Note: Descriptions are shown in the official language in which they were submitted.
WO 93/02206 2 1 i 3 8 1 ~i PCl/~ ;92/06136
P-ORIFICATION OF RECC)MBINANT CILIARY NE~E~OTROPHIC FACTOR
AND C-T13RMINAI. TRlJNCATED CII,IARY NEUROTROP~IC
FACTOR AND ~ETHODS FOR TREATI~G
PERIPHERAL NER~E DAMAGE
BACKGROUND O~E INVENTION
The present invention relates to neurotrophic
lo factors and ciliary neurotrophic factor (CNT~) in
particular, as well as methods of purifying CNTF and
producing recombinant CNTF.
Severe mental and physical disabili~ies
result from the death of nerve or glial cells in the
nervous syst~m. The death of nerve or glial cells can
: ~ be caused by neurodegenerative diæeases such as
Alzheimer's and Parkinson~s diseases a~d multiple
sclerosis, by the ischemia resulting~from stroke, by a
traumatic injury, or by the natural aging process.
N~urotrophic fac~ors are a class of molecules
:: that promoke the survival and functional activity of
nerve or glial cells. Evidence exists to suggest that
~: neurotrophic ~actors will be useful as treatments to
prevent nerve or glial cell death or malfunction
~ resul~ing from the conditions enumerated above. Appel,
81, Ann. Neuroloq~ 10:499.
:~ The bes~ characterized of such neurotrophic
:: :
: ~: factors is nerve growth fac~or ~NGF). NGF has been
demonstrated to be a ~eurotrophic factor for ~he
: 30 fore~rain choliner~ic~erve cells that die during
Alzeheimer's disease and with increa ing age~ The loss
of these nerve r-ells is generally considered
:~ responsible for many of the co~nitive deficits
associated with Alzheimer~s dise~se and with advanced
age.
Experiments in animals demonstrate that NGF
prevents the death of:forebrain chQlinergic nerve cells
after traumatic injury and that NGF can r verse
cognitive losses that occur with aging. Hefti and
Weiner, 1986, Ann. NeyE~l~gy 20:275; Fisher et al.,
~987, Nature, 329:65. These resuIts suggest the
.
W093/02206 ~'~T/US92106136
~ S ~ - 2 -
potential clinical utility in humans of this
neurotrophic factor in the treatment of cognitive
losses resulting from the death of forebrain
cholinergic nerve cell~ through disease, injury or
aging.
A complication of the use of neurotrophi~
factors is their specificity for only those
subpopulations of nerve cells which posse~s the correct
membrane receptors. Most nerve cells in the body lack
NGF receptors and are apparently unresponsive to this
neurotrophic factor. It i5, therefore, of critical
importance to discover new neurotrophic factors that
can support the survi~al of di~feren~ types of nerve or
~ glial cells than does MGF.
New neurotrophic factors have been searched
~: for by their ability ts suppoxt the survival in culture
of nerve cells that are not responsive to N~F. One
widely used s~reening a~say is designed to discover
~ : ~ factors that promote the survival of ciliary ganglionic
: 20: motor ~eurons that innervate skeletal and smooth
: muscle. These ciliary ganglionic nerve cells belong to
the parasympathetic nervous system and their survival
: is not supp~rted by NGF.
The presence of:factors which ~romote the
~ 25: : survival of ciliary ganglionic nerve cells hav~ been
:~ ~ : reported from a variety of tissues and species. Many
o~ these ciliary:ganglionic neurotrophic activities
have the following similar chemical and biological .:
properties~ the~acti~ity is:present in high
concentration in sciatic nerves; (2) the neurotrophic
activity survives exposure to the ionic detergent
sodium dodecyl sulfate~(SDS) and to the reducing agents
beta-mecaptoethanol ~BME) or dit~iothreitol (DTT)
during electrophoresis on SDS polyacrylamide reducing
gels; and (3) on such gels the activity migrates with
an apparent molecular weight bétween 24-28 kd.
~.
W 0 93/02tO6 ~ll3~ PC'r/U592/06l36
- 3 - .,
Collins, 1985, Developmental Bioloav, 109:255~258,
Manthorpe, et al., 1986, Brain Research, 367:282 286.
Bas~d on these similar properties, it had
been proposed that the same or closely related
molecules, typically re~erred to as "ciliary
neuro~rophic factorl' or "CNTF", are responsible ~or the
ciliary ganglionic neurotrophic activities. Thus, the
term CNTF was used as an operational definition
referring to agents with the above properties that
promote the survival of ciliary ganglionic nerve cells
in culture.
Despite widespread scientific interest in
CNTF the difficulty in purifying substantial am~unts
~ from natural sources and the unavailability of human
CNTF hampered attempts to demonstrate its value in
sustaining the via~ility of nerve cells during disea~e
or after injury. Prior attempts to purify a rat CNTF
~ had resulted in an 800-fold enrichment over crude nerve
;~ ~ extract in terms of specific~activity. M~thorpe et
al., 1986, Brain Research 367:282-286. .::
However, an eight hundred-fold increase in
specific activity was insufficient to produce a single
~; protein species. Therefore, the product showing
increased activity obtained from the method described :-
: 25 by Manthorpe et ~l. was insufficient as ik included
multiple protein species. It:was desirable to achieve
purification of CNTF such that a single protein
species is obtained with the appropriate biological
activity.
In a published PCT application
~PC~/US90/00022, Int'l Publication No. W0 90~07341)
Collins ~_al- ha~e:described the purification of CNTF
from rabbit sciatic nerve extract, and have set forth
the nucle~c acid sequences encodi~g ra~bit and human
CNTF and the a~ino acid sequences of rabbit and human
CNTF. The Collins' r ference also describes the
:
:
W093/02206 ~ PCI/US~2/0(~136
recombinant production of CNTF in both animal and
bacterial expression systems. This published
application is specifically incorporated herein by this
reference.
The presen~ invention further describes
methods for the prevention a~d treatment of a variety
of diseases and medical conditions. The common element
of the diseases and medical conditions that are
suitable for prevention or treatment according to the
methods dPscribed herein is damage to the peripheral
nervous system~
The peripheral nervous system consists o~
those nerve cells that extend axonal~processes outside
~ the spinal cord and brain. The principle nerve cell
types in the peripheral nervous system are primary
motor neurons innervating skeletal muscle and
controlling movement, autonomic neurons (both
sympathetic and parasympathetic) innervating the
: ~; cardiovascular system and other internal Drgans and
: 20 regulating their function, and sensory neurons
:~ innervating sensory receptors throughout the body and
conveying sensations including pain and proprioception.
: Conditions that c~mpromise the survival and
:: proper function of one or more of th~se types of
25; p~ripheral nerve cells cause~peripheral nerve damage~
uch damage may occur through physical injury, which
causes th~ deqeneration of the axonal proce~ses of
perlpheral nerve cells that pass through or near the
site of injury. ~Such damage may also occur because of
intentional or accidental exposure to neurotoxins, such
as the cance~ and AIDS chemotherapeutîc agents
: *isplatinum and dideoxycytidine (ddC), respectively.
Such damage may also occur because o~ chronic metabolic
disea~es, such as diabPtes or renal dy~functian. Such
damage may also occur because of neurodegenerative
: disease~ such as Amyotrophic Lateral Sclerosis (ALS),
W093/022~6 2 ~ ~ 3~ P~T/~iS92/06136
-- 5 --
which causes the degeneration of primary motor neurons
and c~nsequently motor dysfunction.
As stated above, the defining characteristic
of such peripheral nerve damage is compromised function
and/or survival of peripheral nerve cells and their
axonal processes. ~..This invention describes treatments
that can support peripheral nerve cells: that is,
promote the normal function and ~urvival of peripheral
nerve cells against the effects of conditions that
typically lead to peripheral nerve damage, or to
reverse or minimize the effects of peripheral nerve
damage.
The metho~s described herein for treating
~-~ peripheral nerve damage involve the administration of
the human protein ciliary neurotrophic factor (CNTF). :
It has been shown that CNTF supports the survival of
embryonic rodent or embryonic chicken pe~ipheral
sympathetic and parasympathetic autonomic neurons and
peripheral sensory neurons in cell culture (Manthorpe
et al7 (1989) Ciliary Neurotrophic Factors, Nerve
Growth Factors, R.A. Rush ed., John Wiley ~ Sons, :~
Ltd.). The~single experiment on animal p~ripheral
nerve cells sug~ests that CNTF was able to rescue
cranial motor neurons after damage to their axonal
processes in newborn rats (Sendtner t al. l9gO Nature
345:440). N~ work has been reported demon~trating that
CNTF can support autonomic or sens~ry nerve cel1~ in
animals. In addition, prior to this invention there
was no evidence that CNT~ can support any type of
peripheral nerve cells in adult animals.
Obviously, little or no useful information is
known regarding the proper doses and routes of
: administration for the prevention or treatment of
periphe.ral nerve damage with CNTF. In t~e one
experiment reported in animals, a single dose of CNTF
was directly:applied to the severed end of the
W093/0~06 PCT/US92/0613
~ 6 -
experimentally-damaged nerve (Sendtner et al. lsso
Nature 345:440). Most peripheral nerve damage does not
involve individual severed nerves, but is widespread
and involves nerve cells and their processes throughout
the body. To treat these systemic conditions, CNTF
will need to be administered systemically or regionally
and not simply to the severed end of a single nerve.
The information on dosing and route of administration
contained in Sendtner, therefore, is of very limited
practical use. To date, no methods have been reported
for systemically or regionally delivering CNTF in doses
that are efective in preventing or reversing
peripheral nerve damage.
~-~ In the present invention, methods are
provided for systemic and regional dosing with CNTF and
it is demons~rated, for the first time, that CNTF used
accordlng to t~ese methods can be e~fective in
preventing or réversing peripheral nerve damage in
adu~t animals. The appropriate route of administration
20 and the appropriate dosing of CNTF needed to treat
: ~different forms o~ peripher~l nerve damage are also
disclosed. These methods differ among different
:~ :diseases primarily in the way CNTF is administered and
the dosing that is used.
.:
W093~02206 _ 7 _ PCT/US92/06136
' ' 3~
An object of this invention is to provide
recombinant human ciliary neurotrophic factor protein
ha~ing an amino acid seguence as in Figure 1 where the
amino acids at the C-terminal end are cleaved.
Preferred truncated ~orms of CNTF are truncated by two
or six amino acids.
The invention also provides ~or an expression
~ector comprising a DNA sequence encoding for C-
terminal truncated forms for CNTF and their expressionin bacterial and pre~erably E. coli expression systems~
In addition, this invention provides for
recombinant human CNTF substantial~y free of truncat~d
~- forms of CNTF.
