Note: Descriptions are shown in the official language in which they were submitted.
W092/105~2 0~ ~ lO PCT/US91/O~Kg
8~8TAIN~D aND CONTI~U0~8 PROD~CTION 0~ ~IG~ TIT2R~
OF R~COMBINANT VIRAL VgCTORB AND ~RAN8DUC~D
TARG~T C~8 FOR ~8~ IN GE~ T9~RAPY
FI~LD 0~ INV~NTION
5This invention is directed to methods for
producing high titers of viral vectors n vitro in a
hollow fiber bioreactor, to methods for infecting target
cells at high multiplicity and for producing high
concentration~ of transduced target cells, and to the
transduced target cells produced by the methods. The
methods are particularly suited for producing transduced
target cells for use in methods of genetic therapy.
BAC~GXOUND OF T~E INVBN~ION
Genetic therapy.
15Genetic therapy for treatment of acquired and
inherited diseases is a recent and highly promising
addition to the repertoire of treatments for such
diseases. It is expected that many congenital genetic
abnormalities and acquired diseases will be amenable to
treatment by genetic therapy. Genetic therapy can ~e
effected by removing selected cells, target cells, from
an afflicted individual, modifying the cells by
introducing heterologous DNA that encodes a
therapeutically effective product and returning the
modified cells to the individual. Eventually it may be
possible to introduce the heterologous DNA directly into
cells n vivo, such as endothelial cells that line the
lungs, without any in vitro manipulation of the target
cells.
Diseases that are candidates for such treatment
include those that are caused by a missing or defective
gene that normally encodes an enzyme, hormone, or other
protein. Examples of such diseases include: a sev~re
combined immunodeficiency disorder, which is caused by a
:, .
,
: : ~ , .,
WO92/105~ 2 Q 9 ` Ll 1 3 PCT/US91/09069 _
defect in the DNA that encodes adenosine deaminase (ADA)
(see, e.g., Kredich et al. (1983), p. 1157, in The
Metabolic Basis of Inherited Disease (5th ed.), eds.
Stanbury, et al., McGraw~Hill, New York); Lesch Nyhan
dissase, which is caused by a defect in the enzyme
hypoxanthine-guanine phosphoribosyl transferase (HGPRT);
cystic fibrosis and Duchenne muscular dystrophy for which
the respective defective genes have recently been
identified: Tay sachs disease; and hemoglobin disorders,
such as ~-thalassemia. In addition, genetic therapy has
been proposed as a means to deliver therapeutic products,
such as tumor necrosis factor (TNF) for the treatment
cancers and CD4 receptor protein for the treatment of
AIDS (see, e.a., PCT International Application No. W0
90/01870).
Genetic therapy invol~es introducing
heterologous DNA into at least some cells of a host
organism in a manner such that the products encoded by
the heterologous DNA are expressed in the host. Upon
introduction into the host cell, the heteroloqous DNA may
be integrated into the genome of the host cells or it may
be maintained and replicated as part of an episomal
element. The heterologous DNA may encode products that
replace or -supplement the product of a defective or
absent gene or a gene that is normally expressed at low
levels or the DNA may encode therapeutic products that
are effective for treating a disease. The heterologous
DNA is operatively linXed to a promoter and/or other
transcriptional and translational regulatory elements
that are recognized by host cell effector molecules, such
as RNA polymerase II, such that it can be expressed in
the host cell. As understanding of the underlying
genetic bases for disease increases, it will be possible
., , ~ . , .
`
--
:
~ ....... , , -
W092/10~ 2 0 ~ PCT/US91tO9069
to refine the methods of genetic therapy so that
regulatory controls that operate at the level of gene
transcription or translation or that rely on mechanisms,
such as feedback inhibition, to control expression of
gene products can also be provided to the host cells.
For example, the heterologous DNA may also mediate or
encode RNA or protein products that mediate expression of
a host cell gene or biochemical process. Expression of
the heterologous DNA can thereby be fine-tuned to the
needs of the afflicted host.
It is also anticipated that numerous means for
introducing heterologous DNA into the cells and genomes
of individuals will be developed and refined. At the
present time, the use of recombinant viral vectors, which
are derived from viruses that infect eukaryotic cells,
provide the most promising means for effecting genetic
therapy. Generally, upon infection of a eukaryotic host,
a virus commandeers the transcriptional and translational
machinery of the host cell. In order to do so, viral
regulatory si~nals, such as promoters, particularly those
recognized early in infection, tend to be highly
efficient so that any DNA that i~ in operative linkage
with such promoters and regulatory signals is efficiently
expressed at high levels. Eukaryotic viruses have,
therefore, been used as vectors for cloning and
expression of heterologous DNA in euXaryotic cells.
R~co~binant ou~ryo~iG viruse8 for delivery of
hetorologous D~A.
Eukaryotic viruses fro~ which recombinant viral
vectors have been constructed include both DNA viruses,
such as SV40, adenovirus, and bovine papilloma virus
- (see, e.a., Gluzman, Y., ed. Eukarvotic Viral
yectors,Ccld Spring Harbor Laboratory, Cold Spring
, ,,. - ................................................... . .
' ' '~ ' ~
:. :
, . , : - . .
WO92~l05~ 2 0 9 8 1 ~ a PCT/US91/0~69
Harbor, NY (1982); Sarver et 31~ (1981) Mo~_ Cell Biol.
1: 486; and U.S. Patent No. 4,419,446 to Howley), and
RNA viruses, retroviruses, such as Moloney murine
leuke~ia virus (MoMLV), mouse mammary tumor virus (MMTV),
Rous sarcoma virus (RSV) and other leukemia and tumor
viruses (see, e.q., Mann et al. (1983) Cell 33: 153-
159; Miller et ~1. (1986) Mol._Cell Biol. 6: 2895-
2902: U.S. Patent No. 4,868,116 to Morgan et al.; U.S.
Patent No. 4,686,098 to Kopchick et al.; and U.S. Patent
No. 4,861,719 to Miller).
Des~gn of retroviral Yectors for use i~ ~etho~s of
g~n~tic t~erapy.
Retroviral vectors are presently the preferred
vectors for genetic therapy (see, e.a., Anderson (1984)
Science 226: 401-409) because retroviral infection is
highly efficient and retroviral vectors can be readily
modified so that heterologous DNA carried by such vectors
is stably integrated into the host cell genome. If
retroviral vectors could be produced at a sufficiently
high concentration, virtually 100% of exposed target
cells, cells that are derived from the afflicted host,
could be infected and express integrated proviral and
heterologous DNA. Upon infection with a retrovirus, and
under appropriate conditions, a single copy of a provirus
integrates per cell. Proviral integration is not, per
se, harmful to the cell. Also, because of the size and
mechanism of retroviral integration, it is possible to
know precisely what DNA has been integrated. Finally,
retroviral vector systems that have a broad host ranga
are readily available.
Retroviruses consist primarily of a protein
envelope that encapsulates core proteins and RNA. The
RNA of a retrovirus encodes two long terminal repeat
.,. .. -- - ~, ~
.. - ~ . .. .
,
. i.. ,
WO92/105~ 2 0 9 8 ~ 10 PCT/US9l/0~69
se~uence ~LTRs), which include promoter and enhancer
regions and which flank the genome; variou~ regulatory
signals that regulate transcription, including the CAP
site and polyadenylation signals, and that regulate
reverse trans-cription and proviral replication;
structural genes inclu-ding the env gene, which encodes
the envelope proteins, the g~ gene, which encodes viral
core proteins, and the ~1 gene, which encodes the
reverse transcriptase. The retro-viral RNA also includes
signal sequences, such as the tRNA binding site (the
replication initiation site for minus DNA strand
synthesis), the replication site for plus DNA strand
synthesis, and the packaging signal, the psi site.
Retroviral envelope proteins include regions
that recognize and specifically bind to mammalian cell
surface receptors. Some retroviral envelope proteins
only bind to a restricted range of host cells; viruses
encapsulated in such envelopes are said to have an
ecotropic host range. Other envelope proteins bind to a
variety of mammalian cells; viruses encapsulated in such
envelopes are said to have an amphotropic host range.
Upon specific recognition and binding to host cell
receptors, the virus enters the cell. The retroviral
reverse transcriptase is translated and the viru~ is
reverse transcribed into a DNA intermediate, referred to
as a provirus, which integrates into chromosomal DNA.
Proviral DNA can also be replicated and packaged into
infectious virions.
Elements for retroviral replication are divided
into those that act in cis and those that act in trans.
Trans-acting factors include the viral proteins that are
necessary for encapsidation, binding and entry of the
virus into a target cell, reverse transcription, and
'
~' , ~ '
.
WO92/lO~ 2 Q 9 ~ r ~ .~ PCT/US9t/~69 ~
integration of the rever~e transcribed DNA into the
target cell genome. Cis-acting factors, ~uch as the
packaging signal, include those that interact with the
trans-acting proteins and other proteins during viral
replication (see, e.a., Coffin, J. (1985) in RNA Tumor
Viruses, vol. 2, pp. 17-74, R. Weiss et ~1~, eds., Cold
Spring Harbor Laboratory, Cold Spring Harbor, NY).
Some of the cis- and trans-acting functions can
be deleted from a retrovirus and, if properly combined,
lo provided separately. A virus that has some or all of the
trans-acting functions deleted is replication-
incompetent, but, if missing functions are provided, such
as by co-transfection with a helper virus containing the
necessary functions, packaged defective infectiou.s viral
particles can be produced. Alternatively, missing
functions can be provided by a cell lîne, a packaging
cell line, that has been modified by ~table incorporation
of such functions in its genome. Because certain
functions can be deleted and provided by way of a helper
virus or as part of a packaging cell line, retroviral
vectors for delivering heterologous DNA, which is then
stably integrated into host cell DNA can be constructed.
In addition, by careful design of packaging cell lines
and retroviral vectors, it is possible to package
z5 infectious replication inco~petent retroviral vectors
without producing helper virus and thereby provide
vectors for integrating DNA into a host cell genome
without the concomitant risk of recombinational events
between the vector and helper virus that could lead to
the production of infectious retroviral particles.
Retroviral vectors are constructed by preparing
DNA copies of the retroviral RNA and deleting all or
parts of the env, ~ol and aa~ genes. Heterologous DNA is
.
.
.
- .
.~
WO92/105~ 2 ~ 9 ~ i ~ 3 PCT/U~91tO906g
inserted in place of the deleted genes under the control
of the endogenous heterologous promoter or other promoter
recognized by a host cell RNA polymerase II, or the
retroviral 5' LTR. Retroviral vectors, thus, do not
include ~enes for replication. When they are transduced,
in the absence of helper virus, into cells that do not
include such retroviral sequences, the retroviral vectors
cannot replicate and, if properly constructed, they are
stably incorporated into the host cell genome. In
addition to the LTR sequences and other cis-acting
regulatory ~equences, retroviral vectors generally also
include splice donor and acceptor sites and a selective
marker gene, such as the bacterial gene, neo, which
encodes neomycin phosphotransferase, which confers
resistance to certain antibiotics, under the control of
an appropriate eukaryotic promoter~
The host range of the packaged retroviral
vector can be controlled by selection of the env gene
that is incorporated into the packaging cell line. If an
amphotropic host range is desired, then the vector is
packaged in a packaging cell line that includes env
sequences derived from a retrovirus that has an
amphotropic host range. For example, the MoMLV (see,
e.a., Mann et al. (1983) Cell 33: 153-159; and ~iller
et al . ~1986) _ Mol. Cell. Biol. 6: 2895-2902) is an
amphotropic retrovir~s; its env protein binds to
rèceptors present on most human cells.
