Note: Descriptions are shown in the official language in which they were submitted.
W093/07295 PCT/US92/0~58
2119~0
PESCRIPTION
Formation of Tri~le Helix Complexes of Sinqle Stranded
Nucleic Acids Usina Nucleoside Oliaomers
Cross-Reference to Related A~lications
This application is a continuation-in-part of
U.S.S.N. 368,027, filed ~une 19, 1989, which is a continu-
ation in part of U.s. Serial No. g24,234, filed Octo-
ber 28, 1986, the disclosure of which is incorporated
herein by reference.
Backaround of the Invention
This invention was made with governmental support,
including a grant from National Institutes of Health
U.S.A., Grant Number CA 42762. The government has cPrtain
rights to this invention.
Publications and other reference materials referred
to herein are incorporated herein by reference and are
numerically referenced in the following text and respec-
tively grouped in the appended Bibliography which immedi-
ately precedes the claims.
The present invention is directed to novel methods ofdetecting and recognizing specific sequences in single
stranded nucleic acids, particularly RNA, using first and
second nucleoside Oligomers which are capable of specifi-
cally complexing with a selected single stranded nucleicacid structure to give a triple helix structure.
Formation of triple helix structures by homopyrimi-
dine oligodeoxyribonucleotides binding to polypurine
tracts in double stranded DNA by Hoogsteen hydrogen bond-
ing has been reported. (See, e.g. (1) and (2)). Thehomopyrimidine oligonucleotides were found to recognize
extended purine sequènces in the major groove of double
helical DNA via triple helix formation. Specificity was
found to be imparted by Hoogsteen base pairing between the
homopyrimidine oligonucleotide and the purine strand of
.
~B~nE~Er,
.
W093/07295 PCT/US92/0~58
211989~ - `
the Watson-Crick duplex DNA. Triple helical complexes
containing cytosine and thymidine on the third strand have
been found to be stable in acidic to neutral solutions, t
respectively, but have been found to dissociate on
5 increasing pH. Incorporation of modified bases of T, such
as 5-bromo-uracil and c, such as 5- methylcytosine, into
the Hoogsteen strand has been found to increase stability
of the triple helix over a higher pH range. In order for
cytosine (C) to participate in the Hoogsteen-type pairing,
10 a hydrogen must be available on the N-3 of the pyrimidine
ring for hydrogen bonding. Accordingly, in some circum-
stances, cytosine may be protonated at N-3.
DNA exhibits a wide range of polymorphic conforma-
tions, such conformations may be essential for biological
15 processes. Modulation of signal transduction by sequence-
specific protein-DNA binding and molecular interactions
such as transcription, translation, and replication, are
believed to be dependent upon DNA conformation.(3)
It is exciting to consider the possibility of deve-
20 loping therapeutic agents which bind to critical regions
of the qenome and selectively inhibit the function, repli-
cation, and survival of abnormal cells.(4) The design and
development of sequence-specific DNA binding molecules has
been pursued by v~rious laboratories and has far-reaching
25 implications for the diagnosis and treatment of diseases
involving foreign genetic materials (such as viruses) or
alterations in genomic DNA (such as cancer).
Nuclease-resistant nonionic oligodeoxynucleotides
(ODN) consisting of a methyIphosphonate (MP) backbone have
30 beén studied n vitro and n vivo as potential anticancer,
antiviral and antibacterial agents.(5) The 5'-3' linked
internucleotide bonds of these analogs closely approximate
the conformation of nucleic acid phosphodiester bonds.
The phosphate backbohe is rendered neutral by methyl sub-
35 stitution of one anionic phosphoryl oxyqen, decreasing
inter- and intrastrand repulsion due to the charged phos-
phate groups.(5) Analogs with MP backbone can penetrate
SIJBS117U~E SHEEI
wo93/o72ss PCT/US92/0~58
21~g~
living cells and have been shown to inhibit mRNA transla-
tion in globin synthesis and vesicular stomatitis viral
protein synthesis, and inhibit splicing of pre-mRNA in
inhibition of HSV replication. Mechanisms of action for
inhibition by the nonionic analogs include formation of
stable complexes with complementary RN~ and/or DNA.
Nonionic oligonucleoside alkyl- and aryl-phosphonate
analogs complementary to a selected single stranded for-
eign nucleic acid sequence are reported to be able to
selectively inhibit the expression or function or expres-
sion of that particular nucleic acid without disturbing
the function or expression of other nucleic acids present
in the cell, by binding to or interfering with that
nucleic acid. (See, e.g. U.S. Patent No. 4,469,863 and
4,511,713.) The use of complementary nuclease-resistant
nonionic oligonucleoside methylphosphonates which are
taken up by mammalian cells to inhibit viral protein
synthesis in certain contexts, including Herpes simplex
virus-1 is disclosed in U.S. Patent No. 4,757,055.
The use of anti-sense oligonucleotides or phosphoro-
thioate analogs complementary to a part of viral mRNA to
interrupt the transcription and translation of viral mRNA
into protein has been proposed. The anti-sense constructs
can bind to viral mRNA and were thought to obstruct the
cells ribosomes from moving along the mRNA and thereby
halting the translation of mRNA into protein, a process
called "translation arrest" or "ribosomal-hybridization
arrest."(6)
The inhibition of infection of cells by HTLV-III by
administration of oligonucleotides complementary to highly
conserved regions of the HTLV-III genome necessary for
HTLV-III replication and/or expression is disclosed in
U.S. Patent No. 4,806,463. The oligonucleotides were
found to affect viral replication and/or gene expression
as assayed by reverse transcriptase activity (replication)
and production of viral proteins pl5 and p24 (gene
expression).
SHEEr
~r . ~ p ~j., ~ P ~? .
W093/0729~ PCT/US92/0~58
~l~.9~g ,,.,"
l'he ability of some antisense oligodeoxynucleotides
containing internucleoside methylphosphonate linkages to
inhibit HIV-induced syncytium formation and expression has
been studied.(7)
Psoralen-derivatized oligonucleoside methylphospho-
nates have been reported capable of cross-linking either
coding or non-coding single stranded DNA; however, double
stranded DNA was not cross-linked.(28)
Summary of the Invention
The present invention is directed to methods of
detecting or recognizing a specific segment of single
stranded nucleic acid or a single stranded nucleic acid
sequence and to methods of preventing expression of func-
tion of a specific segment of single stranded nucleic acid
having a given target sequence by forming a triple helix
complex. Triple helix complexes of either DNA or RNA tar-
get sequences may be formed.
The present invention is also directed to novel modi-
fied Oligomers which are useful for preventing expression
and/or functioning of a selected single-stranded nucleic
acid sequence and which optionally include a nucleic acid
mQdifying group. Additionally, the present invention is
directed to Oligomers which comprise pyrimidine and/or
purine nucleoside analogs. In parti-cular, these purine
nucleoside ~nalogs are modified to favor formation and
stability of the triplex structure and to decrease mis-
reading of the target nucleic acid sequences.
In one aspect, the present invention is directed to
methods of preventing function or expression of a single
stranded nucleic acid target sequence which comprises con--
tacting said target sequence with a first Oligomer and a
second Oligomer wherein the nucleoside sequences of said
first and second Oligomers are selected so that a triple
helix structure is formed. According to one preferred
aspect, the nucleic acid target sequence comprises either
a polypurine or a polypyrimidine sequence. Where the
suss~n~u~EsHEr '
W093/07295 PCT/US92/0~58
211S~3~
target sequence is a homopurine sequence, the first and
second Oligomers may comprise only pyrimidine nucleosides
or analogs or alternatively one of said first and second
Oligomers comprises only purine nucleosides and the other
comprises only pyrimidine nucleosides. However, when the
target sequence is a homopyrimidine sequence, the first
and second Oligomers may comprise only purine nucleosides
or, alternatively, one of the first and second Oligomers
comprises only purine nucleosides and the other comprises
only pyrimidine nucleosides.
In one especially preferred aspect, analogs of the
naturally occurring purine nucleosides are employed in the
Oligomers of the present invention. These purine nucleo-
side analogs have been modified to favor hydrogen bonding
lS configurations which encourage triplex formation and also
triplex stability while disfavoring misreading (or mis-
paring) of the target sequences by the bases of the first
and second Oligomers and also disfavoring nonselective
interactions between the bases on the three nucleic acid
strands.
In one aspect, the present invention is directed to
methods of detecting or recognizing a specific segment of
single stranded nucleic acid or single stranded nucleic
acid sequence and to methods of preventing expression or
funct~on of a specific segment of single stranded nucleic
acid having a given sequence, especially RNA, by forming
a triple helix structure. The present invention is also
directed to novel modified Oligomers which are useful for
preventing expression and/or functioning of a selected
double nucleic acid sequence and which optionally include
a DNA modifying group. Additionally, the present inven-
tion is directed to novel Oligomers which comprise cyto-
sine analogs.
The present invention is also directed to formation
of a triple helix structure by the interaction of a speci-
fic segment of single stranded nucleic acid and first and
second Oligomers. The first Oligomer is sufficiently com-
SU~SmlnESHEE1' '
W093/07295 PCT/US92/0~58
9~0
plementary to the segment of single stranded nucleic acid
to hybridize to it and the second Oligomer is sufficiently
complementary to the hybrid to read it and base pair (or
hybridize) thereto.
Accordingly, in one aspect, the present invention is
directed to methods of detecting or recognizing a specific
segment of single stranded nucleic acid which comprises
forming a hybrid between the segment and a first oligomer
and contacting said hybrid nucleic acid with a second Oli-
gomer which is sufficiently complementary to the sequence
of purine bases in said hybrid or a portion thereof to
hydrogen bond (or hybridize) therewith thereby giving a
triple helix structure.
In another aspect, the present invention is directed
to methods of preventing or inhibiting expression or func-
tion of a specific segment of a single stranded nucleic
acid having a given sequence which comprises first forming
a hybrid using a complementary first oligomer and then
contacting said hybrid with a second Oligomer suffi-
ciently complementary to said double stranded hybrid toform hydrogen bonds therewith, thereby giving a triple
helix structure.
The present invention is directed to methods wherein
the single stranded nucleic acid segment comprises an mRNA
in a living cell and wherein formation of the triple helix
structure inhibits or inactivates said mRNA and prevents
its translation.
~ According to another aspect, the present invention
provides methods of preventing or interfering with expres-
sion of a single stranded nucleic acid target sequencein vivo where the target sequence is an RNA region which
codes for an initiator codon, a polyadenylation region, an
mRNA cap site or a splice junction by formation of a
triple stranded helix. First and second Oligomers are
selected that they will form a triple stranded helix and,
thus, substantially prevent or interfere with expression
of the target sequence.
S~SlllUrE SHEEl
Wos3/072ss PCT/US92/0~58
2 1 ~
Alternatively, the present invention provides methods
of selectively preventing or interfering with expression
of a gene in a cell or a protein product of a gene by
preventing splicing of a pre-mRNA to give a translatable
S mRNA. According to these methods, first and second Oligo-
mers are selected so that they will form a triple stranded
helix with the target sequence and introduced into the
cell and form a triple stranded helix with the target
sequence and prevent splicing of the pre-mRNA.
In a different aspect, the present invention provides
methods of inhibiting replication or translation of a
single stranded DNA target sequence in vivo without sub-
stantially inhibiting overall DNA synthesis by formation
of a triple stranded helix by first and second Oligomers
with the target.
In a preferred aspect, said second Oligomer is modi-
fied to incorporate a nucleic acid modifying group which,
after the second Oligomer hydrogen bonds or hybridizes
with the hybrid, is caused to react chemically with the
hybrid and irreversibly modify it. Such modifications may
include cross-linking second Oligomer and hybrid by form-
ing a covalent bond thereto, alkylating the hybrid, cleav-
ing said hybrid at a specific location, or by degrading or
destroying the hybrid.
The present invention also providés Oligomers which
include nucleosidyl units in which a cytosine analog
replaces cytosine and wherein said cytosine analog com-
prises a heterocycle whi~h has a hydrogen available for
hydrogen bonding at the ring position which corresponds to
N-3 of cytosine and which is capable of forming two hydro-
gen bonds with a guanine base at neutral pH.
The present invention provides Oligomers wherein a
purine analog of adenine or guanine replaces at least one
adenine or guanine base. In particular, 2-amino purine
may replace adenine and guanine may be replaced by its
6-selenium analog or by 6-isopropyledine-7-deazaguanine.
The substitution of at least one 2-aminopurine for a
SUBSmUTESHEEr
. . .
