmid is pRW831.
This C5 deletion plasmid was constructed without
interruption of other canarypox virus open reading frames.
The C5 coding sequence was replaced with the above annealed
oligonucleotides (RW145 and RW146) which include the
restriction sites for HindIII, SmaI, and EcoRI.
The plasmid pRW838, was derived from pRW831 by the
insertion of a SmaI fragment containing the Rabies G gene
(Taylor et al., 1988b) juxtaposed 3' to the vaccinia virus
H6 promoter. Ligation of the 1.8 kbp EcoRV/EcoRI fragment
from pRW837 with the 3.2 kbp EcoRV/EcoRI fragment from
pRW838 led to the construction of plasmid pRW852. Plasmid
pRW852 was used in recombination experiments with a
canarypox isolate designated ALVAC to yield vCP85. ALVAC is
a plaque cloned isolate of canarypox virus (CPV) derived
from the Rentschler strain, a highly attenuated strain of
CPV used for vaccination of canaries. Replication of ALVAC
and derived recombinants is restricted to avian species.
Immunoprecipitation analysis has confirmed that a protein of
approximately 75kd recognized by a rabbit anti-HA serum is
expressed in CEF cells infected with recombinant vCP85.
Referring now to Figure 8, to generate a canarypox
virus recombinant harboring both the MV HA and F genes the
following constructs were engineered. SmaI restriction
sites were added to the ends of the H6 promoted measles
fusion gene. To accomplish this, pRW823, which is pIBI25
... , .; ~ - . ~
- : : -
~ .
W092/~X7X9 2~ . PCT/US91/08703
33
containing the vaccinia virus H6 promoter, was digested
downstream of the promoter sequence at the XbaI site. The
ends were blunted with the Klenow fragment of the E. coli
DNA polymerase in the presence of 2mM dNTPs. The blunt-
ended DNA was subsequently digested with NruI to liberate a
3.Okbp fragment containing the S'-most lOObp o~ the H6
promoter. This fragment was isolated and ligated to a
l.7kbp blunt-ended EaqI/NruI fragment from pSPMF75. The
resultant plasmid was designated as pRW841.
The l.8kbp SmaI fragment derived by digestion of
pRW841 was inserted into the C5 deletion vector, pRW831.
The plasmid pRW85l was linearized at the EcoRI site situated
3' to the fusion gene and was blunt-ended with the Klenow
fragment of the E. coli DNA polymerase in the presence of
2mM dNTPs. The plasmid pRW837, containing the measles HA
gene juxtaposed 3' to the H6 promoter sequences, was
digested with HindIII and EcoRI and blunt-ended with the
Klenow fragment. The resultant l.8kbp fragment was isolated
and inserted into pRW851 that had been linearized with EcoRI
and blunt-ended. The resultant plasmid, which contains both
genes in a tail to tail configuration, was designated
pRW853A and was utilized in in vitro recombination
experiments with canarypox (ALVAC) as the rescue virus to
generate vCP82 also designated ALVAC-MV. Expression
analysis using immunoprecipitation and immunofluorescence
confirmed that in cells infected with recombinant vCP82
authentically processed HA and F proteins were expressed.
The recombinant was also functional for cell fusing
activity.
Re~ults of seroloaical analysis of sera of rabbits_and
ouinea ~iaC inoculated with_ LVAC-MV (vCP8~1
Four guinea pigs were inoculated by the
subcutaneous route with ALVAC-MV (vCP82). Two animals (026
and 027) each received lxlO8 pfu and two animals (028 and
029) each received lx107 pfu. At 28 days, animals were
re-inoculated with an identical dose. Two rabbits were
inoculated with lxlO8 pfu of ALVAC-MV (vCP82) by the
subcutaneous route. At 28 days, animals were re-inoculated
: - , ,
W092/0X789 2~ . PCT/US91/087~3
34
with an identical dose. Serial bleeds of these animals were
analyzed for measles virus neutralizing activity using
either a microtiter neutralizatlon test described by Appel
and Robson (1973) or a plaque reduction neutralization test
described by Albrecht et al. t198l). In addition, sera were
analyzed for the presence of antibody capable of blocking
measles virus induced cell-cell fusion in an anti-fusion
assay performed as ~escribed in Merz et al. (1980).
The results of analysis for the presence of
measles virus serum neutralizing antibody are shown in
Tables 6 and 7. Both guinea pigs (026 and 027) receiving
1x108 pfu of ALVAC-MV sero-converted after a single
inoculation and sera showed an antibody rise after the
booster inoculation. One animal (029) receiving lx107 pfu
also sero-converted after one inoculation. The fourth
animal (028) did not show a detectable response after one
inoculation but did achieve equivalent titers after the
second inoculation.
Rabbit sera were also analyzed using a plaque
reduction neutralization method. The results are shown in
Table 7. Both animals sero-converted after one inoculation.
Sera of rabbit 063 was tested by both the micro-titer
neutralization test and the plaque reduction neutralization
test. Titers achieved were similar using both methods. It
has been reported that a minimal serum neutralizing titer of
1.2 to 1.9 in vaccinated children is required for protection
from disease (Lennon and Black, 1986; Black et al., 1984).
Using this criteria, all animals, except the one guinea-pig
which did not sero-convert until the second inoculation
showed a protective level of antibody after one inoculation.
.. : - ~ ::
,;
W092/08789 2~ PCT/US91/08703
Table 6
Serological analysis of sera of guinea pigs inoculated with
ALVAC-MV (vCP82): Analysis performed by microtiter serum
neutralization assay.
Animal Days post-inoculation
0 14 21 28' 42 48 56
Guinea pigs
026d - N.T.a 1.25b1.49 2.45 2.682.92
027 - N.T. 1.97 1.49 2.68 2.452.21
028e - N.T. - - 1.73 2.451.97
029 - N.T. 0.8 1.49 2.45 2.452.45
a) Not tested.
b) Titer expressed as log10 of reciprocal of last dilution
showinq complete neutralization of cytopathic effect.
c) Animals boosted at 28 days post-inoculation.
d) Animals 026 and 027 received lx108 pfu.
e) Animals 028 and 029 received lx107 pfu.
-:: -. . . . .
:
:',
W092/OX789 ~ PCT/US91/0870~_
J ~ ~
36
~able 7
Serological analysis of sera of rabbits inoculated with
ALVAC-MV (vCP823
Animal Days post-inoculation
0 14 21 28b42 56
_ _ __
Plaque reduction method
063 ~ l.9a 2.8 1.62.2 2.2
064 - 2.2 2.5 2.83.1 2.8
Microtiter neutraliæation method
063 _ 1.5c 1.7 1.51.7
-
a) Titer expressed as log10 of reciprocal of last dilution
showing a 50~ reduction in plaque number as compared to
pre-inoculation serum.
b) Animals boosted at 28 days post-inoculation.
c) Titer expressed as log10 of reciprocal of last dilution
showing complete neutralization of cytophatic effect.
.
W092/08789 PCT/US91/0870
~r~ G~
Previous studies have shown that an inactivated
vaccine was associated with poor protective efficacy and an
enhanced measles disease on re-exposure to the virus.
Recipients of the inactivated vaccine demonstrated an
absence of antibody to the fusion protein and it was
proposed that the inactivation process had rendered the
protein non-immunogenic (Norrby and Gollmar, 1975; Norrby et
al., 1975). In addition, it has been shown for other
paramyxoviruses that antibody to the F protein is able to
inhibit cell to cell spread of virus in tissue culture while
antibody to the hemagglutinin component is not (Merz et al.,
1980).
It was therefore significant to demonstrate that
animals inoculated with ALVAC-MV (vCP82) were able to induce
antibody to the F component which was capable of blocking
cell to cell transmission of measles virus. The results of
this anti-fusion assay are shown in Table 8. Anti-fusion
activity was evident in sera of both guinea-pigs and rabbits
inoculated with ALVAC-MV (vCP82). The sera analyzed was
taken two or three weeks after the boost inoculation. No
anti-fusion activity could be detected in sera of rabbits
inoculated with ALVAC parental virus.
-
~ ' :
W092/08789 ~Q~ ~3 PCr/US91/0870
38
~able 8
Analysis of sera of guinea pigs and rabbits inoculated with
ALVAC-MV for anti-fusio~ activity
_ _ _ _
Animal Designation Immunogen Anti-Fusion Titer
Pre-inoc. Post-Vacc.