Since retroviral vectors do not replicate in the
target host cell, retroviral vectors are replicated and
packaged in cell lines that include DN~ that encodes
functions, absent in the vector, that are necessary for
packaging and replication. Because of the ease with
which retroviruses integrate and excise from chromosomal
WO92/10~ 2n~8 ~ PCT/USgl/OgO69
DNA and undergo recombination, recombination between the
DNA derived from the vector and DNA in the packaging cell
line may result in production of pacXaged, replication
competent viruses and/or helper viruses, which encode
functions necessary for viral replication. Upon
transduction into a target host cell, in the presence of
helper viruses, recombination can result in the
production of infectious retroviral particles in the host
cells. Consequently, for clinical use, not only must
retroviral vectors be replication incompetent, the
packaging cell line and vector must be designed so that
there is virtually no possibility of recombination that
could lead to the production of replication competent or
helper viruses. This is achieved by carefully designing
both the vector and the packaging cell line to include
deletions and mutations that would render it highly
improbable or impossible for any undesirable
recombinational events between the retroviral vector and
packaging cell line (see, e.g., ~ann et al. tl983) Cell
33: 153-159; Miller et al. (1986) Mol. Cell. Biol. 6:
2895-2902 and (1985) Mol. Cell. Biol. 5: 431; and U.S.
Patent No. 4,861,719 to Miller). ~here is, however, the
minute possibility of undesirable recombinational events
between the vector and sequences carried on the host cell
genome that could result in the production of helper
virus or activation of cellular oncogenes. These risks
are, however, minute and retroviral vectors have been
designed that render the probability of such occurrences
insignificant.
Design of pac~gi~g call lines for pro~u¢tion of
clinically useful reoo~binact retroviral vectors.
Manipulation of the viral genome has, thus,
permitted construction of retrovirus-packaging cell lines
' . :
` ' ' ' ' ' ' ' ' ' ' ' ,
.~
WO92/lQ~W ~ PCT/US91/09~9
that can produce relatively large amounts of viral
vectors in the absence of both replication-competent
virus and helper virus. These cell lines package
retroviral vector RNA into virions that are capable of
infecting a broad range of target host cells, but, that,
after infection of such cells, cannot replicate.
Packaging cell lines-contain retrovirus-derived DNA that
supplies the necessary gene functions, such as the env
gene, for viral packaging. Most such packaging cell
lines contain helper virus DNA that has been modified by
deletion of the packaging signal. It has been found,
however, that packaging cell lines in which only the
packaging signal is deleted will produce helper virus at
low frequency and also interact with some retroviral
vectors to yield replication-competent virus at low
levels. Thus, additional mutations are introduced into
the retroviral DNA in the packaging cell lines in order
to further decrease probability for production of helper
virus and/or also replication-competent virus (see, ~ g~,
Miller et al. (1986) Mol. Cell. Biol. 6: 2895-2902 and
U.S. Patent No. 4,861,719 to Miller).
Packaging cell lines are derived from
transformed or immortalized cell lines, such as NIH 3T3
cells, and particularly from NIH 3T3 thymidine kinase (TK-
) cells. A DNA construct, such as a plasmid, containingthe retroviral sequences with the desired deletions and
mutations and a selective marker, such as the herpes
simplex virus (HSV) thy~idine kinase (TK) gene are
introduced into the cell line, such as the NIH 3T3 TK-
3 0 cells, and cultured in selective medium. Cells, whichgrow in the selective medium, are selected and tested for
the presence of the necessary packaging functions. Those
that produce retroviral vectors and do not produce helper
,
: .~
WO 92/10~ 2 0 9 ~ ~ ~ 3 PCT/US91/~069 ~
viral are selected and used as packaging cell lines to
produce infectious replication-incompetent retroviral
vectors.
T~rget ooll~ ~d their use in genetic t~er~py.
Suitable target cells for gene transfer are
those that readily can ~e obtained and that persist
following transplantation, such as fibroblasts, immune
cells, particularly lymphocytes, and epithelial cells
(See, e.a, St. Louis et al. (1988) Proc. Natl. Acad. Sci.
10 85: 3150-54; Keller et al. (1985) Nature 318: 149-154;
Miller et al. (1988) J. Virol. 62: 4337-4345: and Morgan
et al. (1989) U.S. Patent No. 4,868,116).
The first use of genetic therapy in humans
involved tumor infiltrating lymphocytes (TILs~ as target
15 cells (see7 Rosenberg et al. (1990) New Enql. J. Med. 9:
570-578). TILs are a lymphocyte subpopulation that show
promise as vehicles for delivery of anti-cancer
therapeutics to tumor sites. These lymphocytes
infiltrate into tumors, as part of an attempt by the
host's immune system to mount an iD unological response.
TIL cells for use as target cells for genetic therapy
can be produced in vitro by incubating resected human
tumors, such as kidney, colon or breast tumors,
melano~as, and sarcomas in vitro in appropriate tissue
culture medium that contains interleukin-2 (IL-2). The
IL-2 in the medium results in the expansion and
activation of T cells within the tumor, the TIL cells,
and the destruction of tumor cells or tissue. After 2-3
weeks in culture, the tumor cells have been destroyed and
~he culture primarily contains lymphoid cells that have
the phenotype of cytolytic T lymphocytes tCTL) (see,
e.a., Rosenberg et al. (1988) N. Engl. J Med. 319:1676-
1680; Muul et al. (1987) J. Immunol. 138: 989-995; and
... ..
-, ,
... - ~ . : , ~ . ;
: :
-. , .
.
W092tl0~ 2 ~ 9 ~ ~ 1 0 PCT/US91/0~69
Topalian et al., (1989) J. Immunol. 142: 3714-3725).
TIL cells al~o show promise for use in meth3ds
of genetic therapy, particularly cancer therapy, (see,
e.a. Culliton (1989), "News and Comment" in Science 244:
1430-1433 and Kasid et al. (1990) Proc. Nat'l. Acad. Sci.
87: 473-477) because they provide a source of autologous
cells that target tumors and that can be modified by the
insertions of DNA encoding a desired protein, cultured,
and reintroduced into the patient. Recently, TILs
containing DNA encoding a bacterial marker gene, neo,
which encodes neomycin phosphotransferase, were infused
into the veins of melanoma patients in order to track the
fate of the TILs afte- infusion in the patients (see
Rosenberg et al. (1990) New Enal. J. Med. 9: 570-578).
The gene was inserted into a retroviral vector, which
was then introduced into a retroviral packaging cell line
(Miller et al. (1986) Mol. Cell ~iol. 6: 2895-2902).
The packaging cell line was cultured and yielded packaged
defective virions at titers sufficient to transduce TIL
cells at a multiplicity of infection of virions to cells
of about 1.3 to 2.3. After transduction, the cells were
cultured overnight, and, in an effort to increase the
number of cells infected, the TILs were again exposed to
the virus. Although only 1 to 11% of the cells were
transduced, it was possible to locate and identify the
infused TIL in the treated patients for t least 64 days.
TILs from patients with advanced melanoma have
been modified by insertion of DNA encoding TNF and will
be reinfused into the patientC in an effort to enhance
the anti-tumor activity of the ~IL cells.
The first experiment in genetic therapy for the
treatment of a genetic disorder, a severe combined
immunodeficiency disease, is presently underway. ADA
~ ......... . .. . .
-~ - I
- , -
- ' ', '
WO92~l05~ 2 0 9 ~ r~ ~ 3 PCT/USg1/OgO69 -~
deficiency, which is asfiociated with a severe combined
immunodeficiency disease, is a fatal condition because
the ADA substrates, deoxyadenosine and adenosine, which
are toxic to T and B lymphocytes, accumulate in serum of
the affected individual. In the hope of treating this
disorder, a retroviral vector containing DNA encoding
adenosine deaminase ~hereinafter ADA) (Hock et al. ~1989)
Blood 74: 876-881) has been introduced into lymphocytes
obtained from a child ADA deficiency.
lo The retroviral vector was packag~d n vitro
using a cell line shown to produce relatively high titers
of the retrovirus containing the ADA gene without
concomitant production of helper virus. Although the
titers produced by the packaging cells were relatively
high, they were only high enough to infect at a
multiplicity of infection of about 1 virion/target
lymphocyte, which was sufficient to transduce at most
about 10% of exposed target cells after repeated
exposures of the target cells to the packaged retroviral
vectors. The transduced lymphocytes were then infused
into the child. It is hoped that after repeated
infusions of similarly transduced lymphocytes that
sufficient levels of ADA will be expressed to reduce the
concentrations of toxic metabolites and thereby permit
development of a normal array of immune cells.
Since lymphocytes have a limited lifespan,
infusions of transduced lymphocytes will have to be
repeated at regular intervals. For each such infusion
lymphocytes will have to be transduced and each
transduction will require multiple exposures of the
lymphocytes to the packaged retroviral vectors because
only relatively low titers of the retroviral vectors can
be obtained. Even with as many as six exposures of the
,
wo g2/lo~ 2 i~1 3 ~ PCT/US91tO9069
13
lymphocytes to packaged retroviral vectors, only about
10% of the cultured lymphocytes will be transduced. This
procedure is, therefore, costly and, unless improved,
will not be available for general clinical use.
Because retroviral particles are fragile, they
cannot be concentrated by any means known to those of
skill in the art. The concentration (transduced
cells/total number of target cells x 100) and total
number of transduced target cells that can be obtained is
limited by the titer of the retrovixal particles produced
by the packaging cell line, which in turn is limited by
the concentration of packaged particles that are released
into the culture medium bathing the packaging cell line.
Generally, only titers of from 7 x 103 to 5 X 105 CFU/ml
15 can be obtained (see, e.a., U.S. Patent No. 4,861,719 to
Miller), which severely limits their usefulness in
genetic therapy. In order to transduce sufficient
numbers o~ target cells, however, it is necessary to have
titers of at least 106 to 107 CFU/ml) (Miller et al.
20 (1988) J. Virol. 62: 4337-4345)
It is, therefore, an object of this invention
to provide a method for producing recombinant viral
vectors, particularly recombinant retroviral vectors, at
high titers.
It is another object of this invention to
provide methods for transducing target cells at a high
multiplicity of infection.
It is another object of this invention to
provide a dual bioreactor system and methods for
efficiently trans-ducing target cells at high
multiplicities of infection.
It is another ob~ect of this invention to
provide high concentrations of transduced target cells
.
-:
.. ~
: : ,
.
