Note: Descriptions are shown in the official language in which they were submitted.
'I~VO 92!19736 P~.'flUS92103532
-1-
C~~tO~GY~OI~ ~TPTISTS
This application is a continuation-in-part of USSN
07/693, 305, filed May 1, 1991, now pending, which is a
continuation-in-part of PCT/US90/05874, filed October 12, 1990,
which is a continuation-in-part of USSN 07/'419,51, filed
October 12, 1989, all of which axe hereby incorporated by
reference herein.
BA.~CGR~'~ ~P' TIt~DT
Field of_ the Invention
This xn~srention relates to novel growth hormone,
especially bovine growth hormone, muteins which inhibit the
growth of animals or otherwise antagonize the effects of
endogenous gr~wth hormone. These analogues znay be expressed in
transgenic animals which thereby acquire a '°reduced growth"
phenotype .
Information Disclosure Statement
~o~rine growth hormone (GH) is a protein of 192 amino
~eids that is naturally synthesized in the anterior pittaitary.
Tl~e molecular weight of the mature protein is about' 22, 000
d~ltons, but it as init3:ally m~,d.e a~ .a pre-growth horcmone ~rith
axa extra 26 a:~~.no acids ~n the amino t~rnninal. Tha.e leader (or
signal pept~:de) is normally cleaved, during secretion of the
hormone by bovine pituita~,r c~ll~Several forms of the mature
protean have been f ound- in nat~.re . The N- teraninal can ~ra,ry
(due to variation in the s~:~e of clea~rage during secretion) so
that the matureprotein begins with e~-then NH2-Ala-Phe-Pxo or
l~z -Phe-Pro. Additi~nal~.y, the amino arid at posit3.on 126 may
be either le~aciaae or valise; agParently a.s a result of allel~.c
~r~.~iatior~ in the bovirae gaoPu~.atioa~.
Exogeno~zs administration'of bGH to cattle increases
milk production, feed efficieaacy, = growth rate, and the lean-to-
fat ratio, and decreases fattening time.
''V0 92/19735 P(_'fJUS921~3532
- 2 -
~~..~'z~2~
bGH has been produced by recombinant DNA techniques,
see e.g., Fraser, U.S. 4',443,539 (yeast); Buell, EP Appl..
203,395 (bacteria); Krivl, EP Appl. 193,515 (bacteria);,
Kopchicl~, EP Appl. 161,640 (encapsulated mouse cells implanted,
into animals); DeHoer, EP Appl. 75,444 (bacteria; gene modified
to eliminate harmful secondary structure) and this has
facilitated the production of analogues of bGH by site-specific
mutagenesis. Thus, Aviv, GB 2,073,245 describes production of
Met Pro (des A1a) bGH, Met Arg (des Ala) bGH, Met-Glu-Gly (des
Ala) bGH, and des (Alas Phe2 - Pro3 -Ala4 ) bGH in E . r~ol i . Brews ,
et al., PTMAS (USA) 85:336?-?1 (1988) reported preparation of
the bGH mutant IC112L, which extended the hydraplnobic face of
the third alpha helix of bGH. The 96-133 fragment of this
mutant was also prepared.
The biological activity of proteolytic fragments of
bGH has als~ been ~tudied. Brews, et al., Biochemistry,
26:???4 (198?)~ Sw~.sIOC~,i, et al., Endocrinology, x:900
(1970) ; Faladi,ni; et ~.~,. , TIBS; X56 (r3ov. 19?9) . The fragment
of bGH containing ~m~.no acids 96-133 is superior in growth
pr~moti~ag assays to bGH 1-95 and bGH 151-191. Hara, et al.,
Biochemistry, 1~.'7:5~0 (19?8) ; S~nenberg, 'U.S. Pat:~nt Nos.
3;664,925 and 4r~5,520; then arad SOnenb~rg,-J. Biol. Chew.,
250:2510-14 (19??), An o~tag~ptide der~.ved from the amino-
te~;l of 1'.~H has ~e~en shown to have' hypoglycemic activity,
see Ng, et al., Diabetes, 23:943-949 (19?4), but it has no
ef'~eC~ on growth: Similar re~u7s ~e~,e observed with the
fragment bGH (96-133). Graf; et al., Eur: J. Biochem., 64:333-
340 (19°6); Hara, et al., Biochem., 1?:550-56 (1978).
Anal~gues of bGH have varied in growth-promoting.
activity, as have the known analogues of other growth hormones.
However, a growth hormone analogue having growth-inhibitory.
activity hay not previously been reported.
93~~ 9xt19736 PCTt~J59Zt~353~
- 3 -
A variety of transgenic animals have been produced.
Haarnmer, et al., Nature, 315:080-683 (1985) (rabbits, sheep and
pigs). Certain of these animals have been caused to express a
growth hormone, and increased growth of such transgenic animals
has been reported. Palmiter, et al., Nature X00_:611 (1982)
microinjeeted the male pronueleus of fertilized mouse eggs with
a DNA fragment containing the promoter of the mouse
metallothionein-I gene fused to the structural gene of rat
growth hormone. Several of the transgenic mice developed from
the genetically moda.fied zygote exhibited a growth rate
substantially higher than that of control mice. (Zn effect,
the gehetically modified mouse serves as a test environment for
determining the effect of the hormone on animal growth).
Later, Palm~.ter, et al., Science, 2220809 (1983) demonstrated
that a similar enhancement of growth could be obtained in
tr~.nsgenic mice bearing an expressible human growth hormone
gene. A lake effect is observed when human growth hormone
releasing factor is'expre~sed in transgenic mice. Hammer, 3t
a~.r nature, 315:413 (1985).
8~vine growth hormone i~as also been expressed in
transgenic aninnals. ~cGrane, et al. J. viol. Chem., 2C3~:1144351
(1988),- ~opch~.ck, et al., brazil. J. Genetics, 12:3?--54
(1989): However; transg~nic animals characterized by an
exogenous gene which confers a reduced growth phenotype were
hitherto unkyaown.
y ~F ~1f
The present invention,relates to proteins which are
~~stantially homologous with a vertebrate growth hormone brat
h,~ve growth-inhibitory activit~r.
We h~.ve disc~vered that mutation of Gly~ 1 ~ in bGH to
erg ( "G119~2" ) , P'r0 c "G11~P" ) , I°ys ( "G1~:9R" ~ , Trp ( "G119W"
) Or
~,eu ( "G11~L°° ) , or the homologous ~lyl a o in hGH to 1-erg
or Trp,
WO 92/I9736 P~'/1.1~92/03532
- 4 -
results in a mutein~r. (mutant protein or peptide fragment
thereof) which has growth-inhibitory activity in vertebrates,
especially mammals. This novel hormone may be administered to
mammals (or other vertebrates), in particular humans and
bovines, when growth inhibition is desirable.
2n one embodiment of the invention, the hormone is
produced e~cogenously and administered to the subject. In view
of the sixe of the hormone, it is preferably produced by
expression in a suitable host of a gene coding for it. Such a
gene is most readily prepared by site-specific mutagenesis of a
bGH gene. However, the hormone may also be produced ,by other
techniques, such as by condensation of fragments of native bGH
with a syhthetic peptide carrying the replacement amino acid,
7Cf a peptide fragment has the desired growth-inhibitory
a~ti~rity, it may be prepared in toto by a Merrifield-type
synthesis.
Tn a second embodiment of the invention, this gene is
introduced ~.n.tr~ a prenatal foam of a ar~amma7. by known
techniques, and the prenatal fe~rm is developed into a
transgen~.c mammal which ea~pres~e~ a reduced growth phenotype .
Corzceivably, .a anamsnal c~uld be genetically rctodifi~~t after
b1rth, i.e., negene therapy". -
Thus, growth-~:nhibited ~namals may be produced either
by adz~~.nastration of the gx~wtJh' ix~ibitory hormone of this
inven~a.on in pharmaceutical fdr~n; or ~Y 9Eneta:c transformation
of a prenatal or postnatal. foran of ' the anammal a
The growth-inhibitory hormone, or tYae gene encodzng
i~' i~ useful in the production Qf sanall animals f or use in
research facilities where space is restricted, as pets for pet
lovers with limited barters; and as livestock for farmers
having small tracts. The hormone may also be useful in the
treatment of human gigantism; and in research on gigantism and
WO 9211976 ~ ~ ~ ~ P~ I'/ZJS92/~3532
-
dwarfism, in the treatment of diabetes and its sequelae, in the
control of cholesterol, and in the prevention and treatment of
certain cancers.
Character~sta.cally, patients with poorly controlled
diabetes have been found to have high levels of circulating
growth hormone. See, e.g., Lundbaek, et al., Lancet, 2:13-83
(~.g70). It has been speculated that high levels of growth
hormone may contribute to poor diabetic contral, as opposed, to
being merely a caneequence thereof. Press, et al., New England
L~fed. ; X10: 810-14 (3984) . d~ttempts have been made to inhibit
~.rowth hormone release by means of somatostatin analogues .
However, use of growth hormone antagonists has not been
reported previously. Thus, a further aspect of the present
invention is the use of the disclosed G~3 axxtagonists to improve
diabetic control.
.bong the complications of diabetes are retinopathy,
n.~phr~pathy a~ad ahg'z;opathy. Diabetic retinopathy is believed
to ~,ri~e as a r~stxlt of the proliferation of microvascular
endothelial yells in the retina. Human growth hormone is known
to stimulate pr~liferation of microvascular endothelial cells.
See Itymasze~rskie et al:; Proc. Nat. Acad. ~Gi. ~JS1~ ,~:617-2~.
(1990 . The' growth hr~rtnone antagonists -of the present
invention ~.y t~aerefore be useful in countering the adverse
effects .of e7euated levels of endogenous growth hormone on
microvascular tissues, such as the re~lna, In d~.abet~.CS, Or In
ether individuals experiencing excessive growth hormone
le°c~els .
Glomerulc~~clerosis occurs in a variety of glomerular
d~a~ages, including diabet~.c n~~hropathy. The cause is
unknovem, but mesangial cell p~'ol~.feration precedes or
~c~ompan~.es mesangial sclerosis. Thus, dysregulation of
resident glomerular cells may be an imp~~tant issue in the
development of glomerulosclsrosis (Doi, e~ al., Vim. J. Pathol.;
1.37:541, 1990) . _
VV~ 92!1973b P'(°f/~J892/03532
c c ~ _ 6 _
tz ~~ z~. ~
Transgenic mice which express bGH have been shown to
have enlarged glomeruli which progressed to a state of.
glomerulosclerosis. Thus, GH has been implicated in the
development of diabetic glomerulosclerosis (Doi, et al., 1990,
and Bell, stn. J. Nled. ~ci. , 301:195, 1991) . ~.1 GH antagonist
could alleviate the GH-dependent effect an the cells of the
diabetic kidney, and thereby be useful in the prevention or
treatment of glomerulosclerosis.
tnThile growth, hormones have not previously been
implicated in hypercholesterolemia, in another embodiment, GH
aratagonaats are used to reduce serum cholesterol levels.