Furth rmore, the present invention provides a
method for preparing a substantially purified CNTF
comprising~: (a) applying cell lysate containing
: ~ soluble CNTF protein to an anion exchange column which
reversibly binds CNTF; (b) collecting fractions
20: :comprising CNT~ by eluting the CNTF protein bound to
he~anion exchange rolumn with salt; lc) applying the
fractions containing CNTF protein to a cation exchange
column; (d) collecting fractions comprising CNTF by
eluting the CNTF protein with a pH gradient of fro~
: abou~ 7 to about 8.5; (e) applying the ~ractions
; ~ conkaining CNTF protein to an anion exchange column;
and ~(f~ eluting the substantially purified CNTF protein :~
: with~a salt gradlent.
The~:present invention also includes a method
for preventing or treating peripheral nerve damage
which comprises administering to a patient in need
: thereof a therapeutically effective amount of CNTF; the
:~ use of a therapeutically effect:ive amount of CNTF for
the manufacture of;medicament suitab~e for preventing
or treating peripheral nerve damage; and an agent for
preventing or treatlng peripheral nerve damage which
., .
W093/02206 PCT/~92/~6136
3~ 8 ~
comprises a therapeutically effective amount of CNTF.
In particular, the invention provides methods for
administering therapeutically effective amounts of CNTF
by therapeutically effecti~e routes of administration
in order to prevent and reverse peripheral nerve
damage. The invention also demonstrates the adequacy
of these methods to prevent or reverse peripheral nerve
damage from a variety of insults.
It is to be understood that both the
foregoing general description and the following
detailed des~ription are exemplary and explanatory only
and are not restrictive of the invention as claimed.
:
~^' BRI~F DESCRIPTION OF T~U~D~L~Q
Figure l shows the DNA and inferred amino
acid sequence of human CNTF. The human CNTF coding
sequence is interrupted by a single ca. l.3-kb intron
located between amino acids 38 and 39. The splice
a~ceptor/donor sequences at this site are:
:~ ~ 20 ~GTAAGT...l.3kb~..TTTCCTGTATCCTCGGCCAG~. The internal
: : HindIII and NheI sites used in construction of the
expression vec~or are underlined as are the
oligonucleotides used for cloning.
Figure 2 shows the inferred amino acid
: :~ 25 se~uences of human, rabbit and rat CNTF. The amino
~; acid sequences~are presented in single letter code.
~: Numbexs to thé right indicate position in the human
~: : : sequence. Regions in which the sequence is identical
: in all three species are shaded. Since the inferred
rabbit protein is one amino acid shorter than either
human or rat CNTF, a gap (indicated by a dash) has been
: : : introduced into the rabbit equence to maximize
: alignment.
Figure 3 shows the SDS-Page analysis of
~S selected fractions elut d from initial Q-Sepharose ion-
exchange chromatography column (Step 3~. Cell e~tract
W093/02206 P~T/US92/06136
21138~ ~
g
wa~ chromatographed on a cblumn of Q-Sepharose (1.5 X
20 cm). The chromatogram was developed at 2 ml~min and
2 ml fractions were collected. Selected fractions were
. subjected to SDS-PAGE and the gels stained with CBB.
For electrophoresis, samples (15 ~1, lanes 1 and 2 or
30 ~1, lanes 3-28) w~r.e diluted in SDS-sample buffer ;;
(~inal con entrations: 10% glycerol, 1% DTT, 0.5% SDS,
0.002% bromophenQl blue and 25 Mm Tris-HCl, pH 6~8) and :
boiled for 2 min. Key to gel lanes: 1 ~ 2 - crude
extract before and after PEI treatment, respectively;
- 3-28 = even-numbered fractions from 12 to 62. ~umbers
in the left-hand margin indicate Mr values (X 103) of
: protein standards electrop~oresed simultane~usly. CNTF -~
~ co-migrates with the trypsinogen standard (Mr = 24 ~ 000
and the CNTF pool represents fractions 18-50.
: Figure 4 shows the Q-Sepharose ion-exchange
chr~ma~ography (Step 4). The CNTF pool from the first
Q-5epharose column was dialyzed and chromatographed on
a second Q-Sepharose column (1.5 X 15 cm). The
~: ~:20 ~ chomatogram was developed at 2 ml/min and 2 ml
~ fractions were collected. Selected fractions were
: ~ prepared for electrophoresis, subjected to SDS-PAGE and
~ ~he gels sil;ver-stained. The inset shows the protein
: content of electrop~oresed fractions of the CNTF pool
(fractions 114-130). Key to lanes: 1-9 5 ~1 of
: fractions, 114, 116, lI8, 120, 122, 124, and 10 ~1 of
fractions 126, 128 and 130, respectively. Numbers in
the left-hand margin indica~e Mr values (X 10-3) of
: protein standards electrophoresed simultaneously.
Figure 5 shows ~he S-Sepharose ion-exchange
chromatography (Step 5). The CNTF pool from Step 4 was
dialyzed and chroma~ographed on an S Sepharose column
: (1 X 10 cm). The chromatogram was developed at 2
ml/min and 4 ml ~ractions were collected. Selected
fraction~ were prepared for electrophoresis, subjected
to SDS-PAGE and the gels silver-stained. The inset
W~93/02206 PCT/US92/06136
~3~ o
shows the protein content of electrophoresed fractions
of the CNTF pool (fractions 25-29). Key to lanes: 1-5
= 15 ~1 of fractions 25, 26, 27, 28 and 29,
respectively. Num~ers in the left-hand margin indicate
the Mr values (X 10-3) of protein standards
electrophoresed slmultaneously.
Figure 6 shows the Zn2~-affinity
chromatography (Step 6). The CNTF pool from Step 5 was
dialyzed and chromatrographed on a Zn2'-IDA-agarose
column ~1 X 10 cm). The chromatogram was developed at
~.5 ml/min and 3 ml fractions were collected. Selected
fractions were prepared ~or electrophoresis, subjected
to-SDS-PAGE and the gels silver-stained. The inset
~- shows the protein content of electrophoresed fractions
of the CNTF pool (fractions 30-38). Key to lanes: 1-9
: = 25 ~1 of fractions 30, 31, 32, 33, 35, 36, 37 and 38,
: respectively.
Figure 7 ~hows the ~P-HPLC analysis of
purified recombinant human CNTF. CNTF, S ~g (A) and 50
~g (B) were ~pplied to SynChrom RP-8 reverse phase HPLC
column (250 X 4.6 mm~ equilibrated with 0.1% TFA.
: Protein was~eluted with a linear gradient o~ -
acetonitrile containing 0.1% TFA (1~ acetonitrile/min;
flow rate, 1 ml/min).
:~ 25 Figure 8 shows the multiple forms of CNTF.
Purified human recombinant CNTF (12 ~g) was sub~ected
: to SDS-PAGE with (A):or without (B) prior heating in
:~ SDS sample buffer to 100C for~2 min. The protein was
~ransblotted onto a nitrocellulose me~brane and treated
with primary antibody (rabbit anti-CNTF) and secondary
antibody (goat anti-rabbit IgG-alkaline phosphatase).
Fîgure 9 shows the u.Y.-a~sorpt~on spectrum
of recombinant human CNTF. The u.~. absorption
spectrum was recorded on a Beckman ~U 50
spectrophotometer and the concentration of CNTF (1.28
mg/ml) determined by amino acid analysis.
W093/02206 2 1 1 3 ~ 1 ~PCT/US92/06l36 ~
Figure 10 illustrates the rate of recovery of :~
cutaneous sensation after sciatic nerve crush (on day
0) in adult rats treated with vehicle only or with ::
vehicle containing 0.25mg/kg human recombinant CNTF
S delivered in daily subcutaneous injections on days -2
~o +11.
Figure 11 illustrates the rate of recovery of
motor function (me~sured by recovery of the ability to ~:
spread toes 1-5) after scîatic nerve crush ~on day 0)
in adult rats treated with vehicle only or with vehicle
containing 0.25mgjkg human recombinant CNTF delivered
: in daily subcutaneous injections on days -2 to +11.
~: - ' '"
~-~ DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
1~ Reference will now be made in detail to the
presently~preferred embodim~nts of the invention,
~: ~which, togsther with the following examples, serve to
explain the principles of the invention:.
This~application includes recombinant methods
~ of production of human ciliary~neurotrophic factor
CNTFj:. ~A~so lnc~uded in this invention are various
human C-terminal~ truncated CNTFs. In the preférred
embodiments of the invention, the~-terminal truncated
:CNTFs~are iden~ical to full length human CNTF as shown
2~5~ in~figure 1 but~:are truncated at the:C-terminus by
eithér two or~six;amino acid residues. The C-termina~
runcated CN~Fs ~f~the present invention preferably are
produced during the~bacterial~ expression of human CNTF
by;the expr~ssion of vectors containing the gene coding
: 30 for ~NTF. Such C-terminal truncated CNTFs may al SG be
pro~uced by the expression of vectors containing the
gene coding for the C-terminal truncat~d CNTFs. This
invention ~lso~includes~purification pr~cesses ~or
obtaining substanti~l~ly purified~CNTF obtained from
:
35 :: recombinant prod~ction systems.
~ The purificatlon of CNTF from ra~bit sciatic
:
:
.
PCI IUS92/06136
WO 93t~)2206
nerve is described in PCT application W0 90/07341 of
Collins et al. (PC:T/US90/00022~. The Collins
application includes a description of the rabbit and
human genes coding ~or CNTF and the production of
recombinant human CNTF from mammalian a~d bacterial ~:
expression systems. The WO 90/07341 application is
specifically incorporated herein, in its entirety, by
this reference, including without limitation all
definitions and experimental procedures.
A novel process for the production and
purification of recombina~t human CNTF is given below
in Example 1. Further includ~d in this example is a :
six step process for the purification of recombinant
human CNTF comprising~
l. the preparation of cell free extracts;
2. the removal of nucleic acid~ from the
extrac~;
: ~ 3t Q-sepharose ion-exchange chromatography;
4. a second Q-sepharose ion-exchange
chromatography;
5. S-sepharose ion-exchange chromatography;
: and
: ~ 6. Zn~ ~ affinity chromatography~
According to:these procedures, a CNTF composition ~s
25: prepared that contains ~ess than 0,1% non-CNTF
: proteins.
~ A preferred method of purificatisn of human
: recombinan~ CNTF as taught in ~xa~ple 2 below
comprises: (a) applying cell ~ysate containing soluble
CNT~ protein to an anion exchange column which
reversibly binds CNTF; (b) collecting fracti~ns
comprising CNTF by eluting the CNTF protein bound ~o
th~ anion exchan~e c~lumn with salt; ~c) applying the
fractions containing CNTF prvtein to a cation ~xchange
column; ~d) collecting fractions comprising CNTF by
: elutiny the CNTF protein wi~h a pH gradient of from
W093/02206 . PCT/US92/06136
2~3l6,815
about 7 to about 8.5; (e) applying the fractions
containing CNTF protein to an anion exchange column:
and (f) eluting the substantially purified CNTF protein
. with a salt gradient.
An alternate purification of CNTF is
described in Example 2 below, wherein C-terminal :~
truncated CNTFs are isolated and identi~ied. The C-
terminal truncated CNTFs are isolated from a bacterial
expression of a vector containing the gene coding for
full length human CNTF. The C-terminal truncated CNTFs
so isolated are identical to human CNTF -- as shown in
Figure 1 -- but are truncated at the c-terminus by
either 2 or 6 amino acid residues. Also described are
~ procedures f~r ïsolating CNTF from C-terminal truncated
CNTFs and substantially purified CNTF which is
sub~tantially free from C-terminal truncated CNTFs.