. . _ .
Guinea-pig 026 ALVAC-MV - 2 4a, b
027 ALVAC-MV - 1.2
Rabbit 063 ALVAC-MV - 1.8C
064 ALVAC-MV - 1.8
Rabbit W121 ALVAC
W123 ALVAC
.
a) Guinea pig sera tested at 7 weeks post-vaccination.
b) Titer expressed as log10 of reciprocal of highest
dilution showing complete inhibition of measles virus
induced cell fusing activity.
c) Rabbit sera test at 6 weeks post-vaccination.
.: ., : ............................. . : . , : :
: .
. . .
WO92/08~8s PCl/US91/08703
2~ 5~s
In further tests to demonstrate the presence of
antibody to both the Mv hemagglutinin and MV fusion proteins
in sera of animals inoculated with ALVAC-MV,
immunoprecipitation experiments were performed. Sera of
rabbits inoculated with ALVAC-MV was shown to specifically
precipitate both the hemagglutinin and fusion proteins from
radiolabelled lysates of Vero cells infected with Edmonston
strain MV.
In a similar study, groups of guinea pigs, rabbits
and mice were inoculated by the intra muscular route with
ALVAC-MV, and their serological response to measles virus
monitored using the hemagglutination-inhibition (HI) test.
The serological response to canarypox virus was monitored by
ELISA assay. In this study, five guinea pigs were
inoculated with 5.S log10 TCIDso, thirty mice were inoculated
with 4.8 log10 TCIDso, and five rabbits were inoculated with
5.8 log10 TCIDso. All animals were re-inoculated at 28 days
with an equivalent dose. Animals were bled at regular
intervals and their response to measles virus assessed in an
HI assay. The limit of detection in the HI assay
corresponds to a logl0 titer of l and it is considered that
sero-positive (protected) children have a serum titer in the
range of l.6 to 2.8. The results of analysis are shown in
Tables 9, l0 and ll.
Sera of mice were analyzed in groups of 5 animals
(Table 9). All animals showed a primary response to
canarypox virus which was boosted after the second
inoculation. The mice did not show a response to MV after
one inoculation. Three of the six groups showed titers
within the protective range at 8 weeks post-inoculation.
Similarly, all guinea-pigs (Table l0) showed a response to
canarypox virus after one inoculation which was boosted
after the second inoculation. Four of five animals
developed anti-HI titers after one inoculation, one of these
being in the protective range. One week after the second
inoculation, the titers of all animals were in the
protective range. These titers were maintained through 8
weeks post-inoculation when the experiment was concluded.
~, .
~VO 92/0~89 - PC~r/US91/08~03
2~!9''~ 40
All rabbits (Table 11) inoculated with ALVAC-MV (vCP82)
responded serologically to canarypox inoculation. Four of
five animals sero-converted to measles virus after one
inoculation (one in the protective range). Serum titers of
all animals were in the protective range one week after the
second inoculation.
: i .. - . ,
. .
'
W092/08789 2~ . PCT/US~1/08703
41
Table 9
Serological response of mice to inoclllation with ALVAC-MV
(vCP82)
Anti-canaryDox response
-
ELISA TITER Week post-inoculatlon
Mouse Group 0 2 4 5 6 8
a - O. oosDo. 364 0.193 1.821 1.616 1.123
2 -0.0260.0470.240 1.739 1.963 1.986
3 -0.0060.1480.641 1.860 1.861 1.947
4 -0.00~0.1300.451 1.506 1.937 1.124
0.687 0.542
Mean -0.0120.2750.413 1.732 1.844 1.395
Anti-measles response
HI TITER Week post-inoculation
Mouse Group o 2 4 5 6 8
c -
<1 <1 <1 <1
2 <1 <1 <1 1 1.6 1.6
3 <1 <1 1 1 2.2 2.2
4 <1 <1 <1 1.6 1 1.8
~ <1 <1 <1 1.3 1.8 1.2
Mean - - 1 1.2 1.5 1.5
a) Groups of five mice were exsanguinated and sera
pooled.
b) Optical density in an ELISA assay on sera at
dilution of 1:800
c) Limit of detection in HI test corresponds to a log10
titer of 1 i.e. 1:10 dilution. Titer expressed as
logt0 of reciprocal of highest dilution showing
inhlbition of hemagglutination.
W092/08~89 2(~9~C~ PCT/US91/0870.~_
42
Table 10
Serological response of guinea-pigs to inoculation with
ALVAC-MV (vCP82)
Anti-canarypox res~onse
ELISA TITER Week post-inoculation
Guinea-pig0 2 4 5 6 8
1 0.038a 0.045 0.111 .771 1.970 1.856
2 0.010 0.072 0.234 1.768 1.786 1.785
3 -0.011 0.426 0.529 1.567 1.586 1~700
4 0.016 0.045 0.076 1.583 1.6g6 1.635
-0.020 0.012 0.C50 1.583 1.859 1.847
Anti-measles response
HI TITER Week post-inoculation
Guinea pig 0 2 4 5 6 8
_ _
1 <lb 1.18 1.90 3.11 3.41 3.11
2 <1 <1 1.00 2.20 2.20 2.08
3 <1 <1 1.18 2.512.68 2.98
4 <1 <1 <1 1.601.90 1.90
<1 <l 1.30 1.902.20 2.20
a) Optical density in an ELISA assay on serum at a
1:3200 dilution.
b) Limit of detection in HI test corresponds to a log10
titer of 1 i.e. 1:10 dilution. Titer expressed as
in legend to Table 9.
,, , , ., , - . , ~ : : , -
, - - , . .
- ' ' '~ ' ' ' , ' ' . :
,~
: ' .:, ' . '
W092/0X7X9 2~9~;,5~ : PcT/US91/08703
43
Table 11
Serological response of rabbits to inoculation with ALVAC-MV
(vCP82)
Anti-canarypox response
ELISA TITER Week post-inoculation
Rabbit 0 2 4 5 6 8
la -0.009~ 0.085 0.113 1.953 1.754 1.249
2 -0.002 0.06S 0.068 0.717 0.567 0.353
3 -0.003 0.090 0.079 0.921 0.692 0.481
4 -0.005 0.034 0.068 1.558 1.324 1.076
-0.003 0.072 0.092 1.785 1.226 0.710
Anti-measles res~onse
_
HI TITER Week post-inoculation
Rabbit 0 2 4 5 6 8
-
1 <lb <1 1.00 2.81 2.51 2.20
2 <1 <1 <1 2.20 1.90 1.60
3 <1 <1 1.30 2.81 2.51 2.38
4 <1 1.30 1.60 3.11 3.11 2.51
<1 1.00 1.30 2.68 2.38 1.90
,
a) Optical density in an ELISA assay on sera at a
dilution of 1:1600.
b) Limit of detection in HI test corresponds to a log10
titer of 1 i.e. 1:10 dilution. Titer expressed as
in legend to Table 9.
: .- . . . .
,:- .. : ~. ' '
: , :
W092/OX789 2~9f~ PCT/US91/0870
44
Results of ~eroloqical analYsis of sera of squirrel monkeYs
inoculated with ~LVAC-MV tvCP82): Influence of Prior
exposure to poxvir~s on induction of a measles virus
specific immune response
Nine squirrel monkeys (Saimiri sciureus) were
inoculated with ALVAC-MV (vcP82). All monkeys were naive to
measles virus. Seven of the monkeys had prior exposure to
vaccinia virus and/or canarypox virus. The previous
immunization history is shown in Table 12. All monkeys were
inoculated with one dose of ~.8 log10 pfu by the
subcutaneous route. Four of the animals (#3g, 42, 53 and
58) were re-inoculated with an equivalent dose fifteen weeks
after the primary inoculation. Anti-measles antibody was
measured in the HI test. The results are shown in Table 12.
After the first inoculation, two of the nine monkeys
showed a low response to inoculation with ALVAC-MV. After
the second inoculation, the four monkeys re-inoculated all
sero-converted with significant antibody titers in the range
required for protective immunity. The titers achieved were
equivalent whether the monkey had prior exposure to vaccinia
virus and ALVAC or no prior poxvirus exposure.
:'.' ~ ~
, '
. .
WOs2/08789 2~ ? ~ PCT/US91/08703
Table 12
Inoculation of squirre~ monkeys with ALVAC-MV (vCP82):
Immune response in the face of pre-existing ALVAC immunity.