W092/l0~ 2 O 9 8 ~ ~ r~ PCT~US9t/09~9 ~
that can be used in methods of genetic therapy.
8UXMARY OF TKE INVgNTION
Methods for producing of titers of recombinant
viral vectors by culturing prsducer cells in a hollow
fiber bioreactor are provided. In particular, methods
for producing sustained and continuous production of a
high titer of recombinant eukaryotic viral vectors,
particularly recombinant retroviral vectors, by culturing
a packaging cell line in a hollow fiber bioreactor are
provided.
High titers of recombinant retroviral vectors
are secreted into the overlying medium, the extra fiber
space (hereinafter EFS) medium by producer cells,
packaging cells, that are cultured in a hollow fiber
bioreactor are also provided.
The ability to produce high titers of
recombinant viral vectors permits transduction of
sufficient concentrations of target cells to be useful
for genetic therapy. Target cells are transduced by
contacting the target cells with the EFS medium from the
bioreactor in which the producer cells are cultured.
In a preferred embodiment a packaging cell line
containg DNA that is derived from a retroviral vector is
cultured in the bioreactor. High titers, generally at
least about 10S CFU/ ml, of infectious packaged retroviral
vectors accumulate in the EFS medium. If the EFS medium
is harvested and replaced with fresh medium, the producer
cells continue to secrete viral vectors at a high rate,
generally at least about 108 retroviral particles/ml per
day. The EFS medium can be repeatedly harvested and
production of recombinant retroviral vectors continues
and is sustained at the high level.
,,: , ' ' , ' . ~ ~ ~ ' . ,
. : .
.: .
.
~ U~3~ J'
W092/105~ PCT/US91/09069
The EFS medium that contains the recombinant
retroviral vectors is contacted with selected target
cells, particularly lymphocytes, at a multiplicity of
infection that may be as high as about 10 CFU/target
5 cell. The target cells may then be cultured in a second
bioreactor. The target cells may be contacted with
multiple EFS media harvests from the packaging cell line.
It should be possible to transduce up to 100% of the
target cells.
In a preferred embodiment, a dual bioreactor
system in which the EFS from a first bioreactor in which
the producer cells are cultured is connected with the EFS
of a second bioreactor in which the target cells are
cultured. This assembly efficiently and continuously
transduces the target cells by introduci~g the medium in
the EFS from the first bioreactor into the EFS of the
second bioreactor. Means for collecting spent EFS in the
second bioreactor and adding fresh medium to the EFS of
the first bioreactor are included in the system.
Examples are provided that demonstrate that the
EFS medium obtained from a hollow fiber culture of a
packaging cell line produces high titers of the
retroviral vector LASN, which contains ~ucleic acid that
encodes ADA. The packaged LASN retroviral vectors have
been used to efficiently transduce ADA-deficient lymphoid
cell~, which subsequently expressed ADA activity.
~RIEF DE8CRIPTION OF I~ FIG~RB~
Figure la presents titer (vector particles/ml)
as a function of duration of culture in the bioreactor.
After 50 days in culture the titer of viral vector
particles plateaued at more than 106 particles/ml.
Figure lb presents the same data expressed as
packaged retroviral vector particle production per day as
!
.
.
. ' : . . .
~Uvd ~ l~
W092/105~ PCT/US91/09069
16
a function of time in culture. Vector particle
production per day increases substantially with duration
of the culture.
Figure 2 presents a schematic diagram of a dual
perfusion circuit for direct and continuous inoculation
of the EFS from a hollow fiber bioreactor that contains
a viral packaging or producing cell line into the EFS of
a hollow fiber bioreactor that contains target cells.
The perfusion circuit includes: reservoirs (a),
connecting tubing (b), media pumps (c), and hollow fiber
bioreactors (d). Cells are injected into the EFS
through the loading side-ports (f).
Medium from the EFS of the virus-producing
hollow fiber bioreactor is pumped either continuously,
periodi-cally or intermittently into the EFS of the
target cell hollow fiber bioreactor. The circuit also
includes reservoir bottles that contain the EFS
replacement medium (1) for the virus-producing bioreactor
and for collecting the spent EFS ~edium (2) from the
target cell bioreactor Several smaller reservoir bottles
(4~ are included in the connecting lines between the EFS
of the two bioreactors and ~etween the reservoirs (1) and
(2). The smaller bottles may be used for sample
withdrawal, inoculation, or for displacement of the EFS
medium in either bioreactor with sterile air. There are
filters (f) on the each of the reservoirs and smaller
bottles. Clamps (X) are present in the various lines to
direct the flow of medium. Connectors (CO)I which may be
placed in any of ~he lines, per~it removal and
replacement of any component of the circuit. An
automatic pinch valve, which opens when the peristaltic
pump (P) is activated and closes when the pump is not
pumping, may also be included in the circuit.
-. .: : - . ~ ., .
- - ~.
,. ,, -.
WO9V105~ 2 0 9 ~ 3 1 ~ PCT1US91/~69
DE8C~I~TION OF I~ PR~F~RRED EKBOD~M$NT~
Unless defined otherwise, all technical and
scientific terms used herein have the same meaning as is
commonly understood by one of skill in the art to which
this invention belongs. All publications mentioned
herein are incorporated by reference thereto. All U.S.
patents mentioned herein are incorporated in their
entirety by reference thereto.
Defi~t~ons
As used herein, genetic therapy involves thP
transfer of heterologous DNA to the certain cells, target
cells, of an individual afflicted with a disorder for
which such therapy is sought. The DNA is introduced into
the selected target cells in a manner such that the
heterologous DNA is expressed and a product encoded
thereby is produced. Alternatively, the heterologous DNA
may in some manner mediate expression of DNA that encodes
the therapeutic product, it may encode a product, such as
a peptide or RNA that in some manner mediates, directly
or indirectly, expression of a therapeutic product.
Genetic therapy may also be used to introduce therapeutic
compounds, such as TNF, that are not normally produced in
the host or that are not produced in therapeutically
effective amounts or at a therapeutically useful time.
The heterologous DNA encoding the therapeutic product may
be modified prior to introduction into the cells of the
afflicted host in order to enhance or otherwise alter the
product or expression thereof.
As used herein, heterologous DNA is DNA that
encodes RNA and proteins that are not normally produced
in vivo by the cell in which it is expressed or that
mediates or encodes mediators that alter expression of
endogenous DNA by affecting transcription, translation,
.
: . , .:
..
' ~
209~
WO92/10~S~ PCT/US91t~K9
18
or other regulatable biochemical processes. Heterologous
DNA may also be referr~d to a~ foreign DNA. Any DNA that
one of skill in the art would recognize or consider as
heterologous or foreign to the cell in which is expressed
is herein encompassed by heterologous DNA. Examples of
heterologous DNA include, but are not limited to, DNA
that encodes traceable marker proteins, such as a protein
that confers drug resistance, DNA that encodes
therapeutically effective substances, such as anti-cancer
agents, enzymes and hormones, and DNA that encodes other
types of proteins, such as antibodies. Antibodies that
are encoded by heterologous DNA may be secreted or
expressed on the surface of the cell in which the
heterologous DNA has been introduced.
As used herein, a therapeutically effective
product is a product that is encoded by heterologous DNA
that, upon introduction of the DNA into a host, a product
is expressed that effectively ameliorates or eliminates
the symptoms, manifestations of an inherited or acquired
disease or that cures said disease.
Typically, DNA encoding the desired heterologous
DNA is cloned into a plasmid vector and introduced by
routine methods, such as calcium-phosphate mediated DNA
uptake (see, (1981) Somat~ Cell. Mol. Genet. 7:603-616)
or microinjçction, into producer cells, such as packaging
cells. After a~plification in producer cells, the
vectors that contain the heterologous DNA are introduced
into selected target cells.
As used herein, operati~e linkage of
heterologous DNA regulatory and effector sequences of
nucleotides, such as promoters, enhancers,
transcriptional and translational stop sites, and other
signal sequences refers to the relationship between such
.: , - . . . , , : . . . .
- . .
W092/10~ a PCr/US91/09069
19
DNA and such sequences of nucleotides. For example,
operative linkage of heterologous DNA to a promoter meAns
that the DNA and the promoter are spatially related such
that the transcription of such DNA is initiated from such
promoter by an RNA polymerase that specifically
recognizes, binds to the pro~oter and transcribes such
DNA. Heterologous DNA may be introduced into a cell by
any method known to those of skill in the art.
As used herein, a target cell is a cell into
which heterologous DNA is introduced for expression in
the host who is being treated. Such heterologous DNA may
encode a gene product, ~uch as an enzyme, that certain
individuals do not express or exprQss in a form that is
defective. Suitable target cells are known to those of
skill in the art and include, but are not limited, to
fibroblasts (see, e.a., St. Louis et al. (1988) Proc!
Natl. Acad. Sci. 85: 3150-54) and immune cells (see,
e.a., Keller et al. (1985) Nature 318: 149-154 and
Miller et al. tl988) J~ Virol. 62: 4337-4345). Target
cells may be removed from the individual who is being
treated and modified by introducing the heterologous DNA
n vitro. For example, target cells, such as
lymphocytes may be transduced with retroviral vectors
that have been produced by producer cells.
Alternati~ely, it may be possible to modify target cells,
such as endothelial cells that line the lungs, in vivo.
As used herein, transduced target cells refers
to the portion of target cells that, after contacting
target cells w$th a recombinant vector that includes a
heterologous DNA, contain the heterologous DNA or contain
the heterologous DNA and express the product of the
encoded by the heterologous DNA. Genetically engineered
target cells, target cells that contain heterologous DNA,
2 0 9 ~ rj 1 3
WO~2~10~6~ PCT/US9t/09069
are used in genetic therapy to correct genetic
disorders, such as, but not limited to, certain
immunodeficiency diseases, ~-thalassemia, Gauch~r's
disease, hemophilia and cystic fibrosis, by introducing
them into an individual who has an inherited or acquired
genetic defect. In addition, target cells may be
genetically engineered to also express DNA encoding drug
resistance, such as methotrexate resistance, or drug
sensitivity, such that, when such DNA is expressed, the
cells may be selectively expanded or destroyed in_vivo
and to express thereapeutically effective substances,
including antibodies and tumor necrosis factor.
As used herein, transduction is the process
whereby a viral vector specific~lly binds to cell surface
receptors and enters the cell. It is a process akin to
viral infection, except that viral vectors are modified
viruses and, upon introduction, into a target cell,
generally, do not cause productive infection. For
example, retroviral vectors are generally designed to be
replication-incompetent.
As used herein, the concentration of transduced
~arget cells refers to the number of transduced target
cells/total number of target cells contacted with the
vector. The concentration may be expressed as a
percentage (number of transduced target cells/total
number of target cells x lO0).
As used herein, a recombinant viral vector is a
vector that includes DNA that is derived from an RNA or
DNA virus and also includes heterologous DNA, which is
generally in operative linkage with a promoter and other
transcriptional and translational regulatory sequences or
signals that are recognized by the host cell in which the
virus from which such vector is derived can replicate.