W093/07295 PCT/US92/0~58
2 ~ l9 ~9~ 8
6-aminopurine (adenine) will provide a favorable regular-
ity in stacking with the guanine base if homopurines are
used for the third strand. In this case, the base pat-
terns of 2-aminopurines and guanines will be isomolphic
and will have the same geometrical pattern. In such a
situation, the 2-amino group of 2-aminopurine will be
serving as a proton donor to N7 while Nl of the 2-aminopur-
ine will be serving as a proton acceptor to the 6-amino
group of the adenine in the duplex, respectively. In the
homopurine third strand having the adenines replaced by
the 2-amino purines, the 2-amino group of the guanine in
the third strand will be a proton donor to the N7 of the
guanine in the duplex and the Nl proton of the guanine in
the third strand will also be a proton donor to the 6-oxo-
group of the guanine in the duplex. In this case, the2-amino purine (of the third strand) will be donating one
proton and accepting one proton, while the guanine in the
third strand will be donating both protons to form hydro-
gen bonds. Thus, this change will substantially increase
the discrimination in reading A- and G in the target
sequence. The third strand will have a polarity parallel
to the purine strand of the duplex and both nucleosides
will be in the anti conformation. For the guanine ana-
logue, the replacement of the 6-oxo group in guanine by
the 6-selenium group or the isopropyiidene group will
reduce the non-selectivity of guanine in the third strand
for reading other bases.
According to the present invention, first and second
Oligomers are provided that comprise at least one nucleo-
sidyl unit having a modified purine base. These Oligomerscomprise nucleosidyl units (or nucleoside monomers) which
may be linked by any one of a variety of internucleosidyl
linkages. Theæe internucleosidyl linkages include, but
are not limited to, phosphorus-containing linkages such as
phosphodiester linkages, alkyl and aryl-phosphonate link-
ages, phosphorothioate linkages, phosphoramidite linkages
and neutral phosphate ester linkages such as phosphotries-
SUBS mV~ESH Er .
wo93/o72ss PCT/US92/0~58
211~8~
ter linkages; as well as internucleosidyl linkages whichdo not include phosphorus, such as morpholino linkages,
formacetal linkages, sulfamate linkages, and carbamate
linkages. Other internucleosidyl linkages known in the art
may be use~ in these Oligomers. Also, according to a pre-
ferred aspect, these Oligomers may incorporate nucleosidyl
units having modified sugar moieties which include ribosyl
moieties, deoxyribosyl moieties and modified ribosyl moie-
ties such as 2'-0-alkylribosyl (alkyl of 1 to lo carbon
atoms), 2'-0-arylribosyl, and 2'-halogen ribosyl, all
optionally substituted with halogen, alkyl and aryl, and
in particular, 2'-0-methylribosyl moieties. In particu-
lar, incorporation of nucleosidyl units having modified
ribosyl, particularly 2'-0-methyl ribosyl, moieties may
advantageously improve hybridization with the double
stranded nucleic acid sequence and also improve resistance
to enzymatic degradation.
In another aspect, the present invention provides
novel nonionic alkyl- and aryl-phosphonate Oligomers com-
prising these purine nucleoside analogs which are suffi-
ciently complementary to the sequence of a specific single
stranded nucleic acid. Segment to hydrogen bond and form
a triple helix structure~ Preferred are nonionic methyl
phosphonate Oligomers.
The present invention also provides Oligomers having
nucleosidyl units in which a cytosine analog replaces
cytosine and wherein said cytosine analog comprises a
heterocycle which has a hydrogen available for hydrogen
bonding at the ring position which corresponds to N-3 of
cytosine and which is capable of forming two hydrogen
bonds with a guanine base at neutral pH (such as pseudo-
isocytosine). Such cytosine analogs include 5-methyl-
cytosine, as well as the analogs depicted in Table V.
~s~r . ~
W093/07295 PCT/US92/0~58
2~ 8~0
Definitions
As used herein, the following terms have the follow-
ing meanings unless expressly stated to the contrary.
The term "purine" or "purine base~ includes not only
the naturally occurring adenine and guanine bases, but
also modifications of those bases such as bases substi-
tuted at the 8-position, or to the guanine analogs modi-
fied at the 6-position or the analog of adenine, 2-amino
purine.
The term "nucleoside" includes a nucleosidyl unit and
it used interchangeably therewith, and refers to a subunit
of a nucleic acid which comprises a S carbon sugar and a
nitrogen-containing base. The term includes not only
units having A, G, C, T and U as their bases, but also
analogs and modified forms of the bases (such as 8-sub-
stituted purines). In RNA, the 5 carbon sugar is ribose;
in DNA, it is a 2'-deoxyribose. The term also includes
analogs of such subunits, including modified sugars such
as 2'-O-alkyl ribose.
o
The term "phosphonate" refers to the group O=P-R
25 - O ~,
wherein R i8 an alkyl or aryl group. Suitable alkyl or
aryl groups include those which do not sterically hinder
the phosphonate linkage or interact with each other. The
phosphonate group may exist in either an "R" or an "S"
configuration. Phosphonate groups may be used as inter-
nucleosidyl phosphorus group linkages (or links) to con-
nect nucleosidyl units.
O
The term "phosphodiester" refers to the group O=P-O,
O
SUBS~rESHEEr
W093/07295 2 1 1 9 8 9 0 PCT/US92/0~58
wherein phosphodiester groups may be used as internucleo-
sidyl phosphorus group linkages (or links) to connect
nucleosidyl units. A ~non-nucleoside monomeric unit"
refers to a monomeric unit which does not significantly
participate in hybridization of an Oligomer to a target
sequence. Such monomeric units must not, for example,
participate in any significant hydrogen bonding with a
nucleoside, and would exclude monomeric units having as a
component, one of the s nucleotide bases or analogs
thereof.
A "nucleoside/non-nucleoside polymer" refers to a
polymer comprised of nucleoside and non-nucleoside mono-
meric units.
The term "oligonucleoside" or "Oligomer~ refers to a
chain of nucleosides which are linked by internucleoside
linkages which is generally from about 6 to about 100
nucleosides in length, but which may be greater than about
100 nucleosides in length. They are usually synthesized
from nucleoside monomers, but may also be obtained by
enzymatic means. Thus, the term ~Oligomer" refers to a
chain of oligonucleosides which have internucleosidyl
linkages linking the nucleoside monomers and, thus,
includes oligonucleotides, nonionic oligonucleoside alkyl-
and aryl-phosphonate analogs, alkyl- and aryl-phosphono-
thioates, phosphorothioate or phosphorodithioate analogsof oligonucleotides, phosphoramidate anaIogs of oligo-
nucleotides, neutral phosphate ester oligonucleoside
analogs, such as phosphotriesters and other oligonucleo-
side analogs and modified oligonucleosides, and also
includes nucleoside/non-nucleoside polymers. The term
also includes nucleoside/non-nucleoside polymers wherein
one or more of the phosphorus group linkages between mono-
meric units has been replaced by a non-phosphorous linkage
such as a morpholino linkage, a formacetal linkage, a sul-
famate linkage or a carbamate linkage.
SUBSlllV~ESHEI
.
W093/07295 - PC~/US~2/0~58
211989~
12
The term ~alkyl- or aryl-phosphonate Oligomer" refers
to Oligomers having at least one alkyl- or aryl-phospho-
nate internucleosidyl linkage.
The term "methylphosphonate Oligomer" (or ~MP-Oligo-
mer") refers to Oligomers having at least one methylphos-
phonate internucleosidyl linkage.
The term "neutral Oligomer" refers to Oligomers which
have nonionic internucleosidyl linkages between nucleoside
monomers (i.e., linkages having no net positive or nega-
tive ionic charge) and include, for example, Oligomershaving internucleosidyl linkages such as alkyl- or aryl-
phosphonate linkages, alkyl- or aryl-phosphonothioates,
neutral phosphate ester linkages such as phosphotriester
linkages, especially neutral ethyltriester linkages; and
non-phosphorus-containing internucleosidyl linkages, such
as sulfamate, morpholino, formacetal and carbamate link-
ages. Optionally, a neutral Oligomer may comprise a con-
jugate between an oligonucleoside or nucleoside/non-
nucleoside polymer and a second molecule which comprises
a conjugation partner. Such conjugation partners may
comprise intercalators, alkylating agents, binding sub-
stances for cell surface receptors, lipophilic agents,
` photo-cross-linking agents such as psoralen, and the like.
Such conjugation partners may further enhance the uptake
of the Oligomer, modify the interaction of the Oligomer
with the target sequence, or alter the pharmacokinetic
distribution of the Oligonucleoside. The essential
requirement is that the oligonucleoside or nucleoside/non-
nucleoside polymer that the conjugate comprises be
neutral.
The term "neutral alkyl- or aryl-phosphonate Oligo-
mer" refers to neutral oligomers having neutral inter-
nucleosidyl linkages which comprise at least one alkyl- or
aryl-phosphonate linkage.
The term "neutral methylphosphonate Oligomer" refers
to neutral Oligomers having internucleosidyl linkages
which comprise at least one methylphosphonate linkage.
SUBSll~Ul~SHEr
W093/07295 PCT/US92/0~58
211989~
13
The term ~Triplex Oligomer Pair~ refers to first and
second Oligomers which are capable of reading a segment of
a single stranded nucleic acid, such as RNA or DNA, and
forming a triple helix structure therewith.
The term "Third Strand Oligomer" refers to Oligomers
which are capable of reading a segment of a double
stranded nucleic acid, such as a DNA duplex or a DNA-RNA
duplex, and forming a triple helix structure therewith.
The term "complementary," when referring to a Triple
Oligomer Pair or first and second Oligomers (or to a Third
Strand Oligomer), re~ers to Oligomers having base
sequences which hydrogen bond (and base pair or hybridize)
with the base sequence of a single stranded nucleic acid
(or to a nucleic acid duplex for the Third Strand Oligo-
mer) to form a triple helix structure.
In the various Oligomer sequences listed herein "p"
in, e.g., as in ApA represents a phosphodiester linkage,
and "~" in, e.g., as in C~G represents a methylphosphonate
linkage. Also, notation such as "T" indicates nucleosidyl
groups linked by methyl phosphonate linkages.
The term "read" refers to the ability of a nucleic
acid residue to recognize through hydrogen bond inter-
actions and base sequence of another nucleic acid. Thus,
in reading a single stranded DNA sequence, a corresponding
base of each Triple Oligomer pair Oligomer is able to
recognize through hydrogen bond interactions the corres-
ponding base of the segment of a single stranded DNA and
form a triplet therewith.
The term "triplet" refers to a situation such as that
depicted in Figures lA, lB; 2A to 2D and 3A to 3C, wherein
a base of each of the first and second Oligomers has
hydrogen bonded (and thus base paired) with the corres-
ponding base of the target segment of single stranded DNA
or RNA.
~SHEr
W093/07295 PCT/US92/0~58
211989~
14
Brief Descr~etion of the Drawinas
Figures lA and lB depict triplets wherein two pyrimi-
dine bases forms a triplet with a central purine base.
Figures 2~ to 2D depict triplets wherein a purine
base and a pyrimidine base forms a triplet with a central
purine base.
Figures 3A to 3C depict triplets incorporating ana-
logs of G or A.
Figures 4A to 4E depict the base sequences of exem-
plary mixed sequence triple helix structures wherein oneof the Triplex Oligomer pair "reads" across the two other
strands and, thus, base pairs with purine bases on both
other strands.
Figure 5 depicts a nucleosidyl unit having a modified
sugar moiety with an alkyleneoxy link for lengthening
internucleoside phosphorus lin~ages and processes for its
preparation.
Figure 6 depicts a nucleosidyl unit having a modified
sugar moiety with an alkylene link for lengthening inter-
nucleoside phosphorus linkages and processes for its
synthesis.
Figure 7 depicts CD spectra of triple helix struc-
tures, (-) depicts a MP-Oligomer Third Strand, (---)
depicts an Oligonucleotide Third Strand.
Figures 8A and 8B depict cross-linking of (A) single
8tranded DNA and (Bj double stranded DNA using psoralen-
derivatized MP-Oiigomers.
Figures 9A to 9E depict CD spectra. Figures 9A
depicts CD spectra of oligomers I (-) and II (---) in
buffer A in room temperature and III (-~-) in buffer B at
room temperature. Figure 9B depicts CD spectra of I-II,
2:1 at room temperature in buffer A (-) and buffer B
~ ). Fiqure 9C depicts the CD spectrum for 1:1 I-II
(-) and a calculated CD spectrum derived from 1/2 ~I-II
3S (2:1 + II] (----) in buffer A at room temperature. Figure
9D depicts CD spectra of II-III (1:1) + I (-), I (---),
II-III (- -), and a summation of the spectra of II-III and
,
WO93~0729s PCT/US92/0~58
211989
I, all in buffer A in room temperature. Figure ~E depicts
CD spectra of II-III (1:1) + I in buffer A at room temper-
ature (-~ and at 3C (-----) and in buffer C at room tem-
perature (----) and at 3C (-- - --).
Figure 10 depicts autoradiograms of polyacrylamide
gel electrophoresis patterns: Lane 1, II; Lane 2, III-II
(2:1); Lane 3, I-II (2:1); Lane 4, III; Lane 5, III-II
(1.5:1); Lane 6 I-~I-III (1.5:1:1.5). In Lanes 1 to 3, II
labelled by 32p, and in Lanes 4 to 6, III labelled by 32p,
were used as radioactive marks.
Figures llA and llB depict W melting/annealing pro-
files of I-II-I. Figure llA depicts the normali'zed hyper-
chromity changes and Figure llB the ratio of the hyper-
chromicity changes, for dissociation (-) and association
1 5 ( ~~~~ ) -
Figure 12 depicts CD spectra of 2'-O-methyl (piCU) 8-
r(AG)8, 2~ ), and 2'-O-methyl (piCU)8 d(AG)8 (----) at
room temperature.