It has been suggested that long-activity somatostatin
analogues may have ~ralue in the control of breast and prostate
cancers. lNZanni; ~iotherapy, x:32-36 (1992). Manni
hyp~hh~si~es that they could inhibit tumor growth by a number
~f mechana,smsg including inhibiting growth hormone secretion.
Growth. h.armaone is implicated because it is lactogenic and
because it elevates I~F-1 levels; ale suggest that the growth
~orrc~cane antagonists of the present in~rention may be used in the
treatment oaf cancers whose growth, is facilitated by ~xadogenous
yro~vth horanor~e r~~ IGF'-1.' .
In general. these antagonis s are therapeutically or
prdphyl~ct~:cally, us~f~ul ia~ c~unterihg the adverse effects of
gr~~rhh horm~ne~, b~th endogenous hormones and hormones
administered clinically.
In the caaarae o~ our raork, we have discovered a
cor~elavion betv~reen the ability of mouse L cel3s to secrete the
Protein and the protean having an effect (pos~.tive or negative)
on growth rate in a transgenic an~.mal. The use of an L cell
secretion assay to identify growth-modulating proteins is also
a part of this inver~tion.
VI~~ 92J1973~ 2 ~ fl 2 ~ 2 ~ PCT/~.JS92/03532
The appended claims are hereby incorporated by
reference as a .further enumeration of the preferred
embodiments. All patents and publications cited in this
specification are incorporated by reference.
~ItI~F I~~~C,R~PTIi~~1 tala' T~ DRI1GS
Figure 1 Amino acid sequence of bGH (G119R) and
nucleotide sequence of the gene encoding this analogue. The
alpha helices are marled and the amino acids are numbered, with
number 1 being the first amino acid of the mature protein. The
boldfaced bases and amino acids are those mutageni~ed in the
G119R mutant:
Figure 2 General strategy of oligonucleot2de directed
mutagenesis. p$GH10 6 was used as the parental vector. It
contains mouse metal7.othi~nein I traa~scriptional regulatory
sec,~uences (E~lT- 3. ) fused to the bGH gene (BamHI j oined with
EgI2I ) which c~ntai:ns f ive exons ( shaded boxes I--'T) and intron
A. This fusion. gene wad incorporated. into pER~22 at the EcoRI
s~.te: The pER322 orygin of repla,cation (OR.I) , ampicillin
resistant gene (Amp), as well as the bGH translation start
(~1~CG) and stop (TAG) codona are ixadicated. 5' and 3' non-
translat~d regions a.re shown in hatching. The .~cleotide
s~~en~~; between restriction sites Tth111I and r~mal is shown.
Substihutaon mutabi~an~ are indicted: One silent mutation is
also iyadi:cate~ ( * ) ~~ich created a uniqe.te Eam'HI site . The
p~~itaon of the principal ammo acid residues mutated in our
e~erlments ~~1~, 117; 119, 122') are indicated.
Flc~ure 3 is an idealised surface net (cylindrical
plot) representation of most of the thud alpha helm of bovine
growth hormone : Tl°~e surface net is produced bY prod action of
the helix onto a coaxial cylindrical sheet of paper, cutting
this paper parallel o the hel~:cal ~~cis and flattening it. The
~rolumes of the amino acids aye given ~.n parentheses . A dashed
line indicates the cleft or depression formed by A1a122-G1y119-
Asp115:
'V6~~ 92/ ~ 9736 ~'f,'T/~JS92103532
- 8 - ,
Fi"c~~:re 4. is a' '~p~ot of the secondary structure
prediction (alpha-helix, beta-sheet, reverse turn, random coil).
for amino acids 208-127 of bovine growth hormone (a) wild-type
(b) the mutant G119R and (c) the mutant A12~L. These plots.
were generated by the '"Micxo-Genie" program.
Figure 5 Scatchard plots of data from competitive
binding experiments for wild type bGH and bGH-N!8 using mouse
liver membrane preparations. The ordinate represents the ratio
of bound to-free bGH and the abscissa the concentration of
total bGH bound. Each point represents the mean of four
experiments which were carried out in triplicate.
Figure 6 provides a growth rate comparison among
control (non-traa~sgenic), G119R; Gil9L, G119R. and G119P mice,
a:llustrating the growth-inhibitory effect of these mutants.
Firs, 7 presents an axial view of the third alpha
helix (1t39-126) of bGHf showing its amphipathic tendencies.
Hydxoplaobic ~.no acid sectc~xs are sh~.ded by dots; hydrophilic
amino acids ark indicated b~ o~en'sectors; the glycine sector,
a neutral am3.no acid, by ~laxated lines . ~'he residue's numbers
~d hyc~xophi~.i~ity values (Hopp and Wood scale) are given.
T~i~re 8 pxes~nte ssde views of the third alpha helix
of wild tae (left) and G119R mutant (right) bGHs projected on
tie plane in which ;the side cha~.n of the ~rginine-119 of the
mutant ~~.19R lies . The gl~rcine 219 residue found at the bottom
of th.e cleft °is indicated by an arrow.
The ~riews were prepared b~ use of molecular modelling.
software (QUAN~°A and CF3An, Pol~rg~ne; Waltham, Massachusetts,
USA) . .
Figux'e 9 compares serum glucose, urea/nitrogen, and
triglyceride levels of control mice, transgenic bGH-I~8 (ElI7:L,
1P(.°f/iJS92/03532
W~ 92/19736
- 9 -
G1~.9R, A122D)-producing mice, and transgenic wtbGH-producing
mice, of bath sexes.
Figrure _ 20 compares serum cholesterol for transgenic
wtbGH-producing mice, control mice, and transgenic bGH-1~2a-
producing mice, of both sexes.
Figure ~.1 plots GPDH activity against bGH-MS dosage
in a competitive inhibition assay for the antagonism of the
ability of GH (here, wild-type bGH) to promote the
differentiation of preadipocytes (NTH 3T3-F9:42A cells).
Fio~are 1.2 compares of the effect of bGH and bGH-M8 on
the differentiation ~f 3T3-F442A cells. At confluence, cells
were incubated .with increasing concentrations of bGH or bGH-N18.
Cells were h~~°vested on day 8 for determination of GPDH
activity. The experiment ~a~s repeated twice with similar
reeults. Hacl~ bar represents the mean value obtained from
tripli~at~e agsay~The error bar represents the standard
di~r~a i oh.
Fi,~~ure 3. sh~ws the re~.ati:onship between serum bGH
an~ilog con.~entratioxis ~:md the graw~h ratio of transge.~.c mice
(TG)/n~ntr~nsgenic (lef~G). The ordinate represents bGH analog
concen~ra~s~ns in ~exum. The ab~~iea~~ rep~esex~ts the growth
ratio of T~/I3'f~ mike,
~'zc~u~°,~ 14 shows the relationship between serum hGH
analog concentrations and the growth ratio of transgenic mice
. , (TG) /nontransgeni~ (NT~) . The ordinate represents bGH ar~a~:og
don~ent~ations in sezum. The abscissa represents the growth
~~ti~ of ~'~/~fG mice.
mD~~ ~~ TPREF~'3 D $
The present invention relates to growth hormone
antagonists, especially growth inhibitor, which are peptides
~r proteins having a similarity in sequence and secondary
VhO 92A19736 ~ PC,°T/11~92A03S32
- 10 -
structure to a vertebrate growth hormone, including but not
limited to mammalian growth horanones, especially human and
bovine growth hormones. Preferably, the compound comprises an.
alpha helix having an amino acid sequence homology of at least
about 50% with the third alpha helix of a vertebrate growth,
hormone, especially bovine or human growth hormone. Other
alpha helices of the native hormone may be omitted if this can
be done without 1~ss of growth-inhibitory and/or other growth
hormone antagonist activity. The use of the term "antagonist"
is in a functional sense and is not intended to limit the
invention to compounds having a particular mechanism of
action.
The overall percentage homology of bovine growth
hormone with other mammalian growth hormones is highs porcine
(9a%): ovine (99%). human (66%), and rat (87%). Insofar as the
third alpha helix (amino acid sequence homologous to bGH
109-126) is conceded, the percentage homology is comparable to
the ovegal:l f~.gurea porcine (94%), ovine (94%), human (66%),
and rat (94%) .
The second~.x~r Structure of a polypeptide is a regular
ar~ange~nent of a liaaear segment ~f the polypeptide c~~.n. The
m~~t c~~nlyy enco~.~ered secondary stx~xctur~s are the beta-
eh~ets and the alpha-he~:a,ces. See Schulz and Schimer,
F in a. 1 s f ~~ in ruc re ~~ (Springer-Verlag: 1979).
The alpha. - helix 'is' stabilized by hydrogen bonding between
~aeptide. amide and carbonyl groups of residues separated by a
single turn of the'helix. Secondary structure predictions are
based sin observation of the frequency of occurrence of the
aanin~ acid a.n a bets.-sheet, alpha~helix, etc. in a protein
haring a lsno~ran three dimensional stx~zctuxe.
The three-dimensional structure of porcine growth
hormone has been determined by X-ray diffraction and compared
to that of other. growth hormones. ~bdel-Meguid, et al., Proc.
fat. Adad. Sci:, 84:6434 (1987). Like the other growth
~V~ 92119736 PG~'/US32/03532
11 -
hormones thus studied, it is a single domain protein arranged
as a four helix bundle with the helices in an antipara11e1
relationship. Its four helixes are made up of residues 7-34,
75-87, 106-127 and 152-183. For X-ray. studies of bGH and hGH,
see Hell, et al., J. Hiol. Chem., 260:8520-25 01985) and DeVos,
et al., Science, 255:306-312 (1992). 'the three-dimensional
structures of other growth hormones may be deduced by
comparison of the sequences with due regard for the secondary
structure tendencies of substituted amino acids.
Hovix~e growth hormone is 93% homologous at the amino
acid sequenG~ level w~.th porcine growth hormone, and bGH's
structure has been deduced by study of the two sequences and of
the structure of porcine growth hormone. Its four alpha
helixes have been reported to be assumed by amino acids 4-33,
&6-80, 308-127 and 150-179. The third alpha helix of bGH is
defined as amino acids 106-229. However, it will be noted that
the ends of th~.a helix have a less marked alpha helical
~econdarr~r structure than does the central region, which is 109-
126. a ect bounds of the third alpha helix may differ for
~them GH°s, dependiaag on the alpha hel~.cal tendencies of the
"and" amino ada.ds. the conformat3,on as reasonably consistent
wa.th the preda.ction~ ana.de , by Chen and Sonenberg, Bio,~a.s~ry,
~6:2'~.10 ~~:977) u~~.ng tae method of Chou and Fasman;
Hiochemi~try, 1:222 ~1~74) (mss 10-34, 66-87, 111-127, 186-
x.91) .
The ~nino acid ses~xen~e of the growth hormones
isolated from various ~rert~brate species are highly conserved.
In a. comparison of flounder growth ~.ornnone with other growth
hormones; including bGI3, ~latahiki, et al., J. Biol. Chem.,
264:312 (1989) a.dezatified five, con~er~red regions. Watahiki's
conser~red region G~4 c~mprises the stretch T~KDLFEGI~EbHf~ of
bovihe growth h~rm~ne, i . e. , r~esid~,tes 1~.3 to x29 . tfatahiki' s
Figure 3 identifies residues conserved among the GHs and
residues predicted to be important for the manifestation of
growth-promoting activity.