Monkey # Previous Immunity Anti-Measles HI response
to Poxviruses Primarya Boostb
36 W , ALVAC <1 N.B.
37 W , ALVAC-RG <1 N.B.
39 W , ALVAC-RG, CP-FeLV 1 2.2.
W , CP-FeLV <1 N.B.
42 None <1 2.2.
52 ALVAC <1 N.B.
53 ALVAC-RG, ALVAC-RG<1 1.6.
56 CP-FeLV <1 N.B.
58 None 1 2.2.
W : Vaccinia virus, Copenhagen strain
ALVAC-RG: ALVAC recombinant expressing rabies G gene
CP-FeLV: Canarypox recombinant expressing FeLV env
gene
NB: Not boosted
a) Animals received 5.8 log~0 pfu by S.C. route.
b) Animals 39, 42, 52 and 53 were boosted with an
identical dose 15 weeks after the first inoculation.
~.. ,............................... , - - . ~
',.
:. .. .
W092/OX789 2(!9~,6~ - PCT/US91/08~0~
46
Example 15 - ATTENUATED VACCINIA VACCINE STRAIN NYVAC
To develop a new vaccinia vaccine strain, the
Copenhagen vaccine strain of vaccinia virus was modified by
the deletion of six nonessential regions of the genome
encoding known or potential virulence ~actors. The
se~uential deletions are detailed below. All designations I -
of vaccinia restriction fragments, open reading frames and
nucleotide po itions are based on the terminology reported
in Goebel et al. (1990a,b).
The deletion loci were also engineered as recipient
loci for the insertion of foreign genes.
The regions sequentially deleted in NYVAC are listed
below. Also listed are the abbreviations and open reading
frame designations for the deleted regions (Goebel et al.,
l990a,b) and the designation of the vaccinia recombinant
(vP) containing all deletions through the deletion
specified:
(1) thymidine kinase gene (TK; J2R) vP410;
(2) hemorrhagic region (u; B13R + B14R) vP553;
(3) A type inclusion body region (ATI; A26L) vP618;
(4) hemagglutinin gene (HA; A56R) vP723; -
(5) host range gene region (C7L - KlL) vP804; and
(6) large subunit, ribonucleotide reductase (I4L) vP866
(NYVAC).
DNA Clonina and Synthesis
Plasmids were constructed, screened and grown by
standard procedures (Maniatis et al., 1986; Perkus et al.,
1985; Piccini et al., 1987). Restriction endonucleases were
obtained from GIBCO/BRL, Gaithersburg, MD, New England
Biolabs, Beverly, MA; and Boehringer Mannheim Biochemicals,
Indianapolis, IN. Klenow fragment of E. coli polymerase was
obtained from Boehringer Mannheim Biochemicals. BAL-31
exonuclease and phage T4 DNA ligase were obtained from New
England Biolabs. The reagents were used as specified by the
various suppliers.
Synthetic oligodeoxyribonucleotides were prepared on
a Biosearch 8750 or Applied Biosystems 380B DNA synthesizer
as previously described (Perkus et al., 1989). DNA
- ' ~ .
.. , ~ ......................... ... ~ . . ::
~ '' . ' ` -
W092/087~9 2~ Pcr~us9l/08703
47
sequencing was performed by the dideoxy-chain termination
method (Sanger et al., 1977) using Sequenase (Tabor et al.,
1987) as previously described (Guo et al., 1989). DNA
amplification by polymerase chain reaction (PCR) for
sequence verification (Engelke et al., 1988) was performed
using custom synthesized oligonucleotide primers and GeneAmp
DNA amplification Reagent Kit (Perkin Elmer Cetus, Norwalk,
CT) in an automated Perkin Elmer Cetus DNA Thermal Cycler.
Excess DNA sequences were deleted from plasmids by
restriction endonuclease digestion followed by limited
digestion by BAL-31 exonuclease and mutagenesis (Mandecki,
1986) using synthetic oligonucleotides.
Cells~ Virus, and Transfection
The origins and conditions of cultivation of the
Copenhagen strain of vaccinia virus has been previously
described (Guo et al., 1989). Generation of recombinant
virus by recombination, in situ hybridization of
nitrocellulose filters and screening for Beta-galactosidase
activity are as previously described (Panicali et al., 1982;
Perkus et al., 1989).
Construction of Plasmid pSD460 for Deletion of T~Ymidine
Rinase Gene (J2R)
Referring now to FIG. 9, plasmid pSD406 contains
vaccinia HindIII J (pos. 83359 - 88377) cloned into pUC8.
pSD406 was cut with HindIII and PvuII, and the 1.7 kb
fragment from the left side of HindIII J cloned into pUC8
cut with HindIII/SmaI, forming pSD447. pSD447 contains the
entire gene for J2R (pos. 83855 - 84385). The initiation
codon is contained within an NlaIII site and the termination
codon is contained within an Ss~I site. Direction of
transcription is indicated by an arrow in FIG. 9.
To obtain a left flanking arm, a 0.8 kb
HindIII/EcoRI fragment was isolated from pSD447, then
digested with NlaIII and a 0.5 kb HindIII/NlaIII fragment
isolated. Annealed synthetic oligonucleotides
MPSYN43/MPSYN44 (SEQ ID N0:17/SEQ ID N0:18)
2~
WO92/Og789 PCTtUS91/08703.-
48
SmaI
MPSYN43 5' TAATTAACTAGCTACCCGGG 3'
MPSYN44 3' GTACATTAATTGATCGATGGGCCCTTAA 5'
NlaIII EcoRI
were ligated with the 0.5 kb HindIII/NlaIII fragment into
pUCl8 vector plasmid cut with HindIII/EcoRI, generating
plasmid pSD449.
To obtain a restriction fragment containing a
vaccinia right flanking arm and pUC vector sequences, pSD447
was cut with SspI ~partial) within vaccinia sequences and
HindIII at the pUC/vaccinia junction, and a 2.9 kb vector
fragment isolated. This vector fragment was ligated with
annealed synthetic oligonucleotides MPSYN45/MPSYN46 (SEQ ID
NO:19/SEQ ID NO:20) -
HindIII SmaI
MPSYN45 5' AGCTTCCCGGGTAAGTAATACGTCAAGGAGAAAACGAA
MPSYN46 3' AGGGCCCATTCATTATGCAGTTCCTCTTTTGCTT
NotI SspI
ACGATCTGTAGTTAGCGGCCGCCTAATTAACTAAT 3' MPSYN45
TGCTAGACATCAATCGCCGGCGGATTAATTGATTA 5' MPSYN46
generating pSD459.
To combine the left and right flanking arms into one
plasmid, a 0.5 kb HindIlI/SmaI fragment was isolated from
pSD449 and ligated with pSD459 vector plasmid cut with
HindIII/SmaI, generating plasmid pSD460. pSD460 was used as
donor plasmid for recombination with wild type parental
vaccinia virus Copenhagen strain VC-2. 32p labeled probe
was synthesized by primer extension using MPSYN45 (SEQ ID
NO:19) as template and the complementary 20mer
oligonucleotide MPSYN47 (SEQ ID N0:21)
(5'-TTAGTTAATTAGGCGGCCGC-3') as primer. Recombinant virus
vP410 was identified by plaque hybridization.
Construction of Plasmid pSD486 for Deletion of Hemorrha~ic
Reaion ~B13R + B14R)
Referring now to FIG. 10, plasmid pSD419 contains
vaccinia SalI G (pos. 160,744-173,351) cloned into pUC8.
pSD422 contains the contiguous vaccinia SalI fragment to the
right, SalI J (pos. 173,351-182,746) cloned into pUC8. To
construct a plasmid deleted for the hemorrhagic region, u,
.
.
WO ~2/08789 2C~9~ J~`?~ PCI/IJS91/08703
49
Bl3R - B14R (pos. 172,549 ~ 173,552), pSD419 was used as the
source for the left flanking arm and pSD422 was used as the
source of the right flan~ing arm. The direction of
transcription for the u region is indicated by an arrow in
FIG. 10.