Figure 13 depicts a melting curve for 2'-0-methyl
(p~CU)~-r(AG)8 (2:1).
Figures 14A and 14B depict breakpoints in mixing
curves for d(AG) 8 I d(CT) 8 and d(AG)8 ~ d(CT)8-
; Figures lSA-lSD depict CD spectra. Figure lSA
depicts CD spectra for d(AG)8-d(CT)8, 1~ ) and d(AG)8
single strand (---). Figure 15B depicts d(AG)8-d(CT)8, 2:1
(-), calculated spectrum from a weighted average of duplex
and single strand (----). Figure 15C depicts CD spectra
for d(~)8-d(CT)8, 1:1 (-), d(AG)8 single strand (---),
d(CT)8 single strand (--~ ). Figure lSD depicts CD
spectra for d(AG)8-d(CT)8, 2:1 (-) and calculated spectrum
from a weighted average of duplex and single strand (---).
Figures 16A-16C depict thermal denaturation curves
for d(AG)8-d(CT)8, 1:1, (16A); d(AG)8-d(CT)8, 1:1 (16B) and
d(~)8-d(CT)8, 2:1, (16C).
Figure 17 depicts an autoradiograph of a native poly-
acrylamide gel, having gamma t32P] end labelled d(CT) R
(lanes 1 to 12) and d(AG) 8 ( lanes 13 to 17).
- ` SlJBSlllUTESHEEr
W093/07295 PCT/US92/0~58
8 9 ~ 16
Figure l~A depicts hydrogen ~onded NH-N resonances
for d(AG) 8- d(CT) 8 mixtures, 1:1 and 2:1.
Figure 18B depicts temperature dependence of the
chemical shift for the three resonances observed for the
2:1 mixture of Figure 18A.
Detailed Descri~tion of the Invention
The present invention involves the formation of
triple helix structures with a selected target single
stranded nucleic acid sequence by contacting said nucleic
acid with a first and second Oligomers, the Triplex Oligo-
mer Pair, which are selected having nucleoside sequences
such that they form a triple helical (or helix) complex
with the target sequence.
(A) General Aspects
In addition to other aspects described herein, this
invention includes the following aspects.
A first aspect concerns the reading (or recognition)
of the bases in a single stranded nucleic acid segment,
through hydrogen bond formation by the bases in the first
and second Oligomers using the extra hydrogen bond sites
of purines such as adenine and guanine or analogs thereof.
In other words, in reading the base sequence in the single
stranded nucleic acid to give a triplet, there is always
a purine in the central position of the triplet ("central
purine"). The central purine base may be on the single
stranded target sequence, or if the target has a pyrimi-
dine base, it will be on one of the first or second Oli-
gomers. The triplet is formed through hydrogen bond
formation with the bases in the other two strands with the
remaining available hydrogen bonding sites of the central
purine base. Either purines (such as adenine (a), gua-
nine (b) or the adenine and guanine analogs described
herein), or pyrimidines (thymine (T), cytosine (c) or
cytosine analogs described herein may form hydrogen bonds
with the central purine.
SUBSllIUlE SHE~
W093/07295 2 1 1 ~ 8 9 0 PCT/US92/0~8
i) Adenine (A) in the central position of the
triplet is read or hydrogen bonded with A (or an A analog)
or T in the other strands.
ii) Guanine (G) in the central position of the
s triplet is read or hydrogen bonded with c (or a c analog)
or G (or a G analog) in the other strands.
In a preferred aspect of the present invention, the
phosphorus-containing bac~bone of the first and second
Oligomers comprise methylphosphonate groups as well as
naturally occurring phosphodiester groups.
The base planes of the purines and pyrimidines are
rigid, and the furanose ring only allows a small ripple
(about 0.5A above or below the plane). Thus, the confor-
mational state of the nucleoside is defined principally by
the rotation of these two more or less rigid planes, i.e.,
the base and the pentose, relative to each other about the
axis of the C'-l to N-9 or N-l bond. The sugar-base tor-
sion angle, ~, has been defined as ~the angle formed by
the trace of the plane of the base with the projection of
the C-l' to 0-1' bond of the furanose ring when viewed
along the C'-l to a bond. This angle will be taken as
zero when the furanose-ring oxygen is antiplanar to C-2 of
the pyrimidine or purine ring and positive angles will be;~
taken as those measured in a clockwise direction when; ~ 25 viewing C-1' to N." This angle has also been termed the
glycosyl tors~on angle. Using the above definition, it
was concluded that there were two ranges of ~ for the
nucleosides, about -30 for the anti conformation and
about +150 for the syn conformation. The range for each
conformation is about +45. (22, 22a) Other researchers
have used or proposed slightly different definitions of
this angle. (23,24,25,26,27) Information concerning
has been obtained using procedures such as X-ray diffrac-
tion, proton magnetic resonance (PMR) and optical rotatory
dispersion-circular dichroism (ORD-CD). (22a)
In situations of double stranded nucleic acid tar-
gets, in order to accommodate the change of location of
' Sl.~lTr~llE SHEEr
W093/07295 PCT/US92/0~5X
0 18
the purine base to be read from one strand (termed the
"Watson strand") to the opposite strand (termed the "Crick
strand"), we have recognized that a particular conforma-
tion of the nucleoside, defined by the torsion angle of
the glycosyl bond, of the purine nucleosidyl unit in the
Third Strand is required in order that the purine nucleo-
side in the Third Strand can be used to read the purine in
the duplex. In other words, in order to read the purine
bases in the DNA, the conformations of the purine nucleo-
sidyl units in the Third Strand are influenced by thepolarity (parallel (5' to 3') or anti-parallel (3' to 5')
direction) of the strand containing the pùrine bases to be
read in the DNA in relation to the Third Strand. For the
purine nucleosidyl units in the Third Strand, reading the
purine in the parallel strand in the duplex, the conforma-
tion of the purine nucleosidyl unit in the Third Strand
should be in the ~Ya conformation. On the other hand, the
conformation of the purine nucleosidyl unit in the Third
Strand in reading the corresponding purine in the anti-
parallel strand in the duplex, should exist in anti con-
formation. Thus, in reading the purine bases in the
duplex distributed in both strands, one has the choice of
using a Third Strand which has the same polarity as (i.e.,
is parallel to) either one strand or the opposite strand.
As an example,
5' 3'
G C (these 2 strands
I I are anti-parallel
C G to each other)
1 l
T A
A T
3' 5'
(Watson strand) (Crick strand)
The sequence of the Third Strand in the triplet with the
DNA duplex having the same polarity of the Watson strand
from 5' to 3' would be as follows:
W093/0729~ 2 1 1 9 8 9 ~ PCT/US92/0~58
19
5 I G~yn
G~
A~
1~
3' (the Third Strand parallel
to the Watson strand
The sequence of a Third Strand parallel to the Crick
strand would be as follows:
G~ 3'
G~n
A'~
5' (the Third Strand
parallel to the
Crick strand
A~cording to one aspect of this invention, in con-
structing the Third Strand for reading the purines in the
base pairs of the duplex, the following guidelines apply:
25(i) Starting from the 5' end toward the 3' end, the
purine nucleosidyl units (A or G) of the Third Strand need
to be in syn conformation in reading the purines in the
base pair (A or G) of the parallel ("Watson") strand of
the double stranded nucleic acid. In reading the second
purine in the tsecond base pair, the same requirement
applies if the purine is located in the same strand as the
first purine. However, if the second purine is located in
the opposite anti-Parallel (~'Crick") strand (now the oppo-
site strand is anti-parallel to the Third Strand), the
purine nucleosidyl unit needs to be in anti conformation.
In all cases, adenine in the Third Strand is used to read
adenine in the duplex and guanine in the Third Strand is
used to read guanine in the duplex.
A third aspect of this invention concerns the length
of the linkage of the phosphorus backbone of the Third
Strand to allow reading of the purine bases on either
strand of the double stranded nucleic acid. In order to
S~JBSmUlESHEr, .
wo93/o72~s PCT/US92/0~58
?,i~l9890
be able to "read~ (or base pair) with purine bases on
either strand, the distance between nucleosidyl units
along the phosphorus backbone must be increased. Two
types of lengthening link formats for the phosphorus
backbone are proposed. One type of link format for the
phosphorus backbone would use a universal lengthening link
on the individual nucleosidyl units, i.e., all the
lengthening links of the Third Strand would be the same.
Such a universal link format is particularly suitable for
Third Strands comprising only purine bases. Accordingly,
the length of the link between the 5' carbon of the
"nucleosidyl unit one" to the 3' oxygen of the subsequent
"nucleosidyl unit two" may be increased by two atoms (such
as -CH2CH2-) or by 3 atoms (such as -O-CH2-CH2-), thereby
lengthening the linkage between individual nucleosidyl
units by 2 to 6A. In order to allow an appropriate dis-
tance between nucleosidyl units, we recommend that separa-
tion of the units be increased by a number of atoms rang-
ing from 1 to 6. Figure 6 illustrates an example of a
nucleosidyl unit comprising this lengthening link format
and proposed synthetic routes.
A second lengthening link format for the phosphorus
backbone would comprise non-uniform lengthening links.
Links having internucleosidyl distances on the order of
the standard phosphodiester backbone for the Third Strand
would be employed when the purines being read were on the
same strand, while a lengthened link (15-17A in length)
which could comprise lengthening links on the 3' carbon of
one nucleosidyl unit and on the 5'- carbon of its neigh-
bor, would be employed to read the purine bases located onopposite strands. Such a non-uniform lengthening link
format would be particularly suitable for use in Third
Strands comprising both pyrimidine (or pyrimidine analog)
and purine bases.
SUBSTllUrE S~EF
W093/07295 PCT/US92/0~58
2119890
(B) Formation of ~E~e ~elix Structures
(1) Tripl~et lgE~3i~le-Stranded) base airina
Figure lA depicts a triplet ha~ing a central A base
which is hydrogen bonded to a T on either side. In such
circumstances, one T-containing strand is aligned parallel
to the A-containing strand and the other T-containing
strand is aligned antiparallel to the A-containing strand.
Accordingly, the sequence for that triplet is written as
foll~ws.
Figure lB depicts a triplet having a central G which
is hydrogen bonded to a protonated C on one side and a C
on the other side. In such a circumstance, one of the
Triplex Oligomer pair has a cytosine protonated at N3 in
order to form hydrogen bonds necessary for a stable trip-
let. Optionally, that base may be replaced by a cytosine
analog having a nitrogen bearing a proton at a position
analogous to N-3. In the triplet depicted, the strand
containing C+ (or its analog) is aligned parallel to the
central G-containing strand. The C-containing strand is
aligned antiparallel to the central G-containing strand.
Su8slm~E ~EEr
WO93/0729s PcT~uss2to~s8
2l t9~90 22
Accordingly, such a triplet sequence is written as
follows:
r ~ ~ ^
Figure 2A depicts a triplet wherein the central A
forms a hydrogen bond with an A on one side ("side A") and
a T on the other. The strand containing the -side A is
aligned parallel to the strand containing the central A.
The strand containing the T is aligned anti-parallel to
the strand containing the central A. In such a circum-
stance, the glycosyl (~-N) torsion angle of the side A is
in the sYn conformatisn and the glycosyl torsion angles of
the central A and the T bases are both in the anti confor-
mation. Such a triplet sequence is written as follows:
- A
Figure 2B also depicts a triplet where a central A
f~rms a triplet with an A one side and a T on the other.
In this triplet the strand containing the side A is
aligned anti-parallel to the strand containing the central
A. The strand containing the T is aligned parallel to the
strand containing the central A. In such circumstance,
SUBSllTU~E SHg~ `
Wos3/072ss 2 1 ~ ~ g 3 0 PcT/US92/0~58
all three bases are in the anti conformation. Such a
triplet sequence is written as follows:
~A
Figure 2c depicts a triplet having a central G hydro-
gen bonded to a G on one side ~side G") and a C on the
other. The strand containing the side G is aligned
parallel to the strand containing the central G and the
strand containing the C is aligned antiparallel to the
strand containing the central G. In such circumstance,
the glycosyl torsion angle of the side G is in the svn
conformation and the glycosyl torsion angles of the cen-
tral G and the C are both in the anti conformation. Such
a triplet sequence is written as follows.
Figure 2D also depicts a triplet where a central G is
hydrogen bonded to a G on one side and a C on the other
side. In this example, the strand containing the side G
is aligned anti-parallel to the strand containing the
central G and the strand containing the C is aligned anti-
parallel to the strand containing the central G. In such
circums~ance, the glycosyl torsion angles for all three
SUBSll~UlE SHEEl
W093/0729~ 24 PCTtUS92/0~58
bases are in the anti conformation. Such a triplet
sequence is written as follows:
211989U ~r ~
Figures 3A and 30 depict a trlplet wherein a cen-
tral G is hydrogen bonded to a modified G on one side and
a C on the other side. The strand containîng the modified
G, either 2-amino-9-~-~-ribofuranosyl purin-6-selene
("6-selenium guanosine) in Figure 3A or 6-isopropyledene-
7-deazaguanosine in ~igure 3B is aligned anti-parallel to
the strand, containing the central G and the strand con-
taining the C is aligned anti-parallel to the~strand
containing the central G. The triplet containing the
6-selenium guanosine is written as follows:
~ r~ r
~ ~- ~A
and.the triplet containing 6-isopropyledene-7-deazaguano-
sine is written as follows:
~ r ~
.