. ~ ,
.
:: ,
" ~ ' '' ' .
WO 92/10~64 PCl`/US91/09069
~1
Recombinant vsctors may be either retained as part of
independently replicating as episomal elements or
integrated into the genome of the host cell.
Recombinant viral vectors useful for genetic
therapy are typically derived from viruses that infect
and replicate in eukaryotic cells and thereby serve as a
means for introducing heterologous DNA into eukaryotic
cells. Recombinant viral vectors that remain episomal
include an origin of replication, whereby DNA synthesis
can be initiated. Recombinant vectors that integrate
into the genome must include D~A sequences necessary to
effect integration. Preferred recombinant viral vectors
used for genetic therapy are generally selected from
among those which integrate into the host cell genome.
As used herein, a producer cell is cell in which
recombinant viruses can replicate and can thereby be
amplified. Some producer cells also package and secrete
recombinant viruses into the medium in which the cells
are cultured. The recombinant viral vectors produced by
producer cells are used to transduce target cells.
Producer cells are typically immortalized or transformed
cell lines that are cultured in vitro and are designed to
produce maximal amounts of reco~binant vectors. For
example, retrovirus packaging cell lines are producer
cells that include trans-acting factors necessary to
package defective retroviral vectors.
As used herein, adoptive immuno~herapy is a
therapeutic method, whereby cells of the immune system
are removed from an individual, cultured and/or
manipulated in vitro, and introduced into the same or a
different individual as part of a therapeutic treatment
for an acguired or inherited disease. Immune cells and
adoptive immunotherapeutic methods may be adapted for use
. .
,~-. , . - ~ . . .
' .- ' ~
WO92/105~ 209~ i ~, PCT/VS91/09069 ~
22
in methods of genetic therapy as vehicles ~or delivery of
heterologous DNA.
As used herein, immune cells include any cells
that participate tha functioning of the immune system.
Lymphoid cells include lymphocytes, macrophages, and
monocytes that are derived from any tissue in which such
cells are present. In general lymphoid cells are removed
from an individual who is to be treated.
As used herein, a growth promoting substance is
a substance, that may be soluble or insoluble, that
in some manner participates in, induces cells or
otherwise activates cells, directly or indirectly, to
differentiate or proliferate. Growth promoting
substances include mitogens and cytokines, including
interleukins, colony stimulating factors, and any other
of such factors that are known to those of skill in the
art. For example, many types of cells, including target
cells, such as lymphocytes, which n vitro require IL-2,
have absolute requirements for certain growth promoting
substances. Growth promoting substances are well known
to those of skill in the art. Many such substances, such
as the interleukins 1-7, have been cloned and expressed
in yitro. It is within the level of skill in the the
art, to ~elect appropriate growth factors in order for
culturing ~oth producer cells and target cells in a
bioreactor. Other substances, including polycations,
such as protamine, may be added to the bioreactor in
order to promote viral infectivity by, for example,
enhancing viral adsorption to the target cell surface.
As used herein, a therapeutically effective
amount of transduced target cells is a sufficient
concentration and number of transduced target cells for
at least single infusion of such cells into an individual
. .
''
.
WO92/105~ 2 9 ~ PCT/US91/09069
for genetic therapy. Upon infusion of a therapeutically
effective amount of transduced target cells, a sufficient
amount of a product produced by the transduced cells is
expressed to ameliorate or eliminate the symptoms or
manifestations of an inherited or ac~uired disease. In
order to effect a cure or a substantial reduction of the
symptoms or manifestations of the disease, it may be
necessary to repeat perform multiple infusions and/or to
periodically repeat such infusions.
As used herein, a hollow fiber culture system
consists of a hollow fiber bioreactor and means for
pumping and collecting perfusing medium. A hollow fiber
bioreactor is a hollow shell that encases a plurality of
semi-permeable fibers through which medium is perfused.
As used herein, the extra ~iber space (EFS) is
the space in which the cells grow that is external to the
semi-permeable fibers and bounded without by the shell of
the hollow fiber bioreactor. The EFS is alternatively
referred to as the extra capillary space ~ECS).
~s used herein, the EFS cell medium is the
medium in which the cells in the EFS are growing. It may
also be referred to as the EFS supernatant. It contains
secreted cellular products, including secreted viral
particles, diffusible nutrients and any other compounds,
including growth promoting or suppressing substances,
such as lymphokines and cytokines, that have been added
to the EFS medium, or diffusible products that have been
added to the perfusing tissue culture medium. The
particular components included in the EFS is a function
not only of what is inoculated therein, but also of the
characteristics of the selected hollow fiber.
Thus, as used herein, a hollow fiber bioreactor
or hollow fiber bioreactor cartridge consists of an outer
W092tl0~ PCT/US91/~ ~9 ~
2 ~ 9 Q r~
24
shell casing that is suitable for the growth of mammalian
cells, a plurality of semi-per~eable hollow fibers
encased within the shell that are suitable for the growth
of ma~malian cells on or near them, and the EFS, which
contains the cells and the EFS cell supernatant.
As used herein, tissue culture medium includes
any culture medium that i5 suitable for the growth or
maintenance of mammalian cells n vitro. Examples of
such medium include, but are not limited to AIM-V, RPMI,
and Iscove's medium (GIBCO, Grand Island, N.Y.).
As used herein, complete AI~-V is a tissue
culture medium that consists of the proprietary formula
AIM-V (GIBCO, Grand Island, N.Y.) and also contains 10
~g. gentamicin/ml. (GIBCO~, 50 ~g. streptomycin/ml.
(GIBCO), 50 ~g penicillin/ml. (GIBCO), 1.25 ~g.
fungizone/ml. (Flow Laboratories, MacLean, VA.).
Other suitable tissue culture media are well-
known and readily available to those of skill in the art
and may be readily substituted for AIM-V.
~ollow fiber b~or~actor~ and hollow f~ber culture
~ygt~8 .
Hollow fiber thereinafter abbreviated as HF)
bioreactors and HF cell culture systems are known to
those of skill in the art (see, e.q., Knazek et al., U.S.
Patent Nos. 4,220,725, 4,206,015, 4,200,689, 3,883,393,
and 3,821,087, published international application WO
90/02171, which disclosures are herein incorporated by
reference thereto). A HF cell culture system includes
the HF bioreactor, pumping ~eans for perfusing medium
through the system, reservoir means for providing and
collecting medium, and other components, including
electronic controlling, recording and sensing devices.
::
. , . .
:
:
~092/105~ ~ ~g 5 1 ~ PCT/~S91/09069
A typical HF cell culture system, such as the
CELLMAXTY 100 HF cell culture system (Cellco Advanced
Bioreactors, Inc., Kensington, MD.), which is described
in PCT International Application WO 90/02171, consists of
a standard glass media bottle, which serves as the
reservoir, a stainless steel/Ryton gear pump, the
autoclavable HF bioreactor, which includes the fibers and
shell casing in which cells are cultured, and medical
grade silicone rubber tubing, or other connecting means,
which serves as a gas exchanger to maintain the
appropriate pH and PO2 f the culture medium. All
components are secured to a stainless steel tray of
sufficiently small dimensions to enable four such systems
to fit within a standard tissue culture incubator
chamber. The pump speed and automatic reversal of flow
direction are determined by an electronic control unit
which is placed outside of the incubator and is connected
to the pump motor via a flat ribbon cable which passes
through the gasket of the incubator door. The pump motor
is magnetically coupled to the pump and is lifted from
the system prior to steam autoclaving. Tissue culture
medium is drawn from the r~servoir, pumped through the
lumina of the hollow fibers, and then passed thrGugh the
gas exchange tubing in which it is re-oxygenated and its
pH readjusted prior to returning to the reservoir for
subsequent recirculation.
The HF bioreactor, which is a component of a HF
cell culture system, is a cartridge that contains a
multitude of semi-permeable tube-shaped fibers encased
within a hollow shell. The terms HF reactor and HF
~ioreactor are used interchangeably. HF bioreactors
have been used for the growth of mammalian cells and for
the production o~ biologically active products that are
' - '
.
2as~
W092/105~ PCT/~S91/09069 f
26
secreted thereby (see, e.a., Knazek et al. su~xa., see,
also, Yoshida et al. U.S. Patent No. 4,391,912~ and also
have been used to cultivate viruses, including herpes
simplex virus, hepatitis virus, equine encephalitis
virus, mouse mammary tumor virus and human
immunodeficiency virus (see, e.a., Meyers et al. U.S.
Patent No. 4,546,083; Markus et al., U.s. Patent No.
4,301,249; Johnson et al. ~1978) Appl. En~ir. 35:431: and
Tsang et ~1~ publication of Poster presentation at Bio-
Expo, 1986, Boston MA). HF bioreactors have, nothowever, heretofore been used for producing recombinant
vectors, including recombinant viral vectors, in a form
suitable for transducing target cells that are used in
genetic therapy.
HF bioxeactor cartridges, which are well known
to those of skill in the art (see, e.q., PCT
International Application WO 90/02171), contain a
multitude of tube shaped semi-permeable membranes
(hereinafter called fibers) that are encased in a hollow
shell. Cultured cells grow and fill the spaces between
the fibers and are fed by passage of nutrients through
the fiber walls from medium that is perfused through the
lumina of the fibers. Any HF bioreactor known to those
of skill in the art may be suitable for use to practice
this invention. Preferred HF bioreactors for use in
accordance with this invention include the B3 and B4
bioreactors (Cellco Advanced Bioreactors, Inc.,
Kensington, MD) (see, e.a., PCT International Application
WO 90/02171 for a complete description of the B3 and B4
bioreactors).
The B3 bioreactor cartridge contains several
thousand tube-shaped, semi-permeable membranes, which
provide about a 1.1 m2 surface area. The B4 bioreactor
,
wo ~2~10~ 2 ~ ~ 3 .j 1 9 PCTtUS91/09069
27
cartridge is somewhat larger than the B3 cartridge and
provides a fiber surface area o~ about 1.6 m2. The
fibers, which are each approximately 250 ~m in diameter,
are pulled through a polycarbonate $ube that is about 12
inches in length, and the extra-fiber volume is filled at
each end with a polymeric material in a manner such that
liquid can flow through the lumina of the fibers to exit
at the opposite end of the shell. The fiber walls
nominally restrict passage to substances having molecular
weights less than a desired cut-off range. The selected
fiber should be semi-permeable to permit the passage of
nutrients into the EFS and should be of a material, such
as DEAE-cellulose or polypropylene, on which or in the
vicinity of which the mammalian cells are a~le to grow.
For example, the fibers used in the B3 and B4 cartridge
are cellulosic hollow fibers whose walls nominally
restrict diffusion to substances having molecuiar weights
in the range of 3000 to 4000 Daltons. This molecular
weight cut-off range i8 suitable for use in practicing
this inVentiQn because it is sufficiently small to
prevent diffusion of packaged recombinant viral vectors
out of the EFS. The fibers divide the cartridge into the
EFS, which is also referred to as the extra-capillary or
shell-side space, within which minimal bulk flow of
perfusion medium occurs by ultrafiltration through the
fiber wall. ~he EFS volume of the B3 cartridge is about
S0 ml and that of the B4 cartridge is about 100 ml.