~O 92119?36 P~'1US9210~3532
- 12 -
Studying .&~Tatahiki~s GD~4 consensus region, several
families of growth hormones may be discerned. 'The first family.
(I) domprises cGH, rGH, pGH oGH, bGH, and hGH. These begin
with LKDLEEGI. They then continue with IQA (cGH, rGH, pGH),,
ILA (oGH, bGH) or IQT (hGH). All members of family I then
conclude GD4 with L1KR,ELED (except for rGH, LMQELED, and hGH,
LMGRLED). The second family (II) comprises fGH, yGH, tGH and
sGH. These have the consensus sequence LS (E/D) LK (M/T)
G(L/I) (L/G/H/N) (K/L) LI (E/T/R/I) (A/G) (N/S) QD.
Four amino acids in GD4 are conserved among all of
the grovath hormones noted by Watahiki: Leu 113, Leu 116, Gly
119, ~eu 123 and Asp 12 (numbering according to the bGH
sec~uerace) . ~f the amino acids nearest Gly 119 on the face of
the thzrd alpha helix, Asp115 a.s strongly conserved (replaced
r by Glu in the fish hormones); Leu 116 is invariant, Glu 118 is
Cd~~erved a~aox~g the a~amma.ls and birds; but replaced by Met, Thr
or Val in fish, Ile 120 ~.~ almost invariant (replaced by Leu in
f~H); and Ala 122 as well conserved, especially in mammals and
bir~.s (replaced by Thr a~n hGH and L~u or Lys in fish GHs ) . ( It
sh~uld be understood that the present ~.nvention is not limited
to mutants in ~rhieh these conse~°a~at~.ons a~~e maintained ~
zt his been shown that a recombinant molecule
conta~:na.n~ a hGH- (1'-13~) fragment linl~~d to a human placental
lactog~n- (~:~41-1.91). fragment retained full hGH immunological
activity ~d bindi~.g affinity to 'GH rece~tore isolated from
rabbit liver. R.us~eJ.~:, et al. , J. Hiol: Chem. , 256 : 296-300
(193). By ~xsin~ the homolog-scanning mutagenesis technique,
gene fragments ref homologous ' hor~none~ -~..e. , human placental
lactogen or human pro~actin - wex°e systematically substituted
through~~zt the h~H gene, thus producing various chimeric
ho~nones. Cunningham, et al., Science, 23:1330-36 (1989). A
o,~mpari~on of the binding affinities o~ those mutants GHs and
wild-type hGH to a. cloned liver hGH receptor led to the
conclusion that there were three discontinuous polypeptide
VN~ 92/19736 PCT/~JS92i03S32
- 13 -
determinants in hGH involved in receptor binding. They were
located at the 1~1H2 terminus, C00H terminus, and within a loop
between amino acid residues 54 and 74. These putative binding
domains were further analyzed by an alanine-scanning
mutacgenesis technique in which alanine residues were
systematically substituted throughout those regions. Amino
acid residues at positions 10, 58, 64, 68, x.'72, 174, 175 and
176 of hGH were shown to be important for Gi3 receptor binding.
However, none of the mutant GHs were reported to inhibit
growth. Cunningham, et al., Science, 244:108x-85 (3.989).
The present invention is not limited to the mutation
of the third alpha helix of bovine or human growth. hormone.
Rather, it encompasses the mutation of the third alpha helix of
any mat~rcnalian or other vertebrate growth hormone, including,
but not limited to; the growth Norm~nes whose sequences are
given in t~atahi~i (1.989): flounder, yellowtail, tuna, salmon,
chieken, rato p~rcihe; ovine, bovine and human growth hormones.
~xpreseion of Cants o~ ether growth hormones is facilitated
b~ the availability of genes encoding the latter. See, e.g.,
G~eddel; l~3atttr~, 281::544-683 (1979) (hGH) .
The concept ~f a polypeptide ~rhich is substantially
hom~log~us to bovine growth hormone is deemad to include (but
is n,~t l,~:mited tc~) any polypeptide which differs from bovine or
hen growth ho~none by (a) a substitutibn at an amino acid
cc~rrespondin~ to amino acids x.15 ~~ x.19 of bovine growth
hora~none, (b) a substitution at an amino acid corresponding to
an amino acid of bo~ri:~e or human growth hormone which is not
consezvred among the vertebrate growth hormones, especially the
replacement of that amino acid by one found at the site in a
different growth hormone, and/or (c) truncation of amino acids
g5 and/or 1:34-13~:: (Conserved amino acids are identified in
Watahiki, et a.1., 19~~.) Thus, all non-bovine vertebrate
gro~rth hax~mones are "substantially homologous" with bovine
and/or human growth hormone. Preferably, the palypeptide is at
least about SOo homologous, more preferably at least 80%
'VV~J 92!1973b PC.°TlUS92103532
.~
- 14 -
homologous, with bovine or human growth hormone in the
subsequence substantially corresponding to the third alpha
helix (approximately, residues 106-129) of. bGH, and more.
preferably over the entire ~.ength of the polypeptide (ignoring
extraneous non-bGH-related fusions to the amino- or carboxy-
terminal).
The compound is Considered to be growth-inhibitory if
t2~e growth of test animals of at least one vertebrate species
which are treated with the compound (or which have been
genetically engineered to express it themselves) is
significantly (at a 0.95 confidence level) slower than the
growth of control animals (the term "significant" being used in
its statistical sense). Preferably, it is growth-inhibitory in
a plurality of species, or at least in humans and/or bovines.
Growth hormones have considerable interspecies cross-
reaCtivity. Gil3., et al., Biotechnology, 3:63 (1985) reported
y that recombiaiant chicken and. bovine growth hormones accelerate
growth in juvenile pacific salmon.
It i~ k~aov~ra that Certain fragments of growth h~rmones
also have gr~wth-pr~moting activity, and it is expected that
the gro~rth-ihhibibory peptides (the reran is used here,~after to
Exclude proteins) of the present invexation need not be as large
~~ b~T~d Preferab7:y, the peptides are at least 11 amino acids
1~ng (three turns o~ an alpha he3.ix) and more preferably at
last 50 amino acids ~:ong. ~h~se peptides may retain the
growth inhibiting ~Ction of; e.g:, bGH (G119R), yet lack other,
undesirable biological a~ti~riti~~ of the native size mutant.
They a.y also hive more desirable pharmacokinetic
ch~.r~cteraatics
The growth inhibitory peptides of the present
invention may also be larger than bGH, provided that the
additional amino acids do not ~'es~.lt in the Compound being
unable to reduce the growth rate of a vertebrate.
~V~ 92/19736 P~CT/~JS921035~2
~~.~JN:~.~~
- 15 -
While the mechanism of action of applicant°s growth
inhibitory peptides is not known, it is believed that they
function as antagonists to wild-type growth hormones
endogenously produced by the target animal. We have shown
tk~at, e.g., bGH (G119R) and bGH (G119R, E117L, A122D), both
competitively inhibit the binding of wild type bGH to liver
membrane preparations. Thus, it is believed that the compound
has a net result of inhibiting growth because its growth-
pr~moting acta.vity is substantially less than that of wild type
growth hormones (and perhaps is negligible) yet it can displace
from growth hormone receptor (GHR) sites the endogenous native
growth hormone (whose stimulation of growth would have been
more pronounced). However, applicants are not bound by this
theory.
De~Tos, et al., Science, 255:306 (1992) examined the
comply of hG~i and the extrace~.lule.r domain of its receptor
(hGI~) bar X-ra~,diffraction. The f~.rst receptor-binding region
of hGH is concave and 1s formed mainly by residues an exposed
faces of he~:xx 4, but also by exposed residues Of helix 1 and
residues in the region connecting helices ~. and 2, The second
receptor-binding region d~r~prises the exposed sides o~~helices
1 and 3 end is. relatively Elate The role of~the helix 3 is
shov~n, best ~.n DeVos ° Fic~. 5; there is a s~.gnificant decrease in
salvent acces~ibil'~ay a.r~~and hGH E1~:9 upon complex formation.
The c~mplex had' the form hGT3 (hG~Il3.) Z ; that is, the receptor
dim~ra.~es to interact w~.th. hGH. It is possa.ble that our GH
antagonists interfere with tha.s da.mer~.~ata.on.
Preferably, the connpounds of the present invention
have an ED50 which i.s less than about lC~ t~:mes the E~50 of wild
t~rp~ UGH in an 'assay of the ability o~ the compound to displace
r~.diolabeled ~r~ld tie bGH from a li~rer membrane preparation
made as descra:bed below. More pref~rablyp the compounds Yaave
an ED50 at least comparable to that of wild type bGH. N~ost
preferably, the compounds have a higher of f inity f or ~gro~wth
~VU 92/19736 P~'lLJS92/0353Z
_ _ ..,
16
hormone receptors than does the growth hormone native to the
animal receiving ~ the 'compound. For purification and
characterization of a human growth hormone receptor, see Leung,.
et al., Nature, 330:537-43 (1987).
A GH mutein may be considered an antagonist, even if
it lacks growth-inhibitory activity, if it antagonizes another
GH-med:~ated activity, e.g., its diabetogenic,
glomerulosclerotic, hypercholesterolemic, or tumorigenic
activities.
the preferred growth-inhibitory peptides are
characterized by ~. ~nod~.fication of the surface topography of
the third alpha helix. It will be seen from Figure 3 that in
the third alpha helix of "wild-type" bovine growth hormone,
there ~a a surface cleft or depression beginning, at the
A~partate-115, deepening at the Glycine-119, and ending with
the Alanine-12~. ~1I1 of the mutants prepared so far, both
t.hase which retain the gild-type cdrowth-promoting activity and
those which do not, are consistent with the theory'that growth-
promatin~ .activity rec~,uires the presence of this cleft or
de~reseion end that, if the center of ~h~.s cleft is "filled in"
by substitution of amino aids with bulkier side ch~-ras, the
mut~iaa inh~.bits the growth of the ~~ab~ ect o
i~;atat~.ons' which, ~ub~tanti~.lly destabilize the alpha-
helix are undeai~abl~ sine they may result in the loss of all
grQ~th-related activity. ~1'e have obs~r~red such loss in the
c~.se ~f several xnutatir~ns which were expected to disrupt the
~I~~a helix.
For a discussion o~ alpha helix farmers and breakers, .
set Claou and F~sman; su ra. GZu,.Ala anal Leu are the preferred
al~aha helix fo~ners' while Pro- anc3 Gl~r are characterized as
strong helix breakers. Substitutions which introduce strong
alpha helix lareakers are less desirable, but may be tolerated
in a particu~.ar case, such as the ea~d of the helix. 'the
'WfJ 92/19730 ~CTli1S92/03532
2~.~ ~ ~.Z~
- 17 -
secondary structures of our analogues have been predicted using
the "Micro Genie'° computer program, which uses the algorithm of
Garnier, et al., J. Biol. Chem., 120:97-12A (1978).