The reading of the modifie~d~Gain the third strand will be
much more specific by eliminating the 6-oxo group of
normal (i.e., unmodified) G in the triplex formation.
~ITUIE SHEr '
'
W093/0729~ 25 2 1 1 9 ~ ~ O PCT/US92/0~58
Figure 3c depicts a triplet wherein a central A 15
hydrogen b~nded t~ a modified A ( 2 -amino purine) on one
side and a T on the other side. The strand containing the
2-amino-purine is aligned parallel to the strand contain-
ing the central A and the strand containing the T isaligned anti parallel to the strand containing the central
A. Such a triplet sequence is written as follows:
'2a P A
It should be noted that in this triplet, Nl of 2-amino-
purine is accepting a proton from the 6-amino group of the
central A and that the 2-amino group of the 2-aminopurine
is donating a proton to the N7 of the central A. This
arrangement will induce the guanine base in the third
strand to form a hydrogen bond pair by donating a proton
from both N, H and the 2-amino group to the 6-oxo group
and N7 group of the central G in a successive triplet. In
this manner, A to A pairing should contain a donor and a
receptor arrangement from the third strand of A and the G
to G pairing should contain both donor arrangements from
the-third strand of G. Tbus, the reading of purines by
purines will be much more specific.
(2) Polv~urine Taraet Seouences
Wherein the single stranded nucleic acid comprises a
polypurine sequence, it can form triplets where that
strand provides the central purine of the triplets formed,
so that the target is completely sandwiched by the first
and second Oligomers. This Triplex Oligomer pair may both
comprise havin~ complementary polypyrimidine sequences or
alternatively one of the first and second Oligomers has a
polypurine seguence and one has a polypyrimidine sequence.
.
,
W093/0729s PCT/US92/0~58
.. ..
2 119 89~ 26
(3) Polypyrimidine Taraet Sequences
Where the single stranded target nucleic acid com-
prises a polypyrimidine sequence, that target nucleic acid
will not provide the central purine bases for triplet for-
mation. The first and second Oligomers which form thetriple helix structure with the single stranded target may
both comprise polypyrimidine sequence or alternatively,
one of the first and second Oligomers may have a poly-
purine sequence and the other a polypurine sequence.
Since the pyrimidine bases of the target may not provide
the central base of the triplets, an "open sandwich"
triple helix complex is formed wherein one of the Triplex
Oligomer Pairs provides the central purine ~ase of the
triplet. In order to decrease formation of duplex between
the Triplet Oligomer Pairs, it may be preferred that the
first and second Oligomers both comprise polypurine
sequences.
(4) Mixed Sequences
Mixed sequences are sequences wherein the selected
single stranded nucleic acid target sequence comprises
both pyrimidine and purine bases. The triplets formed
using the first and second Oligomers requires a central
purine base that can hydrogen bond to two other bases to
form a triplet. Accordingly, one of thé first and second
Oligomers must be able to "read" across the other two
strands. Examples of mixed sequences including appro-
priately first and second Oligomers are depicted in
Figures 4A to 4E.
Figure 4A depicts a mixed sequence wherein the Oligo-
mer which reads across the other two strands is pyrimi-
dine-rich.
Figure 4B depicts a mixed sequence wherein the Oligo-
mer which reads across the other two strands is purine-
rich.
35 ; Figures 4C, 4D and 4E depict mixed sequences which
reads across the Oligomer containing only purine bases.
- SUBSrlTUrE SHEr
W093/0729~ 2 1 1 9 8 9 ~ PCT/US92/0~58
27
~n Fiqures 4C to 4E, "s" denotes sYn and "a" denotes anti;
no superscript denotes,anti.
Where one of the first and second Oligomers must read
two strands across from one strand to the opposite strand
in order to base pair with a central purine base, it may
be advantageous to provide a lengthened internucleosidyl
phosphorus linkage by incorporation of the previously-
d~scribed backbone link formats into the phosphorus back-
bone which connects the sugar moieties of the nucleosidyl
lo units.
For example, an internucleosidyl linkage may be
lengthened by the interposition of an appropriate alkylene
(~ (CH2) n~) or alkyleneoxy (-(CH2) n~) lengthening link
between the 5'-carbon and the 5' hydroxyl of the sugar
moiety of a nucleosidyl unit or a similar link between the
3'-carbon and the 3'-hydroxyl. (See Figures 5 and 6.)
Where indicated, such lengthening links may be interposed
at both the 3'- and 5'- carbons of the sugar moiety.
Where consecutive central purines used in triplet
formation occur on the same strand, such lengthening links
need not be employed; internucleosidyl phosphorus linkages
such as methylphosphonate linkages allow an appropriate
' base on the other strands to read consecutive central
purine bases on,the same strand.
Accordingly, by employing such lengthening links
where indicated, Oligomers which are capable of reading
central purine bases either of'the single stranded target
or of the other Oligomer, may be prepared.
(C) First and Second Oliqomers
' 30 Preferred are f irst and second Oligomers having at
least about 7 nucleosides, which can be a sufficient num-
ber to allow for specific binding to a desired sequence of
a selected target segment` of single stranded DNA or RNA.
More preferred are Oligomers having from about 8 to about
40 nucleosides; especially preferred are Oligomers having
from about lO to about 25 nucleosides. Due to a combina-
W093/07295 PCT/US92/0~58
211989~
tion of ease in synthesis, specificity for a selected
target sequence, coupled with minimization of intra-
Oligomer, and internucleoside interactions such as folding
and coiling, it is believed that Oligomer~ having from
about 12 to about 20 nucleosides comprise a particularly
preferred group.
(1) Preferred Oliqomers
These Oligomers may comprise either ribosyl moieties
or deoxyribosyl moieties or modifications thereof. How-
ever, due to their easier synthesis and increased stabil-
ity, Oligomers comprising deoxyribosyl or modified ribosyl
moieties (such as 2'-0- methyl ribosyl moieties) are
preferred.
Although nucleotide Oligomers (i.e., having the phos-
phodiester internucleoside linkages present in naturalnucleotide Oligomers, as well as other oligonucle~tide
analogs) may be used according to the present invention,
preferred Oligomers comprise oligonucleoside alkyl and
arylphosphonate analogs, phosphorothioate oligonucleoside
analogs, phosphoro-amidate analogs and neutral phosphate
triester oligonucleoside analogs. However, especially
preferred are oligonucleoside alkyl- and aryl-phosphonate
analogs in which phosphonate linkages replace one or more
of the phosphodiester linkages which connect two nucleo-
sidyl units. The preparation of some such oligonucleo-
sidyl alkyl and arylphosphonate analogs and their use to
inhibit expression of preselected single stranded nucleic
acid sequences is disclosed in U.S. Patent Nos. 4,469,863;
4,511,713; 4,757,055; 4,507,433; and 4,591,614, the dis-
closures of which are incorporated herein by reference.A particularly preferred class of these phosphonate ana-
logs are methylphosphonate Oligomers.
Preferred synthetic methods for methylphosphate
Oligomers t"MP-Oligomers") are described in Lee, B.L.,
et al., Biochemistry 27:3197-3203 (1988), and Miller,
SUBS~rUrESH Er '
WO 93/07295 2 1 1 ~ 3 ~ ~ P~/US92/08458
P . S ., et al ., Biochemistry 25 : 50g2-5097 ( 1986), the dis-
closures of which are incorporated herein by reference.
Preferred are oligonucleosidyl alkyl- and aryl-
phosphonate analogs wherein at least one of the phospho-
diester internucleoside linkages is replaced by a 3'-5'
linked internucleoside methylphosphonyl (MP) group (or
''methylphosphonate~). The methylphosphonate linkage has
a bond length similar to the bond length of the phosphate
groups of oligonucleotides. T~us, these methylphosphonate
Oligomers ("MP-oligomers") should present minimal steric
restrictions in the interaction with selected nucleic acid
sequences. Also suitable are other alkyl or aryl phospho-
nate linkages wherein such alkyl or aryl groups do not
sterically hinder the phosphonate linkage or interact with
each other. These MP-Oligomers should be very resistant
to hydrolysis by various nuclease and esterase activities,
since the methylphosphonyl group is not found in naturally
occurring nucleic acid molecules. Due to the nonionic
nature of the methylphosphonate linkage, these MP-oligo-
mers should be better able to cross cell membranes andthus be taken up by cells. It has been found that certain
MP-Oligomers are more resistant to nuclease hydrolysis,
are taken up in intact form by mammalian cells in culture
and can exert specific inhibitory effects on cellular DNA
and protein synthesis (See, e.g., U.S. Patent
No. 4,469,863).
Preferred are MP-Oligomers having at least about
seven nucleosidyl units, more preferably at least about 8,
which is usually sufficient to allow for specific recogni-
tion of the desired segment of single stranded DNA or RNA.More preferred are MP-Oligomers having from about 8 to
about 40 nucleosides, especially preferred are those
having from about 10 to about 25 nucleosides. Due to a
combination of ease of preparation, with specificity for
a selected sequence and minimization of intra-Oligomer,
internucleoside interactions such as folding and coiling,
SUBSmUlE SHEEI
W093/07295 PCT/US92/0~58
21I particularly preferred are MP-Oligomers of from about
12 to 20 nucleosides.
Especially preferred are MP-Oligomers where the
5'-internucleosidyl linkage is a phosphodiester linkage
and the remainder of the internucleosidyl linkages are
methylphosphonyl linkages. Having a phosphodiester link-
aqe on the 5'-end of the MP-Oligomer permits kinase label-
ling and electrophoresis of the Oligomer and also improves
its solubility.
The selected single stranded nucleic acid sequences
are sequenced and MP-Oligomers complementary to the purine
sequence are prepared by the methods disclosed in the
above noted patents and disclosed herein.
These Oligomers are useful in determining the pre-
sence or absence of a selected single stranded nucleicacid sequence in a mixture of nucleic acids or in samples
including isolated cells, tissue samples or bodily fluids.
These Oligomers are useful as hybridization assay
probes and may be used in detection assays. When used as
probes, these Oligomers may also be used in diagnostic
kits.
If desired, labelling groups such as psoralen, chemi-
luminescent groups, cross-linking agents, inter-calating
agents such as acridine, or groups capable of cleaving the
targeted portion of the viral nucleic acid such as molecu-
lar scissors like o-phenanthrolinecopper or EDTA-iron may
be incorporated in the MP-Oligomers.
These Oligomers may be labelled by any of several
well known methods. Useful labels include radioisotopes
as well as nonradioactive reporting groups. Isotopic
labels include 3H, 35S, 32p, t~I, Cobalt and 14C. Most
methods of isotopic labelling involve the use of enzymes
and include the known methods of nick translation, end
labelling, second strand synthesis, and reverse trans-
cription. When using radio-labelled probes, hybridization
can be detected by autoradiography, scintillation count-
ing, or gamma counting. The detection method selected
SUBSmUlE SHEr
W093/07295 ~ 8 9 0 PCT/US92/0~58
will depend upon the hybridization conditions and the
particular radioisotope used for labelling.
Non-isotopic materials can also be used for label-
ling, and may be introduced by the incorporation of modi-
fied nucleosides or nucleoside analogs through the use ofenzymes or by chemical modification of the Oligomer, for
example, by the use of non-nucleotide linker groups. Non-
isotopic labels include fluorescent molecules, chemilumi-
nescent molecules, enzymes, cofactors, enzyme substrates,
haptens or other ligands. One preferred labelling method
includes incorporation of acridinium esters.
Such labelled Oligomers are particularly suited as
hybridization assay probes and for use in hybridization
assays.
When used to prevent function or expression of a
single-stranded nucleic acid sequence, one or both of
these Oligomers may be advantageously derivatized or
modified to incorporate a nucleic acid modifying group
which may be caused to react with said nucleic acid and
irreversibly modify its structure, thereby rendering it
non-functional. Our co-pending patent application, U.S.
Serial No. 924,234, filed October 28, 1986, the disclosure
of which is incorporated herein by reference, teaches the
derivatization oP Oligomers which comprise oligonucleoside
alkyl and arylphosphonates and the use of such derivatized
oligonucleoside alkyl and arylphosphonates to render
targeted single stranded nucleic acid sequences non-
functional.
A wide variety of nucleic acid modifying groups may
be used to derivatize these Oligomers. ~ucleic acid modi-
fying groups include groups which, after the derivatized
Oligomer (or Oligomers) forms a triple helix structure
with the single stranded nucleic acid segment, may be
caused to form a covalent linkage, cross-link, alkyiate,
cleave, degrade, or otherwise inactivate or destroy the
nucleic acid segment or a target sequence portion thereof,
SU13ST~SHEEr
W093/07295 PCT/US92/0~58
32
and thereby irreversibly inhibit the function and/or
expression of that nucleic acid segment.