The particular cartridge selected for use
depends upon various parameters, including the
requirements of the cells that are being cultivated, the
~aterials perfusing through the lumina of the fibers, and
the cellular products and recombinant vectors that are
being harvested. It is within the level of skill in the
.
W092/10~ 2 ~ v ~ PCT/VS9l/09069
28
art to select an appropriate bioreactor cartridge and
also HF culture system. The fibers and, therefore, the
cartridge and HF cell culture system, are selected as a
function of the components of the perfusing medium to
which they must be permeable and/or impermeable and as a
function of the components of the EFS. In accordance
with this invention, the fibers will generally be
selected such that they are impermeable to the viral
vectors, packaged viral vectors or whatever form the
vectors are produced in order to maximize the
concentration thereof in the EFS and to prevent
undesirable contamination of the perfusing medium with
~uch vectors or virions.
Tissue culture medium perfuses through the
lumina of the fibers and is also included within the EFS
surrounding said fibers. The tissue culture medium,
which may differ in these two compartments, contains
diffusible components that are capable of sustaining cell
growth and proliferation. Tissue culture medium, which
is generally oxygenated, is provided in a reservoir from
which it is pumped through the fibers. The flow rate can
be controlled by the varying the pump speed. In
addition, the direction of flow of the perfusing medium
can be reversed (see, e.a., PCT International Application
WO 90/02171).
The EFS and/or the perfusing medium may
additionally contain an effective amount of at least one
growth promoting or suppressing substance, such as IL-2,
that specifically promotes the expansion or suppression
of the cultured cells, particularly the selected target
cells, such as lymphocytes, in which the effective amount
is an amount sufficient for the cells to be maintained or
proliferate in vitro. The EFS and/or perfusing medium
. .: . - ~ .
WO92/10~ 2 ~ ~ v ~ 1 3 PCT/US91/09069
may also be supplemented with additional ingredients
including serum, serum proteins, and selective agents for
selecting genetically engineered or modified cells. The
selected method is a function of, among other variables,
the type of cells, their intended use, and the extent to
which they adhere to the fibers.
The flow rate can be increased as the number of
cells increases with time. Typically the initial flow
rate of the medium is adjusted to about 30 to 40 ml/min
and is then increased up to about 300 ml/min as the
number of cells increases with time. The direction of
perfusion of the medium through the lumina of the hollow
fibers may be periodically and automatically reversed,
typically every ten minutes, in order to pro~ide a more
uniform distribution of nutrient supply, waste dilution,
and cells within the space surrounding the hollow fibers.
The entire system is sterilized prior to cell
inoculation and is designed for operation in a standard
air-C02 tissue culture incubator. Upon inoculation, the
cells settle onto the surface of the hollow fibers,
through which nutrients pass to feed the cells and
through which metabolic waste products pass to ~e diluted
into the large volume of the recirculating perfusate. A
suspension of cells is inoculated into the extra-fiber
space (EFS) of a HF bioreactor usually through one of two
side ports. The lumina are perfused with cell culture
medium and the cells are maintained la vitro for the
desired period of time. As the cells are cultured, the
perfusing medium is periodically monitored for glucose
concentration. The perfusing medium is replenished by
replacing the medium in the reservoir bottles whenever
glucose concentration drops to about 30 to 40% of its
initial value.
. ~ . , - .
- , .-, :
~ . ~
WO92~105~ 2 Q 9 ~ PCT/US91/09~9
After culturing the cells, the EFS and/or the
cells may be harvested. In accordance with this
invention, the EFS from a bioreactor that c~ntains
producer cells is harvested and used to tran~duce target
cells that are cultured in a second bioreactor. After
transduction, which may be repeated multiple times, and
incubation, the target cells are harvested~ Any suitable
means know to those of skill in the art may be used to
harvest the EFS and to harvest the target cells. For
example, in order to harvest the EFS, the bioreactor
cartridge is removed from the incubator and placed in a
laminar flow hood. The bioreactor cartridge containing
the target cells is given a single gentle shake, which
usually suspends about 30-40~ of cell~, and the contents
of the EFS, including the loosened cells, are drained
into a side port bottle. Fresh medium is added to the
EFS and incubation of the target cells can be continued.
Packaged vector production continues at high
rate as long as the EFS is periodically harYested and
replaced with fresh medium. Other methods known to those
of skill in the art for removing the EFS and cultured
cells from the bioreactor may be used.
Sele~t~on of the re¢om~in~nt viral vector and pro~uction
of high t~ter~ thereof.
The preparation and selection of the recombinant
viral vector DNA encoding at least one gene product is
within the level of skill in the art. In general, the
selected recombinant viral vector is one that can be
replicated and packaged by selected producer cells but
not by the selected target cells. It may be a vector
that is integrated into a host cell genome, such as an
SV40-derived or retrovirus-derived vector, or one, such
wo 92/lns64 2 3 n ~ PCT/US91/~K9
31
as a vector derived from Epstein Barr virus, which
includes an origin of replication, that remains episomal.
The gene product may be a therapeutic product,
such as an anti-cancer or anti-viral agent: it may be a
product, such as adenosine deaminase or immunoglobulin,
that the recipient either fails to produce or produces in
a mutated defective form because of a genetic defect; it
may be a marker, such as DNA that encodes neomycin or
methotrexate resistance, whereby the reinfused target
cells may be selected or detected; or it may encode a
product that regulates expression of another gene
product. Selection, cloning and insertion of the
heterologous DNA into the recombinant Yiral ~ector is
within the level of skill in the art and may be effected
by any of the well known methodologies therefor
Any recombinant viral vector derived from
viruses that can replicate in eukaryotic cells may be
used. The selected heterologous DNA is inserted into the
recombinant viral vectors, which is then introduced into
producer cells by any means known to those of the skill
in the art. The transfected producer cells are then
cultured in a HF bioreactor for a time sufficient for
replication and production of the recombinant vector,
whereby high titers of recombinant vectors are produced.
Preferred embodiments employ recombinant retroviral
vectors produced by a packaging cell line that secretes
packaged replication-incompetent infectious retroviral
particles into the EFS of the HF bioreactor.
Preferred retroviral vectors are those that are
suitable for genetic therapy. Suitability for use in
genetic therapy neces~itates minimizing the possibility
for recombination to produce replication competent
retrovirus or to activate cellular oncogenes and the
.. . . . . .
: '
WV92/105~ 2 0 ~ PCTIUS91/~XK9
retroviral vector must be packaged in packaging cell
lines that do not concomitantly produce helper virus.
Such retroviral vectors may be constructed by means Xnown
to those of skill in the art may be retroviral vectors
known to those of skill in the art or may be derived
therefrom.
Typically, suitable retroviral vectors include:
the LTRs: necessary regulatory signals and retroviral
sequences to produce and integrate proviral DNA into the
host cell genome; and heterologous DNA, which includes
DNA that encodes a detectable marker and/or selectable
marker. The heterologous DNA is inserted in place of all
or portions of the retroviral structural genes in
operative linkage with transcriptional and translational
regulatory sequences including a promoter, such as the 5'
LTR or endogenous promoter, that is recognized by an RNA
poly~erase in the target cell.
Retroviral vectors are generally constructed by
preparing cDNA, which is inserted into a convenient
plasmid, such as pBR322. Desired insertions and
deletions are effected using standard ~ethods, and the
plasmids are introduced into selected packaging cell
lines in order to generate retroviral particles.
Introduction of the plasmids into the packaging cell line
may be effected by any method known to those of skill in
the art. For example, the DN~ may be transfected by Ca-
phosphate mediated transfection (see, e.a., PCT
International Application W0 90/01870~, DEAE-dextran
~ediated transfection methods, lysozyme fusion, direct
uptake or any other method known to tAose oP skill in the
art. Typically the plas~ids are first introduced into an
ecotropic cell line to produce infectious packaged
particles, which are then transduced into an amphotropic
WO92/105~ ~l~ 9 ~ U PCT/US91/09069
~3
packaging cell line, and cultured in selective medium,
and cellular ~lones are selected. The selected clones
are tested for the ability to produce packaged retroviral
vectors without concomitant helper virus production.
Those that do not produce helper virus and~or replication
competent pacXaged retroviral vectors are suitable for
use in producing packaged viruses for transducing target
cells used in genetic therapy. Examples of retroviral
vectors from which clinically useful recombinant
retroviral vectors that can be modified by insertion of
heterologous include, but are not limited to, the
retroviral constructs: pN2 tsee, e.q., Keller et aL
(1985 Nature 318:149-154; and U.S. Patent No. 4,861,719
to Miller): pLHL, which is derived from N2 (see, e.a.,
Miller et al. (1986) Cold SDrin Harbor Symp. on
Ouantitative ~ioloaY. Volume LI, Cold Spring Harbor
Laboratory , pp. 1013-1019); pSDHT (Miller et al. (1986)
Somat. Cell. Mol. Genet. 12:175-183), which includes the
bacterial marker gene that encodesthe neomycin phospho-
transferase gene (neo), which confers resistance to G-
418: and pLPL (Proc. Nat'l Acad. Sci. USA 80: 4709-
4713), which includes the gene encoding the selective
marker hypoxanthine-guanine phosphoribosyltransferase,
HGPRT.
Derivatives of these vectors, such as those that
include the heterologous gene or genes of interest, may
be constructed by inserting selected heterologous DNA
into a retroviral vector in operative linkage with a
promoter, which recognized by a target cell ~NA
polymerase, and other transcriptional and translational
regulatory signals. For example, retroviral vectors SSC
and SSCX, ATCC Accession Nos. 67760 and 67761,
respectively, which are derived from N2, encode a solu~le
.
: 7
.
': ,
~` : :
WO92/1o~ 2 0 n ~ PCT/US91/09069
form of the glycoprotein receptor CD4, which as been
proposed for u3e in AIDS therapy. SSC and SSCX have been
packaged using the PA317 cell line (ATCC Accession No.
CRL 9078). The construct pLPL2 (see, ~ g~, U.S. Patent
No. 4,861,719 to Miller), which is derived from pLPL by
including additional deletions, such as deletion of the
second pacXaging signal in the 3' LTR, which prevents
packaging of pBR322 DNA.
ln a pre~erred embodiment, the retroviral vector
LASN (see Hock et 31~ (1989) Blood 74: 876-881), which
is a derivative pLNL6, an N2 deri~ative (see Bender et
al. (1987) J. Virol. 61: 1639), and which encodes ADA,
is produced in high titer in a HF bioreactor by a
packaging cell line derived from PA317 (ATCC Accession
No. CRL 9078). The L~SN plasmid ~ector includes DNA that
encodes 5' LTR, the psi~ packaging signal, which includes
qaq protein encoding sequences, but which have been
modified by changing ATG to TAG to prevent translation of
any gaq encoding sequences (see, e.a., Bender et al.