With respect to amino acid 119, glycine is both the
smallest amino acid residue and the one least favorable to
alpha-helix formation. Thus, it is believed that any other
amino acid ma.y be substituted for it without destabilising the
alpha helix, while at the same time filling in the
aforementioned cleft. A11 of the 6118 bGI~ substitutions tested
resulted in a "small animal" phenotype. These substitutions
wire arginine (a large, positively charged ~), proline (a
cxelie aliphatic AA), lysine (a large, positively charged .~A),
tryptophan (a large aromatic AA) and leucine (a large,
nonpolar; aliphatic AFa). In hGH, the homologous glycine is at
pos~.tion 3.19. Subati~ution of arginine or tryptophan resulted
in an antagonist, ho~rever, hGH G120~ retained gro'c~ath-promoting
activ~ay. Corxseguent~.y, it is presently believed tk~at this
glycine; which is conserved in X11 vertebrate GHs, may be
replaced by away amino acid other than alanine (the second
smallest amino. acid),'and mope preferably by any amino acid
which i~ at least as large as proline (the smallest replacement
ami~ao acid known t0 re8~tlt in a "sm~.ll°' animal phen~ty.~~) . The
del.eti~n of G$"'' 9 ~e also Y.nov~n to result ~n 'a °'small" animal
phenotype
Nlod~.f icati~n - of p~~i~ion x.15 is suggested by our
~°tleft'n thet~ry. The' aspartate at position. 115 may be replaced
b~ a b~lk~.er amira~ acid wh~.ch does not destroy the alpha helix.
Preferably, tfie replacement amino acid has a sire greater than
that of ~lut~tate. The aani~.o acids histidine, methiox~ine,
is~leucine; leucix~e, lysine, a.rginine, phenylalanine, tyrosine
and trypt~phan are substantially larger than glutamate. Of
these; H~.s, Met, Leu and Trp are more preferred because they
combine the advantages of bulk with a reasonably sarong
alpha.helical propensity. Note, however, that the wild-type Glu
is the stron.Best alpha-helix former of all of the annino acids .
~i'~ 92J19736 P(.'TlL3S32/03532
- 18 -
The D115A mutant of bGH is not a GH antagonist, but Alanine is
smaller than Aspartic Acid, .~so this is not probative of the
value of replacing Asp115 with a bulkier amino acid.
zt is possible that G119A might lead to a t~small°'
phenotype if coupled with other mutations, e.g., at 115 and
122.
zt is Qossi.ble to systematically screen for the
effect of all possible am~.no acid substitutions at positions
115 and 119. ('here are 202 -1 or 399 combinatorial
~eassibilitie~.) DNA which encodes bGH and is degenerate at
these positions, so as to there encode ..all possible amino
acids, or only those with acceptable alpha-helical
pro~ensa.ta.es, is prepared, a.g., by a 'dirty bottleo~ synthesis.
Phage are pregared.; as taught by Ladner, et al.,
pC~/~S89j03731, W090/02809, which display the mutant bGHs as a
deznaira of a dhimeri~ coat protein. The phage are incubated
with ~ chromatographic support bearing a growth hormone
receptor. (For tl~e techniques ~f isolata.ng growth hormone
receptors, see Leung, et al., Mature 330:537 (1987) and
Spe~a.ce~, et a~.. , J. Biol : Chem. , 263 :7862 (3.988) ) . l~Tative
bG~I is ;also incubated with the support, before, during...-~r after
th:~; phage a:ncLabation. Bound phag~ are recovered, amplified and
ein~d. to determine the sequence of the mutant bGH (usually
by': sequencing the'c~rresponding g~he a.n the phage genom~).
These z~utants haV~ dem~nstrated the ability to compete with
wild tie bGH for ~ growth h~~one receptor. Their ability to
a~~agor~i~e GH acti~rity in ~ri°vo i~ then confirmed by, a . g . ,
administering'' them directly to an animal or by preparing a
suitab~.e transgenic animal:, ~r by the ~n vitro assay described
ix~' Ele 7. This approach ~.y be extended, if desired, to
other ami,rao acid posit~:ons in the third alpha helix. Amino
aCyds which are particularly preferred for screening are the
six an~,ino aca.d~ spatially nearest bGH ~ s Glyl~.~ , that is ,
~a122, I~eu123, zlea20, Leu116, ~sp1.1.5 and G1u118. zt should
be noted that Bass, et al., Proteins: Structure, Function and
wc~ 9zim~~6 p~re~sgz/Q3s~z
- 19
Genetics, 8x309-314 (1990), prepared "hormone phage" which
express and display hGH-geneTII fusion proteins and which were
bound by anti-hGH monoclonal antibodies. Moreover, it was
possible to separate phage bearing inTt-hGH from phage bearing
the low affinity hGH mutant R64A by means of affinity
chromatography (using the extracellular domain of the hGH
receptor bound to nonporous oxirane beads).
besides the mutations at position 119, which is
deemed necessary to
impart the desired
growth-inhibitory
acti~rity, additional mutations are possible which; will leave
the growth-inhibitory
activity or other antagonist
activity
intact: I'hese mutations may take the form of single or
multiple substitutions, deletions, or insertions, in
nonessential regions
of the polypeptide.
For example, it is
possible to alter another amino acid in the alpha helix
provided that the substitution does not destroy the alpha
~e~i~. preferably; such
alterations replace
an amino acid with
one of eimi3:ar size
~.nd polarity. It may
be advantageous to
modify amino acid$ f~,an)c~:ng
the primary mutation
site 119 in
oxder to increase the alpha-helical propensities of the
s~queh.ce, paxticul.a.rly ~.f the mutation at 119 is one expected
to destabilize the helix<
the following table may be helpful in identifying
candidate mutar~ts s
~ V~7:ume A3.pkia
f anctstxoms ) Helicitv
Gly(G) 60.1 ~.93
Ala (.~) ~ 8 ~ 6 1. 45
Ser(S) 89.0 0.79
s (c) 108.5- 0: 77
Asp (D) 1.11: 2 0 .98
Thr (T) 1.1.6 1 0 . 82
Asp (N) 11.7 . 7 0 . 73
Px~o (p) 122 . 7 0 . 59
G1u(H) 18.4 1.53 .
val(v) 140.0 1.14
Gln (Q) 3.43 . 9 1.17
His(H) 18.2 1.24 .
i~b'O l2/1973~6 ~ PC'TA~JS32/~3532
' ..
- 20 -
Met{M) 162.9 1.20
Ile(T) 166.7 1.00
Leu(L) 166.? 1.34
Lys(K) 168.6 1. d7
Arg(R) 173.4 0.79
Phe {~') 1~9 . 9 1..12
Tyr(Y) 193.6 0.61
Trp{W) 227. 1.14
Several of the cited references provide guidance as
to where and where not the polypeptide will tolerate
mutagenesis. Watahiki, et al. (19H9) compared the sequences of
flounder, yellowtail, tuna, salmon, chicken, rat, porcine,
ovine, bovine and human growth hormones. He identified five
consez~red domains which he labeled GDl-GnS. Mutations in these
conse~red domains are more' likely to affect activity; GD4
corresponds to the third alpha helix of bGH. In mutating a
known GH antag~na.~t with the desire to retain inha.bitory
activity, mutations outside the c~nserved domains are more
pedant. Howe~rer, mutations in these conserved regions, if
caref~x~.ly claosez~; may be to~.erated; for example, the mutation
E11.?L does not modify the activity of either wild-type bGH or a
bGH G119R mutant. Note that not only substitutions, but also
ihserta:ons and deletions, are suggested by the example of the
cogne;te harm~nes.
~bdel-Nleguid~ et al. (197) determined the 3ri-
st~ucture of reco~niaia~~~t anethionyl porcine growth hormone, and
suggestedthat it revealed the wg~n~~al three-dimensional fold"
of the growth horanones a The 3I7-structure can be used to
id~ntif~r interior and surface residues; generally speaking,
proteir~~ mutated at surface residues (other than the receptor
binding site) are moxe likely to remain functional. However,
Creigh~On ~.nd Chothia., Platuxe, 339'14 (199) diSCUS9 the
toleration of mutations at-buried residues. The structure may ,
al9o be'used to determine flexible surface "loops°°; proteins
arm more tolerant of e~eletions and insert~.ons in such regions.
~unningham; et al. (;1989) used homolog-scanning
mutagenesis to a.d~ntify the epitopes of hGH for its cloned
., -
.,.i t.. . Y ,'
.x c
a.:, o
7 . ,
~'J , .
n ..>. . . .. ,.., . r .. n., . . ., . t .. .. ~W.v:. n. , ,
~nriw:..~..m. ,. ......, s .'.:.tf....~.. ~....r . . . ,. . . .. .......~..A:
W . In..pl..;, . .'f~~.'~. . .. r.... . .. , ,.. .... .. . ..
ego ~zn9~36 ~mus9z~n3~~z
~1~~~.Z9
-~~-
liver receptor. Only variant hormones having mutations in
regions C (54-'74) , x'.(164-19 t7) , and, to a lesser extent, A(11-33)
exhibited reduced binding affinity. Cunningham and in7ells,
Science, 24~s1081 (1989) used a related technique, alanine-
scanning mutagenesis, to further study these regions. Note,
however, that binding to the receptor utilized by Cunningham is
not necessarily critical to the growth-promoting or growth-
inhibitory activity of the mutant.
k'or example; it seems likely that major amino- and
carboxy-terminal truncations can be made without adverse
effects on growth-inhibitory activity, since the 96-133
fxagment of bGH (Ttll2L) is understood to retain bioactivity.
Truncations may be generated by gene modification or by
e~copeptidase treatment .
7n terms of the kinds of substitutions which may be
ode, one may 1~ok first to analyses of the frequencies of
amino acid ~Iaangea between homologous proteins of different
organisms, such as those presented in Table ~.-2 of Schulz and
Schimer; a ra ~d figure 3 - 9 of Creighton, s_ u~ara . Based on
such analyses, we define conservative substitutions as
exchanges within the groups set f~rth below: ,d
I sma.l~: ala.phatic, nonpolar or slightly polar
re~i:~lues -Ala, Ser, Thr (Fro, Gly)
1CI negata.°vely, charged residues and their amides Asn
g Gnu Gln
2II positively charged residues - ~iis Arg Lys
ZV large aliphatic nonpolar residues
l~Iet Leu Ile Val (Cys)
large aromat~.c residues -
Fhe ~.'1rr Trp
Three residues are parenthesised because of their
special ro~.es in protein architecture. Gly is the only residue
without a side chain and therefore imparts flexibility to the
chain. Fro has an unusual geometry which tightly constrains
1~V0 92/19736 P~'/~JS92/~3532
_ ~2 _
the chain. Cys can participate in,disulfide bonds which hold
proteins into a particular folding; the four cysteines of bGH
are ?highly conserved. Mote that' Schulz and Schimer would merge.
I and II above. Note also that Tyr, because of its hydrogen
bonding potential, has some kinship with Ser, Thr, etc.
Within the growth hormone family itself, we see a
wide variety of substitutions of other amino acids for the
residues of bGH. k'pr example, among the vertebrate GHs set
forth in Watahiki, et al., (1989), Pro appears 6 times in bGH.