The location of the nucleic acid modifying groups in
the Oligomer (or Oligomers) may be varied and may depend
on the particular nucleic acid modifying group employed
and the targeted single stranded nucleic aci~ segment.
Accordingly, the nucleic acid modifying group may be
positioned at the end of the Oligomer or intermediate the
ends. A plurality of nucleic acid modifying groups may be
included. Also both of the first and second Oligomers may
include nucleic acid modifying groups.
In one preferred aspect, the nucleic acid modifying
group is photoreactable (e.g., activated by a particular
wavelength, or range of wavelengths of light), so as to
cause reaction and, thus, cross-linking between the Oligo-
mer and the single stranded nucleic acid.
Exemplary of nucleic acid modifying groups which may
cause cross-linking are the psoralens, such as an amino-
methyltrimethyl psoralen group (AMT). The AMT is advan-
tageously photoreactable, and thus must be activated by
exposure to particular wavelength light before cross-
linking is effectuated. Other cross-linking groups which
may or may not be photoreactable may be used to derivatize
these Oligomers.
Alternatively, the nucleic acid modifying groups may
comprise an alkylating agent group which, on reaction,
separates from the Oligomer and is covalently bonded to
the nucleic acid segment to render it inactive. Suitable
alkylating agent groups are known in the chemical arts and
include groups derived from alkyl halides, haloacetamides,
and the like.
Nucleic acid modifying groups which may be caused to
cleave the nucleic acid segment include transition metal
chelating complexes such as ethylene diamine tetraacetate
(EDTA) or a derivative thereof. Other groups which may be
used to effect cleaving include phenanthroline, porphyrin
or bleomycin, and the like. When EDTA is used, iron may
SUBS~IIUIE SHEr
wo g3/07295 2 1 1 9 ~ 9 0 PCT/US92/0~58
be advantageously tethered to the Oligomer to help gener-
ate the cleaving radicals. Although EDTA is a preferred
DNA cleaving group, other nitrogen containing materials,
such as azo compounds or nitreens or other transition
metal chelating complexes may be used.
The nucleosidyl units of a first or second Oligomer
which read purine bases on two strands to form a triplex
sequence may comprise a mixture of purine and pyrimidine
bases or only purine bases.
Where purine bases on two strands of a triplex
sequence are to be read, it is preferred to use a "read
across" Oligomer having only purine bases. It is believed
that such purine-only Oligomers are advantageous for sev-
eral reasons: (a) purines have higher stacking properties
15 than pyrimidines, which would tend to increase stability
of the resulting triple helix struc~ure; (b) uce of pur-
ines only eliminates the need for either protonation of
cytosine ~so it has an available hydrogen for hydrogen
bonding at the N-3 position at neutral pH) or use of a
20 cytosine analog having such an available hydrogen at the
; position which corresponds to N3 on the pyrimidine ring;
and allows use of a universal lengthening link.
The purine bases (and pyrimidine bases as well) are
normally in the ~n~i conformation; however, the barrier
25 ~or a base to roll over to the sYn conformation is low.
In formation of the third triple helix, the purines on th~ 2
Third Strand may assume the ~y~ conformation during th-
hydrogen bonding process. If desired, it is possible t
modify the purine so that it is normally in the svn cor ac
30 formation. For example, the purine may be modified at t1 in
8-position with a substituent such as methyl, bromo, is me
propyl or other bulky group so it will assume the ~ 25 al~
configuration under normal conditions. Nucleosidyl un
comprising such substituted purines would thus norma
35 assume the svn conformation. Accordingly, where a pu~
base in the syn conformation is indicated, the pre
invention contemplates the optional incorporation of
, ~SHEr '
W093/07295 2 1 ~ ~ ~ 9 ~ PCT/US92/0~58
~"~ ed purines in place of unsubstituted A or G.
Studies with Kendrew models indicate that suc~ substitu-
tions should not affect formation of the triple helix
structure.
Use of purine nucleosidyl units in the anti and sYn
conformations, as appropriate (following the rules for
reading the central purine bases described herein) allows
reading of the central purine ba~es on two strands and
formation of a triple helix structure by a purine-only
lo third ~trand.
If a Oligomer compri~ing both pyrimides and purines
is used to read purines on two strands of a triplex
~equence, a non-uniform link format is used, as described
herein, to allow the third str~nd (~read across Oligomer")
to read across from one of the two strands to the other.
~2) Preferred Purine Oliqomers
The present invention provides a novel class of pur-
ine Oligomers which comprise nucleosidyl units selected
from:
.C~B~ t-c~
Q~F~ R ~0~ \
wherein Bp is a purine base; R is independently selected
from alkyl and aryl groups ~uch that the phosphonate linX-
age is not sterically hindered and the groups do not
interact with each other; R' is hydrogen, hydroxy or
methoxy; and alk is alkylene of 2 to 6 carb.on atoms or z
alkylene of 2 to 6 carbon atoms.
SUBSlTrU~E SHEr
wo 93/072g5 2 1 1 9 8 9 0 Pcr/usg2~084s8
Preferred are Oligomers which comprise at least about
7 nucleosidyl units.
Preferred are nucleosidyl units where R is methyl.
Also preferred are nucleosidyl units wherein R' is hydro-
gen. Suitable bases Bp include adenine and guanine,either optionally substituted at the 8-position, preferred~
substitutions include methyl, bromo, isopropyl and the
like. Also according to another preferred aspect, pre-
ferred Oligomers which read central purine bases may
include purine analogs, modified to favor triplet forma-
tion and stability. These purine analogs include 6-selen-
ium guanosine or 6-isopropylidene-7-deazaguanosine in
place of guanosine or 2-amino purine in place of adeno-
sine. Preferred are alk groups having from about 2 to
3 carbon atoms. Particularly preferred are alk groups
having two carbon atoms, and include ethylene.
(3) Oliaomers Comprisina Cytosine AnaIoas
In another aspect of the present invention, novel
Oligomers are provided which comprise nucleosidyl units
wherein cytosine has been replaced by a cytosine analog
comprising a heterocycle which has an available hydrogen
at the ring position analogous to the 3-N of the cytosine
ring and i8 capable of forming two hydrogen bonds with a
guanine base in the duplex at neutral pH and thus does not
require protonation as does cytosine for Hoogstein-type
base pairing, or formation of a triplet.
Suitable nucleosidyl units comprise analogs having a
six-membered heterocyclic ring which has a hydrogen avail-
able for hydrogen bonding at the ring position correspond-
ing to N-3 of cytosine and which is capable of forming two
hydrogen bonds with a guanine base in the duplex at neu-
tral pH and include 2'-deoxy-5,6-dihydro-5-azadeoxycyti-
dine (I), pseudoisocytidine (II), 6-amino-3-(~-D-ribo-
furanosyl)pyrimidine-2,4-dione (III) and 1-amino-1,2,4-
(~-D-deoxyribofuranosyl)triazine-3-[4H]-one (IV), the
structures of which are set forth in Table 5.
~nnESHEEr
wo93/o72ss PCT/US92/0~58
2 119~ ga 36
(D) Preparation of MP-Oliqomers
(1) In General
As noted previously, the preparation of methylphos-
phonate oligomers has been described in u.s. Patent
Nos. 4,469,863; 4,507,433; 4,511,713; 4,ss~,614; and
4,757,055.
Preferred synthetic methods for methylphosphonate
Oligomers are described in Lin, S., et al., Biochemistry
28:1054- 1061 (1989); Lee, B.L., et al., Biochemistry
lQ 27:3197-3203 (1988), and Miller, P.S., et al., 25:5092-
5097 (1986), the disclosures of which are incorporated
herein by reference. Oligomers comprising nucleosidyl
units which comprise modified sugar moieties having
lengthening links (see Figures 5 and 6) may be conven-
iently prepared by these methods.
Oligomers comprising phosphodiester internucleosidylphosphorus linkages may be synthesized using any of sev-
eral conventional methods, including automated solid phase
chemical synthesis using cyanoethylphosphoroamidite pre-
cursors (29).
If desired, the previously-described nucleosidyl
units comprising cytosine analogs (see Table 5) may be
incorporated into the MP-Oligomer by substituting the
appropriate cytidine analog (see Table 5) in the reaction
mixture.
(2) ~çearation MP-Oligomers Havina Lenathenina Links in
the Phosphorus Backbone
(a) 5'-(EthyleneoxY)-Substituted-Suaar Intermediates
MP-Oligomers may be prepared using modified nucleo-
iides where either the bond between the 5'-carbon and the
5'-hydroxyl or the 3'-carbon and the 3'-hydroxyl of the
sugar moiety has been substituted with a alkyleneoxy
group, such as ethyleneoxy group.
Figure 5 shows proposed reaction schemes for prepa-
ration of intermediates for modified nucleosides havingeither a 3'-(ethyleneoxy) or 5'-(ethyleneoxy) link. In
SUE~Sm~SHEEr
W093/07295 PCT/US92/0~58
2 ~ 9 ~
Figure 5, B represents a base, Tr and R represent protect-
ing groups, Tr depicting a protecting group such as
dimethoxytrityl and R depicting protecting groups such as
t-butyldimethyl silyl or tetrahydropyranyl.
If desired, nucleosidyl units having such lengthening
links at both the 3'- and 5'-positions of the sugar moiety
may be prepared.
(b) 5'-~-Hydroxyethyl-Substituted Suaar Intermediate
In situations where a double stranded nucleic
sequence has purine bases on two strands to be read (i.e.,
both the target sequence and the first Oligomer), it may
be preferred to use Oligomers having a slightly lengthened
internucleoside link on the phosphorus backbone.
Such Oligomers may be prepared using nucleosides in
which the sugar (deoxyribosyl or ribosyl) moiety has been
modified to replace the 5'-hydroxy with a ~-hydroxyethyl
(HO-CH2-CH2-) group synthetic schemes for the preparation
of such a 5'-~-hydroxyethyl-substituted nucleosides is
depicted in Figure 6.
Figure 6 depicts a proposed reaction scheme for a
5'-~-hydroxyethyl-substituted sugar analog. In Figure 6,
-~- D~C denotes dicyclohexylcarbodiimide, DMSO denotes
dimethyl~ulfoxide. B is a base. Suitable protecting
groups, R, include t-butyldimethyl silyl and tetra-
hydropyranyl.
~c) Preparation of MP-Oliaomers Havina Lenatheninq Inter-
~ucleoside Links in the Phos~horus Backbone
MP-Oligomers incorporating the above-described modi-
fied nucleosidyl units are prepared as described above,
substituting the modified nucleosidyl unit.
In the preparation of Oligomers comprising only
purine bases, use of nucleosidyl units having the same
lengthening links may be employed. However, in the prep-
aration of Oligomers comprising both pyrimidine (or pyri-
midine analog) bases and purine bases, a mixture of
' ~æmUrESHEr
W093/07295 PCT/US92~0~58
2119890 38
nucleosidyl units having no lengthening link and lengthen-
ing links are used; nucleosidyl units having lengthening
links at both the 3~-carbon and the 5'-carbon of the sugar
moiety may be advantageous.
(3) Preparation of Derivatized MP-Oliaomers
Derivatized Oligomers may be readily prepared by add-
ing the desired DNA modifying groups to the Oligomer. As
noted, the number of nucleosidyl units in the Oligomer and
the position of the DNA modifying group(s) in the Oligomer
may be varied. The DNA modifying group(s) may be posi-
tioned in the Oligomer where it will most effectively
modify the target sequence of the DNA. Accordingly, the
positioning of the DNA modifying group may depend, in
large measure, on the DNA segment involved and its key
target site or sites, although such optimum position can
be readily determined by conventional techniques known to
those skilled in the art.
(a) Preparation of Psoralen-Derivatized MP-Oliaomers
The derivatization of NP-Oligomers with psoralens,
such as 8-methoxypsoralen and 4'-aminomethyltrimethyl-
psoralen (AMT), is described in Kean, J.M., et al.,;~
Biochemistry ~:9113-9121 (1988), and Lee, B.L., et al.,
Biochemistry ~:3197-3203 (1988), the disclosures of which
are incorporated herein by reference.
(b) Preparation of EDTA-Derivatized MP-Oliqomers
The derivatization of MP-Oligomers with EDTA is
described in Lin, S.B., et al., Biochemistry 28:1054-1061
(1989), the disclosures of which are incorporated herein
by reference.
(E) ~tilitY
According to the present invention, a specific seg-
ment of single stranded nucleic acid may be detected or
recognized using first and second Oligomers which form a
WO 93/07295 PCT'/US92/08458
21~90
triple helix with the single stranded nucleic acid accord-
ing to the triplet base pairing guidelines described
herein. The first and second Oligomers have sequences
selected such that a base of each nucleosidyl unit of each
Oligomer will form a triplet with a corresponding base of
the single stranded nucleic acid target to give a triple
helix structure. Detectably labeled Oligomers may be used
as probes for use in hybridization assays, for example, to
detect the presence of a particular single-stranded
lo nucleic acid sequence.