Included within:the scope of this application ar~ all
: C-terminal trunca~ed CNTFs that retain any of the
biological activity associated with CNTF.
: 20 It has also been ~ound that recombinant CNTF
produced as described in Example 2 can be further
purified by using an additional chromatography step.
As described in Example 3 below, columns that have been
found effective in lowering the amount of non-CNTF
:proteins from purified CNTF solution include hydroxy
: apatite resin, butyl HIC (hydrophobic interaction
:~ chromatography) resin and Zn-IMAC (immobilixed metal
affinity chromatoyraphy) resin.
As noted above, the present invention further
relates to methods for preventing and treating
peripheral nerve damage in patients suffering
thereProm. These m thods comprise the route of
administxation of a therapeutically effective amount of
: a ciliary neurotrophic factor (CNTF) to a patient
suffering from peripheral nerve dama~e or to a patient
at risk o~ su~fering peripheral nerve dama~e.
W093/0220S PCT/~S92/~6136
- 14 -
~ ~ A disease or medical indication is to be
considered to be peripheral nerve damage if the
survival or function of peripheral nerve cells andJor
their axonal processes is compromised. In a preferred
embodiment, a patient is at risk of suffering
peripheral nerve damage or actually has peripheral
nerve damage as the result of one of the following
conditions: l) Physical injury, which causes the
degeneration of the axonal processes of peripheral
nerve cells that pass through or near the site of
injury; 2) Exposure to neurotoxins, such as the cancer
and AIDS chemotherapeutic agents cisplatinum and
dideoxycytidine (ddC), respectively; 3) Chronic
~ metabolic diseases, such as diabetes or renal
dysfunction; and, 4) Neurodegenerative diseases such
as Amyotrophi Lateral Sclerosis (AI.S), which cause~
the degeneration of primary motor neurons and
~; consequently motor dysfunction. A non-exclusive list
of conditions involving peripheral nerve damage
23 includes ~myotrophic Lateral Sclerosis, Diabetic
Peripheral Polyneuropathy, Toxic Periphera]. Neuropathy
caused by the cancer chemotherapeutic agents taxol or
cisplatin or vincristine, Toxic Peripheral Neuropathy
caused by the AIDS chemotherapeutic agents ddI or d~C,
and physical damage to peripheral nerves such as ~hat
caused by crush or cut injuries to the arm and hand.
: Th~ treatment of peripheral nerve damage
: includes the ability to reverse permanent periph~ral
nerve damage and the ability to enhance naturally
occurring recovery processes by either speeding up such
processes or by effecting a more complete recov~ry from
the peripheral nerve damage. The prevention of
: peripheral nerve damage includes the ability to totally
prevent nerve damage against the ef~ects of conditions
that typicalIy lead to peripheral nerve damage, as well
as the ability to lessen the extent of peripheral nerve
W093/0220~ PCT/US92/06136
- 15 - 2 1~ 3
damage associated with such conditions.
In one embodiment, preferred CNTFs are
naturally occurring protein~. The naturally-occurring
proteins are preferred in part because they pose a
s comparatively low risk of producing un~oreseen and
undesirable physiological side effects in patients
treated th~rewith. Human CNTFs are preferred for use
in thi~ invention. However, to the extent tha~ non-
human CNTFs are substantially equi~alent to human CNTFs
and possess equivalent biological activity, they are
considered to be within the scope of this invention.
For purposes of the specification and claims,
a protein is deemed to be "naturally-occurring" if it
or a substantially ~quivalent protein can be found to
exist normally in healthy humans. "Naturally-
: occurring" proteins specifically includes forms of
: ~ ~ proteins found to exist in healthy humans that are
partially truncated at the amino or carboxyl term~nus
o~:such protei~ns or that have amino acids that ~re
deamidated or otherwise chemically modified."Naturally-occurring" proteins may be obtained by
: ~ recombinant DNA m~thods as well as by isolation from
cells which ordinarily produce them. "Naturally-
ocourring" a1so encmpasses proteins that contain or
lack an NH2-terminal methionyl gr~up as a consequ@nce
: of~expression~in E._~51i.
: ~ "Substantially equivalent" as used throughou~
the specifioation and~claims is defined to mean
possessing a very high degree of amino acid residue
hom~logy (See qenerallY M. Dayhoff, Atlas of Protein
Se~uence and Struoture, vol. 5, p~ 1~4 (1972), National
Biochemical Researc~ Foundati~n, Washington, D.C.,
spe~i~icalIy incorporated herein by reference) as well
as possessing comparable biological activity.
Particularly preferred CNTFs of the present
invention are the naturally-occurring proteins that
W093/~2206 . PCT~US92/06136
~ 16 -
have previously been described in PCT application Wo
90/07341 of Collins, et_al. entitled "Purified Ciliary
Neurotrophic Factor.-l
The nucleic acid sequences of the genes
encoding human and animal CNTFs and the amino acid
sequence~ of such~proteins are given in the Collins et
al. application. ~he present invention encompasses
non-glycosylated ~orms of CNTF as well as truncated
forms of khe naturally-occurring-and recombinant CNTF
proteins as described in the Collins et al.
application. In a further embodiment, C~TF is modified
by attachment of one or more polyethylene glycol (PEG)
or other repeating pol~meric moieties.
~ethods for producing the naturally o~curring
15 ~ ~r modified CNTFs are also disclosed herein and in the
above-mentioned~application. One disclosed method
consists of isol:ating CNTF from ~arious sources, such
as peripheral nerve tissues. A second disclosed method
~ ~ involves isolating the genes responsi~le for coding
; 20 CNTF, clonin~ ~he gene in suita~le vectors and cell
types, and sxpressing the gene in order to produce the
: ; :CNTF~ The latter method, which is exemplary of
: ~: recom~inant DNA methods in general, is a preferred
: : me~hod of the present invention. Recombinant DNA
: 2~5 methods are:pre~erred in part because they are capable
; : of achieving comparatlvely higher amounts at greater
: : pu~i~y.
~ Preferably, the above described CNTFs are
`~ produced by the aforementioned method in "substantially
pur~" form. By "substantially pure" it is meant that
CNTF, in an unm~dified form, has a comparati~ely high
specific activity. It is to be recognized, however,
that deri~atives of CNTF may have diff~rent specific
; ~ act~vities. In a preferred~ embodiment of ~he present:~ 35 invention, a therapeutic composition comprising CNTF is
administered in an effective amount to patients
.
WV93/02206 PCT/US92/0~136
,. .
- 17 -
2113~
suffering from peripheral nerve damage. ~:~
Because it is possible that the neurotrophic
function of the preferred CNTFs is imparked by one or
more discrete and separable portions of the CNTF
protein, it is also envisioned that the method of the ~:
present invention could be practiced by administering a
therapeutic composition whose active ingredient
: consists of that portion (or those portion~) of CNTF
which controls ~or control) CNTF neurotrophic function.
The therapeutic composition of the present
in~ention is pre~erably administered parenterally by
injection or intrathecally by continuous infusion from
an implanted pump. Also, other effective
administration forms, such as parenteral slow-release
formulations, inhalant mists, orally active
formu~ations, or suppositories, are also envisioned.
~; ~ One preferred carrier is ~hysiological saline solution,
but it is contempla~ed that other pha~maceutically
:
: acceptable carriers may aIso be used. In one preferred
: ~ 20 embodiment it is envisioned that the carrier and the
CNTF constitute a physiologically-compatible, slow-
r~lease formulation. The primary solvent in such a
: : : carrier may be either aqueous or non-aqueous in nature.
In addition, the carrier may contain other
pharmacolo~ically-acceptable excipients for modifying
or maintaining the pH, osmolarity, viscosity, clarity,
color, sterility,` stability, rate of di~solution, or
odor of the formulation. Similarly, the carrier may
contain still other pharmacologically-acceptable
excipients for modifyin~ or maintaining the sta~ility,
rate of dissolution, release, or absorption o~ the
CNTF. Such excipients~ are:those substanc0s usually and
customarily employed to formulate dosages for
: parenteral administration in either unit dose or multi-
dose form or ~or intr~thecal delivery by continuous or
periodic infusiQn from an implanted pump or
W093/02206 PCT/IJS92/06136
~ 18 -
intrathecally by periodic injection.
Once the therapeutic compositicn has been
~ormulated, it may be stored in sterile vials as a
solution, suspension, gel, emulsion, solid, or
dehydrated or lyophilized powder. Such formulations
may be stored either in a ready to use form or
requiring reconstitution immediately prior to
administration. The preferred storage of such
formulations is at temperatures at least as low as 4C
and preferably at -70C. It is al50 preferred that
such formulations containing CNTF are stored and
administered at or near physiological pH. It is
presently believed that storaqe and administration in a
~ formulation at a pH below approximately pH 5.5 and
above appr~ximately pH B.0 is undesirable.
Preferably, the manner of parenterally
administering the formulations containing CNTF is via a
subcutane~us or intramuscular route. To achieve the
de~ired dose of CNTF, repeated daily or less frequent
~ subcutaneous or intramuscular injeotions may be
administered. It is believed that the administration
of CNTF in daily doses below approximately 0.00lmg/kg
may not be e~fective, while the administrativn of daily
doses of greater than lmg/kg have undesirable side
e~fects.
A preferred dosage range for the parenteral
treatment of peripheral nerve damage is between about
0.0l and 0.25 mg per kg of patient body weight per 24
hours administered in a single dose per 24 hours. In a
preferred mode for the prevention or minimlzation of
peripheral nerve damage, the administration of CNTF
will begin up to one week before the ::onditivn or
initiation of events~that typically leads to peripheral
nerve damage, For example, in a preferred embodiment
to prevent toxic neuropathy due to cancer
chemotherapeutic agents/ administr~tion of CNTF, will
W093/02~06 PCT/U592/06136
-- 19 -- .
2~1~Xl~ ~
begin up to 1 week before the initiation of treatm~nt
with the chemotherapeutic agent and will continue
during the period of exposure to the agent. The
frequency of dosing will depend on pharmacokinetic
parameters of CNTF in the formulation used and will be
readily ascertained by one skilled in the art.
To achieve the desired dose of CNTF to motor
and other damaged nerve cells whose cell bodies are
within the spinal cord, CNTF may be administered
intrathecally into khe subarachnoid space of the spinal
cord. Administration may be continuous or periodic and
may ~e accomplished by a constant- or programmable-flow
implantable pump or by periodic injections.
It is also contemplated that certain
formulations containing CNTF are to be administered
orally. Preferably, CNTF which is administered in this
fashion is encapsulated. The encapsulated CNTF may be ~:
: ~ formulated with or without thvse carriers customarily
used in the compounding of solid dosage forms.