The first Pro is not substituted, but is absent from sGH. The
second is replaced by Leu in fGH; Thr in yGH and tGH. The
third is replaced by Leu in fGH, Ile in yGH and tGH, Val in
sGF~: ~'he fourth Pro is conserved. The fifth Pro is replaced
by Phe in fGH; Ser in yGH. The sixth Pro is replaced by Phe in
fGH; yGH and tGH; and Leu in sGH. Overall, Pro is replaced 4
times by Phi, 3~ tunes by Leu, 2 times each by Thr and Ile, and
~nce each by dal and Sir. When this azxalysis is extended to all
,no acids of' bGH; . vae obtain the following tallies:
( 1~ ; 2 conser~red) - >
Thr 14 . Ser fly.) , Asp (~) , Ile (4) . Glu (4) .
Glv ~, 4~ . Val ( 3 ) , Gln ( 3 ) D Leu ( 3 ) . Lys ( ~ ) .
Pale ( 1. ) v ASn ( 1 ) j , J S
~p ( 1.0; ~ Conserved) - >
~~y~(6)'a .Ash t4) . Val (~) D ~ 3) . Lys (2) , ~'g
(2); Gly (2), Thr (1), Ser (1), Phe (1). ~.a
(1a
Glu (13; 2 conserved)->
,~~ f14) . Lys (1~) a Gln ~4) . Ala (3) . Pro (2) .
T~°l~' ( 2 ) , Asn 1 , Ser ( ~l. ) , Val ( 1 ) , Met ( ~,. ) , Arg
(1) D G1Y (1)
Phe (13; 3 conserved)->
Tvr t7). Leu (~), Asn (6), Ser (5). Gln (3). Ile
(~) D Gly (2) I Has (1) D Thr (1) , Val (1)
~l0 92119?35 P~l~J~92/~3~32
~~~~~~z~
- 23 -
fly (lo; 1 conserved) ->
Arg . ( 9 ) r Cs"7.u ( 8 ) r ~P ('1 ) r 'dal ( ~ ) , Pro ( 4 ) . Sex'
Asn ( 3 ) . Phe ( 3 ) . Asp ( ~ ) , Hi s ( 1 ) , Thr
(1) r Tyr (~.) r Aa.a 1
Hia (3; 1 conserved) ->
~,~~(1) ~ Asn (1) , Tyr (1) , Asp (1)
I1e (~')
->
Gl.n (7) , .Asn (5) , laeu Phe (4) . Val (4)
(4) . , .
Al.:a(2) , Ser (1) . ~g (~.)
~~s (
12
;
2
conserved)
-
>
Ser (11) . Ar 7 , Gly (~4) Gln (2) ~eu (2) ,
r ,
Ann (3.)
~eu (~?;
~:1
Conserved)
-a
her (11) ; Va7: t91 . Asn bet Gln (7) ,
('7) , ('!)
.
~.g (4) , flu (~) , Phe (3) ~'r (3) ~~.y (1) ,
, . Pro
(1) I~~:S (1)
s
~~t (
~,
a'
:.ale Ser (3) Leu (1~ Asn
~'7) ,
.
~1:~
(4)
;
r'hr
(3)
:
( ~1~1 1
1
)';
~n (~)
~~
Ile' (5? , leis (4) . Aao ~lx~ (3) C,~lu (2)
_I,'3) . . ,
Ser (1)
Pro (6; canserved)>
1
~Yae (~) : Lei: (~)' , ~h~ Ile (2) ~'a~. t1)
(2~ . ,
her
~
1
)
Gl.n ( 1 conserved) -
1~;
L~u (13) . .Ax3 (6) . lG~s Ser (~) Glu t4) .
(~) , ,
llis (~.) . G1Y (1) . ~ (~) Pro (1)
~
1~~ 92/19736 PCT/US92/~3x32
..
_ 2~ _
Arg ( 9.3 ; 1 conserved) .. j
hvg (19.) , Ser (9) , Thr (7) , lle (3) , Glu (2) ,
Gl~r ( 2 ) . Asn ( 2 ) . H~a. s ( 2 ) . Vas ( 1, ) , Gln ( ~. ) . Asp
(~.) , Ala (l)
Ser (13; 3 conserved)->
Ala (~) ~ Asn (~) , Gln (~) , Leu (4) . ~~.v (3) . Glu
(~) . AgP (2) . Thr (2) . Arg (1) ~ Va1 (2)
Thr ( 12 ; ~. conserved) - >
gar lle~) . Ala (13) . Val (7) , Tyr (5) . Phe (4) .
=l a ( ~ ) . Iv~et ( 3 ) , Leu ( 3 ) , Pro ( 2 ) . Asn ( 2 ) , G
Val (6) ->
Ala (4), Ser (~). ~1e (3). Thr (2). G1n (6), Gly
(2) . l~f~~ (2) ; Leu (~) , L~,ts (1)
~r (6) °~
~eu: ( 5 ) , Pro ( 4 ) . Gln ( ~ ) t. Phe ( ~ ) . Glu ( 1 ) , Ser
(1)
Note t that the above figures are not- normalized to
adjust for the relative fre~a~ncies of occurrence of the
~rioug ~t~.no adids . ~Te ~ux~lher note that in our own
mu~.agenesas ~~gerixnents; changing Lys 112 to heu or Lys ~.~.4 to
T(I~), Glu to G3y (~126G) br Leu (M4), or Ala to Thr (A~.22T)
did xaot alter acti°~ity; while changing T~ys, G~.u or veu to Pro
abolished activ-it~:
The present invention ~.s not limited t~ a.n~r
particu3ar method of producarag the desixed GH antagonists.
Pref~rab~:y, these antagona.sts ark, produced bg~ first altering a
gene encoding a vertebrate GPI (e.g., bGH rrr hGH) having the
"r~ati~re" third alpha. helix by site~°specific Hnutagenesis, and
~~eh cloning and expressing the altered gene in asuitable
W~ 92/19736 1'C.°T/1JS92103532
_ 25 _
host. Molecular biology techniques are described in, e.g.,
Sambrook, et al., Molecular Cloning: A Laboratory Manual (Cold
Spring ~iarbor Lab Press; 2nd ed., 1989). The gene may be of
genomic origin, it may be cDNA prepared from bGH messenger RNA,
it may be synthetic, or it may be a combination thereof. For
the amino acid sequence of bGH and for the cDNA sequence of the
bGH gene, see Miller, et al., J, Hiol. Chem., 255:7521-24
(1980). 1"'or the genomic bGH sequence, see lrloychick, et al.,
N'tRGlel.C Acids Res. , 10:7197-?210 (1982) . The cDNA sequence for
hGH a.s given by Chang, et al., Gene, 55:189 (1987) and DeNoto,
et al., Nucleic Acid Res. 9:3719 (1981), and the: genomic hGH
sequence is in. Robbins, et al., Cell, 29:623 (1982).
The host may be any convenient organism, including a
bacterial, yeast, or mammalian cell. The gene is operably
linked to a promoter functional in the host. A constitutive
proanoter mould a~ti.vate gene expression in a general manner,
i.e., in many tissue end at all times during development. A
~egulatable promoter may be activated in a tissue or cell
specific mannerp at precise time during development, or in
response to chaxages in the environment. A constitutive
pr~moter is usually employed when larger amounts of gene
product (usually ~gotein) is requa.red or when the g~n~ product
as required in anan~ cells of many tissues.' A regulatable
Promoter is uta.l3zed when one gene product is required an a
soall number ~~ cells of a particular tissue or at a given time
during d~~rel~pmen~
°I'he e~pressifln system may be engineered so that the
antag~nist ~.s secreted into the culture medium, or the host
dells may be grown to a high cell density and f.hen lysed to
release the c~mpound.
~ne method suitable for the purification of bGH
(G119R) and the like is described' in Leung, et al.,
Endocrinolog~rp ~:~.9:1489-1.496 (1986) . Hssentially, this
procedure involves purification by (a) ammonium sulfate
dV0 9Z/19736 ~ PC3'flLJS92/~3532
- 26 -
precipitation, (b) fractionation on DEAE-cellulose (or any
equivalent ion-exchange cohuann), and (c) gel filtration (e. g.,
on a Sephadex G-25 and/or Sephacryl S-200 column). Other
procedures applicable to purification of growth hormone-related
compounds are set forth in Reichert, Jr., "Purification of
Anterior Pituitary Hormones: Bovine, Rat and Rabbit," Meth.
Enzyrnol., 37:360 et seq. (Academic Press, ~1'.Y.:1975).
Polyclonal or monoclonal antibodies which specifically
recognize the protein of interest may also be used in the
purification process.
The purified antagonist may then be combined with
compatible, nontoxic pharmaceutical excipients and
administered to an animal, e.g. to treat a condition
characterized by an excessive growth rate. (The term "animal"
is intended to include humans.) zn the case of administration
to nonhuman animals, it may be preferable to incorporate the
dxvg into the animal's feed, possibly ~.n a prepared combination
c~f drug and, nutritional material ready for use by the farmer.
The antagonist may be administered orally or parenterally
(~.r~cluding intravenously, subcutaneously arid intramuscularly)
to hang in any suitable pharmaceutical dosage form. ~n the
case. of treatment of xetinopathy, i~ may be adm~,a~ristered
da~r~ct~:y to the eye by means of a conventional ocular
phacw.tical form. An effee~ive -dosage and treatment
prat~col ziciay be d.et~rm~:n~d by:conve~tional means, starting with
a low d~se in laboratory anim~al~ and ~&~en increasing the dosage
while monitoring the effects; and systematically varying the
d~~ag~ re~~.men as wel'1. The trial dosages would be chosen
after consi~3eration of 'the clinical literature with respect to
administration of gr~wth hormones, and of somatostatin (a
~r~wth hormone release inhibitor).
In another embodiment; the gene is introduced into a
host cell which is developed into genetically transformed cells
of a transgenic animal. Linearized I~IvTTA, bearing the growth
hormone antagonist gene may be introduced into a gamete, or
:., ,
..<.S'n
. a.. . a9 .; . ..,u. a.
.. . . ',r . .. .> a .
...'~...-.a~. .n ..,stw.. ~...~ . u.l.f.. . . ..... ... f...'... , . w,... ..v
.... . , .._.... ..:.5~~.......,..,. v. .. . ,
WO 92/19736 PCT/US92f03532
~~.~>~~~
- 27 -
microinjected into the pronuclei of fertilized eggs, into the
cytoplasm, into the. nuclei of two-cell embryos, into individual
cells of a blastocyst, or into the blastocoel cavity. (Some of
these targets may be reached by electroporation instead of
microinjection.) Alternatively, a retrovirus bearing the gene
may be constructed and used to infect preimplantation embryos
or tissue culture cells (e.g., embryonic stem cells) which may
be aggregated with such embryos. In either case, the
genetically modified zygote, after a brief in vi ro
cultivation, is implanted into a foster mother and carried to
term. For '~~ene therapy" post partum, see Clime, et al.,
Nature, 284:422-425 (1980); Williamson, Nature, 298:416-18
(~.g~2). Again, the gene is operably linked to a promoter
functional in the host, and the promoter may be constitutive or
regulatable. Preferably, expression is regulated so abnormal
ionic or fetal development is avoided.
The invention is further illustrated, without
limitation; by the following examples.