The present invention also provides a method of
preventing expression or function of a selected target
sequence of single stranded nucleic acid by use of first
and second Oligomers which hydrogen bond with and form a
triple stranded helix structure with ~he single stranded
target as described above. Formation of the triple
stranded helix may prevent expression and/or function by
modes such as preventing transcription, preventing of
binding of effector molecules (such as proteins), etc.
Thus, according to the present invention, the target
~equence of single stranded nucleic acid will be recog-
nized twice, or in two steps, (1) one time by duplex
formation by Watson-Crick base pairing with the first
Oligomer and (2) a second time by triplex formation with
the second Oligomer with or without an internucleosidyl
lengthening link between nucleosides of the second Oligo-
mer to allow the second Oligomer to read across strands.
In this manner, a high affinity complex is formed with a
high degree of selectivity. Derivatized Oligomers may be
used to detect or locate and then irreversibly modify the
target site in the nucleic acid by cross-linking (psora-
lens) or cleaving one or both strands (EDTA). By careful
selection of a target site for cleavage, one of the Oligo-
mers may be uæed as a molecular scissors to specifically
excise a selected nucleic acid sequence.
The Oligomers may be derivatized to incorporate a
nucleic acid reacting or modifying group which can be
SU~SHEEr
W093/07295 PCT/US92/0~58
2119~90
caused to react with the nucleic acid segment or a target
sequence thereof to irreversibly modify, degrade or
destroy the nucleic acid and thus irreversibly inhibit its
functions.
These Oligomers may be used to inactivate or inhibit
a particular gene or target sequence of the same in a liv-
ing cell, allowing selective inactivation or inhibition.
The target sequence may be DNA or RNA, such as a pre-mRNA,
an mRNA or an RNA sequence such as an initiator codon, a
polyadenylation region, an mRNA cap site or a splice func-
tion. These Oligomers could then be used to permanently
inactivate, turn off or destroy genes which produced
defective or undesired products or if activated caused
undesirable effects.
Another aspect of the present invention is directed
to a kit for detecting a particular single stranded
nucleic acid sequence which comprises first and second
Oligomers, at least one of which is a detectably labeled
purine MP-Oligomer Third selected to be able sufficiently
complementary to the target seguence of the single
stranded nucleic acid to be able form a triple helix
structure therewith.
To assist in understanding the present invention, the
following examples are included which describe the results
of a series of experiments, including computer simula-
tions. The following examples relating to this invention
should not, of course, be construed in specifically limit-
ing the invention and such variations of the invention,
now known or later developed, which would be within the
purview of one skilled in the art, are considered to fall
within the scope of the present invention as hereinafter
claimed.
SU8Sr~lUlESHEEr '
W093/07295 2 1 1 ~ ~ ~ O PCT/US92/0~58
Examples
Example 1
Computer Simulations of Tri~le Helix Structures
The primary purpose of these computer simulations was
to determine whether nonionic nucleotide analogs with a
methylphosphonate ("MP") backbone would bind with greater
affinity in comparison with unmodified oligodeoxynucleo-
tides ("ODN") as the Third Strand of the triple-stranded
helical DNA through Hoogsteen-type base pairing. Experi-
mental work suggested that ODN ~inding to duplex DNA andinhibition of transcription could be via triplet forma-
tion (8), but no experimental comparison had been made
between analogs with MP backbone verses native ODN in
formation of the triple-stranded DNA helix. It was pre-
viously unknown whether a nonionic analog with MP backbonecould be accommodated in the major groove of triple-
stranded helical DNA. Furthermore, the conformation of
fully solvated triple-stranded helical DNA with native or
MP backbone in the third strand had not been determined.
Site-specific oligonucleotide binding via double and
triple stranded DNA complex formation has recently been
shown to suppress transcription of human oncogenes
vitro (8, 9). The goal of this example was to use
molecular dynamics simulation to investigate nonionic
oligonucleotide analogs with MP backbone in triple-
stranded helical complexes, and to gain insight into the
molecular mechanism(s) involved in this process.
(A) Simulation Methods
Triple-stranded poly (dTIo) -poly (dA~o)-poly (dTIo)
tT,AT2] coordinates were obtained from the A-DNA x-ray
structure of Arnott and Selsing (lO). The same coordi-
nates were used for the starting geometry of poly(dT~o)-
poly (dAIo)-poly(dTl0) methylphosphonate [TIAT2MP]. Geometry
optimization and partial atomic charge assignments for the
dimethyl ester methylphosphonate fragment were calculated
by ab initio quantum mechanical methods with QUEST (ver-
S~SllrUlESHEr
W093/07295 PCT/US92/0~58
2119890
42
sion 1.1) using 3-21G* and STOG* basis sets, respec-
tively (11). The latter basis set was used to maintain
uniform charge assignments with those previously calcu-
lated for nucleic acids in the AMBER database. The final
monopole atomic charge assignments for the MP fragment
were made to obtain a neutral net charge fo~ each base,
furanose, and MP backbone of the third DNA strand. Alter-
nating Rp and Sp methyl substitution of the backbone
phosphoryl oxygens of the T2MP strand was done by stereo
computer graphics. The substitution of MP diastereomers
was made in this manner to approximate experimental yield,
since the synthesis cannot be controlled. Molecular
mechanics and molecular dynamics calculations were made
with a fully vectorized version of AMBER (version 3.1),
using an all-atom force field (12, 13~. All calculations
were performed on CRAY X-MP/24 and VAX 8600 computers.
The negative charge of the DNA phosphate backbone was
rendered neutral by placement of positive counterions
within 4 A of the phosphorus atoms bisecting the phosphate
oxygens; counterions were not placed on the MP-substituted
strand. The triple helices and counterions were sur-
rounded by a 10A shell of TIP3P water (14) molecules with
periodic boundary conditions. There are 9,283 and 10,824
atoms in the T~AT2 and TIAT ~ systems, respectively. The
box dimensions were 101, 686.8 A3 for TIAT2, and 124,321.1
A3 for TtAT~P. Initially, the DNA and counterion atoms
were fully constrained while the surrounding water mole-
cules were energy minimized using an 8.0 A nonbonded
cutoff until convergence (root mean-square trms] of the
gradient <0.1`kcal/mole/A). The DNA, counterions, and
water were subsequently energy minimized without geometric
constraints for an additional 1500 cycles, followed by
220 cycles of minimization with SHAKE activated (15).
Molecular dynamics using SHAKE at constant temperature and
pressure (300K and 1 bar) was carried out without con-
straints for 40 psec trajectories for each of the two
molecular ensembles.
~ .
SU~mUrESH~ ~
W093/07295 2 t 1 9 8 9 0 PCT/US92/0~58
43
(B) Results of Simulation Studies
The third DNA strand with MP backbone resulted in
several changes consistent with enhanced binding of the
ODN with the MP backbone in the triple helix. The average
hydrogen bond distances and mean atomic fluctuations are
consistently smaller in the TIAT~MP triplet (Table 1). The
interstrand phosphorus atoms distance was 9.6A (+/-0.91)
for A-T2 and 8.3A (+/-0.58) for A-T2MP. The reduced
interstrand phosphorus atom distance and smaller mean
atomic fluctua-tions between the second and third strands
are due to decreased interstrand electrostatic repulsion
accompanying MP substitution in the backbone.
Both triple helical DNA systems had strand-specific
polymorphic conformational behavior during molecular dyna-
mics. There are significant conformational changes in thefuranose relative to the starting geometry in both systems
(Table 2). In the TlAT2 helix the furanose ring popula-
tions of the Tl and T2 strands remained predominantly in an
A-DNA conformation (C3'endo) and the largest proportion of
the adenine sugars adopted a B-DNA conformation (C2'endo).
A notable percentage of the adenine furanose conformations
were in an 01'endo conformation in T~AT2 and TIAT2MP. The
sugar puckering pattern of the MP substituted helix had a~
greater proportion of 01'endo and C2'endo conformations in
contrast to the unsubstituted helix. Analysis of other
conformational parameters support the hybrid conforma-
tional nature of these triple helices. The helical twist
angle (between T1 and A strands) averaged 39.4 degrees
(+\-2.86) for the TtAT2 structure and is more consistent
with a B-DNA conformation (range 36-45). The T~AT2MP
helical twist angle averages 32.0 degrees (+\-2.19) and is
closer to that of A-DNA (range 30-32.7). The average
helical repeat sinqles (between the T1 and A strands) for
the entire structure are for 10.2 T~AT2 and 11.2 degrees
for TIAT2MP. The average intrastrand phosphorus atom
distances over the 40 psec trajectory are presented in
Table 3. In both helices, the intrastrand phosphorus
.
su~r~nE~Er ,
W093/07295 PCT/~S92/0~58
2t~ ~89~)
44
distances of the Tl strands are most consistent with an
A-DNA conformation (7.0 A). The interstrand phosphorus
distances of the T2MP strand are more consistent with a
B-DNA conformation, in contrast to values more consistent
with A-DNA for the T2 strand.
We analyzed the coordination of counterions and water
along the backbone of the DNA to determine t~e changes
accompanying MP substitution. The average coordination
distance and atomic fluctuations of the counterions with
phosphorus atoms was 3.8A (~\-0.6) for T~AT2 and 4.6A
(+\-0.9) for the T~AT2MP helix. The increase in average
coordination distance and atomic motion in TIAT2MP (by
0.8A) is most likely due to the proximity of Rp (axial
projecting) methyl groups to the counterions coordinated
to the second strand. The average number of water
molecules coordinated to the phosphate groups is not
significantly altered in the MP substituted helix.
The DNA backbone and the Cl'-N (base) dihedral tran-
sitions of the two helical systems are shown in Table 4.
Comparisons of the ~-dihedral of the adenine strands
reveals a slight change in the average position of the
dihedral with MP substitution, positioning the dihedral
closer to trans, but there is a large overlap in the,~
transitional motions of both dihedrals during the 40 psec
tra~ectory. There was a significant change (by 27.0
degrees) in the average Sp-MP diastereomer ~ dihedral
angle from baseline. The fluctuation of the ~ dihedral
containing the Sp-MP diastereomer was significantly less
than the Rp-MP.
(C) Interpretation of Simulation Results
The results of these molecular dynamics calculations
predict that an MP-substituted ODN incorporated as a
colinear third strand with Hoogsteen pairing will form a
more stable triple helical complex than a native ODN as
the third strand, as in the case of poly(dT)poly(dA)poly
(dT). The enhanced binding of the MP strand is due to
W093/07295 2 1 1 ~ 8 ~ O PCT/US92/0~58
reduced interstrand electrostatic repulsion. The MP-sub-
stituted helix has reduced hydrogen bond distances,
decreased interstrand A-T2 phosphorus distances, and less
fluctuation in atomic position relative to the native
triple helix. The closer fit and reduced atomic motion
durins molecular dynamics are qualitatively consistent
with a greater enthalpy of binding and stability of the
MP-substituted triple helical complex. These findings
support the MP-substitution of the third strand facili-
tates formation of a more cohesive triple helical struc-
ture by decreased interstrand phosphate repulsion, and
will secondarily have closer approximation of Hoogsteen
and Watson-Crick hydrogen bond interactions. One would
expect predominant effects on Hoogsteen pairing, but there
is an unexpected enhancement of Watson-Crick hydrogen
bonding with MP substitution in these calculations. The
latter finding is most likely due to decreased electro-
static repulsion and shielding (by the third strand)
between the T~ and T2MP strands.
The conformation of these DNA structures differs from
experimental data based on the fiber diagram. The struc-
ture of poly(dT)poly(dA)-poly(dT) was determined by x-ray
diffraction ætudies under conditions of 92% humidity, and,~
is a low resolution structure (10). The molecular dyna-
mics simulations are of fully solvatéd DNA structures
under periodic boundary conditions with counterions. DNA
in solution is generally believed to predominate in the
B-form; A-DNA conformation predominates under conditions
of lower humidity (16). Several triple-stranded DNA heli-
cal structures have been determined by x-ray diffraction
studies and have been uniformly observed in an A-DNA con-
f ormation under conditions of low humidity and increased
salt concen-tration (10,17,18). These computer simula-
tions predict that different DNA conformations coexist
within the triple helix, that the individual strands of
the helices have predominant conformational populations,
and that a Hoogsteen-paired, MP-substituted DNA strand is
8~SHEEr ' ~
WO93/072gS PCT/US92/~58
2119~ 46
predicted to predominate in the B-form. The large propor-
tion of 01' endo sugars in both triplexes is of interest
since this furanose conformation is 0.6 kcal/mole higher
than C2' endo and C3, endo DNA sugar puckers (16). The
DNA dodecamer crystal structure (19) has a notable 01'
endo population, and a significant proportion of 01' endo
sugar puckers were observed in molecular dynamics simula-
tions of dsDNA by Seibel et al. t20) Both helical struc-
tures generally follow the classical observations of pur-
ine nucleotides adopting C2' endo geometries and pyrimi-
dines adopting C3' endo geometries.