To remove unwanted sequences from pSD419, sequences
to the left of the NcoI site (pos. 172,253) were removed by
digestion of pSD419 with NcoI/SmaI followed by blunt ending
with Klenow fragment of E. coli polymerase and ligation
generating plasmid pSD476. A vaccinia right flanking arm
was obtained by digestion of pSD422 with H~aI at the
termination codon of B14R and by digestion with NruI 0.3 kb
to the right. This 0.3 kb fragment was isolated and ligated
with a 3.4 kb HincII vector fragment isolated from pSD476,
generating plasmid pSD477. The location of the partial
deletion of the vaccinia u region in pSD477 is indicated by
a triangle. The remaining B13R coding sequences in pSD477
were removed by digestion with ClaI/HpaI, and the resulting
vector fragment was ligated with annealed synthetic
oligonucleotides SD22mer/SD20mer (SEQ ID NO:22/SEQ ID NO:23)
ClaI BamHI HpaI
SD22mer 5' CGAT~ACTATGAAGGATCCGTT 3'
SD20mer 3' TAATGATACTTCCTAGGCAA 5'
generating pSD479. pSD479 contains an initiation codon
(underlined) followed by a BamHI site. To place E. coli
Beta-galactosidase in the B13-B14 (u) deletion locus under
the control of the u promoter, a 3.2 kb BamHI fragment
containing the Beta-galactosidase gene (Shapira et al.,
1983) was inserted into the BamHI site of pSD479, generating
pSD479BG. pSD479BG was used as donor plasmid for
recombination with vaccinia virus vP410. Recombinant
vaccinia virus vP533 was isolated as a blue plaque in the
presence of chromogenic substrate X-gal. In vP533 the B13R-
B14R region is deleted and is replaced by Beta-
galactosidase.
To remove Beta-galactosidase sequences from vP533,
plasmid pSD486, a derivative of pSD477 containing a
polylinker region but no initiation codon at the u deletion
'' : , ' ' ~;
,
W092/OR789 2~`~5'~i~?. PCT/US91/0870~
junction, was utilized. First the ClaI/HpaI vector fragment
from pSD477 referred to above was ligated with annealed
synthetic oligonucleotides SD42mer/SD40mer (SEQ ID NO:24/SEQ
ID NO:25)
ClaI SacI Xhol H~aI
SD42mer 5' CGATTACTAGATCTGAGCTCCCCGGGCTCGAGGGATCCGTT 3'
SD40mer 3' TAATGATCTAGACTCGAGGGGCCCGAGCTCCCTAGGCAA 5'
BqlII SmaI amHI
generating plasmid pSD478. Next the EcoRI site at the
pUCtvaccinia junction was destroyed by digestion of pSD478
with EcoRI followed by blunt ending with Klenow fragment of
E. coli polymerase and ligation, generating plasmid pSD478E
. pSD478E- was digested with BamHI and HpaI and ligated
with annealed synthetic oligonucleotides HEM5/HEM6 (SEQ ID
NO:26/SEQ ID NO:27)
BamHI EcoRI H~aI
HEM5 5' GATCCGAATTCTAGCT 3'
HEM6 3' GCTTAAGATCGA 5'
generating plasmid pSD486. pSD486 was used as donor plasmid
for recombination with recombinant vaccinia virus vP533,
generating vP553, which was isolated as a clear plaque in
the presence of X-gal.
Construction of Plasmid PMP494~ for Deletion of ATI Re~ion
tA26L)
Referring now to FIG. ll, pSD414 contains SalI B
cloned into pUC8. To remove unwanted DNA sequences to the
left of the A26L region, pSD414 was cut with XbaI within
vaccinia sequences (pos. 137,079) and with HindIII at the
pUC/vaccinia junction, then blunt ended with Klenow fragment
of E. coli polymerase and ligated, resulting in plasmid
pSD483. To remov~ unwanted vaccinia DNA sequences to the
right of the A26L region, pSD483 was cut with EcoRI (pos.
140,665 and at the pUC/vaccinia junction) ~nd ligated,
forming plasmid pSD484. To remove the A26L coding region,
pSD484 was cut with NdeI (partial) slightly upstream from
the A26L ORF (pos. 139,004) and with HPaI (pos. 137,889~
slightly downstream from the A26L ORF. The 5.2 kb vector
fragment was isolated and ligated with annealed synthetic
oligonucleotides ATI3/ATI4 (SEQ ID NO:28/SEQ ID NO:29)
.
.
~...................... .
:, : , .
; . ' ~ '
~92/08789 2~ ,5 ~ ; ; PCT/US91/087~3
51
NdeI
ATI3 5' TATGAGTAACTTAACTCTTTTGTTAATTAAAAGTATATTCAAAAAATAAGT
ATI4 3' ACTCATTGAATTGAGAAAACAATTAATTTTCATATAAGTTTTTTATTCA
~lII EcoRI HPaI
TATATAAATAGATCTGAATTCGTT 3' ATI3
ATATATTTATCTAGACTTAAGCAA 5' ATI4
reconstructing the region upstream from A26L and replacing
the A26L ORF with a short polylinker region containing the
restriction sites BalII, EcoRI and HPaI, as indicated above.
The resulting plasmid was designated pSD485. Since the
BalII and EcoRI sites in the polylinker region of pSD485 are
not unique, unwanted BqlII and EcoRI sites were removed from
plasmid pSD483 (described above) by digestion with BalII
(pos. 140,136) and with EcoRI at the pUC/vaccinia junction,
followed by blunt ending with Klenow fragment of E. coli
polymerase and ligation. The resulting plasmid was
designated pSD48s. The 1.8 kb ClaI (pos. 137,198)tEcoRV
(pos. 139,048) fragment from pSD489 containing the A26L ORF
was replaced with the corresponding 0.7 kb polylinker-
containing ClaI/EcoRV fragment from pSD485, generating
pSD492. The B~lII and EcoRI sites in the polylinker region
of pSD492 are unique.
A 3.3 kb BalII cassette containing the E. coli Beta-
galactosidase gene (Shapira et al., 1983) under the control
of the vaccinia 11 kDa promoter (Bertholet et al., 1985;
Perkus et al., 1990) was inserted into the BalII site of
pSD492, forming pSD493KBG. Plasmid pSD493KBG was used in
recombination with rescuing virus vP553. Recombinant
vaccinia virus, vP581, containing Beta-galactosidase in the
A26L deletion region, was isolated as a blue plaque in the
presence of X-gal.
To generate a plasmid for the removal of Beta-
galactosidase sequences from vaccinia recombinant virus
vP581, the polylinker region of plasmid pSD492 was deleted
by mutagenesis (Mandecki, 1986) using synthetic
oligonucleotide MPSYNl77 tSEQ ID NO:30) (5'-
AAAATGGGCGTGGATTGTTAACTTTATATA-ACTTATTTTTTGAATATAC-3'). In
the resulting plasmid, pMP494~, vaccinia DNA encompassing
positions [137,889 - 138,937~, including the entire A26L ORF
.. . ~ ,. -. ~ .
~, '" . ~ : ' ' .
WO92~0R789 2C`9S~`~3 PCT/US91/08703
52
is deleted. Recombination between the pMP494~ and the Beta-
galactosidase containing vaccinia recombinant, vP581,
resulted in vaccinia deletion mutant vP618, which was
isolated as a clear plaque in the presence of X-gal.
Construction of Plasmid PSD467 for Deletion o~ Hemaq~lutinin
Gene ~A56R)
Referring now to FIG. 12, vaccinia SalI G
restriction fragment (pos. 160,744-173,351) crosses the
HindIII A/B j~nction (pos. 162,539). pSD419 contains
vaccinia SalI G cloned into pUC8. The direction of
transcription for the hemagglutinin (HA) gene is indicated
by an arrow in FIG. 12. Vaccinia sequences derived from
HindIII B w~re removed by digestion of pSD419 with HindIII
within vaccinia sequences and at the pUC/vaccinia junction
followed by ligation. The resulting plasmid, pSD456,
contains the HA gene, A56R, flanked by 0.4 kb of vaccinia
sequences to the left and 0.4 kb of vaccinia sequences to
the right. A56R coding sequences were re~.oved by cutting
pSD456 with RsaI (partial; pos. 161,090) upstream from A56R
coding sequences, and with EaqI (pos. 162,054) near the end
of the gene. The 3.6 kb RsaI/EagI vector fragment from
pSD456 was isolated and ligated with annealed synthetic
oligonucleotides MPSYN59 (SEQ ID NO:31), MPSY62 (SEQ ID
NO:32), MPSYN60 (SEQ ID NO:33), and MPSYN 61
(SEQ ID NO:34)
RsaI
MPSYN59 S'ACACGAATGATTTTCTAAAGTATTTGGAAAGTTTTATAGGTAGTTGATAGA-
MPSYN62 3' TGTGCTTACTAAAAGATl-rCATAAACCmCAAAATATCCATCAACTATCT
5'
MPSYN59 -ACAAAATACATAATT~
Balll
MPSYN60 5' TGTAAAAATAAATCACTTTTTATACTAAGATCT-
MPSYN6 1 3 ' TGTTTTATGTATTAAAACATTTTTATTTAGTGAAAAATATGATTCTAGA-
Smal Pstl Ea~l
MPSYN60 -CCCGGGCTGCAGC 3'
MPSYN61 -GGGCCCGACGTCGCCGG S'
reconstructing the DNA sequences upstream from the A56R ORF ~-
and replacing the A56R ORF with a polylinker region as
indicated above. The resulting plasmid is pSD466. The
.. . .