1e 1: Ge~eralb~~n ~f fi~tatgons C~nferr~.ng tlae ~teduced
~P3~e~~tgrpe
TE1ZI~..LS .~ vl~T~iODS
the pla~mid, pBGH-lOdelta6, was derived from pBGH-10
and contains the eomplete codang region of bGH and intron A.
Bovine growth h~rrnone introns B, C and D are absent (Figure 1).
This p3asmid eneode~ "wild type°° bGH, and its expression is
controlled by a 100 base pair segment of the mouse
~etall~athione~:n I t~anscriptional regulatory sequence.
Plasmids pBGH-lt~delta6-G1 s s R and pBGH-lOdelta6-E11' ~,,
~a.zzD here derived from pBGH-lOdelta6 and were generated
by segment-directed gnuaage~esis using complementary
oligonucleotides to replace the I~NA between the Tth111I site
(found near the 3 ~ end of Exon IV) and the Xma. I site (located
'VV~ 92/19736 PGT/US92/03532
_ 2$ _
near the S' end of Exon 'il). The other mutations described
herein were generated similarly.
The complementary oligonucleotides used for pBGHIO
delta 6-G:2~gR were:
a'GTGTCTATGAGAAGCTGAAGGACCTGGAGGAAAGGATCCTGGCCTGATGCGGGAGCTGGA
AGATGGCACCCC 3'; 73-MER) and (5'CCGGGGGGTGCCATCTTCCAGCTCCCGCAT
CAGGGCCAGGATCCTTTCCTCCAGGTCCTTCAGCTTCTCATAGAGA 3'; 76-MER).
The complementary oligonucleotides used for pBGHlQdelta6-E11?L~
Ga x a R d Ai 2 z y~ veers
(5'GTGTCTATGAGAAGCTGAAGGACCTGCTGGAFaAGGATCCTGGACCTGATGCGGGAGCTG
GAAGATGGCACCCC 3'; 73-mer) and 5' CC~',GGGGGTGCCATCTTCCAGCTCCCGC
ATE,A.GGTCCAGGATCCTTTCCAGCAGGTCCTTCAGCTTCTCATAGACA 76-mer).
These oligonucleotides hybridi~~e as follows;
G~l9I~
GT FTC TAT GAG A~1G CI'G AAG GAC CTG GAG GAPa AGG ATC CTG GCC
A~ CAG ATA CTC TTC GAC TTC CTG GAC C;TC CTT TCC TAG GAC CGG
Arg 'Tel Tyr Glu Lys Leu hys Asp Leu Glu Glu Arg Tle Leu A1a
CTS ATG ~G.AG CTG GAT GGC ACC CC
GAC TAC GCC C~'G GAC CTT CTA CCG ~G GCC
Iaeu I~et Az.~g Gha ~~u .
~7.2:~~0 G1~~R.~ F~..2~D
GT GTR ~,'AT GAG AAG CTG ~t,G GAC CTG C3~'G GAA AGG ATC CTG GAC
ACA CAG'ATA CTC TTC G~.C TTC CTG GAC'GTC CTT TCC TAG GAC CGG
Arg Va1 r Glu hy~ Leu Lys Asp Leu Leu Glu Arg I1a Leu Asp
C~'~ ~,TG' CGG Gt'aG CTG GAA GAT GGC ' ACC CC
GAC TAC GCC CTC GAC CTT CTA CCG 'fGG GGG GCC
Leu. filet ~g Glu L~u
Thes~ ol~:gonucleotides encode D1VA changes which
result a.n the substitutions of arginine for glycine at position
12.9 a.n pBGH-l.Cdelta6-G119R; and leucine for glutamate at
1~~ 9219736 P~.°T1~S92!~3532
~.~~~~~~ - 29
position 117, arginine for glycine at position 119 and
aspartate for alanine at position 122 in pBGH-lOdelta6-E11'L,
G$~9R, and AlaaD: These amino acids were chosen because they
have hydrophilic (arginine and aspartic acid) or hydrophobic
(leucine) character [See Hopp and Woods, PNAS (USA), 78:3824-28
(1981)], positively (arginine) or negatively (aspartic acid)
charged side chains LSee Kaiaer and Kezdy, Science acid)
223:249-55 (1984)]; and high cx-helical-forming potential (See
Claau and Fasman; Ann. Rev. Biochem., 47:251-76 (1978)]
furtheringgeneration of an idealized amphiphilic a-helix (See
7Nlargalit, et al., J. Immunol., 138:2223-29 (1987);; Brems, et
alo; Biochemistr~:26:7774-78 (1987); Kaiser and Kezdy, supra_;
Cherl; et al. , P1L~AS (U$A) ; 87:50f1-65 (July 19903 . Tn addition,
these oligonucleotide duplexes encode a silent base-pair change
designed to create a unique BamHI restriction site which
s~.mplified gcreeni~g px'oc~edures. The oligonucleotides were
annea7.ed and aubcloned between the Tthllll and Kanal sites using
standard pracedures (l~Iani.atis ~t al:. Molecular Cloning (Cold
Spring Harbar: (1982)) ~tant plasrcdid DNA's were identified
b~: ~i~eatian with Bami~l restriction site which simplified
screening pracedures. the oligonucleotides were annealed and
su~cloned between the Tthlll~ end ~na.T sates using standard
procedures IMahiatis et ~1.; Molecular Cloning (Cs~~r Spring
Narborr 1982~)a mutant plasmid DrTA's Were identified by
diges~aLdn with ~a~il.
The nucleotide segu~hce of the mut~.ted bovine growth
hormone target geg~ons ,were determined by using the dideoxy
chain-termination matched with modified T7 DNA pcalymerase
(Sequenase, United States Biochemical; Sanger et al.. PNAS
(USA), 74:5463-67 (1977)): Oli~ohucleotide primers for manual
DNA: sequeneing mere synthesized using the I~u~ont Coder #3~0.~DNA
synthesizer and purified by denat~arir~g polyac~ylamide gel
electrophoresis, passive eluti~n and c~ncentratian by ethanol
precipitation. The oligon~:eleotide primers used for the direct
sequencing analysis of the two mutants was the following: I~mer
(5'AAATTTGTCATAGGTCTG 3!). Briefly; 1-~~ag of doublestranded
!WO 92/9736 ~'C°T/EJS92/~3532
- 30 -
plasmid DNA was denatured in the presence of 0.2N Na~H, and 10-
~0 pmoles of oligonucleotide 'primer was allowed to anneal
(65°C, a min. followed by 30 min. slow cool) to the denatured.
template. A two-step polymerization was performed by using the
modified T7 DNA polymerase which extends the oligonucleoti,de-
primed chain in the presence of dNTP's and deoxyadenosine
triotriphosphate (~~.000 Ci/mmole, Amersham) followed by
transfer of equal aliquots into each of four specific
dideoxynucleotide mixes which randomly terminate chain
elongation. Following addition of a formamide termination
buffer to each reaction, the samples were incubated,at ~0°C for
2 min. and the ,DNA sequence was determined after size
fractionation of the four sets of fragments by 10~
polyacrylamide/~M urea electrophoresis end autoradiography.
1e 2: reesi~n ~ ~.l.ian Cells ~.n. Culture
using the in ~ritro mutagenesis protocols described
above, two mutant bGH genes were generated initially: one
con~rerts glycinell9 to arginine ("~219R") and the second
convgrts~ glutamat~lx' to leucixae, glycine219 to arginine, and
alanir~e~ 2 2 to aspar~ate (E1~.TL, G1~.9I~, A~:22D) .
~,
~h~ ~la~ana.~~ encoding theta mutations- as well as wild
type bGH ANA (pBGHlCdelta) were transiently introduced into
dultured m~use L cells; wha.ch were svxbsequently analyzed for
b~H exgres~ion. Fall~wing "western analysis", protein bands of
approximately 22,000 daltons wire observed for wild type bGH
end bG~ derived from the two mutant genes.
Mouse L cells were maintained in Dfi~N! (Gibco) plus
10% calf serum and ~5 ~,/m1 gentamicin (Gibco). In this study, a ,
m~dification of a previously described transfection procedure
vas employed (~capata et al . , Nucleic kids Res. , 1.2 : 5'07-5717
(1984)). Briefly, 2~,g of plasmid DNA was added to l.~ ml of
DI~lEM c~ntaining 0.2mg DEAF-dextran. This solution was added to
approximately 106 cells in a 35-n~ tissue culture plate which
'~O 92f 19736 CPC T/US921d~3532
- 31 -
had been washed previously with 2.0m1 of DMEM. Following
incubation of the cells for 1 hour at 37°C, the DNA-DEAE-
dextran solution was removed and the cells "shocked" for 90
seconds with 2.0m1 of 10% DMSO in Hepes buffered saline, at
room temperature. Subsequently, the "shock" solution was
removed and cells washed with 2.0m1 DIEM. Media containing ~.0%
Nu-Serum .(Collaborative Research) plus 50~g/ml gentamicin were
changed daily, Culture fluids were stored at -20°C. For bGH
binding assays, transfected cells were incubated in DMEM minus
serum for ~.6 hours, after which the culture fluids were removed
and frozen at --20°C.
Sodium dodecyl sulfate (SDS) PAGE analyses of
secreted bGH have been described (Kopchick et al.. DNA, 4:23-31
(1985); Kelder ~t al., Gene, 76:75-80 (1589). In this study,
we used a polycloa~al anti-bGH serum for "western°° analysis.
1e ~ m ~r~~r~ne R.~cepttOr Ba.ndi.n~ Bltud3..e~
Culture fluids lacking serum were collected from
ells tramsf~c ed by pBGH-1~delta6 (wild type bGH) and the
m~~s,nt bGH genes: Following lyophilization of the culture
media and bGH c~ncentration determinations, cgmpetitive
mernbran~ ~inda:rag studies were c~.rried out- as previously
described (Smith & Talamants, .Js B301. Chem., 26222213-19
(1987)). Diver membrane prepa.rati:ons from C57BDj6JxSJD hybrid
mice ~f either sex'(f0-120 days ald? were homogenized with a
B~a.nkman Polytron in 4 volumes (w/v) of 0.3M sucrose, 1~mM
EDTA, SOmM Hepes, (7. lrnM TPCK and llmM PI~ISF at pH $ . 0 . The' above
step and all the follo~iing protocols were carried out at 4°C.
The; homogenate was centrifuged at 20; 000xg for 30 nain. and the
supernatant was centrifuged at 7.~C,OC~~xg for 1 hour. The
pellets were washed once with lOmi~I Hepes, pH 8~0 and
~ecentrifuged. These pellets were xesuspend~ed in lOmM Hepes,
~H 8.0; to a protein concentration of. approximately 50mg/ml.
The membranes were aliqucated, frozen on dry ice, and stored at
-20°C. Membrane protein concentrations were determined by the
1~V~ 92>19736 ~Cf/US92A03532
32
Lowry protein assay (Lowry et al., J. Biol. Chem., 193:265-275
(191)).