: 20 Preferably, the capsule is designed 50 that the active
: portion o~ the formulation is released at that point in
the ga~tro-intestinal tract when bioavailability is
maximized and pre-systemic degradation is mi~imized.
~;~ Additional excipients may~be included to facilitate
:2S~ absorption of CNTF. Diluents, flavorings, low melting
: point waxes, vegetable oils, lubricants, suspending
: agents, tabl~t disintegrating agents, and binders may
also be employed.
Regardless~of the manner of administration,
the specific dose is calculated a~cording to the
approximate body weight or surface area of the patient.
Further refinement of the calculations necessary to
dekermine the appropriate dosage for treatment
involving each of the above mentioned formulations is
routinely made by those of ordinary skill in the art
and is within the ambit of tasks routinely performed by
WO 93/02206 PCr/US9~0~136
-- 20 --
them wit~ndu-- experimentation, especially in light
of the dosage information and assays disclosed herein.
~hese dosages may be ascertained through use of the .
established assays for determining dosages utilized in
conjunction with appropriate dose response data.
It should be noted that the CNTF formulations
described'herein may be used for veterinary as well as
human applications and that the term "patient" should
not be construed in a limiting manner. In the case of
veterinary applications, the dosage ranges should be
the same a~ specified aboveO
It is understood that the application of
teachings of the present invention to a specific
problem or environment will be within the capabilities
of one having ordinary skill in the art in light of the
teachings contained herein. Examples of representa~ive
: uses of the present invention appear in the following
~: examples.
Example 4 below describes the application of
: : 20 the present invention to peripheral nerve damage from
physical injury to a peripheral nerve, as described
herein~ The differences, if any, between this
treatment and the treatment of patients suff~ring from
: oth r forms of peripheral nerve damage would be readily
and routinely identified by one of ordinary skill in
the art. The ability to acr-elerate the recovery of
~ensory and motor function after physical injury t~
peripheral nerves by administering CNTF as shown in the
following example, shows that the administration of
CNTF may be equally effective in preventing and
treating other forms of: peripheral nerve damage, as
defined herein.
.
WO 93/02~06 Pcr/~ls92/û6136
.
~113811j
EXA~qPLE l: PURIFICA~ION OF RECOMBINANT CILIARY
Materials and Methods - The purification,
cloning and expression of CNTF has been previously
described and is incorporated by reference herein,
Collins et al., W0 90/07341. (See also, Collins, et
al., U.5. Patent 5,011,914 and Collins et al., U.S.
Patent 4,997,929). Numbers in brackets refer to
re~rences listed below in the section entitled
: Re~erences ~or Example 1.
Cloninq the Human CNTF Gene - Fully
degenerate oligonucleotides were synthesized
corresponding to the amino acid sequence of rabbit CNTF
[7~. The sense orientation of each oligonucleotide is
: given starting with the 5' end together with the
:~ :corresponding rabbit protein sequence (N denotes A,C,G,
or T) CNTF-l: TAT/C GTN AAA/G CAT/C CAA/G GG (Tyr-Val-
Lys-His-Gln Gly); C~TF-2: A~T/C AAA/G AAT/C ATT/C/A
: ATT/C CjTT (Asn-Lys-Asn-Ile-Asn-Leu); CNTF-3a: AAA/G
TTA/G TGG GGN TTA/G AA; CNTF-3b: AAA/G TTA/G TGG GGN
: CTN AA, CNTF-3c: AAA/G CTN TGG GGN TTA/G A~; CNTF-3d:
~: ~ /G CTN TGG~GGN CTN AA ~Lys-Leu-Trp-Gly-Leu-Lys).
2.5 Oligonucleotides CNTF-3a to 3d were:used in separate
PcR:Feactions~to reduce~degeneracy.
: oligonucleotides l:(sense) and 3a to ~d
tanti-sens~ were used as primers in PCR with human
genomic DNA. PoIym~rase chain reactions were per~ormed
as previously described C1] except that each reac~ion
contained 1.75 mM MgCl2, 100 ng of each
oligonucleotide, and:0.5 ~g of human genomic DNA
: : prepared from placenta ~2]. To identify DNA bands
amplified from the CNTF gene, DNA ~Southern) blots of
the PCR products were probed with 32P-labeled
oligonucleotide 2, which occurs just downstream of
oligonucleotide 1 in the rabbit gene t7]~ A single ca.
.
.
W093/02~0~. PCT/US92/~61~6
~ 3Q3~ 22
400-bp band of amplified DNA hybridized to this probe
in Southern blots of the PCR products from human
genomic DNA. This band was most intense in the
reaction using CNTF-3d. This band was cloned and
sequenced to give the DNA sequence of the human CNTF
gene between oligonucleotides l and 3 in Fig. l.
The ca. 400-bp fragment ampli~ied from human
genomic DNA was labeled with 32p by randorn priming and
used to screen a human genomic DNA library at high
stringency. The hum~n genomic DNA library was
constructed by cloning genomic DNA [18], partially
digest~d with Sau3AI, into the BamHI site of Charon 30
[3~. Out of lxlO6 clones, nine positive clones were
isolated. Two of these cIones were se~uenced and the
rest appeared related to these based on DNA (Southern)
blot analysis. The sequenced clones contained an open
: reading frame (Fig. l) that was 89~ identical to the
rabbit CNTF coding sequence [7]. In addition, each
open readin~ frame contained a segment identical to the
fragment amplified from human genomic DNA by PCR.
: Restriction en~onuclease fragments from the human
ge~omic DNA clones corresponded to those observed on
DNA ~outhernj~ blot anaIysis of human ~enomic DNA,
indiGating ~hat the clones were representative vf the ~`
~ ~ ~5 organization of the CNTF gene in ~enomic DNA.
: Pre~ration of DNA f~r the ExPression of
~ ~ 5~E~ A human gen~mic DNA clone for CNTF in phage
: :: Charon 30 was digested with the restriction enzymes
SalI and HindIII and a 4.3 kb-fragment was subc~oned
~0 into the Bluescript KS Ml3(-) plagemid vector
(Stra~agene). This fragment contains the CNTF coding
~equences upstream~of the HindIII site in the coding
sequence (Fig. l~. This ~.3 kb-fragment also contains
a single, approximately l.3 kb intron (Fig. l). To
allow expression în bacterial cells, the intron was
removed by site-directed mutagenesis in ~itro L 4 } using
W093/02206 PCT/US92/06136
21i3~ 1 ~
- 23 -
the synthetic oligonucleotide
5'- GATGTTCTTGTTCAGGCCCTGATGCTTCACATAGGATTCCGTAAGAGCAGT
CAGGTCTGAACGAATCTTCC-3' to produce phagemid 1.
The 5' end of the CNTF coding se~uence in
phagemid 1 was reconstructed for cloning into the
axpression vector and to make changes found to increase
the ef f iciency of expression in E. coli. Phagemid 1
contains a single NheI site at amino acids 22-23 in the
human CNTF codiny sequence (Fig. 1). Partially
overlapping complementary oligonucleotides,
(5'-GATCCGATCTTGGAGGATGATTAAATGGCTTTCACTGAACACTC
TCCGCTGACCCCGCACCGTCGAGATCT~TGCAGCCGCTCTATCTGG -
: 3'/5' - CTAGCCA~ATAGAGCGGCTGCACAGATCTCGACGGTGCGGGGTCA~- GCGGAGAGTGTTCAGTGAAAGCCA TTTAATCATCCTCCAAGATCG - 3')
containing a 3' NheI overhang were synthesized,
annealed together, and ligated to NheI-cut phagemid 1
to produce phagemid 2. These oligonucl otides al~er
: the human codon usage to that used preferentially by E.
coli [5] withou~ changing the amino acid seguence, and
~: ~ 20 contain a 5' BamHI overhang that creates a BamHI site
in phagemid 2. Oligonucleotides 2 and 3 also contain a
~ : transnatlo~al coupler:to promote effectiv~ translation
: in E. c:oli [6~.
Phagemid 2 DNA was then digested with BamHI :~
and HindIII to release the DNA:fragment referred to as
: ~NTF-Synl which contains DNA s~quences suitable for
expression in . coli and encodinq human CNTF upstream
of the HindIII si~e (Fig.~
To prepare the 3' end:of the expression
construct, a human gen~mic DNA clone for CNTF in phage
Charon 30 was cut with the restriction ~nzyme Hind~II
and a 2.1 kb-fragment, containing the CNTF coding
se~uences downstream of the HindIII site (Fig. 1~, was
subcloned into HindIII-cut plasmid pEMB~8 [7). A SpeI
site was inserted into~ the 2.1 kb-insert DNA by
oligonucleo~ide directed mutagenesis 13 base pairs
W~93~02~06 PCT/US92/06136
'2 1 1~ 8 ~ - 24 - :
downstream of the stop codon ending the CNTF sequence
using the synthetic oligonucleotide 4 (5' - ATG TAG CAG
TTA GTC ACT AGT CTC TTC CTT GCT - 3'). The mutated
plasmid was cut with HindIII and SpeI to release the
DNA re~erred to as CNTF-Syn2.
CNTF Synl and CNTF-Syn2 were ligated at the
HindIII overhangs to produce CNTF-Synl/2, which was
subcloned into ~he BamHI- and SpeI-cut phagemid
expres~ion vector pJUl003 [8~ to produce pJUl003-
huCNTF, which was transfo~med into E. coli strain
B~21(DE3) ~9]. ~his places expression of the CNTF
insert under control of the T7 phage promoter upon
induc~ion with isopropyl ~-D-thio-galactopyranoside
(IPTG) [24]. One transformant, CNTF A, producing CNTF
after induction with IPTG was selected.
Expression o~ recombinant human CNTF -
Overnigh ultures of CNTF-A were prepared in Luria
broth [~o~ supplemented with l0 ~g/ml of tetracycline.
: : ~ These cultures were diluted (l to 50) with thP same
20~ medium and grown until th~ A~co reached l.0 (3-4 h).
Expression of CNTF was achieved by adding IPTG to a
final concentration of 0.5 mM and incubating ~or 4 h.
Cells were harvested by centrifugation (9,000 X g, 5 -
min~, washed with 50 mM sodium phosphate, pH 8.0, and
2~5 recentrifuged. Cell pastes were either used
~:~ immediately or stored frozen at -80~C.
All
purification steps were carried out on ice or at 4C
and fractions~from~he various chromatography columns
: 30 were analyzed by SDS-PAGE.
Step l~ PreParation of_Cell Free
- A cell pa te (4-5 g wet weight~
was suspended in 3-4 volumes of buffer A (50
mM sodium phosphate,^ pH 8.0, c~ntaining 5 m~
EGTA and 5:mM EDTA) and passed through a
French pressure cell at 18,000 lb./in.2 The
.
W093/~2206 PCT/US92tO6136
_ 25 -2113~l5
resultant mixture was c~ntrifuged at 48,0QO X
g for 20 min and the supernatant filtered
through glass wool.