(1987) J. Virol. 61: 1639); the cDNA encoding the ADA
gene inoperative linkage with the 5' LT~; the neo gene
in operative linkage with the SV40 early region promoter
and enhancers; and the 3' LTR, which includes a
polyadenylation site. The AUG start codon for ADA mRNA
begins in the LTR, continues through ADA sequences, the
SV40 sequences and neo seguences and terminates in the 3'
LTR. The LASN plasmid vector has been transfected into
the packaging line, PA317 (ATCC Accession No. CRL 9078),
which produces packaged LASN retroviral particles that
have an amphotropic host range (see, Hock et ~1. (1989)
Blood 74: 876-881) but which does not produce detectable
helper virus.
,. ~.
.~
WO92/lO~ 2 ~ PCT/US9l/~06
In a preferred embodiment, the LASN-producing
PA317 cell line is inoculated into the EFS of a HF
bioreactor and cultured under conditions whereby packaged
LASN retroviral particles accumulate in the EFS medium at
high titer. No detectable helper virus is produced.
Pr~paration o~ pro~uc~r 0~118.
Recombinant viral vectors used for genetic
therapy must be able to infect target cells, but should
not harm the host. Therefore, the viruses from which they
are derived should be modified such that they do not
commandeer target cell biochemical pathways to the
detriment of the target cell and/or host into which the
target cells are introduced. Consequently, in order to
amplify recombinant viral vectors that contain
heterologous DNA of interest, the reco~binant vectors
must be cultured in vitro in producer cells in which they
can be replicated.
In preferred embodiments, recombinant viral
vectors are amplified in producer cells lines, called
packaging cell lines, that are cultured in a HF
bioreactor and secrete the recombinant vectors into the
EFS in a form in which the recombinant vectors can be
introduced into target cells. Tn particular, packaging
cell lines that produce infectious, replication-
incompetent, recombinant retroviral vectors that contain
heterologous DNA are cultured in a HF bioreactor and high
titers of pacXaged retroviral vector particles accumulate
in the EFS.
A cell line, such as PA317 that contains such
a DNA construct can transmit pacXaged viral RNAs,
including those that encode heterologous DNA, as long as
the viral RNA includes the proper cis-acting elements,
.. .
: , , , ' -'' - . ~ :
- .' - '; - , ~
2~ 9~ PCT/US91/~9069
36
such as the packaging signal. The packaged viral
particles that are produced by PA317 are amphotropic,
and, thus, can infect a broad range of mammalian target
cells.
Suitable packaging cell lines ~ay be constructed
or ~ay be derived from readily available well-known
lines, which include, but are not limited to: psi2 (Mann
et al. (1983) Cell 33 153-159); NIH 3T3 TK (Miller et
al. (1986) Mol. Cell. Biol. 6: 2895-2902): PA317 (ATCC
Accession No. CRL 9078) (see, e.a., U.S. Patent No.
4,861,719); and PE501, which is similar to PA317, but
produces packaged retroviral particles that have an
ecotropic host range (see, Hock et al. (1989) Blood 74:
876-881).
In a preferred embodiment, the retroviral vector
LAS~ is produced by a packaging cell line that has been
derived from PA317. Construction of PA317 is described
in U.S. Patent No. 4,861,719 to Miller and construction
of the L~SN-producing derivative of PA317 is described in
Hock et al. (1989) Blood 74: 876-881.
Briefly, DNA constructs, which were carried in
pBR322 and in which all cis-acting elements, except for
the tRNA binding side, had been deleted were introduced
into NIH 3T3 TK- cells by co-transfection with a
selectable marker, the HSV TK gene. TK+ cell clones were
selected and tested forthe ability to package and
transmit a retroviral vector, pLPL2, that includes the
HGPRT gene in operative linkage with a promoter. The
retroviral vector was introduced by calcium phosphate-
mediated transfection and the cells were cultured. Afterseveral days the overlying tissue culture medium was
tested assayed for the presence of HGPRT-producing virus.
The cell line, PA317, that packaged the highest titer of
W092/ln5~ ~33, s, ~ PCT/US91/09069
HGPRT-virus (6 x 104 CFU/ml), was selected.
The retroviral vector, LASN was constructed by
introducing cDNA that encodes ADA was inserted in plasmid
DNA that contained the retroviral LNL6, which is an N2-
derived vector (Bender et al. (1987) J. Virol. 61:
1639). In LASN, ADA-encoding mRNA begins in the 5'LTR,
continues through ADA, SV40 and ~eo sequences and
terminates in the 3' LTR (see, e.~., Hock et al. (1989)
Biood 74: 876-881) The pBR322-derived plasmid that
contained the retroviral constructs was transfected into
an ecotropic packaging cell line. Packaged retroviral
particles from the ecotropic cell line were transduced
into PA317 and G-418-resistant clones were selected and
tested for helper virus production. Those that do not
produce helper virus have been used to produce packaged
LASN for transduction of target cells.
other retroviral constructs containing
heterologous DNA and packaging cell lines may be
similarly constructed and used in accordance with this
invention.
Culturing produc~r ~lls in a ~F biore ctor.
Prior to use, a HF cell culture system, such as
the CellMAXT~ lO0, is steam autoclaved, continuously
perfused with recirculating deionized water, drained,
flushed, and perfused with the selected tissue culture
medium in both the EFS and perfusate pathways. All
operations are performed in sterile conditions, such as
in a sterile laminar flow hood.
A sufficient amount, generally about 105 - 2 X
1O6 producer cells/ ml, of cells in a sufficient volume to
fill the EFS of a bioreactor cartridge is inoculated into
the pre-sterilized cartridgè, such as a B3 or B4
.: - . .
- ~
- . .
WO92~10~ 2 0 9 ~ j 13 PCTIUS91/09069
38
bioreactor cartridge tCellco Advanced Bioreactors, Inc.,
Xensington, MD),. The inoculated bioreactor is
transferred to a standard incubator, perfused with
medium at an appropriate temperature, generally about 32
C to about 37 C and maintained under these conditionæ.
After the cells settle, culture ~edium is
continuously perfused through the HF bioreactor by means
of externally applied pressure, such as a pump. A
reservoir that contains tissue culture medium, the HF
bioreactor cartridge, and pumping means are connected by
tubing, typically silicone rubber, which also serves as
an oxygenator. The medium may be oxygenated by any
means known to those of skill in the art. The silicone
rubber tubing simultaneously serves as a membrane gas
exchanger t~ replenish oxygen and, if the medium is
buffered with bicarbonate; to ~aintain the pH via CO2
transport into the perfusion medium. Medium that is
buffered with systems other than bicarbonate do not
necessarily require CO2 in the incubator.
Perfusion is continued for a sufficient ti~e and
under conditions, whereby the vector is released into the
EFS, which then contains high titers of the recombinant
vector. The conditions, which include, the tissue
culture medium, incubation temperature and incubation
time, are chosen as a function of the requirements of the
producer cells and recombinant viral vector.
Determination and optimization of such conditions are
within the level of skill in the art.
During the incubation period, the reservoir
containing the perfusing medium is replaced in order to
maintain a sufficiently high concentration of glucose and
other diffusible nutrients in the EFS and for waste
removal. Typically, the perfusate is replenished several
: :
'
WO92/105~ 2 ~ 3 PCT/US91/09069
39
times a week by replacing the reservoir bottle with one
containing fresh medium. Incubation continues for at
least about one to thirty days or more days. During the
incubation period, the EFS is periodically harvested and
contacted with target cells. After the cell~ have been
incubating for one to several days to a week or so, the
EFS can be harvested. The EFS can be harvested
batchwise, periodically, or continuously or by any
variation thereof known to those of skill in the art.
It may also be connected to the EFS of a second
bioreactor that contains target cells, as shown, for
example, in Fig. 2.
In preferred embodiments, L~SN-producing PA317
cells, which are suspended in tissue culture medium, are
inoculated into a B3 or B4 bioreactor, (Cellco Advanced
Bioreactors, Kensington, MD) via the side ports. The
bioreactor is attached to a perfusion circuit, the cells
are permitted to settle onto the fibers for about 15
minutes to several hours before perfusion is initiated.
After perfusing overnight or for day or two the EFS can
be harvested, batchwise or by directly introducing it
into a second bioreactor using a dual perfusion circuit,
fresh EFS medium is added and perfusion continues. If
the EFS is harvested periodically, about once a day, the
LASN-producing cells continue to produce high titers, at
least about 105 CFU/ml, for up to at least 6 to 7 weeks.
Viral titer may be measured by any method known
to those of skill in the art (see, e.g., U.S. Patent No.
4,861,719 to Miller; and U.S. Patent No. 4,868,116 to
Morgan et al. Typically viral titer is measured as
colony forming units/ml.
- . . . . ,, : .
W092/105~ 2 ~ 1 3 PCT/US91/O~K9
8electing target cells an~ transdu~ing them ~ith
r~combin~t v~ral Yeotors p~o~uce~ by oell~ cultur~ ln
a HF bioreactor.
Target cells, such a6 fibroblasts (see, ~ g~,
Palmer et al. (1987) Proc. Natl._Acad. Sci. 84: 1055; St.
Louis et al. (1988) Proc. Natl. Acad. Sci. 85: 3150-54
and PCT International Application W0 90/01870) epithelial
cells (see, U.S. ~atent No. 4,868,116 to Morgan et al.)
and immune cells, such as lymphocytes, are obtained
either from the patient, who has the inherited or
acquired disease or from another donor. The selected
target cells are contacted with the harvested recombinant
viral vectors that were produced in a ~Y bioreactor to
produce transduced target cells. In order to enhance
infectivity of the viral vector, polycatio~s, such as
protamine at concentrations of about 5-10 ~g/ml, may be
added to the harvested viral vectors or to the bioreactor
in which the producer cells are cultured. Contacting may
be effected by any method known to those of skill in the
art. The target cells are then inoculated into the EFS
of a second bioreactor, which has been autoclaved and
prepared as described above for the producer cells, and
incubated as described above.
The target cells may be transduced, either
Z5 before or after inoculation into the EFS of the second
bioreactor, by contacting with the EFS medium from a
first bioreactor that contains producer cells. The
target cells may be mixed with harvested EFS medium, may
be introduced into a second bioreactor into which the
harvested EFS medium is inoculated or the EFS of the
second bioreactor may be connected to the EFS of a first
bioreactor that contains producer cells and is
continuously or intermittently inoculated. The target
:
'. ~ '
. . .
WO~2/lO5~ 2 ~ 9 8 ~ PCl/US91/09069
cells are contacted with harvested vector-containing EFS
medium one or more times.
Target cells can be harvested by gently shaking
the bioreactor and pouring the suspended cells into a
side port bottle. Generally about 101 target cells are
used for one treatment and, ideally, 100% should be
transduced.
In preferred embodiments, lymphocytes are
inoculated into a second bioreactor and then transduced
with the EFS medium from a first bioreactor, which
contains packaged infectious replication-incompetent
retroviral vectors.