Competitive hinding assays were performed using the
followa.ng protocol. Microsomal membranes corresponding to.
three mgs. protein were incubated with 30,000 cpm/tube lzsl bGH
(Cambridge lMedical Diagnostics) and unlabeled bGH ranging from
0.3m1 assay buffer (20mM Hepes, lOmM CaCl2 0.1% DSA, and 0.05%
NaN3 pH 8.0). All assays were performed in triplicate. After
overnight incubation at room temperature, membrane bound
hormone was separated from free hormone by the addition of 1 ml
of ice cold assay buffer followed by centrifugation at 10,000xg
for 20 min: Membrane pellets were then assayed for
radioactivity. Specifically bound radioactivity was determined
by subtraction from the value produced by incubation of
membranes ~ri~h 5~Cg unlabeled bGH (Smith and Talamants, 1987) .
Hffective doses which resulted in 50% displacement
C~~~O) of lzsl-bGH fr~m the membrane preparations were
determizaed. Mutant bGH encoded by pHGH-lOdelta6-G1~9R. and
~BGHl~delte. 6-El z ~ I,,, Gl i a gz~ Ai 2 2 D revealed an HD50 value
eirn~~.lar to wild type bGH.
~'
1~ ~4: gean~.c ~ ~x~uct~.c~n silent study
1~ 'series ,of tran~genic mouse dines which contain wild
type and mutant IbGH genes were produced by standard
mieroinjecta:on techniques (~dGrane et al.. 1988). DNA
eactraction from mouse tails, dot blots, and serum
determinations ;was as described (~IcGrane et al. . 1988) .
~,e Renee contain the ~ranscriptional regulatory
seqbzenc~s- of the mouse metallothionein I promoter which has
been shown to be aetive in liver tissue as well as other
tissues of the transgen~~ mouse (Pahniter et al.. Nature,
300:611-6~.5 (19'82) ) . Offspring generated by the znicroinjection
procedure were assayed for bGFi DNA by 'slot blot hybridization
'1y~ 92119736 ~'(.'T/USg2/03532
_ 33 -
analysis. Mouse lines were generated which contain
approximately one copy of the recombinant bGH I7TdA sequences
derived from pBGH-lOdelta6, (wild type), pBGH-14de1ta6-G119R,
and pBGHlOdelta6-E~ 1 ~ L, G11 a R, A12 2 D, Serum from transgenic
animals were assayed for bGH levels by the Inlestern technique.
All mice which expressed the wild type bGH transgene in serum
also possessed a corresponding enhanced growth rate. Mice
which expressed mutant bGH (G11 s R or Ea 1 ~ L, 6119 R, p,1 2 2;p) in
serum were dramatically and significantly smaller. After eight
weeks' growth, the growth ratio for wild type bGH tranagenic
mice relative to control littermates was ~..5 while the ratio
for the two bGH mutant mice to control littermates was -0.6.
In the case of the triple mutant, we generated ~.0 founder mice
that express the mutated bGH gene. The growth ratio between
the transgenic and nontransgenic littermates ranged from 0.58
to 1.00. The degree o~ suppression of growth was directly
related to the serum levels of the mutated bGH. Three founders
haws been bred that pass the trait to offspring; ~50% of these
~ffspring are positive for the gene and possess the
corresponding small phenotype.
It has been demonstrated that many activities of GH
are meda.ated t~rou,gh a family of peptides known as in~lin-like
growth factors (IGF)~ in particular ~GF-1, which is believed to
be produced primarily in the liver following GH binding to its
recept~r(e). (Bee ~ruesch, et al., Ann. Rev. Physiol.,
,~~7~e~,~36? (19s5) ; Zapts et al., T3~rm. Res., 24:12.-130 (~.9s6) ) .
1GF-l has been sh~wn to decrease GH production in the pituitary
b~ a classical negati~cre feedback mechanism. (Leung, et al.,
endocrinology, 119:189-96 (1986)). One hypothesis to explain
the growth suppression in pBGHlO~5-M8 transgenic mice is that
' b~H-M8 is aetive as an in vivo antagonist to mouse GH (mGH),
tYa~~eby suppressing mouse IGF-1 prdductic~n. Tf this is true,
.hen ane would e~sect not only a reduction in serum mouse IGF-1
levels in ~aGH M8 transgenic mice but also an increase in mGH
production in the pituitary. We have found that the 2GF-1
leirels in the serum of the "~mal1" transgenic mice are- ~50%
s. .. . . , v . ...d ~..~ , ... . .. . . ... ...
. .".....,... . .... . ...., ._.., .,...".........., .. ';',a:S r . ., . . ..
... ..... ,.... ..... . , ':.e ~ .. ..
VV~ 92/19736 P~f/US92/03532
- 3~ -
those of normal non-transgenic mice while mice containing wild
type bGH (large mice) have approximately 2x the IGF-1 levels of
non-transgenic mice. Results from immunoblot analysis of whole .
pituitary glands taken from bGH-MS .transgenic mice, bGH
transgenic mice, and their nontransgenic littermates suggest .
that the pituitary glands in those growth-suppressed mice
contain higher levels of mGH relative to their nontransgenic
littermates. In contrast, mGH levels in bGH transgenic mice
were largely depressed because mouse serum IGF1 levels were
increased up to twice as much, as levels in serum of their
nontransgenic littermates. Palmiter, et al., Science, 2~2:809-
1~ (1983) . Together, these results indicate that the altered
bG~I molecules are acting as an antagonist to endogenous mouse
GH. Thus, it is the first example to our knowledge of an a~n
vivo growth hormone antagonist and the first examgle of
uncou~aling of growth-promoting and receptor-binding activities
of GHs .
1e 5: Gore~ng of other te3.~ of b~GH a~ hGH
~y simil~;r procedures; muteins of bGH and hGH with
al~.er~.~.iox~s a~n the th~.rd al~aha helix have been prepared and
tested for secretion in L cells, and, in selected cask their
effect on the growth of transganic mice, with the following
reat~ltg .
The mutants are de~~r~.bed by giving the original
amino acid, gas positi~xa in the amin~ acid sequence of bGH, and
the g~placement amino acid, with the amino acids set forth
according to the internationally accepted single letter code.
~eOrge, et al., Protein Seq. Data Anal., 1.:27-39 (198'7).
A fir9t set of mutated bGH:genes, when expressed in
transgenic mice, resulted in animals with a growth ratio
sianilar to that of mice which express wild type bGH (i.a., -
1.59 - 1.72). y~Te hive referred to these analogs as "full
functional agonises" (Table I).
W~ 9~/~973G P(.'T/US92/~3532
~~.~~~~9 _ ~5 -
A second set of mutated bGH genes, when expressed in
transgenic mice, resulted in mice with a growth ratio smaller
than those animals which express wild type bGH (i.e., between
1,29 -1.35). We refer to these bGH analogs as "partial.
functional agonists" and have listed them in Table II.
A third set of mutated bGH genes, when expressed in
transgenic mice, resulted in animals with a growth ratio
sam3lar to nontransgenic mice (i,e., - 1.0). isle refer to these
analogs as "non-functional agonists" (Table III),
A fourth set of mutated bGH genes, when expressed in
transgenic mice, resulted in mice with a growth ratio of
between 0.5'~ and 1.0 (Table I~T). The growth ratio of the mice
was negatively correlated with the serum level of the bgh
ans:l.og, i.e., a~ the serum level of the bgh analog increased,
the growth ratio of' the animals decreased. Thin correlation is
sh~r~an graphically in Figure 13.
Also, these analogs, when expressed to NIH-3T3-
preadipoeytes, did not result in stir~tulata.on of preadipocytes
diffe~e~.t~:ation; however, native GH will pro~y,~a~e this
differentiation (Fig. 12). In faGt~ these analogs will
antagon~.ze the abil:ity ' of wild ty~~ GH t~ promote preadipocyte
.differez~tiatiora (Fig. Zl) : ~Te have referred to these s:nalogs
a,s "functional a?r~ta~oni~~s" (Table IV) .
hake also generated transgenic mice which express
either ~nrild ty~ae h~~I, hGH G120A., hGH G120R and hGH GZ20'W (Table
V) : Mice which express hGH G~.2~A s~aow a growth enhanced
~her~oty~e similar to mice which express wild type IaGH (Table
~)~ We call this hGH analog a a'functional agonist." In
contrast, substitutican. of R or W f~r G at position 120 in hGH,
and subsequent expression ~.r~ transgenic mice, results in
arximals with a growth ratio between 0.?3 and 0.96 (Table V);
aid whose level of serum hGH analogy is negatively correlated
W~ 92/19736 PC°'~'/Ug92/03532
N~~~
_ 36 _
with the growth phenotype; i.e., as the serum levels of these
hGH 120 analogs increase, the growth ratios decrease. This
correlation is shown in Figure 14. Therefore, like the bGH.
analogs which act as "functional antagonist," we termed these
hGH 120 analogs as "functional antagonist.°' It is important to-
note that the glycine residue in bGH at position 119 is the
homologue of the glycine residue in hGH at position 120. They
are both located in the central portion of the third a-helix.
A subset of bGH analogs is presented in Table VI in
which we have evaluated their ability to be secreted following
transfection of tkxe mutated DI~7A into mouse L cells. Transgenic
animals have not been generated which contain these mutated
DNAs.
The mutant K112L, R3.14~nT shows the effect of expanding
the hydrophobic face of the helix. This mutant affects animal
growth much a~ does wild ype growth hormone.
Th.e mutations R114P, H118P and L121P (and various
combina.ti~ns thereof) apparently destroy the alpha helix
(Prol~.ne is-a strong alpha he~.ix breaker.) The growth-related
viol~gica7: aot~.vity is abolished. The mutation H~~6G is a
special ca~ea glycin~'is a helix breakex, but position 126 is
at bye ehd of the helix so the noranal biological activity is
r~t~a.ned: ~T~.th G119P, howe'~erone strong helix breaker was
substututed for ~n even stronger ones the alpha helix was
aPparea~tly presexved:
The 'third alpha helix of wild type growth hormone
diverges from a perfeet amphiphilic alpha helix at three
poszti~n~: F~.rst, at 117, Glu is a hydrophilic amino acid in
the hgrdroph~biC dace: ~SecOnd,.at 119, Gay is a neutral amino
acid in the h~rdrophilic face: Finally, at 122, Ala is a
hydrophoba.c am~.no acid in the hydrophilic face. The mutations
E117L, G119~t ~.nd A~.22D, separately or in combination, increase
!y~ 92f19736 P("TfLJS92f03532
..
the amphiphilic character of the helix. G119R additionally
increases the alpha-helical tendencies of the sequence.
Our initial hypothesis was that the growth-inhibitory
activity of the mutants G119R and E117L/G119R/A122D was
associated with the increased amphipathicity of the third alpha
helix. We have since developed evidence that the
amphipathicity of the third alpha helix is largely irrelevant
to that activity,
(1) The single E117L, like wt bGH, produced large
aa~imal s
(2) fi~utant G119P produced the small animal phenotype
even though proline is as .hydrophilic as
glycine.
(3) Mutant G119L produced the small animal phenotype
wen though leucine is hydrophobic and therefore
disrupts the hydrophilic face of the helix.
(4) ~utara.t E111L/G1~.9W/R~.25L produced the small
ana.mal phenotype even though all three mutations
disrupt the hydrophilic face of the helix,
(S) the single A122D produces a mutein which has no
effect on growth.