Step 2. Removal of Nu~leic Aci~s - PEI
was added to the supernatant to a final
concentration 0.25% (v/v) to facilitate
removal of nucleic acids ~ll]. Without this
treatment, the nucleic acid contained in the
supernatant would bind to the anion-exchange
resin and decrease the number of times that
the Q-Sepharose could be regenerated ~nd
reused. ~fter incubating for lO min, the
mixture was centrifuged as above and the
resultant supernatant filtered through the
glass wool.
Step 3. O~SePharose I n-exchanqe
: : Chromato~raphy - Cell extract W35 loaded onto
: a column (l.5 X 20 cm) of Q-Sepharose
~ previously equilibrated with buffer A. After
~: :
: 20 loading, the column was washed with buffer A
: ~ until the A280 reached baseline. CNTF was
detected in the column flow~through/wash.
The CNTF pool was dialyzed twice against lO
: ~ ~olumes of buffer B (5 m~ sodium phosphate,
2:5 ~ pH 8.0, containing lO mM NaCl, 1 mM EGTA and
1 mM EDTP~)o
5tep 40 O-Se~harose Ion-exchan~
Chroma~o~ra~ The above CNTF pool. was
; loaded onto a column ~1.5 X~15 cm) of Q-
Sepharose previously equilibrated with buffer
B. After loadi~g, the column was washed with
buffer B until ~h~ ~z~O reached baseline.
Bound proteins were eluted wi~h a gradient
(150 ml) of lO to 80 mM NaCl in buffer B.
The CNTF pool was dialyzed twice against lO
volumes of ~uffer C (5 mM sodium phosphate,
WO 93/02206 PCr/US92/0~13
2 6 -
p~l 7 .1, containing 0 . 1 mM EGTA and 0 .1 ~I
EDTA) -
Step 5 - S-SePharose Ion-exchan~
Chromatoq~aPhY - The above CNTF pool was
loaded onto a column (1 X 10 cm) of S-
Sepharose previously equilibrated with buffer
C. After 102ding, the column was washed with
buf~er C until the A280 reached baseline.
Bound proteins were eluted with a gradient
(60 ml) of 0 to 0.5 M NaCl in buffer C. The
CNTF pool was dialyzed.twice against 10
volumes of buffer D (10 mM Hepes, pH 7.5,
containing 5~ mM NaCl, 0.1 mM EGTA, and 0.1
~ .
mM EDTA).
Step 6. Zn2'-af~initv Chromatoara~hY -
The CNTF pool was loaded onto a col~mn (1 X ~-
10 cm) of Zn24-IDA a~arose previously
equilibrated with buffer D without the metal
: ~ ion chelators, EGTA and EDTA. A~ter loading,
: the column was washed with the same buf~er
un~il the A280 reached baseline. Bound
~m ~ protei~s were eluted with a gradient (50 ml~
: ~ of o to 50 mM histidine in buffer D ~without
chelators). The final,~purified CNTF pool
~;25 was dialyzed twice against 10 volumes of 10
: : mM ph~sphate, pH 8,0, containing 50 mM NaCl~
:: 0.1 mM EGTA and~0~1 mM EDT~ and stored at -
~ C.
: 30 ~ TFA and acetonitrile were added to
protein samples to final concentrations of 0.1% (v/v)
and 5% (v/v), respectively, prior to injec~ion~ RP-
HPLC was per~ormed using a 250 X 4.6 mm SynChropak RP~8
column (SynChrom, Inc., Lafayette, IN) with 0.1%
aqueous TFA as solvent A and 0.1% TFA in acetonitrile
as solvent B~
W093~02206 . PCT/US92/06136
- 27 - 2 ; ~ 3 8 1 ~
ElectroPhoresis and Blottinq Techniq~es -
Electrophoresis was performed in 12.5% polyacrylamide
slab gels (1.5 mm thick), with a 5~ acrylamid~ stacking
gel, in the presence of 0.1% (w/v) SDS at 40 mA, with
the discontinuous buffer system of ~aemmli tl2]. Gels
were s~ained with CBB as described previously [13] or
~ilver-stained using a Rapid-Ag-Stain Kit (ICN
Radiochemicals,~Irvine, CA). Gels to be used to
separate proteins prior to Western blotting and protein
sequencing were pre-electrophoresed for 16 h at 15 mA
in the presence of 25 mM thioglycolic acid and 10 m~
DTT. This pr~vents blockage of amino-terminal amino
a~ld groups during electrophoresis of protein samples
E 14~. Western blotting was preformed as previously
described ~15~ using Immo~ilon-P (Millipore
Corporation, BPd~ord, MA) or nitr~celluloss ~Schleier
and Schuell, Inc., Keene, NH) membranes. Immobilon-P
~membranes wer~ stained with CBB and the appropriate
protein bands excised ~or se~uenci~g~ Ni~rocellulose
membranes were subjected to treatment with antibodies
to CNTF~ and subsequently, with goat anti-(rabbit IgG)
conjugated to alkaline phosphatase ~Cappel). The
secondary antibody was detected using a kit with 5-
: bromo-4-chloro-indo-3-yl phosphate and nitroblue
tetrazolium supplied by Promega (Madison, WI~.
Preparatlon of_Antibodies to CNTF - Highly-
purified recombinant human CNTF in 19 mM sodium
: phosphate, pH 8.0 containing 50 ~M NaCl, 0.1 mM E~TA
and 0.1 mM EDTA was emulsified with~2 volumes of
Freund's complete adjuvant and injected ~ubcutaneously
into multiple dorsal sites of two New Z~aland rabbits
(100 ~g of CNTF per~rabbit). Booster injection~ of 100
~y of CNTF ~mulsified in Freund'~ incomplete adjuvant
were than given at ~ to 3-week intervalsJ Sera were
prepared from blood collected 7 week after the initial
injection, and again at 2-week intervals and stored at
W093/02206 PCT/US92/06136
~3~ 2~ -
-70~C. The titer of the antiserum was 3,000 as
determined by ELISA [16].
Bioassays - Bioassays for CNTF activity w~re
per~ormed as described by Lin et al., ~lO]. Briefly,
the in vitro assay for CNTF activity tl7~ measures the
survival of chick embryo ciliary ganglion (E8),
sympathetic chain (Ell) or dorsal root ganglion (El0~
neuronC. TWo thousand purified neurons were placed -
into each well of a 96-well dish and serial dilutions
lQ of sampl~s to be assayed were added. Aftex 20 h
(ciliary ganglion neurons) or 44 h ~sympa~hetic chain
: and dorsaI root ganglion neurons), neuronal survival
: was estimated by the ability of li~e cells to reduce
~ the vital dyP MTT (3-4~,5 dimethylthiazol-2-yl]-~,5- :
diphenyltetra-zolium) (Sigma). The titer af
bioactivity in trophic units (TU) per ml was de~ined as
the dilution that gave 50~ of the maximal neuronal
: ~ ~ survival in the ~TT a~say. For example, if a dilu~ion
of l:l000 was required to give 50% survi~al, the titer
was defined as l,000 TU/ml.
: . . Pe~tide Mappina and Protein Séquencina -
: Generation of C-terminal:peptides of CNTF was achieved
: by first digesting the protein with CNBr overnight at
: room temperature in hexafluoro-ace~one hydrate.
25~: Peptides were separated on a narrow-bor~ C8 RP-HPLC
column (Brownlee, Inc., Santa Clara, CA), with 0.085%
a~eous TFA a~ solvent A and 0:.085% TFA in 80%
~: ~ acetonitrlle as solvent B. The C-terminal peptide was
then subdigested with endoproteinase ASP N ~7] and the
peptides separated as above. Amino-acid analysis and
protein sequencing were carried out as described by
: Armes and Forney E 18~] .
Other Methods - Protein concentra~ions were
: : determined by the BioRad microassay based on CBB dye-
binding ~l9] or by amino-acid analysis. U.V.-
absorption spectra were recorded in a Beckman D-50
W093/02206 P~T/US92/06136
- 29 -
spectrophotometer and densitometry performed using an
~KB Ultrascan XL laser densitometer.
Materials - S- and Q-Sepharose were purchased
from Pharmacia; IDA-agarose from Pierce Chemical Co.,
and IPTG, PEI, Mr markers and tetracycline from Sigma.
RE8ULT~ ~d DIBCU~ION
uman CyT~ Genç - The genomic DNA se~uence
and inferred amino acid sequence encoding human CNTF
are shown in Figure ~. The ~uman VNA and protein
sequences are 89% and 86% identic~l to the rabbit CNTF
[7~ and 85% and 83% identical to the rat CNTF [8] DNA
and protein sequences, resp~ctively.~ Alignment of the
inferred amino acid sequences of human, rabbit and rat
CNTF is ~hown in Figure 2. Only a single band that
hybridized to ~NTF specific probes was observed in DNA
(Southern~ blots of human genomic DNA dig~sted wi~h
various r striction endonucleases (not shown),
~ ~ consis~ent with only a single gen~ in human genomic DNA
: 20 hybridizing at high stringency.
Purification of recombinant CNTF - Upon
induction with IPTG, cultures of the bacterial
transformant pJ~1003-CNTF-A synthesized recombinant
human CNTF. At the end of the cultuxe period, CNTF
~25 accounted for approximately 13% of the soluble protein
in cell extracts (25 mg/liter/A600 unit) as judged by
laser densitometer analysis of CBB-stained gels (Fig.
: 3, lane l).
When ~he soluble material from crude cell
extract was subjected to anion-exchange chromatography
on Q-Sepharose in a relatively high-ionic strength
buffer at pH 8.0j CNTF was slightly retarded on the
column and.emerged in the flow-through and cslumn wash
lFig. 3, lanes 6-22) ~ust after the passage ~f cellular
debris and other proteins ~FigO 3, lanes 3-5). The
bulk of E._coli pro~eins were re~ained on the column
W093/02206 PCT/US92/06136
~ 3~ 30 -
under these conditions. W~en the CNTF pool from the
first column was dialyzed into a low ionic strength
bu~f~r at pH 8.0, CNTF now bound ts a second column of
Q-Sepharose and could be eluted by application of a
salt gradient as a peak at 55-60 mM NaCl ~Fig. 4).
The resultant CNTF pool (Fig. 4, inset) was
dialyzed into a low ionic strength buffer at pH 7Ol and
subjected to cation-exchange chromatography on S-
Sepharose. CNTF bound to the resin was eluted by
application of a salt gradient as a peak between 125- ;
250 mM NaCl (Fig. 5). The CNTF p401 (Fig. 5, inset~
was then subjected to a final af f inity chromatography
step on a Zn2~-XD~-agarose column. CNTF bound to the
~ column, probably via an interaction between zinc and
histidine residues, of which CNTF possesses ten per
molecule ~Table I~. CNTF was eluted from the column by
application of a histidine gradient at 30-35 mM
histidine (Fig. 6).