' "' ' " ' '
WO 92/08789 PCT/US91/08703
53
vaccinia deletion in pSD466 encompasses positions [161,185-
162,053]. The site of the deletion in pSD466 is indicated
by a triangle in FIG. 12.
A 3.2 kb BglII/BamHI (partial) cassette containing
the E. coli Beta-galactosidase gene (Shapira et al., 1983)
under the control of the vaccinia 11 kDa promoter (Bertholet
et al., 1985; Guo et al., 1989) was inserted into the BglII
site of pSD466, forming pSD466KBG. Plasmid pSD466KBG was
used in recombination with rescuing virus vP618.
Recombinant vaccinia virus, vP708, containing Beta-
galactosidase in the A56R deletion, was isolated as a blue
plaque in the presence of X-gal.
Beta-galactosidase sequences were deletion from vP708
using donor plasmid pSD467. pSFD467 is identical to pSD466,
the pUC/vaccinia junction by digestion of pSD466 with
EcoRI/BamHI followed by blunt ending with Klenow fragment of
E. coli polymerase and ligation. Recombination between
vP708 and pSD467 resulted in recombinant vaccinia deletion
mutant, vP723, which was isolated as a clear plaque in the
presence of X-gal.
Construction of Plasmid pMPCSK1.DELTA. for Deletion of Open
Reading Frames [C7L-K1l]
Referring now to FIG. 13, the following vaccinia
clones were utilized in the construction of pMPCSK1.DELTA..
pSD420 is SalI H cloned into pUC8. pSD435 is KpnI F cloned
into pUC18. pSD435 was cut with SphI and religated, forming
pSD451. In pSD451, DNA squences to the left of the SphI
site (pos. 27,416) in HindIII M are removed (Perkus et al.,
1990). pSD460 is HindIII M cloned into pUC8.
To provide a substrate for the deletion of the [C7L-
K1L] gene cluster from vaccinia, E. coli Beta-galactosidase
was first inserted into the vaccinia M2L deletion locus (Guo
et al., 1990) as follows. To elimiante the BqlII site in
pSD409, the plasmid was cut with BglII in vaccinia sequences
(pos. 28,212) and with BamHI at the pUC/vaccinia junction,
then ligated to form plasmid pMP409B. pMP409B was cut at
the unique SphI site (pos. 27,416). M2L coding sequences
W092/08789 PCT/US91/0870
2 ~ 9cjG~ 54
were removed by mutagenesis (Guo et al., l990; Mandecki,
1986) using synthetic oligonucleotide
BqlII
MPSYN82 (SEQ ID N0:35) 5'
TTTCTGTATATTTGCACCAATTTAGATCTTACTCAAAA
TATGTAACAATA 3'
The resulting plasmid, pMP409D, contains a unique BqlII site
inserted into the M2L deletion locus as indicated above. A
3.2 kb BamHI (partial)/BqlII cassette containing the E. coli
Beta-galactosidase gene (Shapira et al., 1983) under the
control of the 11 kDa promoter (Bertholet et al., 1985) was
inserted into pMP409D cut with 8qlII. The resulting
plasmid, pMP409DBG (Guo et al., l990), was used as donor
plasmid for recombination with rescuing vaccinia virus
vP723. Recombinant vaccinia virus, vP784, containing Beta-
galactosidase inserted into the M2L deletion locus, was
isolated as a blue plaque in the presence of X-gal.
A plasmid deleted for vaccinia genes [C7L-KlL] was
assembled in pUC8 cut with SmaI, HindIII and blunt ended
with Klenow fragment of E. coli polymerase. The left
flanking arm consisting of vaccinia HindIII C sequences was
obtained by digestion of pSD420 with XbaI (pos. 18,628)
followed by blunt ending with Klenow fragment of E. coli
polymer~se and digestion with BqlII (po5. 19,706). The
right flanking arm consisting of vaccinia HindIII K
sequences was obtained by digestion of pSD451 with BqlII
(pos. 29,062) and EcoRV (pos. 29,778). The resulting
plasmid, pMP581CX is deleted for vaccinia sequences between
the BalII site (pos. 19,706) in HindIII C and the BalII site
(pos. 29,062) in HindIII K. The site of the deletion of
vaccinia sequences in plasmid pMP581CK is indicated by a
triangle in FIG. 13.
To remove excess DNA at the vaccinia deletion
jun~tion, plasmid pMP581CK, was cut at the NcoI sites within
vaccinia sequences (pos. 18,811; 19,655), treated with Bal-
31 exonuclease and subjected to mutagenesis (Mandecki, 1986)
using synthetic oligonucleotide MPSYN233 (SEQ ID N0:36) 5'-
TGTCATTTAACACTA-
~V092/0X7~9 ~?'~ 3 PCT/US91/08703
S5
TACTCATATTAATAAAAATAATATTTATT-3'. The resulting plasmid,
pMPCSKl~, is deleted for vaccinia sequences positions
18,805-29,108, encompassing 12 vaccinia open reading frames
~C7L - KlL]. Recombination between pMPCSK1~ and the Beta-
galactosidase containing vaccinia recombinant, vP784,
resulted in vaccinia deletion mutant, vP804, which was
isolated as a clear plaque in the presence of X-gal.
Construction of Plasmid ~SD548 for Deletion of Larqe
8ubunit, Ribonucleotide Reductase ~I4L)
Referring now to FIG. 14, plasmid pSD405 contains
vaccinia HindIII I (pos. 63,875-70,367) cloned in pUC8.
pSD405 was digested with EcoRV within vaccinia sequences
(pos. 67,933) and with SmaI at the pUC/vaccinia junction,
and ligated, forming plasmid pSD518. pSD518 was used as the
source of all the vaccinia restriction fragments used in the
construction of pSD548.
The vaccinia I4L gene extends from position 67,371-
65,059. ~irection of transcription for I4L is indicated by
an arrow in FIG. 14. To obtain a vector plasmid fragment
deleted for a portion of the I4L coding sequences, pSD518
was digested with BamHI (pos. 65,381) and HpaI (pos. 67,001)
and blunt ended using Klenow fragment of E. coli polymerase.
This 4.8 kb vector fragment was ligated with a 3.2 kb SmaI
cassette containing the E. coli Beta-galactosidase gene
(Shapira et al., 1983) under the control of the vaccinia 11
kDa promoter (Bertholet et al., 1985, Perkus et al., 1990),
resulting in plasmid pSD524~BG. pSD524KBG was used as donor
plasmid for recombination with vaccinia virus vP804.
Recombinant vaccinia virus, vP855, containing Beta-
galactosidase in a partial deletion of the I4L gene, was
isolated as a blue plaque in the presence of X-gal.
To delete Beta-galactosidase and the remainder of
the I4L ORF from vP855, deletion plasmid pSD548 was
constructed. The left and right vaccinia flanking arms were
assembled separately in pUC8 as detailed below and presented
schematically in FIG. 14.