The large perturbation of the ~ dihedral and variable
conformational fluctuation of the Rp and Sp MP diastereoi-
somers in the triplet are due to nonbonded and hydrophobic
interactions. The Sp-MP groups are in close proximity to
thymine methyl groups (in the major groove) on the same
DNA strand, and interact by Van der Waals forces, which
could locally destabilize the helix by "locking" the thy-
mine to the Sp-MP backbone. There are greater deviations
in the ~ dihedral of the ~p-MP groups, since these groups
project out into the solvent water and are positioned
farther away from the thymine methyl groups. There is a
known relationship between the orientation of the methyl~
substituent on the phosphorus atom and DNA duplex stabil-
ity, and a proposed mechanism of reduced stability ofSp-MP diastereomers is due to local steric interactions
(21). Our calculations suggest that steric interactions
contribute very little toward local helix destabilization,
and the predominant mechanism is mediated by no~-bonded
interactions between the methyl groups of the Sp-MP back-
bone and thymine on the same strand which locally desta-
bilizes the DNA.
SUBSm U~E ~EEr ,
l W093/07295 2 1 1 9 ~ 3 ~ PCT/US92/0~8
Example 2
Detection of Triple Helix Formation Usina Circular ~ichro-
ism Spectroscopy
Circular dichroism spectroscopy studies were per-
formed using Triple Helix structures formed using a
combination following nucleoside oligomers.
I: d(CTCTCTCTC?CTCTCT)
abbreviated d(CT)8
E~ = 9.2 x 104 M-~ cm~~
II: d(AGAGAGAGAGAGAGAG)
abbreviated d(AG) 8
E~ = 1.45 x 105 ~I cm~l
III: d(CpT~C~T~C~T~C~T~CpT~C~T~C~T~C~Tp
abbreviated d(C~T) 8 or d(CT)8
E~ = 8.5 x 104 ~I cm-~
Circular dichroism (CD) spectra for the triple helix
structures made with (a) 2:1 d(CT)8 d(AG)8 and (b) 1:1:1
d(CT) 8 d(AG) 8 d(C~T~) 8 were performed using a CD spectro-
polarimeter in 0.1 M phosphate buffer at the indicated pH.
Figure 7 shows the CD spectra for triple helix
(a) [2:1 d(CT)8-d(AG)8 ( - ] and (b) [1:1:1 d(CT)8-d(AG)8-
d(CT)8( --- )].
- , ~
~xamPlÇ 3
Crosslinking of Triple Helix Structures Usinq Psoralen-
Deriya~ized MP-Oliaomers
Psoralen derivatized dTp(T) 6 oligomers were prepared
as described in Lee, B.L., et al., Biochemistry 27:3197-
3203 (1988).
The T7 oligomers were allowed to hybridize with DNA
having the following sequence including a 15-mer poly dA
subsequence:
5' 10 20 30 40 3'
d- TAATACGACTCACTATAGGGAGATTTTTTTTTTTTTTTACGAGCT
d- ATTATGCTGAGTGATATCCCTCTAAA~A~AAAAAAAA~TGCTCGA
3' 5'
SUBSllTU~E SHEr ~
WOg3/07295 PCT/US92/0~58
21198~0 48
MP-oligomers derivatized with 4'-(aminoethyl)amino-
methyl-4~5~8-trianethyl-psoralen ["(ae)AMT"], 4'-(amino-
butyl)-aminomethyl-4,5',8-trimethylpsoralen ["(ab)AMT"]
and 4'-(aminohexyl)aminomethyl-4,5'-8-trimethylpsoralen
["(ah)AMT"] were allowed to hybridize with (a) single
stranded DNA of the above DNA sequences and (b) double
stranded DN~ of the above sequence at 4C and were
irradiated to cause crosslinking as described in Lee,
et al.
Results are depicted in Figures 8A and 8B Figure 8A
shows crosslinking of the psoralen derivatized T7 Oligomers
with the single stranded (poly A containing) DNA sequence.
Figure 8B shows crosslinking of the double stranded
DNA with the double stranded DNA sequence.
TABLE 1
AVERAGED HYDROGEN BOND DISTANCES (RMS)
WATSON-CRICK WITHOUT MP WITH MP
APE HN6B - THY 04 2.33 (~/-0.31) 1.98 (+/-0.15)
ADE Nl - THY H3 2.10 (+/-0.17) 1.95 (+/-0.13)
20 HOOGSTEEN
ADE HN6A - THY 04 2.12 (+/-0.22) 2.09 (+/-0~19)
ADE N7 - THY H3 1.94 (+1-0.16) 1.92 (+/-0.12)
Averaged Watson - Crick and Hoogsteen hydrogen bond
distances (in Angstroms) in T~AT2 and T~AT2MP helices.
These distances are calculated for the triple helical DNA
complexes. The fluctuation in atomîc position (calculated
as the root-mean-square ~rms]) are in (A).
SUBSTIlUlES~
WO 93/07295 2 1 ~ 9 8 9 0 PCr/US92/0~58
l ~ ~
o ~ o o o o E~
... ... C:
, o ~ o ~ o o ~ .,,
Z o
H o
a ~p ~ ~
~ ~ ~ 0 ~ o
p~ - ~D ~` o ~ ,~ h
. ~ o ::~
O a d~ 0,O 0~O d~ 0,O '
E-~ ~ o ~
-
o ~ ~ Z
C~ Z ~0 0~ 0~o 0~O 0~O
~ 00 ~ 1 t~
3 - ~ o ~ ~
~ D ~ o O a~ O
~1 ~ ~ O ~ ~
_~ N '1 N ~ N NU a ,~5
+l +l +l ~1 +
- w ~1~ o ~ ~ o o, ~ ¢ c
o ` .~ ~
^~_ __ o o
~D t~ ~ ~ In tn
ooO oOo ~
... ... ~OtU
~ ~ oOo 000 X
O-- +1 +1 +1 ~1 +1 +1 U
, --
tn
OD 00 a~ o
~r ~ I
c ooo ooo ~ u -~
O ~1 ~
~ o
,¢ a
C~ Z ~ X S
~ ~n ~ O
U~ O ~
SUBSlllllrE SHEEt
W093~072ss PcT/uss2/o~58
2119~90
TABLE 3
AVERA~E INTRASTRAND PHOSPHATE A~OM DISTA~CE (RMS)
STRAND WITHOUT MP WITH MP
Tl 6.5 (+/0.28) 6.2 (+/0.31)
5A 7.0 (+/0.26) 7.1 ~+J 0.24)
T2 7.3 (+/0.29) 6.8 (+/0.26)
Intrastrand phosphate distances of TIAT2 and T~AT~P
helices. The calculated intrastrand phosphate distances
(in Angstroms) averaged over the 40 psec trajectory are
shown for the entire triple helical systems. Standard
interstrand phosphorus di~tances are 6.OA for A-DNA and
7.OA for B-DNA(15).
TABLE 4
Without MP With MP
a 03' - P - 05' - C5' `~
T1 280.5 (18.5) 288.4 (11.3)
A 252.9 (28.7) 233.2 (28.5)
T2 285.1 (11.6) 288.5 (11.3)
~ P - 05' - C5'. - C4'
T1 161.2 (11.5) 168.7 ( 8.7)
A 151.5 (10.7) 159.3 (21.5)
T2 140.8 ( 8.8) POR158.8 (21.9
POS167.8 ( 8.7)
Y 05~ - C5 - C4' -~3
Tl 70.6 (14.6j 62.6 ( 9.3)
A 104.8 (27.9) 112.3 (25.5)
T2 67.2 (10.5) 64.0 (10.4)
~ C5' - C4' - C3' - 03'
Tl . 90.3 (12.8) 82.5 (11.1)
3Q A 112.5 (16.7) 111.6 (17.2)
T2 88.6 (10.4) 104.5 (16.5)
~ C4 - C3' - 03' - P
T1 196.4 (lO.l) 199.1 (10.6)
A 200.1 (10.9) 198.0 (13.3)
T2 197.5 (10.5) 187.9 ( 7.8)
- SUBSllTUTE SHEr
W093/07295 2 1 1 9 8 9 ~ PCT/US92/0~58
51
TABLE 4 (Cont'd)
Without MP With MP
c3'_- 03' - P - 05'
~1 290.8 (10.6) 290.6 ( 9.6~
5 A 282.9 (12.0)282.0 (18.5)
T2 285.0 (10.5)280.s .(11.4)
PUR 01' - Cl~ - Ns - c4
ADE 215.3 (14.7)212.1 (14.2)
PYR
Tl 212.3 (11.0)205.9 (10.0)
T2 206.3 (10.7)213.9 (13.2)
Average backbone dihedral angles (rms) for the triple
helical DNA structures during the 40 psec trajectory.
,.
;~ .
- SUBSrl~UrE SHEr
.
WO93/0729~ s2 PCI/US92/08458
9 ~ CYTIDINE ANALOGS
Structure Reference (Pre~aration)
~ Goddard, A.J., et al.,
5 I I ~ Tetrahedron Letters
29:1767 (1988)
I ~ Beisler, et al., J. Med.
IIO O ~ Chem. 20:806 (1977)
. ~0
Doboszawske, B., et al., J.
~ ~ Org. Chem 53:2777
7~ ~ (1988);
~r'~`~ Woodcock, T.M., et al.,
~J Cancer Res. 40:4234
~o - `~' (1980)
0 Burchenal, J.H., et al.,
\ Cancer Res. 36:~520
/ (1976)
l~O
~ Winkley, M.W., et al. J.
20 ~ ~ ~ Chem Soc. (c), p. 791
~0 ~ 0~o '"~
~o 0~
From 1,2,4-triazine-3(4H)
/ -one (by reaction with
ammonium chloride or
ll* 11 by (a) nitrosating
25~ ~ tJ followed by (b) treat-
h ment with sodium
0 ~ borohydride)
'\
SUBSmUrE SJH~
W093/0729s 2 ~ ~ 9 g ~ PCT/US9Z/0~58
53
ExamPle 4
Formation of a Triple Helix Complex with a
Sinqle Stranded Polvdeoxypurine Nucleoside Tarqet
Formation of a triple helix complex using a d(AG) 8
single stranded target (II) was demonstrated using two
strands of an oligonucleotide analog containing 2'-0-
methyl-pseudoisocytidine (piC) and 2'-O~methyluridine (X)
in an alternated sequence (piC X)7 piCT (I). Formation of
a triple helix complex between a d(AG)g-d(CT)8 duplex
(II:III) and I was also demonstrated. (d(CT) 8 is repre-
sented by III.)
(A) General Methods
All chemicals were obtained from Aldrich Chemical Com-
pa~y, Inc. (Milwaukee, WI). Solvents were obtaîned from
Fisher Scientific Co. ~Pittsburgh, PA). TLC was performed
on a silica gel 60F2~ plates (Merck, West Germany) and
column chromatography on silica gel G60 (70-230 mesh,
ASMT, Merck). HPLC was performed on a Vista 5500 (Varian,
Sunnyvale, CA) with a PRP-l column (Hamilton, Reno, NV) or
Varian 5000 with ODS-3 column (Whatman, Clifton, NJ).
Radioactivity was counted on an LS 7500 liquid scintilla-
t-ion counter (Beckman, Columbia, MD). ;,
The following buffers were used in the CD, uv mixing
titration, melting/annealing, and geI electrophoresis
studies: buffer A, 0.01 M Na phosphate, 0.1 M NaCl, 0.01
mM EDTA p H7.2; buffer B, 0.02 M Na phosphate, 0.01 M
NaCl, S mM MgCl2; buffer C, O.01 M Na phosphate, 0.35 M
NaCl, 5 mM MgCl2, pH 7.2; buffer D, 0.06 M Tris borate,
5 mM MgCl2, 0.075 mM EDTA, pH 7.3.
(B) Synthesis of Nucleoside Analoqs and Oliqonucleotide
Analogs
X and piC were synthesized according to the reported
methods (30, 31, 32), and were converted to their corres-
ponding amidite synthons (33, 34). The oligo-nucleotide
I was synthesized on a DNA synthesizer ~either Milligen
SVBSlllUrE S~EEr
W093/0729~ PCT/US92/0~58
2119890
54
7500 or Applied Biosystem) according to the reported
methods (31, 32). After being deblocked and cleaved from
the solid support by conc. NH40H treatment, I with protect-
ing dimethoxytrityl (DMTr) groups was purified by HPLC.
Fractions were treated with 80% acetic acid solution to
deblock the DM~r group after which oligomers were purified
by HPLC. The purified oligomer I of this preparation
showed a single peak by HPLc analysis. Starting from
2 ~mole solid supporting material 2.5 o. D. units of I were
obtained.
(C) CD SpectroscoEy
CD spectra were obtained on a J-500A CD spectropo-
larimeter (Jasco, Japan). Sample temperature was con-
trolled by using a circulating water bath. The Oligomer
or the Oligomers were concentrated in vacuo, after which
the residues were dissolved in appropriate buffers, except
for the preparation of the I~ III sample. This mixture
was prepared by cooling a solution of II-III duplex in
buffer A on an ice bath, and then adding this solution
to I. The whole solution mixture was kept on an ice bath
for 30 minutes, and then kept at room temperature for
another 30 minutes. After CD spectra of this mixture were
measured, a con¢entrated salt solution was added to the
mixture to set the final salt condition as for buffer C,
then other spectra were measured. Sample temperature was
controlled by fluid circu~ating from a temperature regu-
lated water bath.