In a preferred embodiment, transduction is
effected continuously or intermittently using a dual
perfusion circuit as shown in Fig. 2, discussed below, by
connecting the EFS of the second bioreactor to EFS of a
first bioreackor in which retroviral ~ector-producing
cells have been inoculated. The target cells are then
repeatedly exposed to EFS medium from the first
bioreactor. A high percentage of target cells can
thereby be transduced.
Tha ~u~l b$or~Gtor perfusio~ circuit.
Continuous or intermittent inoculation of target
cells with recombinant retroviral vectors may be effected
by directly pumping the EFS from the fir~t bioreactor
that contains the producer cells into the EFS of the
second bioreactor that has been inoculated with target
cells. This may be accomplished using the dual perfusion
circuit, pictured in Fig. 2.
As shown in Fig. 2, ~he perfusion circuits of
the two bioreactors are separated by a pinch clamp
(represented by ~ in Fig. 2). A peristaltic pump, is
.
: -, ~ '' ' ~ ' ,
- :
.. . . . .
.
WO92/10~ 2 ~ PCT/US91/09069
used to introduce fresh medium into the bioreactor that
contains the producer cells. When the peristaltic pump
is operating, the pinch clamp opens, thereby connecting
the EFS of the first bioreactor via a side port to that
of the second bioreactor via a side port. EFS medium
that contains recombinant retroviral vectors is forced
out of the first bioreactor through the connecting tubing
and pinch clamp and into the second bioreactor. Fresh
medium is introduced through the second side port of the
producer bioreactor. A filter that is designed to remove
blood leukocytes, is placed in the tubing between the two
bioreactors, interposed between the pinch clamp and the
second bioreactor. This prevents contamination of the
target cells by producer cells. Excess medium from the
EFS of the second bioreactor is forced through the second
side port into an overflow flask. The peristaltic pump
may be operated continuously or periodically. In
preferred embodiments, the pump is operated for about 1
minute per hour at a pressure sufficient to introduce
about 10 ml of vector-containing EFS medium into the EFS
of the second bioreactor that contains target cells.
The following examples are included for
illustrative purposes only and are not intended to limit
the scope of the invention.
25~xAMpLæ 1
Production of ADA-oo~ta~ning retroviral p~rticles.
LASN-producing cells were the gift of Dr. Dusty
Miller. The construction of the LASN retroviral vector
that contains the ADA gene in operative linkage with the
LTR and the helper-free cell line that produces packaged
LASN retroviral vector particles is described in U.S.
Patent No. 4,861,710 t~ Miller and in Hock et al. (1989)
BLood 74: 876-881 is discussed above. The packaging cell
W~92/l05~ 2 ~ 9 3 S 1 ;3 PCT/US91/09069
43
line and LASN vector were prepared using publicly
available and well known starting materials.
Briefly, LASN is a derivative of the vector LNL6
(Bender e~ al. tl987) J. Virol. 61: 1639), which i5 a
derivative of the well-known vector N2 ~see, Nature 318:
149-154; see, also, Armentano et al. (1987) J. Virol. 61:
1639). LASN includes, starting at the 5' LTR, which is
the MoMLV LTR, the extended packaging signal, psi~, ADA
cDNA under control of the LTR, the SV40 early region
promoter and enhancer, the bacterial D~Q gene under
control of the SV40 promoter, the second LTR, and a
polyadenylation site. A~A encoding sequences extend
through the SV40 and ~ÇQ and into the 3' LTR. A plasmid
containing the LASN sequences was introduced into an
ecotropic packaging cell line/ PE501, and virus from
these cells was used to infect PA317, ATCC accession no.
CRL 9078, and G-418-resistant LASN-producing PA317 cells
were isolated.
LASN-producing PA317 cells were grown in T-150
flasks and cultured to produce confluent monolayers. The
cells from three T-150 culture flasks (about 4.5 x 107
LASN-producing PA317 cells) were trypsinized, resuspended
in complete tissue culture medium (cTCM), which contains
10% heat-inactivated fetal calf serum (FCS) (Hyclone,
Logan, UTAH), and centrifuged at 800 x g for about 10
minutes at room temperature. The cell pellet was
resuspended in 100 ml cTGM and inoculated into the EFS of
a B4 HF cartridge (Cellco Advanced Bioreactors,
Kensington, MD) via the side ports. All operations were
performed in a sterile laminar flow hood.
Prior to use, the silicone rubber tubing flow
path from the bioreactor culture system had been
connected to the pump and reservoir and steam autoclaved
- . - . .
. .
- ~. : .
- - , -
.. .. - : '
.
.
2 ~
W092tl0~ PCT/US9t/0~69
with side port tubing and bottles at about 121 C for 20
minutes. U~ing sterile technique, a B4 bioreactor
cartridge was re~oved from its package and inserted into
the sterilized silicone rubber tubing pathway. The side
port bottles were attached to the side ports of the B4 HF
cell bioreactor. The distilled water in the EFS of the
bioreactor was drained into empty side port bottles and
discarded. The system was perfused with 0.8 liters of
deionized water overnight at 37 C. The perfusion pathway
and extra-fiber space of each system were then drained
and flushed with Dulbecco's minimal essential tissue
culture medium (DMEM, Gibco, Grand Island, NY) which was
then discarded and replaced with cTCN, which contained 45
gm glucose/liter DMEM, 10% heat-inactivated FCS, 50 units
of penicillin/ml, 50 ~g streptomycin/ml, and 2.5 ~g
amphotericin B/ml, which had been placed in the reservoir
of the perfusion circuit. The bioreactor culture system
was then transferred to a standard tissue culture
incubator, which was held at 37 C and contained a
humidified 5~ C02 in air atmosphere. Perfusion was
initiated at a rate of about 100 ml/minute. After an
overnight perfusion, the bioreactor was removed from the
incubator and the EFS was inoculated with 100 ml of the
resuspended LASN-producing PA317 cells via the side port
bottles. The entire CELLMAXT~ bioreactor unit was then
placed into the incubator, but not perfused for 4 hours,
in order to facilitate uniform attachment of cells to the
fibers. Subsequent perfusion was commenced at a rate of
about 40 ml per minute and gradually increased to about
300 ml per minute during the course of the culture in
order to insure that the cells were adequately
oxygenated. The direction of flow of perfusing medium
was not reversed.
WO92/105~ ~ 9 ~ PCT/US91/0906g
Glucose concentration of the perfusing medium
was monitored about every 1-4 days. The perfusion medium
was replaced when glucose concentration had dropped to
about 30-50% of the initial value of about 4.5 gr/l. The
medium replacements were performed in a laminar flow
hood.
As expected, the perfusate, which was assayed
for virus by a colony forming assay, contained no
detectable virus. The viral particles are about 150-200
nm in diame-ter, which is too large to diffuse through
the fiber walls. At the indicated times (see Figures la
and lb), the medium in the EFS, which contained the viral
particles, was harvested and replaced with fresh cTCM.
The harvested medium was stored at -70 to -B0 C awaiting
assay for virus content.
Figure la presents viral titer as a ~unction of
days in culture in the bioreactor. Figure lb presents
the total number of viral particles produced per day as
a function of days in culture.
~XAMPL~ 2
~he effe~t of harve~ti~g ~nd replacing the ~F8 on total
viral output ~nd ~ir~l titer/ml.
on two successive days, day=t and day=t+l, the
EFS medium from a bioreactor, which had been inoculated
and incubated as described in Example 1, was harvested
and titered. The EFS was harvested by gently
pressurizing one side port bottle through a 0.2 micron
filter to force the contents of the EFS out ~f the
bioreactor and into the other side port bottle.
The first EFS harvest, occurring 22.5 hours
after the EFS medium was introduced, yielded a titer of
7.0 x 105 CFU/ml. This was equivalent to a production
rate of 5.2 x 107 virus particles per day. After the
: . ., , : . . : - .
.
-. . ~ -
. ~ . . .
. - , , : . .
W092tlO~ 2 04~ J a PCT/US91/~69
46
harvest in which all of the EFS medium was removed, fresh
medium was added to the EFS and incubation was continued
for another 4 hours, after wAich the all of the EFS
medium was harvested and titered. This titer was 2 x 105,
which is equivalent to production rate o~ 12 . O X 107
particles per day. All remaining EFS medium was removed
and completely replaced by fresh medium. The EFS mediu~
was then harvested after 17 hours and completely replaced
with fresh medium, which was harvested after 7 hours.
The results are shown in TABLE I.
It was possible to achieve viral titers of 105-
106 and viral production rates from a single bioreactor of
more than lOa viral particles per day. Furthermore,
increasing the frequency of the EFs harvest appeared to
increase total viral output.
For comparison, two T-150 flasks containing a
pre-confluent monolayer (about 107 cells) of LASN-
producing PA317 cells were incubated at 37 C in a
humidified 5% CO2 atmosphere. ~hen the cells were
confluent, the medium from the monolayer cultures was
harvested and titered. The results, which are presented
in TABLE II, demonstrated that in monolayer culture, it
was only possible to achieve a titer in the range of
about IOa particles/ml.
': ' ''- -:
- -
:: ' ~ . ' '
WO92~105~ 2 ~ 9 ~ J ~ ` PCT/US91/09069
TABL~ I
PRODUCT~ON OF VIRAL PARTICLE~ IN TE~ ~F BIOXEaCTOR
Conse- Duration titer EFS volume rate o~ virus
cutive hours x10 5** production
Samples _ _ x 10-7***
l 22.5 7.0 70 5.2
2 4.0 2.0 l00 12.0
3 17.0 5.0 75 5.3
4 7.0 8.9 70 21.3
* hours between replacing and harvesting the EFS
** titer= recombinant viral particles/ml
*** rate of recombinant viral particle production =
recombinant viral particles/ml/day x EFS medium
volume.
TABL~
PROD~CTION OF VIRAL PARTICL~ IN MONOLAYER C~TURE :~
Flask#/ Duration titer vol~me rate of virus
harvest# hours* xlO-~** mlproduction
x 1 0 * * *
l/l 29 l~67 92 l.27
l/2 27 l 90 .80
2/l 29 l.ll 92 .84
2/2 27 .56 90 .44
* hours between feeding and harvesting all of the
medium in the flask
** titer= recombinant viral particles/~l
*** rate of recombinant viral particle production =
recombinant viral particles/ml/day x volume of
supernatant.
. ' .
,
.;. . . .
,
~' ~
WV92/l05~ 2a~ PC~VS91/0~69
48
g~A~P~E 3
I~rans~uctioD of lymphoc~t~s uith the retroviral
pnrtlcles.
A LASN-producing PA317 culture was initiated by
inoculating a B3 bioreactor (Cellco Advanced Bioreactors,
Inc. Kensington, MD) with 8.4 x loB cells, which were 100
viable. ~he B3 cartridge is similar to the B4 cartridge,
except that it smaller. The EFS has a volume of about
50 ml. Tri-lumen, thin-walled tubing was used to connect
the cartridge outlet to reservoir in order to increase
oxygen transport into the medium. The direction of
perfusion of medium was periodically reversed as
described in PCT International Application No. WO
90/01271.