Thus., ~.n one emb~diment, the gresent invention
relates to ~rautatioh~ of.the third alpha helix which result in
~rowth~~nhibitory activity yet reduce or leave unchanged the
aniphiph.ilic character of the helix.
diagonal growth: hox-mone antagonists may be
idehtified by'sy~tematically varying the codon corresponding to
G~.19 in bGH, so as to eacpres~ the ~.~ other mutants ' having a
single- amino acid change at, this p~sitican. This is readily
ac~complish~d b~ synthesizing oligonucle~tid~s differing from
hose set forth in Example 1 as ccadon 11.9 so as to encode the
desired alternative amino acid. Similarly, one may alter the
hoanologous glycine reside in the third alpha helix of other
GHs, ~.g~e the G12° of hGH. Hy similar means, variations of
VV~ 92119736 PC'~'/B.JS92/~3532
- 38 -
the codons corresponding to other amino acids of the third
alpha helix of a GHlare investigated.
le ~6 , ~,t~.chol.esterolem~.c acti~.ty of Gr~wth ~~~one
.~intagon~.sts
Procedures for Clinical Chemistry Tests:
Blood samples were obtained from mouse tails. The
samples were allo~red to clot at room temperature for 5 minutes
and were then centrifuged and the serum was collected and
frozen at -2a°C unt~.l analysis. Total Cholesterol (TC),
Triglyceride (TR.), Glucose (GL), and Hlood Urea Nitrogen (BUN)
Were analyzed on a Kodak Ektachem DT 6a Analyser using dry,
multilayered, self-contained elements specific for each test.
~1. of serum was pipetted on individual slides specific for
each test ~.nd were analyzed using co7.orimetric measurement by
reflectance spectrophotometry methods and compared to dai~.y
~~,ala~ty Coxatrol reference samples.
Results:
There ~.s no significant difference in blood glucose,
seraun urea/na.trogen and ~~rum triglycerir~e levels betwn bGHi~i~
tr~sge~ic miss an~i them n~ntrans~enic littermates . ~zowever,
total serum ch~le~te~ol lev~l.~ in bGH-118 transgenic mice are
sigax~.fa:cantly decreased (P<0, 053 as compared to their
nontran~geniic littermates and bGH transgenic mice.
~.e ~: 1.n '~a.tr~ ~~.o~eay fir Gr hormone Antogon.:i..st
l~cti~ay
Studies of growth hor~nnne have shown that it promotes
the forrn~t~.on of adipese from preadip~se 3T3 cells. iKurikawa,
et al., Cell 29.789 (192). Glycerophosphate dehydrogenase
(GPDI3) has been used as a differentiation marker for this
G~h.nduced adipose conversion. ~rl~.~e and Green, J. Biol . Chem. ,
~54:~73-75 (1979): TTixon and Green, Endocrinology, 114:527
~JV~ 92/19736 P~'/L1S92/~3532
2~.~~~.~9
- 39 -
(1984); Pairault and Green, Proc. Nat. Acad. Sci. (USA),
?6:5138 (19?9) .
We have adapted this assay to. determine whether a bGH
mutant acts as a GH antagonist. Both bGH and bGH-M8 bind to
receptors on these preadipocytes with a Kd value of 1(?mM. When
exposed to native secxuence bovine growth hormone (30 pM) and
cultured for seven days, the preadipocytes differentiate and
GPDH activity is stimulated. If the bGH mutant is added to
culture medium containing wild-type bGH, there is a
dosedependent reduction in GPDH activity and, therefore,
presumably, a.n adipose conversion (Figure 11).
This as~a~r is a convenient screening tool for
identifying p~tential GH antagonists.
1e ~:
Mice transgenic for the wild type bGH gene are known
t~ develop progressive se~rere glomeru.losclerosis and increased
glomerular size. Doi, et a~.. , lam: J. Path. , 137: 541-52
(199); Resce; et ~1.; hab. Invest., 65: 601-5 (1991); Doi, et
al ~ : ~- J. Path. ; 131: 398-40~ (19f39) ; see also St~ewart, et
al:, Ez~docrinolagy, 1~0: 405-41.4 (192). This is not merely a
function Of body ize, as bGH-Ml.l mice (i.e., hl~3.P, E126G
mutant). whose x~ut~nt bGH does ncat enhance growth, also
exl~a.bit ~lumeru~.oscle~osis . In bGH-M8 (G119I2) mace, however,
which had reduced ~eruzn IGF-1, body size, a.nd glomerular size
relative to nontra~sgenic mice, glomerulosclerosis was absent.
Sumr~a.ry of growth ratio comparisons between transgenic mice
express~.ng bGH analogs and their non-transgenic littermates at
6 to 8 weeks of age.
~,~ ~zm ~73s we rms~zro~s~z
Table 1. Transgenic mice which express the following bGH
analogs exhbited phenotypes similar to transgenic mice which
express wild type bGH (we have termed these analogs "full
functional agonists")*
bGH Analogs n Mean Growth Ratio SD
WT-bGH____ ? 1.61 0.14
bGH-111A 2 1.72 ____
bGH-K112L 12 1.?0 0.19
bG~f-~11~&'W 12 1.70 ' 0.19
bGH-L116A 6 1.?1 0.16
bGH-E117L 18 1.68 0.18
bGFi-A122T 10 1.6? 0.16
bGH-R125L 3 1.61 0.18
bGH-E126G 4 1.59 0.14
* There is no correlation between serum levels of these bGH
analogs and the growth phenotypes. These mutated bGH genes are
e~garegsed in mouse L cells and the secretion pattern is similar
to the wild type bGH~
T~&ale ~I. Transgenic mice which express the ~ollw~ring bGH
analogs eibit~d p~.en~t~~s smaller than transgenic mice which
egress wild hype bGH, however, large than non-transgenic mice
(we have termed these ana~.ogs "parta:al functional agonists)*
bGH n dean Growth Ratio SD
t~!°-bGH ? 1.61 0.14
D115s~3. 3 1. 35 0 .15
L123I 3 1.29 0.13
There is no correlation between serum levels of these bGH
analogs and the grov~th phenotypes. These mutated bGH genes are
expressed in and secreted ~by mouse L cells with the pattern
~~D 92IR~736 ~CTlUS92~'~353
~~.~~~.~9 - 4~ -
similar to wild type b~H.
H'ote that for the purposes of Tables x-vz, the characterization
pf a mutein as °'functional~' or "non-functional" is in the
context of its effect on growth.
!fi'O 92/19736 PCT/IJS92/~3532
~1 ~~~ . , _ 42 _
Table III. Transgenic mice which express the following bGH
analogs exhibited phenotypes similar to their non-transgenic.
littermates (we have termed these analogs as '°non-functional
agonists")'"
bGH Analogs n Mean Growth Ratio sD
~~.z4P, EZasP ~ l . ax. o . a9
L121P,E226G ~.1 0.94 0.06
13a22D 3 0 . 9 0 0 .11
'" There is n~ correlation between levels of bGI-i analogs in
serum and the growth phenotypes. These mutated bGH genes are
expressed :in and secreted by mouse L cells with the ea~ceptions
of bG~I-K1~.4P; El~.sP and bGH-L121P, E1.26G which are not secreted
by mouse L cells.
'VV~ 92/19736 F~.'I'/~JS92/~3532
~3 -
Table TAT. Transgenic mice whisk express the following bGH
analogs exhibited phenotypes smaller than non-transgenic
littermates (we hare teraned these analogs as "functional
antagonists" )''
bGg Serum bGH Growth Ratia
Analogs Animal Sex (ug/ml) (Two Month)
#
E1~.7L, G11,9R,
A12~D 6 F 3.4 0.58
M 3.3 : 0.69
32 F 3.7 0.57
51 F 5.1 0.63
55 M 2 . ~. 0 . 85
65 ~ 0.6 Z.0
~7 F 0.6 0.87
70 F ~.3 0.70
F 2.6 0.70
89 F 1.8 0.85
G119R 2~ M 0.5 0.93
2g* M 0.9 0.88
49'' ~ 6.0 w'~.60
53 M 1.5 . 0.85
94 F 0.~ 0.98
138 F 3.0 0.74
G119P ~ F 2.0 0.81
G119K 110 M 0.5 0.8~
12 M 0.4 . 0.95
18 F 4.0 0.78
26 F 5.0 0.59
G129L~ 23 F . &.5 0.81
27 M 0.5 1.0
W~ 92/I9736 ~C.°I'1US92103532
- 44.-
G119W 16 . M ~.0 0.64
6119~ 1~ M 0.5 0.96
15 M 0.~ 0.90
22 N! 6 . 0 0 . ?5
23 M 9.5 0.90
The level o~ mouse growth suppression is correlated. with
serum levels of analogs (see Fig. 13). These mutated bGH genes
ire expressed in and secreted mouse L cells. The secretion
pattern is similar to wild tie 1~GH.
~~ 92119736 P~'/~JS92/~3532
- 45 -
Table V. Summary of transgenic mice which express hGH genes
encoding single amino acid substitutions at position 120* (hGH-
G120A is a "full-functional agonist". hGH-G120R and hGH-G120Tn~
serve as "functional antagonists")
hGH animal # Sex Serum hGH Growth Ratio
Analogs (ug~ml) (Two Months)
WT-hGH n=7 1..62 ~ 0.15
G120A g5 M 3.9 1.48
6 F 21.5 1.76
G120R 20 F ?8.5 0.79
4g F 1.5 0.96
68 M 3.4 0.73
73 F 0.8 0.93
F ~ o ~ 0 . 93
G120~1 1~ M 5.5 0.82
39 M ' 2 . 7 0 . 7?
56 F 2.0 0.83
l~GT3 Gly 1~.9 ass et~uivalentto hGH Gly 120.
in a
position
Th~xefore, we xe~er .o hGH Gl~r x.20 consa.stently
with the
liaer~tur~.
* * Th.e lw~l of growth suppress~.on
is correlated with serum
.levels of hGI3 analogs (See F~:g.
3.4)
'W~ 92/19736 P'CT/US92l03S32
- 46 -
Table V'I. Summary of mutated UGH genes expressed in mouse L
cell without transgenic mice dais.
UGH Analogs L-Cell Secretion
Wild fiype bGH +
K114P _
E11~P
E~.l?,G119R ~ +
r'rll~i ,~'.22D +
~I109D,Y110D,L116R +
E11.1L, G11~W +
L121R;1~d124K +
E111L; G1.19Tn1, L121R-, lvl124K +
D115V +
~115G +
'6TZ09D; Y~.~.1D, L3:16R;'L121R, hl124K -
E~.1~.L, G11,9W, R125L +
E17L1L, G11.9W, L121R,1~124K +
VlO~D,Y110D,L11,6K,R125L +
Table vII '1~ ' ~ni.ce mutarats
Ma. ~rezla~s KZZ~w)
r~~o cxi~~~;E~l~P)
X11 (&121PoE126G)
T?~4 ( E 117I.~ )
1~I6 (Orl~.9R)
(22~)
N.t'7 (E~.~.'lL, G119R)
(E11?L,A3:22D)
~a (~z~.~L~:~y~R;~i2an)