~: ~ sum~ary of the purification of recombinant
20 human CNTF is shown in Table II. The average yield of
CNTF was l9 + 1.5% (n=4). The percent CNTF in protein
pools c~llected after each~chromatography step was
determined by la~ser densikometer analysis o~ CBB
s~ained gels. These perce~tages were used to calculate
:: 25 ~he total amount of CNTF in any given pool and, from
this, the fold puriflcation and yields (Table II).
ver-stained gels were not used f or this puxpose,
: since the i~tensity of staining with silver was not
~proportional to~the amount of protein and this method,
therefore, was not reliably qua~titative. However,
silver-stained gels werP used to ~ualitatively assess ~:
the degree of purity of CNTF contained in the variou~ ~:
pools (insets, Figs. 4, 5 and 6).
: . The pI of human CNTF, calculated from the
amino acid composition, is 6.4. Thi5 is signi~icantly
: higher than that calculated for r~bbit ~pI - 5.8) or
. .
W093/~2206 PCT/US92/06136
2113X:1 5
rat (pI = 5.7) CNTF [7,8J. This difference in
calculated pI suggests that the above purification
protocol, which relies heavily on ion exchange
chromatography at carefully controlled pH and ionic
strengths, might require modification in order to be
used to purify recombinant rat or rabbit CNTFs from
bacterial expression systems.
Pu~ity of CNT~ - The amino acid composition
o~ human recombinant CNTF, purified as above,
corresponded well to the amino acid composition
predicted from the human coding sequence (Ta~le I). In
addition, peptide map and amin~ acid sequence analyses ..
o~ the purified prot~in indicated only the presence o~
CNTF sequences. The amino acid sequence of recombinant
human C~TF was that expected from the human coding
sequence (Fig. 1), except for the failuxe to detect an
amino-~erminal methionine. Amino acid sequence
analysis of three different CNTF preparations yi~lded
: less than 0.1% of the expected amount of methionine at
the amino-terminal position. Removal of the amino-
terminal methionine during expression in bacteria is
: not uncommon for proteins, such as CNTF, in which t~e
amino-terminal methionine is following by an alanine
residue:~20, 21~.
~5 The purity of CNTF was fur~her analyzed by
RP-HPLC. Elution profiles obtained at 214 and 280 nm
(~ig. 7a and 7b, respectively) revealed two symmetric
protein peaks accounting for 95 ~ 2% and 5 + 2 % (n =
3) of the total protein eluted. The minor form did not
appear to derive from the major form during
chromatography:, since some preparations of CNTF
exhibited no dete table minor form on RP-HPLC. Peptide
map and amino- and carboxyl- terminal amino acid
sequence analyses of the protein contained in both ~:
: 35 fractions revealed only the presence of full-length
CNTF. Therefore, the two peak~ represent forms of CNTF
W~93/~2206 P~T/US92/0~136
~ ~3 S ~ 32 -
that di~fer in an unknown way. These CNTF forms may be
a consequence of deamidation. A second possible
explanation is proline isomerization, which has been
reported for other proteins, including insulin [22, 23,
24].
When an amount of CNTF in excess of lO0 ~g
was subject to RP-HPLC and monitored at 214 nm, a peak
representing less than 0.1% o~ the detected protein was
observed immediately prior to the two peaks discussed
above. Since insufficient quantities of thi~ protein
could be obtained for sequence analysis by RP-HP~C, lO0
~g amounts of purified CNTF were sub~ected to SDS-PAGE
and Western blot analyses in an attempt to identify
what protein species was present at approximately 0.l%
of the total.
: CBB staining of such gels revealed the
presence of ~aint protein bands corresponding to Mr ~
46,000, 2I,000, 18,000 and l6,000, in addition to
native CNTF tdata now shown). .These bands were,
however, more easily visualized upon immunoblotting
using antibodies to CNTF (Fig. 8, lane A). This
observation in itself does not identify these bands as
CNTF since the antisera was raised against this
preparation of CNTF. The proteins of Mr = 18,000 and
l6,000, appeared to be heat generated fragments o~ :
native CNTF, since the~e bands increased with time of
heating at lO0^~ for a~ least 2 min prior to ::
electrophoresis (compare lanes A and B, Fig. 8). The -~
proteins of Mr = 46,000 and ~l,000 were bl~tted from a
heavily loaded gel onto imm~bilon-P and suhjected to
amino-terminal protein sequencing. The only sequencing
detected were those of CNTF, which suggests that the
46,000 dalton species may bP a dimer of CNTF (~r =
23,000 daltons). It is unlikely that dimerization
occurred by disulfide-bond formation, since the samples
were reduced with DTT bef~re electrophoresis. No CNTF
W093/02206 . 2 1 1 3 3 ~cT/us92/06~36
- 33 -
seguence was detected from a strip of immobilon-P
excised from between the 46,000 and 23,000 dalton
species. This suggests that the detection of any CNTF
sequence at the 46,000 dalton level is not a
consequence of streaking of native CNTF upon.SDS-PAGE.
The 21,000 dalton species may be a carboxyl-terminally
truncated form of CNTF, since its amino terminus was
intact (too little material was available for
se~uencing of the carboxyl-terminal peptide).
Based on la~er densitometry of CBB stained
gels, the apparent dimer accounted for approximately
0.01% and the truncated CNTF for approximately 0.1% of
the total protein. The 0.1~ RP-HPLC peak, discuss~d
above, was tentatively identified as a putative
truncated ~orm of CNTF. Loss of the highly charged
carboxyl-terminus of CNTF ~Fig. 1) would reasonably be
: expected to alter migration on RP-HPLC. These results
:~ indicate that contamination of purified CNTF by non--
CNTF proteins was significantly ~elow 0,1%.
~o Ultraviolet AbsorPtion S~ectrum of CNT~ - The
u.v.-absorption spectrum of the recombinant human CNTF
is shown in Fig.:9. An absorption maximum was observed
: at 279 nm, with~a shoulder at 290-295 nm, indicative of
the presence of tryptophan. This is consisten~ with
~: 25 the amino acid compvsition STable I) which reveals th~
: presence of 4 mol of tryptophan per mol of CNTF. An
: : absorption coefficient of the protein was calculated
from the u.v.-absorption spectrum and the protein
concentratinn (determined by am no acid analysis~.
Bioactivitv of recQmbinant human CNTF - There
would appear to be no need to perform a refolding step
in order to produce biologically active CNTF from the
bacterial expression system. Since there is only one
cysteine in human CNTF ~amino acid 17 in Fig~ l), there
can be no intramolecular disulfide bonds that would
need to reform correctly. Also, since CMTF can regain
W093~0220~ PCT/US92/06136
~ - 34 - .
biological activity after exposure to SDS,
acetonitrile, and TFA ~lOJ, CNTF appears able to
spontaneously refold after some forms of denaturation.
As anticîpa~edj both crude bacterial lysate and
purified recombinant CNTF exhibited CNTF biological
activity.
Highly-purified recombinant CNTF promoted t~e
survival in culture of chic~ embryo parasympathetic
(ciliary), sympathetic chain, and sensory (dorsal root)
neuron$ (Table III). The specific activities in Table
III are equivalent within experimental error to those
observed for recombinant human CNTF expressed in animal
(COS-7~ cells ~ciliary neuron~ = 1.7+ 1.2 TV/ng (N=5);
sympathetic neurons =^7.7 ~ 2.l TU/ng (N=3)). This
suggests that the purified CNTF from E. col is fully
biologically active.
Crude or partially purified extracts from
various tissues have also been reported to promote the
survival in culture of all three of the chick embryo
2Q neuronal populations used above ~25, 26, 27~. The
activity of these extracts has been ascribed to CNTF.
Our results indeed demonstrate that a single molecule,
CNTF, has these activities.
The primary structure of human CNTF exhibit~
no N-linked glycosylation sites (N-X-T/S) ~Fig. l). In
addition, the biological activity of bacte~ially- :
expressed human CN~F indicates that other ~orms of :~
glycosylation, even if they occur in vivo, are not
essential for the biologiral activity of CNTF.
PcEFERENCES FOR EXAMPLE 1 ~:
l. Saiki, R.K., Gelfand, D.H.~ Stoffel, S., Scharf,
S.3., Higuchi, R., Horn., G.T., Mullis, K.B.
& Erlich, H.A. (l988) Science 23~, 487-491.
2. Blin, N. ~ Stafford, D.W., (1976) Nucleic Acids
Res. 3, 2303-2308.
WO93~02206 P~/US92/06136
- 35 ~ 2113YI~
3. Rimm, D.L., Horness, D., Kucera, J. & Blattner,
F.R. (1980) Gene ~2, 301-309.
4. McClary, J.AL, Whitney, F. & Geisselsoder, J.
(1989) Biotechni~ues 7, 282-289.
5. deBoer, H~A. ~ Kastelei~, R.A. (1986) in
Maximizinq Gene Expression (Gold, L. &
Reznikoff, W.S., eds.) pp. 225-285,
Butterwvrths, N~.
6. Schoner, B.E., ~siung, H,M., Belagaje, R.M.,
Mayne, N.G. & Schoner, R.G. (1984) Proc.
Natl. Acad. Sci. USA 81, 5403-5407.
7. Dente~ L., Cesareni, G. & Cortese, R. (1983)
Nu~cleic Acids Res. 11, 1645-1655.
~. 8. Squires, C~H., Childs, J., Esienberg, S.P.,
2~ Polverini, P.J. ~ Sommer, A. (1988) J.
Biol. Ch~m~ 263, 16297-16302.
9r Studier, F.W. & Moffatt B.A. (1986) J. Mol. ~ol.
189 ~ 113 -130
: 10. Maniatis, T., Fritsch, E.F. & Sambrock, Jr. (1982)
Molecular Clonina: _A Laboratory Manual Cold
Spring Harbor ~aboratory. Cold Spring
Harbour, NY.
:30
11. Burgess, R.R. & Jendrisak, J.J~ (1975
; ~ BiochemistrY 1~, 4634-4638.
,
12. Laemmli, U.K. (1970) Nature ~27, 680-685.
13. McDonald, 3.R., Groschel-Stewart, U. & Walsh, M.P.
~1987) Biochem. J_ 242, 695-705.
: 14. Moost Jr., M., Nguyen, N.Y. &.Lu, T.-Y~ (1988)
~ 4:0 J. BioL _gh~m~ 2~3, 6005-6008.
: 15. Towbin, H., Staeh~lin, T.. & Gordon, Jr. (lg7g)
Proc._Natl. Acad. Sci._USA 76, 4350 4354
45- 16. Tainer, J.A., Getzoff, E.D., Alexander, H.
Ho~ghton, R.A., Olson/ A.J, & Lerner,
R.A~ (1984) NatuEe 312, 127-134.
17. Collins r F. and Lile, J.D. (1989) Braln Res. 502,
99-108.
18. Armes, L.G. & Forney, L.J. (1990~ J Protein Chem~
9, 4~-52. .
W0~3/02~06 PCT/US92~06136
3~s~ 36
l9. Spector, T. (1978) Anal._Biochem. ~6, 14Z-146.
20. Hirel, P.-H., Schmitter, J.-M., Dessen, P., Fayat,
G. h Blanquet, S. (1989) Proc. Natl. Acad.
Sci USA 86, 8247-8251.
21. Dalboge, H., Bayne, S. & Pedersen, J. (1990)
FEBS Lett. 266, 1-3.