To construct a vector plasmid to accept the left
vaccinia flanking arm, pUC8 was cut with BamHI/EcoRI and
, ~
,
W~92/08789 - PCT/US91/08703
~:~`~''~5 `- ~ 56
ligated with annealed synthetic oligonucleotides 518A1/518A2
(SEQ ID NO:37/SEQ ID NO:38)
BamHI RsaI
518A1 S' GATCCTGAGTACTTTGTAATATAATGATATATATTTTCACTTTATCTCAT
518A2 3' GACTCATGAAACATTATATTACTATATATAAAAGTGAAATAGAGTA
BqlII EcoRI
TTGAGAATAAAAAGATCTTAGG 3' 518A1
AACTCTTATTTTTCTAGAATCCTTAA 5' 518A2
forming plasmid pSD531. pSD531 was cut with RsaI (partial)
and BamHI and a 2.7 kb vector fragment isolated. pSD518 was
cut with BalII (pos. 64,459)/ RsaI ~pos. 64,994) and a 0.5
kb fra~ment isolated. The two fragments were ligated
together, forming pSD537, which contains the complete
vaccinia flanXing arm left of the I4L coding sequences.
To construct a vector plasmid to accept the right
vaccinia flanking arm, pUC8 was cut with BamHI/EcoRI and
ligated with annealed synthetic oligonucleotides 518B1/18B2
(SEQ ID NO:39/SEQ ID NO:40)
BamHI BalII SmaI
518B1 5'
GA'rCCAGA'rC'rCCCGGGAAAAA ~ TTATTTAACTTTTCATTAATAGGGATTT
518B2 3'
GTCTAGAGGGCCCTTTTTTTAATAAATTGAAAAGTAATTATCCCTAAA
RsaI EcoRI
GACGTATGTAGCGTACTAGG 3' 518B1
CTGCATACTACGCATGATCCTTAA 5' 518B2
forming plasmid pSD532. pSD532 was cut with RsaI
(partial)/EcoRI and a 2.7 kb vector fragment isolated.
pSD518 was cut with RsaI within vaccinia sequences (pos.
67,436) and EcoRI at the vaccinia/pUC junction, and a 0.6 kb
fragment isolated. The two fragments were ligated together,
forming pSD538, which contains the complete vaccinia
flanking arm to the right of I4L coding sequences.
The right vaccinia flanking arm was isolated as a
0.6 kb EcoRI/BqlII fragment from pSD538 and ligated into
pSD537 vector plasmid cut with EcoRI/BqlII. In the
resulting plasmid, pSD539, the I4L ORF (pos. 65,047-67,386)
is replaced by a polylinker region, which is flanked by 0.6
kb vaccinia DNA to the left and 0.6 kb vaccinia DNA to the
right, all in a pUC background. The site of deletion within
.. ~ - .,
.
-
W O 9~/0X789 ~ c~r~ PC~r/US91/08703
57
vaccinia sequences is indicated by a triangle in FIG. 14.To avoid possible recombination of Beta-galactosidase
sequences in the pUC-derived portion of pSD539 with Beta-
galactosidase sequences in recombinant vaccinia virus vP855,
the vaccinia I4L deletion cassette was moved from pSD539
into pRCll, a pUC derivative from which all Beta-
galactosidase sequences have been removed and replaced with
a polylinker region (Colinas et al., 1990~. pSD539 was cut
with EcoRI/PstI and the 1.2 kb fragment isolated. This
fragment was ligated into pRCll cut with EcoRI/PstI (2.35
kb), forming pSD548. Recombination between pSD548 and the
Beta-galactosidase containing vaccinia recombinant, vP855,
resulted in vaccinia deletion mutant vP866, which was
isolated as a clear plaque in the presence of X-gal.
DNA from recombinant vaccinia virus vP866 was
analyzed by restriction digests followed by electrophoresis
on an agarose gel. The restriction patterns were as
expected. Polymerase chain reactions (PCR) (Engelke et al.,
1988) using vP866 as template and primers flanking the six
deletion loci detailed above produced DNA fraqments of the
expected sizes. Sequence analysis of the PCR generated
fragments around the areas of the deletion junctions
confirmed that the junctions were as expected. Recombinant
vaccinia virus vP866, containing the six engineered
deletions as described above, was designated vaccinia
vaccine strain "NYVAC."
Example 16 - CONSTRUCTION OF NYVAC-MV RECOMBIN~NT
EXPRESSING MEASLES FUSION ~ND
~EMAGGLUTININ GLYCOPROTEINS
cDNA copies of the sequences encoding the HA and F
proteins of measles virus MV (Edmonston strain) were
inserted into NYVAC to create a double recombinant
designated NYVAC-MV (vP913). The recombinant authentically
expressed both measles glycoproteins on the surface of
infected cells. Immunoprecipitation analysis demonstrated
correct processing of both F and HA glycoproteins. The
recombinant was also shown to induce syncytia formation.
,
.:
2(!"~J~ 3 "
W092/08789 PCT/US91/08703
58
ells_and Viruses
The rescuing virus used in the production of NYVAC-
MV was the modified Copenhagen strain of vaccinia virus
designated NYVAC. All viruses were grown and titered on
Vero cell monolayers.
Pl~smid Construction
Referring now to Fig. 15 and Taylor et al. (1991),
plasmid pSPM2LHA contains the entire measles HA gene linked
in a precise ATG to ATG configuration with the vaccinia
virus H6 promoter which has been previously described
(Taylor et al., 1988a,b; Guo et al., 1989; Perkus et al.,
1989). A 1.8kpb EcoRV/SmaI fragment containing the 3' most
24 bp of the H6 promoter fused in a precise ATG:ATG
configuration with the HA gene lacking the 3' most 26 bp was
isolated from pSPM2LHA. This fragment was used to replace
the 1.8 kbp EcoRV/SmaI fragment of pSPMHA11 (Taylor et al.,
1991) to generate pRW803. Plasmid pRW803 contains the
entire H6 promoter linked precisely to the entire measles HA
gene.
Plasmid pSD513VCVQ was derived from plasmid pSD460
by the addition of polylinker sequences. Plasmid pSD460 was
derived to enable deletion of the thymidine kinase gene from
vaccinia virus (FIG. 9).
To insert the measles virus F gene into the HA
insertion plasmid, manipulations were performed on pSPHMF7.
Plasmid pSPHMF7 (Taylor et al., 1991) contains the measles F
gene juxtaposed 3' to the previously described vaccinia
virus H6 promoter. In order to attain a perfect ATG for ATG
configuration and remove intervening sequences between the
3' end of the promoter and the ATG of the measles F gene
oligonucleotide directed mutagenesis was performed using
oligonucleotide SPMAD (SEQ ID N0:41).
SPMAD: 5'-TATCCGTTAAGTTTGTATCGTAATGGGTCTCAAGGTGAACGTCT-3'
The resultant plasmid was designated pSPMF75M20.
The plasmid pSPMF75M20 which contains the measles F
gene now linked in a precise ATG for ATG configuration with
the H6 promoter was digested with NruI and EagI. The
resulting 1.7 kbp blunt ended fragment containing the 3'
,
. . ... ~. .
W092/0X7X9 2('~55~?. ` PCT/US9l/08703
59
most 27 bp of the H6 promoter and the entire fusion gene was
isolated and inserted into an intermediate plasmid pRW823
which had been digested with NruI and XbaI and blunt ended.
The resultant plasmid pRW841 contains the H6 promoter linked
to the measles F gene in the pIBI25 plasmid vector ~IBI, New
Haven, CT). The H6/measles F cassette was excised from
pRW841 by digestion with Smal and the resulting 1.8 kb
fragment was inserted into pRW843 (containing the measles HA
gene). Plasmid pRW843 was first digested with NotI and
blunt-ended with Klenow fragment of E. coli DNA polymerase
in the presence of 2mM dNTPs. The resulting plasmid,
pRW857, therefore contains the measles virus F and HA genes
linked in a tail to tail configuration. Both genes are
linked to the vaccinia virus H6 promoter.
DeveloDment of NYV~C-MV
Plasmid pRW857 was transfected into NYVAC (vP866)
infected Vero cells by using the calcium phosphate
precipitation method previously described (Panicali et al.,
1982; Piccini et al., 1987). Positive plaques we~e selected
on the basis of in situ plaque hybridization to specific MV
F and HA radiolabeled probes and subjected to 6 sequential
rounds o~ plaque purification until a pure population was
achieved. One representative plaque was then amplified and
the resulting recombinant was designated NYVAC-MV (vP913).
Immunofluorescence
Indirect immunofluorescence was performed as
previously described (Taylor et al., 1990). Mono-specific
reagents used were sera generated by inoculation of rabbits
with canarypox recombinants expressing either the measles F
or HA genes.