1~ The B3 bioreactor was perfused with DMEM that
contained 10~ heat-inactivated FCS, 2 mM glutamine (Flow
Laboratories), 50 units of penicillin/ml and 50 ~g
streptomycin/ml. The unit was placed in the incubator,
as described in Example 1, and the cells were permitted
to attach for about 15 minutes. Perfusion was commenced
at a low flow rate, less than 100 ml/min. and gradually
increased to 300 ml/min. The EFS was harvested
periodically as described in Example 2 and centrifuged at
about 800 x g for about 10 min. to remove cells and cell
debris. The harvested EFS was stored at -70 - -80 C for
later analysis.
About five weeks after the culture was
initiated, about 60 ml. was harvested from the EFS and
replaced with fresh medium. About 10 ml. of the
harvested EFS was re~oved, diluted and checked for
bacterial contamination, which was absent, and to check
the cells, which appeared healthy.
. :
WO92/lO~ 2 0 ~ 3 ~ 1 ~ PCl/US9t/0~69
The remaining 50 ml. was filtered through a 1
pore size nylon Polydisc7~ AS filter (WHATMAN Ltd.,
Maidstone, England). This filtrate was used for
transduction of the target cells.
The selected target cells were a human T cell
lymphotropic virus I (HTLV I)-transformed, ADA-deficient,
IL-2-dependent, human lymphocyte cell line, TJF-2. TJF-2
was originally obtained from a patient having ADA
deficiency and was then transformed with HTLV I.
A second bioreactor, a B4 bioreactor (Cellco
Advanced Bioreactors, Inc., Xensington, MD) was
inoculated with 1. 3 x 108 T3F-2 cells. The cells were
cultured in the bioreactor in RPMI 1640 tissue culture
medium (Biofl~ids, Rockville, MD.) supplemented with 10%
heat inactivated FCS, penicillinl streptomycin, 2 mM
glutamine (Flow Laboratories) and 1000 units/ml of
interleukin-2 (IL-2) (provided by Cetus Corp.,
Emeryville, CA). 1000 units/ml of IL-2 were also
included in the EFS. The medium in the reservoir was
changed every 1-4 days. Also, more TJF-2 cells were
periodically injected into the EFS in order to increase
cell density. After the culture was established, 7.2 x
10~ cells were removed in a laminar flow hood, by giving
the bioreactor cartridge a single gentle shake. About
30-40~ of cells were then drained into a side port
bottle. The cells were about 65% viable. About 20% of
the cells were removed to serve as non-transduced
controls. The remaining cells were pelleted and
resuspended in 45 ml of the LASN filtrate, described
above.
The EFS of the second ~ioreactor, which
contai~ed the remaining TJF-2 cells, was reinoculated
with the resuspended cells. RPMI 1640 complete medium,
: .
- - ~
W092tlO~ 2 ~ 9 ~ j - 3 PCTtUS91/09069 -
prepared as described above, was adde~ to fill the EFS,
the unit was placed in the incubator and perfusion was
started. After 2 days, the transduction procedure was
repeated with a second volume of LASN filtrate. After
two more days, the transduction procedure was repeated
again. Before each transduction with LASN, samples of
the cells were removed for analysis. The cult~re was
terminated after about 8 days. It contained a total of
1.02 x 101 cells with 82% viability.
Some of the sample transduced cells were
introduced into soft agar and cultured in the presence of
G-418. Colony formation indicated that the cells were
expressing the n~Q gene that is present in the LASN
vector.
In addition, samples of TJF-2 cells taken from
the second bioreactor before transduction, two days after
the first transduction and two days after the second
transduction were assayed for the presence of the neo
gene by polymerase chain reaction (PCR) analysis, which
demonstrated the presence of the gene after transduction.
PCR analysis was carried using the GeneAmpR
Reagents and DNA Thermal Cycler (Perkin Elmer Cetus,
Emeryville, CA). DNA was isolated from the transduced
and non-transduced TJF-2 cells a~d PCR was initiated with
1-2 ~g of genomic DNA with neo gene primers having the
following sequences:
CAAGATGGATTGCACGCAGG
CCCGCTCAGAAGAACTCGTC.
The reaction mixture was heated at 94 C for 2
min., annealed at 56 C for 2 min, and extended at 72
C for 3 minutes in the DNA Thermal Cycler for 30
repetitive cycles. The products of the reaction were run
on a gel and probed with a neo-specific probe. Genomic
~`
W092/lO~ 2 ~ 9 ~ J~ ~ PCT/US9l/O~OS~
DNA from the transduced cells included neo DNA: whereas
the non-transduced cells did not. Therefore, the target
cells are transduced by LASN and have LASN-derived DNA
incorporated into genomic DNA.
~AMPL9 ~
Tr~eRuot~oD of pri~ry, ~on-tr~sform~, A~A-deflc~e~t
ly~phoayt~s with L~BN using a ~ual par~u3~0n b~ore~ctor
¢ircuit.
A B3 cartridge, prepared as described in
Example 1, was inoculated with 3.5 x 108 primary, non-
transformed, ADA-deficient lymphocytes, and suspended in
84 ml of the continuously harvested LASN-containing EFS
mediu~. The LASN-containing EFS medium had been harvested
during the previous 48 hrs and supplemented with 1000
units of IL-2/ml (Cetus, Emeryville, CA). The bioreactor
was perfused overnight with AIM-V containing 1000 U IL-
2/ml in the forward direction at a rate of about 100
ml/min.
The EFS of the first bioreactor, which
contained the LASN-producing PA317 cells, was then
connected to the EFS of the target cell bioreactor in the
arrangement of a dual perfusion circuit as shown in Fig.
2. A peristaltic pump pumps fresh medium, DMEM medium
containing 10% FCS (HyClone, Logan, UTAH) and 1000
units/ml IL-2, into the entrance side port in the first
bioreactor. The perista pump was run for 1 minute every
hour. The fresh medium was pumped into the EFS at a rate
of 5 mls/min. The LASN-producer PA317 cartridge is
perfused wi~h DNEM that contains 2% FCS at a rate of 300
ml/min. As result of the relatively high flow rate of
the perfusate and intermittently open side ports, some of
the perfusate was ultrafiltered into the EFS through the
fiber walls at an approximate rate of about 5 ml/~in.
WO92/10~ 2 Q ~ 3 PCT/US91/~69
Since serum proteins do not ultrafilter to a significant
extent, the final concentration of FCS proteins in the
EFS is estimated to be ahout 5% FCS. When fresh EFS
medium is not being pumped into the side ports, the
perfusate is not ultrafiltered.
The pinch clamp that separates the EFS of the
two bioreactors automatically closes when the pump is
off. A RC-50 Pall filter (Pall Biomedical Products
Corp., Glen Cove, NY), which is a leukocyte removal
filter for blood, is interposed between the first
bioreactor and the clamp in order to remove any LASN-
producin~ cells that might be dislodged from the EFS of
the bioreactor that contains the LASN-containing EFS
medium.
lS The two bioreactors were sterilely attached
using a Sterile Tubing Welder (SCDIIB, DuPont,
Wilmington, DE). one side port of the second bioreactor
is connected to the input from the EFS of the first
bioreactor and the other is connected to a flask, which
collects the overflow.
About 3.5 x lOa lymphocytes were inoculated into
the second bioreactor and perfused overnight with AIM-V
that contained lO00 units/ml of IL-2 at a rate of about
50 ml/min that reversed direction every minute. ~ecause
the flow rate of the perfusate in the second bioreactor
wa~ relatively slow, there was no substantial
ultrafiltration into the overflow flask.
- About l9 hours after the second bioreactor was
inoculated, the peristaltic pump, which was pumping at a
rate of about 5 ml/min, was turned on for one minute and
about lO ml of the EFS medium from the first bioreactor
was introduced into the EFS of the second bioreactor.
The lO ml includes S ml of fresh medium from the
.
.' .
.
WO92/105~ 2 0 ~ 3 `; 1 ~ PCT/US91/09069
reservoir and 5 ml resulting from the ultrafiltration of
the perfusate into the EFS that occurC by virtue of the
relatively high flow rate of the perfusate. Incubation
was continued and once an hour the peristaltic pump was
auto~atically turned on for l minute. After about 87
hours in culture, including the initial l9 hours,
approximately 0.5 x loB lymphocytes from the second
bioreactor were harvested by draining them from the EFS.
At the same time, the second bioreactor was
inoculated with the lymphocytes, 2 x 106 lymphocytes were
introduced into each well of two 24 well CostarT~ plates.
Prior to introduction into the plates, the lymphocytes
had been suspended in 1 ml of the continuously harvested
LASN-containing EFS medi~m, which was harvested as
described in Examples l and 2. Then l ml of AIM-V
containing 2000 units/ ml of IL-2 was added to each well.
The cells were incu~ated in a CO2 incubator at 37 C for
87 hours. About l.6 x lO~ cells were harvested from the
plates at the same time the lymphocytes in the second
bioreactor were harvested.
Aliquots of about 107 lymphocytes from both the
plates and bioreactor were placed in centrifuge tubes,
pelleted at 800 x ~ for lO min, washed in Hanks BSS, re-
pelleted and frozen at -80 C for subsequent ADA protein
analyses.
MPL~ 5
~ easurement of ~DA pro~uction by ths tr~nsduced
lymphooytes.
Samples of lymphocytes prepared in Example 4
were assayed for ADA production. The cell pellets were
warmed and lysed by freeze-thawing. ~4C-adenosine, an ADA
substrate, was added and the mixture was incubated at 37
C for 1 hr, heat at 95 C for 5 min to quench the
. ~ ~ , ,
:
: ~ ;
'
2,q9~
W092/10~ PCT/US91tO9069
54
reaction. The mixture i5 centrifuged and aliquots are
spotted onto thin layer chromatography (~LC) paper and
run in solvent containing Na-phosphate, saturated
ammonium sulfate and N-propyl alcohol for an l hr. The
TLC paper dried overnight. The spots are cut-out and
placed scintillation vials with scintillation fluid and
counted in a scintillation counter.
The rate of ADA production by the singly
transduced lymphocytes grown in the 24 well plates was
55.2 nmoles/min/108 lymphocytes. ADA production by the
continuously transduced lymphocyte cell~ harvested from
the second bioreactor was 73.2 nmoles~min~lO8 lymphocytes.
This rate of ADA production is comparable to the rate of
ADA production, 50-90 nmoles~min~lO~ lymphocytes, by
normal lymphocytes that are not de~icient in ADA
production.
In comparison, the rate of ADA production by
lymphocytes transduced using the supernatant obtained
from LASN-producing PA317 cells grown in monolayer and
exposed to the supernatant six times was only ll.6
nmoles~min/lO8 lymphocyte~. The ADA activity of the non-
transduced lymphocytes from the ADA-deficient patient was
0.6 n~oles/min/lO8 lymphocytes.
Since modifications will be apparent to those of
skill in the art, it is intended that this invention be
limited only by the scope o~ the appended claims.
, . .
. . . -