22. Hig~ins, K.A., Craik, D.J., Hall, J.G. & Andrews,
P.R. (1988) rugL Des. Deliv. 3, 159 170.
23. Xordel, ~. Forsen, S., Drakenberg, T. & Chazin,
W-J- (l990) ~i~ch~ y ~g~ 4400-44~9
24. Kie~haber, T., Quass, R., Hahn, U. & Schmid, F.X.
(1990) Bioch~LLstr~ 29, 3053 3061.
25. Barbin, G., Manthorpe, M. & Varon, S. (1984)
20~-~ J. Neurochem. 43, 14S8-1478.
26. Saadat, S., Sendtner/ M. ~ Rohrer, H. (1989)
Cell. Biol. l08, 1~07-1816.
27. Lehwalder~ D., Jeffrey, P.L. & Unsicker, K. (1989)
J. Neurosci.~ Res. 24, 329-337.
~ :
:
~,
::
..
. .
.
:: :
.
:
:
:
`:
'
,
~: :
WO ~3/022~6 P~r/lJS9~/06i36
- .
2~3~
TABLE I
Amino acid com~osition of recombinarlt human CNTF
Amino Acid Calculated~a) . Expected
Asp/Asn (D/N) 18 . 7 .18
Thr ~T) .11. 0 12
Ser (S) 13 . 6 13
Glu/Gln (E/Q) 26. 0 26
Gly (G) 10. 5 10
Ala (A) 15. 5 15
Val (V) 7 . 3 8
Met (M) 4 . 6 4C
Ile (I) 11. 9 12
Leu (L) 25 . 7 26
Tyr (Y) 5. 0 5
Phe (F~ 6.9 7
L.ys ~K) 8. 6 9
His (H) n . d . 10
Arg ~R) 12.1 12
Cys ~C~ n.d.
Trp (W) n. ~ . 4
Pro ~p~ ç. g 7
To~al residues 176 . 2 : 200
Mr 22,931
(a) ~mino acid analysis performed as described by
Armes and Fc)rney ( 1~90) .
b) From sequence in Fig. 1.
n . d . = not detex~nined
(c) Based on absence of the amino-terminal methionine.
:
WO 93J02206 PCl /U~;~2/06136
.,
3 8 -
~ .
~ a
a~ ~U H
3 ~
~q tlS O Z
~ ~ ~rl O
O Ul ~) W
^r ~ h ~; ~
r I h r~ ~ o
_ U~ ~1 O 0~ CO O
~ æ ~
I O ~ ~ ~
1. Q~ ~ ~ æ
~ : I Y ~ ~ .
I R ~
C,~ N ~ U')
,_~ H ¦ Ul V ~
~1 ~ .
IY~I C: O ~n A
I a~
't ~) 3 ~
, ~ ~ ~ .. ~
5~
X ~ o
I Q~ r o .:
O ~D C~ ~ r~ ,.
I t~ ~ o s~ o r~ ~ ~ ~ o
. ¦ Q ~ :~ (`')t` N r~
I
~ In
,~
~ ~ o o o ~
R y h .c
V ~ ~ ~ U~
Q.
-
:
:.
WO !~3/02206 PCI /US92/06136
. . 39 21 ~3~
~n
o ~
o
.,~ h ~1 ~
h ~ fa z -- -,1
~ U~ 0
X ~
o a ,~ ,e
o ~ o
o
Q) h
o ,~
O
S~ ~ O
I ~q :1 liil a~ o :
I .,~ ~n o a)
I ~ ~ 0
1 ~ h C,) E~ 0
-- U~ 0 3 Q)
. ~ o ~D 0
1~1 I V Q~
.-- I . ~:: H Z ~ ,~3 :
~:1cI h O O ~ u
'a ,C H X
C :~- 0 V ~ .
~ h a) -I
:
I r~ Z .
1~3 C~ O a) o
1 " " ' ' .
I q~
I C~
:: ~ ~ V --
O O
c o ~
~ C ^ Z +l ~:5 X ~1
- ~ O ~ h
æ
(~) Z ~ h ~ ~:
''~ N ~ ~L U)
C) ~
:
W093/02206 PCT/US92/06136
~ 40 -
EX~MPLE 2: IDENTIFICATION OF C-terminal TR_NCATED
FORMS OF CNTF
In an alternate process for the production and
purification of CNTF, C~terminal truncated forms of CNTF
were identified.
Fermentation
Strain description: :
1) Alternatives to the lead Q-Sepharose (CNTF
capture) column:
Q-Sepharose Bid Beads by Pharmacia was te~ted
successfully. Fermentation run: The tank was inoculated
with seed culture and the cells were indu~ed with IPTG at .
10 ~D (600 nm). Th~ cells were harvested by
~-~' centrifugation at 55 OD. The cell sludge (50% solids)
was either used immediately or the cells were frozen at -
-20C. Typical production scales were 10 or 160 liters.
Ç~l 1~ ,.
The cells were thawed and w~ter was added to
obtain 20% cell solids~and the pH was adjusted to 8.2
with 0.5 M Tris-base. Alternatively freshly h~rvested
cells were used. The entire process from performed at 4-
; 8C.
The cells were lysed by a ~ontinuoushomogenizer. The lysate was clarified by centrifugation
and diluted with 10-15 ~ol~mes of cold water to a
: conductivity egual to that of the lead column
:~ e~uilibration buffer:.
Purification
Step 1: (CNTF CAPTURE)
Q-SEPHAROSE FAST FLOW COLUMN ST~P
The product was captured on an anion exchange
column (2.5 cm diameter by 7.1 cm) with 35 mL bed volume
of Q S pharose fast flow resin (Pharmacia~, equilibrated
with 10 mM Tris-HCl pH 8.1 and 1 ~M EDTA~ The clarified
W0~3/02206 PCT/~S92/06136
- 41 ~ 2 1 1 3 8 ~
lysate was pumped at 11 mL per minute through a 3 uM
filter and then on the column. The column was washed at
the same flowrate with column equilibration buffer until
the OD (2~0 nm) returned to base li~e (a~proximately
three bed volumes). CNTF was step eluted from the column
at 3.7 mL per minute with 80 mM NaCl prepared in 10 mM
Tris HCl pH 8.2 and 1 mM EDTA. The entire peak was
pooled and diluted two fold with water and the pH was
adjusted to 7.2 with 0.1 N ~3PO4.
Step 2: S-SEPHAROSE FAST FLOW COLUMN STEP (CNTF C-
terminal TRUNCATED FO~MS I, II AND III S~PARATION)
The pooled CNTF w~s diluted two-fold with cold
water and loaded at 407 mL/minute onto the cation-
exchange ~S~Sepharose, Pharmacia) column (~.5 cm diameter
and 2~500 mL bed volume) eguilibrated with 25 mM NaPO pH
7.1, 25 mM Na~l, and O.1 mM EDTA~ The column was washed
at ~he same ~lowrate with e~uilibration bu~fer until the
OD (280 nm) returned to baselin~. The CNTF was eluted
with a pH gradient goin~ from 7.1 to 8.1. This was
accomplished by a 200 mL gradi~nt made up with two
buffers. The low pH buffer was 25 mM NaPi pH 7.1, 25 mM
NaCl, and 0.1 mM EDTA. The high pH buffer was made up of
25 mM Tris-HCL, pH 8.1, 25 mM NaCl, and 0.1 mM EDTA.
The CNTF was gradient eluted at a flowrate of
1.2 mL/minute. Of the th~ee peaks, the last peak (pH
7.8-8.1) was pooled from OD (280 nm) 0~2 to 0.2.
: The last~peak contains substantially pur~ CNTF
Form III/ whic~ contains the full amino acid se~uence as
set forth in Figure 1. The second peak con~ains C-
t~rminal truncated CNTF F~rm II, wherein the last twoamino acids of the C-terminal end of the amino se~uence
as set forth in Figure 1 are cleaved. The ~irst peak
contains C-terminal truncated CNTF Form I, wherein the
W093/02206 PCT/US92~6136
~3~ 42 - ~
last six amino acids of the C-terminal end of the amino
acid sequence as set forth in Figure 1 are cleaved.
Alternatives to CNTF C-terminal Truncated Forms -:
~, II, IXI Separation column:
Cation-exchange resin from Toso Haas (TSK SP
650) and S-Sepharose HP from Pharmacia were tested
successfully.
The CNTF C-terminal truncated form~ I, II, and
III were also separated using NaCl gradients at pH 7.l
using 50 mM ~hosphate buffer.
Step 3: Q-SEPHAROSE FAST FLOW COLUMN STEP
Th~ pH ~f the S-Sepharose pool was adjusted to
8 . O with 0.1 N HCl or NaOH. The dimension of the Q-
Sepharose (Pharmacia) column was 2.5 cm in diameter with
a bed vslume of ~0 mL. The resin was equilibrated with
lO mM Tris pH 8.0, 50 ~ NaCl. The column was loaded at
a flowrate of 3 0 4 mLjminute and washed with equilibration
buffer until the OD (280 nm) returns to baseline. Th~ :
CNTF was eluted at l.l mL/minute with a 200 mL salt
~0 gradient composed of 2 buffers. The low salt bu~fer was
10 mM Tris-HCl pH 8~0 and 50 mM NaCl~ The high salt
buffer was lO mM Tris-HCl pH 8.0 and 200 mM NaCl. The
pooling of the fractions took place between an OD (~8Q
nm) of 0.3 and 0.9.
Step 4: B~LK STORAGE ~
Th~ pH of the Q column ~luate was adjusted to
7.l-7.2 using O.l N H3PO4. Alternatively the CNTF
concentratlon was increased to approximately 8 ~g/ml by
ultrafiltration using an Amicon YMlO membrane. Finally
the material was frozen at -70C.
W093/02206 PCT/US92/06136
_ 43 21~3(~1~
EXAMPLE 3. FURTHER CNTF PURIFICATION PROTOCOLS
The present chromatography train is Q~ S~
Q. The CNTF at this stage is purified to equal to or
greater than 99.9% purity with respect to ECP (E. coli
prot~in). Furthermore it did pass DNA and endotoxin
specifications. These are less than lO0 pg DNA p r dose
and less than 5 E.U. per kg body weight per day,
respectiv~ly. The amounts of CNTF forms were typically
97, 3 and 0.1% of CNTF C-terminal truncated ~orms III,
II, and I, respectively. Note that III is the full size
CNTF. The amount o f ECP in the final product was between
50-200 ppm as judged by ELISA to ECP. To further lower ~-
the amount of ECP in a range below 25 ppm an additional
~ ~ ..
column was needed.
The locations for this fourth column in the
: ~ process flow diagram can be either in between the 2nd
: (~sr) and the third column ~'Q') or after th~ third
column:. In the ~ollowing para~raphs examples are gi~en
: o~ the various column resins tried that produced material
~:: that had a lower E~P~content.
: Example A. Hydroxy Apatite Resin ~ .