Immunoprecipitation
Immunoprecipitation reactions were performed as
previously described (Taylor et al., 1990) using a guinea-
pig anti measles serum (Whittaker M.A. Bioproducts,
Walkersville, MD).
:
;~
W092/0X7X9 ZC!~C~ Pcr/us91/OX7
Cell Fu~ion Experiments
Vero cell monolayers in 60mm dishes were inoculated
at a multiplicity of l pfu per cell with parental or
recombinant viruses. After l h absorption at 37C the
inoculum was removed, the overlay medium replaced and the
dishes inoculated overnight at 37C. At 20 h post-
infection, dishes were examined.
In order to determine that the expression products
of both measles virus F and HA genes were presented on the
infected cell surface, indirect immunofluorescence analysis
was performed using mono-specific sera generated in rabbits
against canarypox recombinants expressing either the measles
F or HA genes. The results indicated that both F and HA
gene products were expressed on the infected cell surface,
as demonstrated by strong surface fluorescence with both
mono-specific sera. No background staining was evident with
either sera on cells inoculated with the parental NYVAC
strain, nor was there cross-reactive staining when mono-
specific sera were tested against vaccinia single
recombinants expressing either the HA or F gene.
In order to demonstrate that the proteins expressed
by NYVAC-MV were immunoreactive with measles virus specific
sera and were authentically processed in the infected cell,
immunoprecipitation analysis was performed. Vero cell
monolayers were inoculated at a multiplicity of lO pfu/cell
of parental or recombinant viruses ih the presence of 35S-
methionine. Immunoprecipitation analysis revealed a HA
glycoprotein of approximately 76 kDa and the cleaved fusion
products F1 and F2 with molecular weights of 44 ~Da and 23
kDa, respectively. No measles specific products were
detected in uninfected Vero cells or Vero cells infected
with the parental NYVAC virus.
A characteristic of MV cytopathology is the
formation of syncytia which arise by fusion of infected
cells with surrounding infected or uninfected cells followed
by migration of the nuclei toward the center of the
syncytium (Norrby et al., 1982). This has been shown to be
an important method of viral spread, which for
:. ,
W092/08~89 z~9~5~ : PCTtUS91/08703
Paramyxoviruses, can occur in the presence of HA-specific
virus neutralizing antibody (Merz et al., 1980). In order
to determine that the MV proteins expressed in vaccinia
virus were functionally active, Vero cell monolayers were
inoculated with NYVAC and NYVAC-MV and observed for
cytopathic effects. Strong cell fusing activity was evident
in NYVAC-MV infected Vero cells at approximately 18 hours
post infection. No cell fusing activity was evident in
cells infected with parental NYVAC.
Result~ of_seroloqical analYsis of sera of rabbits
inoculated with NYVAC-MV ~vP9l3)
In this study, two rabbits were inoculated with lxlO8
pfu of NYVAC-MV (vP913) by the subcutaneous route. At 28
days, animals were boosted with an equivalent dose. Serial
bleeds were analyzed for MV neutralizing activity using the
plaque reduction method. The results are shown in Table 13.
The results indicate that neither rabbit responded to the
initial inoculation of NYVAC-MV. However, the sharply
rising response after the second inoculation indicates that
the animals were primed. Both animals achieved neutralizing
antibody titers in the protective range.
The in vivo analysis of immunogenicity of ALVAC-MV
(vCP~2) shown in Example 14 indicates that on inoculation of
a range of species, the recombinant is able to induce a
serological response which is measurable in standard
serological tests. The titers achieved are in the range
required for protection from disease. Inoculation of NYVAC-
MV (vP913) into rabbits similarly induces a level of measles
virus neutralizing antibody which would be protective.
- ~ .
. ~ ~' '' ' -
W092/08789 2~9$~33 . ` PCT/US91/08703
62
Table 13
Anti-measles neutralizing antibody titers (log10) in sera of
rabbits inoculated with NYVAC-MV (vP913)
Animal Titer at weeks post-inoculation
W0 W2 W4' W5 W6 W7
Rabbita Al16 <1 <1 <1 2.8b 2.2 2.2
Al17 <1 <1 <1 1.9 1.9 1.9
,
a) Rabbits received 8.0 log10 pfu of NYVAC-MV (vP913) by
S.C. route.
b) Titer expressed as log10 of reciprocal of last
dilution showing a 50% reduction in plaque number as
compared to pre-inoculation serum.
c) Animals were re-inoculated at 28 days.
,
.
. ~ .
' ` ~ . ''
W092t08789 2,~ 9f~ PCT/US91/08703
63
REFERENCES
1. Adams, J.M., and D.T. Imagawa, Proc. Soc. Exper.
Biol. Med. 96, 240-244 (1957).
2. Albrecht, P., K. Herrman, and G.R. Burns, J. Virol.
Methods 3, 251-260 (1981).
3. Alkhatib, G., and D. Briedis, Virology ~50, 479-490
(1986).
4. Alkhatib, G., C. Richardson, and S-H. Shen, Virology
175, ~62-270 (1990).
5. Appel, M.J.G., and O.R. Jones, Proc. Soc. Exp. Biol.
Med. 126, 571-574 (1967).
6. Appel, M.J.G., and D.S. Robson, Am. J. Vet. Res. 34,
1459-1453 (1973).
7. A~ery, R.J., and J. Ni~en, Infect. Immun. 26, 795-
801 (1979).
3. Baker, J.A., B.E. Sheffy, D.S. Robson, J. Gilmartin,
Cornell Vet (USA) 56, 588-594 (1966).
9. Bertholet, C., R. Drillien, and R. Wittek, Proc.
Natl. Acad. Sci. USA 82, 2096-2100 (1985).
10. Bestetti, G., R. Fatzer, and R. Frankhauser, Acta
Neuropathol. 43, 69-75 (1978).
11. Black, F.L., L.L. Berman, M. Libel, C.A. Reichelt,
F. de P. Pinheiro, A.T. da Rosa, F. Figuera, and
E.S. Gonzales, Bull, W.HØ 62, 315-319 (1984).
12. Bush, M., R.J. Montali, D. Brownstein, A.E. James,
Jr., and M.J.G. Appel, J. Am. Vet. Med. Assoc. 169,
959-960 (1976).
13. Carpenter, J.W., M.J.G. Appel, R.C. Erickson, and
M.N. Novilla, J. Am. Vet. Med. Assoc. 169, 961-964
(1976).
14. Choppin, P.W., C.D. Richardson, D.C. Merz, W.W.
Hall, and A. Scheid, J. Infect. Dis. 143, 352-363
(1981).
15. Clewell, D.B., J. Bacteriol. 110, 667-676 (1972).
16. Clewell, D.B., and D.R. Helinski, Proc. Natl. Acad.
Sci. USA 62, 1159-1166 (1969).
17. Colinas, R.J., R.C. Condit, and E. Paoletti, Virus
Research 18, 49-70 (1990).
, . : ,. . ~ ,.
- - -- : , .
- . . ~
W O 92/08789 z~<~o~533 PCl/US91/0870~ .
64
18. DeLay, P.D., S.S. Stone, D.T. Karzon, S. Katz, and
J. Enders, Am. J. Vet. Res. 26, 1359-1373 (1965).
19. Diallo, A., Vet. Micro. 23, 155-163 (1990).
20. Dowling, P.C., B.M. Blumberg, J. Menonna, J.E.
Adamus, P. Cook, J.C. Crowley, D. Kolakofsky, and
S.D. Cook, J. Gen. Virol. 67, 1987-1992 tl986~.
21. Drillien, R., D. Spehner, A. Kirn, P. Giraudon, R.
Buckland, F. Wi.ld, and J.P. Lecocq, Proc. Natl.
Acad. Sci. USA 8S, 1252-1256 ~1988).
22. Engelke, D.R., P.A. Hoener, and F.S. Collins, Proc.
Natl. Acad. Sci. USA 85, 544-548 (1988).
23. Fenner, F., P.A. 8achmann, E.P.J. Gibbs, F.A.
Murphy, M.J. Studdert, and D.O. White, In Veterinary
Virology, ed. F. Fenner, (Academic Press, Inc., New
York) pp. 485-503 (1987).
24. Gillespie, J.H., and D.T. Karzon, Proc. Soc. Exp.
Biol Med. 105, 547-551 (1960).