The~column with cerami¢ H~droxy Apatite (HA) resin (AIC)
~ was:equilibrat~d~:with 5 mM NaPi pH 7Ø The pH o~ the
: l~ad ~the S column) was adjusted to 7.0 wit~ 0.1 N HCl
:: ~ 25 and water was added to the load until its conducti~ity
~: : was equal to the conductivity of:the ~A column
: equi~ibration buffer.:~ The column was washed with
:equi~libra~ion buffer unti~l the OD ~280 nm) r~turned to
bas~line a~d t~e~ ;CNTY was eluted with a 10 bed volume
phosphate gradient. The low phosphate buffer was 5 mM
NaPi pH 7Ø The high phosphate:buf~er was 150 mM
: :phosphate pH 7Ø ~ractions were pooled between an OD
~ ~2~0 nm) of 0.3 and 1.0~at the leading and at the
: :: :: :
:
W~s3to22~6 . PCT/US92/~6136
~3~ 44 ~ :~
trailing edge of the peak, respectively. The ECP loan
decreased to less than 25 ppm.
In addition to the ~eramic HA a spheroidal HA
from BDH was also ~uccessful in removing ~CP but it
required a lower phosphate conc~ntration throughout all
~teps. The HA column can also be used a~ter the third
column in which case there is no phosphate present in the
final bulk product.
~xample B. Butyl HIC resin.
Butyl ~oyopearl 650 M (Toso-Haas) is a resin
used in hydrophobic interaction chromatography (HIC).
The butyl column (2.5 diameter by 10.2 cm) with 50 m~
resin was equilibrated with 200 m~ of 300 mM NaCl in 20
mM NaPi pH 7.5. The NaCl and ph~sphate concentrations in
the load of 200 mg CNTF were adju~ted ~o 300 mM and 20 mM
pH 7.5, respectively. The column was loaded at 9.6 mL
per minute with CNTF and washed with column equilibration
buffer. The CNTF was step eluted with 175 mL of a 20 mM
imidazole buffer pH 7.5. Alternatively, the CNTF could
2Q be eluted with 20 mM Tris pH 7.5 of 50% (v/v) ethylene
: glycol in 20 mM phosphate buffer pH 7.5 or water or 20%
ethanol or 10% glycerol in 20 mM imîdazole pH 7.5. The
; resin was regenerated with a 6 M urea followed by washing
with water and requilibration. Butyl resins with bead
sizes o~ 650 M or 650 S are expected to yield similar
results.
Example C. Zn-IMAC (immobilized metal a~finity
chromatography~ resin.
The column had a diameter of l cm and was
3~ filled with ~ mL chelating Sepharose Fast-Flow from
Pharmacia. The column was equilibrated with lO mM Hepes
pH 7.5 a~d 50 mM NaCl followed by a charging step using a
solution of l mg ZnCl2/mL pr~pared in water. The CNTF
W~93/02206 PCT/U~92/06136
_ 45 _ 2 ~ S
was loaded to a capacity of 5 mg/mL resin at 3 mL/minute
followed by a wash in column e~uilibration buffer. The
CNTF was eluted at 1 mL/minute with a histidi~e gradient
~f 80 mL. The gradient was 0 to 75 mM histidine prepared
in column equilibration buffer. The column was
regenerated with a solution containing 5 mM EDTA in 10 mM
Hepes and 1 M NaCl at a pH of 7.5, followed by a l hour
soak in 1 M NaOH. Then the column was washed in water
and requilibrated followed by a recharge with æinc. The
lo~ativn of this zinc column was tried both after the S
column as well as after the Q column. Alternative
charging metals are copper, cobalt, and nickel.
EXAMPLE 4: DEMONSTRATION_OF THE ABILITY OF CNTF TO
ACCELERATE THE RECOVERY OF SENSORY_AND
MOTOR FUNCTION AFTER PERIPHERAL NERVE
DAMAGE.
A. Protocol for creating peripheral nerve damage.
Female Sprague Dawley rats weighing 120-140 g
were used. The surgical procedure for producing damage
~o th~ sciatic nerve~was performed on rats anesthetized
with methoxyflurane. Induction was in a bell chamber.
Anesthesia was maintained by nose cone.
The fur on the left hind limb was clipped from
2~ the thigh and hip regions. The clipped area was cleaned
with betadine soap and rinsed with ethanol. ~sing
sterile technique throughout the procedure, a 15 mm skin
incision was made in the proximal half of the line
between ~rochanter major and knee j~int. The vastus
lateralis and biceps femoris muscles were separated by
blunt dissection and the sciatic nerve exposed where it
emerges from under the gluteus maximus and runs o~er the
semi-membranous and semitendinosus muscles. The nerve
w~s elevated and Crile hemostatic forceps placed around
W093/022~6 PCT/~Sg2/~6~36
~ ~ - 46 -
the nerve 5 mm distal to the trochanter major. The Crile
~orceps were closed maximally for 30 sec. The muscles
were not reopposed. The skin was closed with wound
clips. ~ single intramuscular injection of penicillin G
procaine and penicillin G benzathine in an a~eous
suspension was given.
The rats are ambulatory 10 to 15 min after the
surg~ry. Becal~se the ~emoral nerve i5 intact, the rats
are able to bear weight on the lesioned limb.
B. Methods for assessing recovery of sensory and motcr
function a~ter peripheral nerve injury.
i. Sens~ry_~unction: Recovery of cutaneous
sensation to the plantar surface of the footsole of the
lesioned leg was performe~ by eliciting a withdrawal
ref~ex after applying an electrical stimulus to the
: footsole. If sensory nerves have regenerated, a reflex
arc i~ completed which causes the muscles of the hind
limb to contract. A graded series of electrical curr~nt~
~ ~ were applied to the footsole in 100 ~A decrements in a
: 20 range o~ 800 to 300 ~A. The current was generated by a
constant-current generatox (53500 Precision Instrument,
Stoelting, Wood Dale, I~) and transmitted to the skin by
duaI timula~ing electrodes with poles that are 1/8"
apart (Lafayette Instrument, Lafayette, IN~. The ~urr~nt
was applied to the plantar surface of the paw immediately
~: ~istal to digit 5~ The lowest current to which the rats
responded by withdrawing that limb was determined. A
percentage recovery was calculated based on the lowest
detectable current. Rats responding to 3~0 ~A were
considered ~o be 100% recovered, since 1his was the
smallest current leYel that caused withdrawal
reproducibly in nonmal rats.
ii. N~5~ I~U~o~: The sciatic nerve crush
WO93J~2206 PCT/~'S~2/06136
21~381~
- 47 -
results in denervation of the extensors of the digits in
the hindlimb. The digits are hyperflexed and held
abnormally close together. This loss of toe spreading
was used as an index of motor function after sciatic
nerve crush. Toe spreading was measured from footprints
made by walking rats. Measurements were compared in
CNTF-treated and untreated rats during the course of
regeneration o~ the sciatic nerve.
The plantar sur~aces of both hindlimbs were
pressed against an ink pad that was soaked lightly with
black ink. The rat was placed, hindlimbs first, at the
entrance of a walkway. The walkway was composed of a
three-sided cardboard tunnel with its ground surface
removed. The tunnel, which served to direct the rat's
movements, was placed on a strip of white butcher paper.
The rat was allowed to move freely through the tunnel.
The o~ject was to obtain at least two paired ~ootprints
on the butcher paper while the rat was in a walking m~de.
Two parameters, the footspread (FS) and the
distance between the intermediary toes (ID), were
measured from the footprints. F5 is the linear distance
to the nearest millimeter from the medial edge o~ digit 1
to the lateral edge of digit 5. ID is linear distance to
the nearest millimeter between the medial edge of digit 2
and the lateral edge of digit 4. The mean distances for
:: FS and ID were determined for each foot. For each
parameter, a ra~io was cal ulated from values d~termined
on the lesioned left foot and non-lesioned ri~ht foot~
Thus, as motor function recovered as a function of time
after sciatic nerve crush~ ratios of either FS or ID,
which at day 7 after nerve crush were less than 5~ of
normal, began to increase approaching a normal ratio of
1Ø RatiQs were calculated daily beginning at day 7
.
W093/022~6 PCT/US92/~6136
- 48 -
~from values determined for the paired lesioned and non-
lesioned feet and compared for each parameter between
CNTF-treated and untreated groups.
C. Administration of CNTF.
Rats were injected subcutaneously with CNTF at
the dorsal midline in the region of the scapulae. The
CNTF admini~tered was human recombina~t CNTF, produced as
descri~ed in the Collins et al. patent application
described above. Injections were made with an insulin
syringe with a built-in 28 gauge needle. Minimal
physical restraint was required during the injections.
The volume of injected CNTF was l.0 ml per kg body
: weight . Control rats were injected with l.0 ml per kg of
~ buffer vehicle, using the same technique.
D. Experimental design.
Injections with CNTF or vehicle were begun two
days before the sciatic nerve injury and continued ~or ll
days after the injury for a total of 14 days. The
; completeness of the sciatic nerve crush was tested by the
footsole test on day 3. R~generation of the sensory
nerves was determined by the foot sole test on a daily
basis beginning ll days after nerve crush.
E. Effects of CNTF on recovery of function after
peripheral nerve damage.
~25 Administration of CNTF to rats at a dose of O~l
and 0O25 mg per kg of body weight t as described abo~e,
accelerated the rate of recovery of sensory (Figure lO)
and motor (Fi~u~e ~l) function.~ The CNTF-treated rats
recovered 50% o~ normal sensory function 2.5 days earlier
than rats treated with vehicle alone (Figure lO). It
should be noted that vehicle-treated or untreated rats
recover sensory and motor function wi~hout difficulty
after physical nerve injury. Acceleration of recovery,
.
W093/~2206 PCT/US92/0~136
- 49 -21~'15
in what is already considered to be a rapidly recovering
system is, therefore, a significant finding.
F. Controls showing the non-toxic nature of CNTF alone.
Separate ~ontrols were included to assess the
ef~ects of CNTF alone. CNTF had no effect on.mortality
and no significant effect on body weight at the doses
found to accelerate recovery after peripheral nerve
damage. In animals receiving CNTF in the experiments
described above, there were no abnormalities apparent in
the motor or sensory function on the control, unlesioned
side. This indicates that CNTF had no obvious e~fect on
sensory or motor function in the absence o~ nerve injury.
G. Conclusions.
~.--
CNTF was effective in accelerating recovery
from peripheral nerve damage after phy ical injury in
rats when CNTF was administered by daily subcutaneous
i~jection around the time of injury. These results
demonstrate that subcutaneously-administered CNTF i5 able
to modify in a positive way the response of peripheral
sensory and motor ~erve cells to injury. A similar
therapeutic regimen can be readily accomplished in a
patient ~uf~ering from peripheral nerve damage.
~lthough the present invention has been
des~ribed in connection with preferred embodiments, it is
unders~ood that those skilled in the art are capable of
.
making modifications and variations without departing
f~om the scope~or~spirit of the present invention.
~Therefore, the foregoing description of preferred
embodiments is not to be taken in a limiting sense, and
the present invention is best defined by the following
: claims and their equiv-lents~
~ ' ~
.