25. Giraudon, P., Ch. Gerald, and T.F. Wild,
Intervirology 21, 110-120 (1984).
26. Goebel, S.J., G.P. Johnson, M.E. Perkus, S.W. Davis,
- J.P. Winslow, and E. Paoletti, Virology 179, 247-266
(199Oa).
27. Goebel, S.J., G.P. Johnson, M.E. Perkus, S.W. Davis,
J.P. Winslow, and E. Paoletti, Virology 179, 517-563
(199Ob).
28. Graves, M.C., S.M. Silver, and P.W. Choppin,
Virology 86, 254-263 (1978).
29. Guo, P., S. Goebel, S. Davis, ~.E. Perkus, B.
Languet, P. Desmettre, G. Allen, and E. Paoletti, J.
Virol. 63, 4189-4198 (1989).
30. Guo, P., S. Goebel, S. Davis, M.E. Perkus, J.
Taylor, E. Norton, G. Allen, B. Languet, P.
Desmettre, and E. Paoletti, J. Virol. 64, 2399-2406
( lggo)
31. Hall, W.W., R.A. Lamb, and P.W. Choppin, Virology
1~0, 433-449 (1980).
32. Hartley, W.J., Vet. Path. 11, 301-312 (1974).
33. Imagawa, D.T., P. Goret, and J.M. Adams, Proc. Natl.
Acad. Sci. USA 46, 1119-1123 (1960).
34. Karzon, D.T., Pediatrics 16, 809-818 (1955).
.. , ~ , ~
. . , ~ ~ ,
.
~ , , '
': ' ' ' :
W042/0X789 ZC~!n~:5~ 3 ~ PCT/US91/Og703
35. Karzon, D.T., Annals of the N.Y. Academy of Sci.
101, 527-539 (1962).
36. Kazacos, K.R., H.L. Thacker, H.L. Shivaprasad, and
P.P. Burger, J. Am. Vet. Med. Assoc. 179, 1166-1169
(1981).
37. Kingsbury, D.W., M.A. Bratt, P.W. Choppin, R.P.
Hanson, T. Hosaka, V. ter Meulen, E. Norrby, W.
Plowright, R. Rott, and W.H. Wunner, Intervirology
10, 137-152 (1978).
3B. Kunkel, T.A., Proc. Natl. Acad. Sci. USA 82, 488-492
(1985).
39. Lennon, J.L., and F.L. Black, J. Ped. 108, 671-676
(1986).
40. Mandecki, W., Proc. Natl. Acad. Sci. USA 83,
7177-7181 (1982).
41. Mandecki, W., Proc. Natl. Acad. Sci. USA 83,
7177-7181 (1986).
42. Maniatis, T., E.F. Fritsch, and J. Sambrook,
Molecular Cloning, Cold Spring Harbor Laboratory, NY
545 pages (1982).
43. Maniatis, T., E.F. Fritsch, and J. Sambrook,
Molecular Cloning, Cold Spring ~arbor Laboratory, NY
545 pages (1986).
44. Merz, D.C., A. Schied, and P. Choppin, J. Exp. Med.
151, 275-288 (1980).
45. Moura, R.A., and J. Warren, J. Bact. 82, 702-705
(1961).
46. Norrby, E.l and Y. Gollmar, Infect. Immun. 11, 231-
239 (19~5).
47. Norrby, E., G. Enders-Ruckle, and V. ter Meulen, J.
Infect. Dis. 132, 262-269 ~1975).
48. Norrby, E., S.N. Chen, T. Togashi, H. Shesberadaran,
and K.P. Johnson, Archives of Virology 71, 1-11
(1982).
49. Norrby, E., and M.N. oxman, In Fields Virology 2nd
Ed., B.N. Fields and D.M. Knipe, eds. (Raven Press,
NY) pp. 1013 1044 (1990).
50. Novick, S.L. and D. Hoekstra, Proc. Natl. Acad. Sci.
USA 85, 7433-7437 (1988).
51. Orvell, C., and E. Norrby, J. Gen. Virol. 50, 231-
245 ~1980).
i~ . - - ~ : . .
W092/0~7~ PCT/US9l/0870~
2(~9~ J33 66
52. Panicali, D., and E. Paoletti, Proc. Natl. Acad.
Sci. USA 79, 4927-4931 (1982).
53. Paterson, R.G., and R.A. Lamb, Cell 48, 441-452
(1987).
54. Perkus, M.E., A. Piccini, B.R. Lipinskas, and E.
Paoletti, Science 229, 981-984 (1985)a
55. Perkus, M.E., K. Limbach, and E. Paoletti, J. Virol.
63, 3829-3836 (1989).
56. Perkus, M.E~, S.J. Goebel, S.W. Davis, G.P Johnson,
K. Limbach, E.X. Norton, and E. Paoletti, Virology
179, 276-286 (19gO).
57. Phillips, T.R., J.L. Jensen, M.J. Rubino, W.C. Yang,
and R.D. Schultz, Can. J. Vet. Res. 53, 154-160
(1989).
58. Piccini, A., M.E. Perkus, and E. Paoletti, In
Methods in Enzymology, Yol. 153, eds. Wu, R., and
Grossman, L., (Academic Press) pp. 545-563 (1987~.
59. Preblud, S.R., and S.L. Katz, In Vaccines, eds. S.A.
Plotkin and E.A. Mortimer, (W.B. Saunders Co.) pp.
182-222 (1988).
60. Richardson, C.D., A. Berkovich, S. Rozenblatt, and
W. Bellini, J. Virol. 54, 186-193 (1985).
6$. Richardson, C., D. Hull, P. Greer, X. Hasel, A.
Berkovich, G. Englund, W. Bellini, B. Rima, and R.
Lazzarini, Virology 155, 508-523 (1986).
62. Roberts, J.A., J. Immunol. 94, 622-628 (1965).
63. Rosel, J.L., P.L. Earl, J.P. Weir, and B. Moss, J.
Virol. 60, 436-449 (1986).
64. Sanger, F., S. Nicklen, and A.R. Coulson, Proc.
Natl. Acad. Sci. USA 74, 5463-5467 (1977).
65. Shapira, S.K., J. Chou, F.V. Richaud, and M.J.
Casadaban, Gene 25, 71-82 (1983).
66~ Spehner, D., R. Drillien, and J.P. Lecocq, J. Virol.
64, 527-533 (1990).
67. Stephenson, J.R. and V. ter Meulen, Proc. Nat. Acad.
Sci. USA 76, 6601-6605 ~1979).
68. Tabor, S., and C.C. Richardson, Proc. Natl. Acad.
Sci. USA 84, 4767-4771 (1987).
69. Taylor, J., R. Weinberg, Y. Kawaoka, R.G. Webster,
and E. Paoletti, Vaccine 6, 504-508 (198~3a).
W092/OX789 PCT/US9l/08703
2l`67~5~
70. Taylor, J., ~. Weinberg, B. Languet, P. Desmettre,
and E. Paoletti, Vaccine 6, 497-503 (1988b).
71. Taylor, J., C. Edbauer, A. Rey-Senelonge, J.F.
Bouquet, E. Norton, S. Goebel, P. Desmettre, and E.
Paoletti, J. Virol. 64, 1441-1450 (1990).
72. Taylor, J., S. Pincus, J. Tartaglia, C. Richardson,
G. Alkhatib, D. Briedis, M. Appel, E. Norton, and E.
Paoletti, J. Virol. 65, 4263-4272 (1991).
73. Tizard, I., J. Am. Vet. Med. Assoc. 196, 1851-1858
(1990) .
74. Vialard, J., M. Lalumiere, T. Vernet, D. Briedis, G.
Alkhatib, D. Henning, D. Levin, and C. Richardson,
J. Virol. 64, 37-50 ~1990).
75. Warren, J., M.K. Nadel, E. Slater, and S.J. Millian,
Amer. J. Vet. Res. 21, 111-119 (1960).
76. Wild, T.F., E. Malvoisin, and R. Buckland, J. Gen.
Virol. 72, 439-442 (1991).
77. Wild, F., P. Giraudon, D. Spehner, R. Drillien, and
J-P. Lecocq, Vaccine 8, 441-442 (1990).
78. Yuen, L., and B. Moss, Proc. Natl. Acad. Sci. USA
84, 6417-6421 (1987).
-: , , . , : , .
:- - . . , :
.
.. .. . . . . .