(D) Gel Electrophoresis
Gel electrophoresis experiments were conducted using
gels containing 15~ polyacrylamide in buffer D prepared in
a Bio-Rad Protean II gel apparatus with 20 x 22 cm glass
slabs and 0.75 mm spacers. The samples (5 ~L) were pre-
pared in buffer D with 3% glycerol and kept at room tem-
perature for 1 hr. except for the mixture of I and the
duplex II-III which was prepared by mixing 2.5 ~L of
s~slTru~E s~Er
W093/07295 2 1 1 9 ~ ~ ~ PCT/US92/0~58
duplex (II-III) solution and 2.S ~L of the third strand
(I) at 4C and then equilibrated at room temperature for
S minutes. Each sample contains an oligonucleotide
labeled by 32p at the 5'-end as a marker. Bromophenol blue
tracking dye (0.025%) was added to the samples containing
only a single oligonucleotide molecule. Experiments were
conducted at room temperature at 200 volts (5-10 mA) for
4 hrs. After electrophoresis was halted, the gels were
dried ~n vacuo, and autoradiogramed. In addition, bands
were also cut from the gel, and the radioactivities were
counted.
(E) W Mixinq Titration and Meltina/Annealina
W absorbance was measured by Varian DMS lOo and 219
spectrophotometers. Thermal profiles of melting/annealing
was monitored by the Varian 219 with a thermoregulated
sample compartment. Sample temperature was controlled by
fluid circulating from a temperature regulated bath moni-
tored with a calibrated thermistor probe inserted in a
"dummy" cuvette.
(F) Confirmation of Formation of Triple Helix Structure
~1) CD Spectral Studies
Formation of the triplex I:II:I was confirmed by CD
spectral studies. (See Figures lOA to E.) Figure 9A
depicts the CD spectra of the single stranded I, II and
III at pH 7.2. The CD spectrum of I:II (2:1) showed a
large negative band at 213 nm in 0.1 M NaCl (buffer A); a
similar spectrum was observed upon addition of 0.25 M NaCl
and 5 nM MgCl2~(buffer C). Such ~ spectrum has been shown
to be indicative of homopyrimidine-homopurine-homopyrimi-
dine triplex formation for the repeating dinucleotideæequences AG/CT in both polymer and oligomer systems
(Figure 9B) (35, 35).
Figure 9C depicts the CD spectrum of I:II mixture at
one to one ratio. Figure 9C does not show such a large
negative band in this wavelength range; however, this
SUBSrllUrE E~Er
W093/0729~ PCT/US92/0~58
211~890 56
spectrum is identical to a calculated spectrum derived
from the spectrum of one half of single stranded II and
the spectrum of one half of I:II (2:1). The o~served CD
spectrum indicates the 1:1 I:II mixture is one half I:II:I
triplex and one half single stranded II. Thus, this CD
study indicates that the I:II:I is favored over the I:II
duplex, even at stoichiometric ratios which would favor
duplex formation.
The magnitudes of the observed negative band at
213 nm of CD spectrum of the mixture of II-III duplex and
single stranded I in 0.1 M NaCl is similar to the calcu-
lated spectrum derived from a summation of the spectra of
II-III duplex and single stranded I in both room tempera-
ture and 3% (See Figures 9D and 9E). In the presence of
MgCl2 and higher NaCl concentration (buffer C), a larger
negative band was detected, which may indicate formation
of a I-II-III triplex. (See Figure 9E.)
(2) Detection of Triplexes ~y Gel Electro~horesis
Formation of I-II-I and I~ III triplexes can be
directly monitored by polyacrylamide gel electrophoresis
(30, 31) using different oligonucleotides labeled by 32p at
the 5'-end as markers. The result of two sets of experi-
ments are shown in Figure 10.
Using II labeled by 32p as a marker, the mobility of
single-stranded II is shown in lane 1. At the same condi-
tions, the mixture of II and III shows only one band in
spite of a one to two concentration ratio (lane 2). The
mobility of this band is less than that of II itself. Two
bands are detected in the mixture of II and I (lane 3)
again with a concentration ratio one to two. The band
with fastçr mobility can readily be recognized as the II-I
duplex. The slower band is the evidence of formation of
the I II-I triplex. It is interesting to note that only
one band is detected in lane 2, which i5 clear evidence
that the III-II-III triplex is not formed at these
conditions.
SUBS~ SHEEI
wo93/o729s 2 1 i 9 g ~ PCT/~S92/0~58
Lanes four to six in Figure 10 are the electrophore-
tic results when single-stranded III is labeled by 32p at
the 5'-end. The Mobility of III itself is shown in lane 4
as a reference. The mixture of III and II (1.5:1) is
shown in lane 5. The slower moving band has a comparable
mobility to the band observed in lane 2 leaving no doubt
as to the formation of the III-II duplex. The excess
amount of single stranded III is present as a faster
moving band which is identical to that in lane 4. This
confirms the results obtained from lane 2, namely, that no
III-II-III triplex is formed at neutral pH even in the
presence of MgCl2. On the other hand, the triplex I-II-III
is observed when a 1.5:1:1.5 mixture was electrophoresed
in lane 6. The three bands clearly correspond to triplex,
duplex, and single strand from top to bottom, respec-
tively, by comparison to bands observed in lanes 2 to 5.
In order to further prove that no III-II-III triplex was
formed, the bands in lanes 5 and 6 were cut from the gel
plate and counted. In lane 5, the ratio of radioactivi-
ties of duplex as single stranded III are about two to one(65:35). This result fits the original mixture ratio
(1.5:1) quite well. Namely, one unit of duplex is formed
and 0.5 unit of single stranded III remains. Therefore,~
no free II strand should be present in the II-III (1:1.5)
mixture. The counting results of lané 5 can now be used
as an internal reference for the same purpose in lane 6.
The radioactivity ratio of the slowest to fastest bands in
lane 6 is 42:23:35. The sum of triplex and duplex is
again 65% (42+23). Therefore, all II strands are again
involved in either triplex or duplex formation. Further-
more, the concentration of the duplex is 35% of the duplex
and triplex (23/(23+43)). Apparently, about one third
of II is involved in the duplex formation and the other
two thirds is involved in the formation of triplex.
Therefore, the observed triplex band must be due to the
formation of the III-III triplex and cannot be III-II-III.
It should be noted that these arguments rule out the for-
SUBSlmnE~ ,
W093/07295 PCT/US92/0~5~
211~890
58
mation of ~he I-II-I triplex by dismutation in the orig-
inal mixture.
(G) U~ i3g_~itration and Meltinq/Annealinq Studies
A W mixing titration of the I-II system in buffer A
was performed and monitored at 260 nm. Only one end point
at 67:33 stoichiometric ratio of I to II was observed.
This indicated the formation of the I~ I triplex.
Thermal profiles of melting and annealing processes for
the l-II-I triplex are shown in Figures llA and llB. Each
dissociation or association profile shows only one transi-
tion which can be tentatively attributed to the melting of
the triplex directly to the single strands or the forma-
tion of the triplex directly from the single strands
(based on results from uv mixing triation and CD spectra).
The transition for I-II-I triplex annealing was shifted to
a lower temperature (Tm = 66C) than that observed for
dissociation of the triplex (Tm = 66C~ than that observed
for dissociation of the triplex (Tm = 74C). No melting/
annealing experiment was performed on the I~ III triplex
system.
Exa~Pl~_5
Formati~ of a Triple Helix Structure With a Single
Stranded_Oligoribonucleoside Target
Formation of a triple helix structure using a single
stranded oligoribonucleoside target, r(AG)8, using two
Oligomers which comprise 2'-O~methyl(piC U) 8 was demon-
strated, as may be seen in Figures 12 and 13. CD spectra
and melting and annealing studies were performed as
described in Example 4, in 0.01 M Na phosphate, 0.1 M
NaCl, 0.01 mM EDTA, pH 7.2.
The observed CD spectrum differs from the additive CD
spectrum (see Figure 12), especially in the 210 nm region
which indicated triple helix formation.
The melting and annealing profile (see Figure 13)
indicated Tm of about 78-80C for the triplex.
SVBSlTrU~E SHEr
W093/07295 ~ 1 19 8 9 0 PCT/US92/0~58
59
Example 6
Formation of a Triple Helix Complex With a Sinqle Stranded
Polypyrimidine Oligodeoxyribonucl _tide as_a Target and
Polypurine Methyl~hosphonate Oligomers
Formation of a triple helix complex with a single
stranded d(CT) 8 oligonucleotide and two methylphosphonate
d(AG) 8 Oligomers was demonstrated.
Figure 14 depicts continuous variation in composi-
tions of W absorption measured at d (AG) 8 phosphodiester
and d(AG) 8 methylphosphonate homopurine oligomers with
d(CT) 8 at four wavelengths ( ) 280 nm, (-) 260 nm, (O)
254 nm, and (o) 235 nM. Total strand concentration was
2.4 ~m in 0.1 M Na' 0.01 M Po4'3, 10'5 M EDTA, pH 7Ø A
single end point at 1:1 purine:pyrimidine stoichiometric
ratio was observed for the interactions of the phosphodi-
esters d(AG) 8 and d(CT) 8 which indicated that only aWatson-Crick type duplex formed under these conditions.
Three end points were observed for the d(AT) 8 methylphos-
phonate and d(CT)8. At a 1:1 purine:pyrimidine stoichio-
metric ratio, a Watson-Crick type duplex was also
detecteq. The additional end points at 67:33 (2:1) and
33:67 (1:2) purine:pyrimidine ratios indicated formation
o~ purine:purine:pyrimidine and pyrimidine:purine:pyrimi -~
dine triple heliX complexes, respectively, in this system.
Figure 15 depicts observed CD spectra. The observed
spectrum for 2:1 d(~)t:d(CT)8 was very different from the
spectrum calculated by simpIe addition which indicated
triple stranded helical complex formation. The CD spectra
were run at 2QC in 0.1 M Na+, 0.01 M Po4-3, 10-5 M EDTA,
pH 8Ø Totai strand concentration was 4.8 ~M and the
was reported per mole of base residue.
Figure 16 depicts the TTm and melting profiles of
d(~)t:d(CT)8 1:1, d(AG)8:d(CT)8 2:1. The thermal dena-
turation profiles~for the Oligomer complexes were moni-
tored by W absorption hyperchromicity. Total strandconcentration was 4.8 ~m in 0.1 M Na+, 0.01 M P04-3, 10-5 M
E~TA, pH 8Ø For comparison purposes, each curve was
sussmurE SHEEr
W093/07295 PCT/US92/0~58
21~9~90
normalized to the to~al change in absorbance. The Tm for
d(AG)8:d(CT)8 1:1 was 50C. The Tm for d(AG)8:d(CT)8 1:1
was 53C. The Tm for d(AG)8:d(CT)8 2:1 was S1C. As may
be seen from the melting curves, the melting profile
S observed for the triplex was much more narrow or sharper.
This date suggested a simultaneous dissociation of duplex
and triplex, but that the transition of the triplex was
more homogeneous in thermal stability.
Figure 17 depicts the electrophoretic analysis of the
complexes in native polyacrylamide~gel. Figure 16 is an
auto-radiograph of a native 16% (29:1 bis) polyacrylamide
gel containing gamma [32p] end labelled d(C$) 8 ( lanes 1-12)
and d(~) 8 (lanes 13-17) and their complexes. The gel was
electrophoresed at four volts per CM for 30 hours at 5C
in 0.1 M NaCl, 0-04 M Tris, 0.01 M Po4'3, 1o-3 M EDTA, pH 8.0
with buffer recirculation to prevent pH changes. The
concentration of Oligomers in each lane is shown below the
stoichiometric ratio of the interacting strands. The
position of éach species with differential mobility is
indicated at the left the position of the origin and the
xylene cyanol and bromophenol blue marker dyes are indi-
cated by o, x and b, respectively. This gel clearly shows
the existence of the d(AG) 8 d(AG) 8 d(CT) 8 triplex and the
d(~)~-d(~)8-d(CT)8 triplex in 0.1 M NaCl at 5C.
Figure 18A depicts the hydrogen-bonded NH-N resonance
of a 1:1 and a 2:1 mixture of d (AG)8 and d(CT)8 at 300 MHz
in 0.1 M Na+, 0.01 M P043, 105 M EDTA, pH 8Ø Figure 17A
depicts spectra at 30C for 1:1 and 2:1 stoichiometric
mixtures of purine:pyrimidine Oligomers. Figure 188
depicts the temperature dependence of chemical shift for
the three resonances observed for the 2:1 mixture:
-~ Watson-Crick Gua NlH-Cyt N3 (-); Watson-Crick Thy N3H-
Ade Nl ( ); and new third strand hydrogen bonded imido
protons (~). The Watson-Crick assignments were tentative
and based on comparison to chemical shifts observed for
the d(AG) 8 phosphodiester duplex. These three resonances
were easily detected up to 60C. At 65C their inten-
.
SUBSIllUrESHEEr ~
W093/0729s PCT/US92/0~58
2119890
61
sities decreased dramatically, indicating that the hydro-
gen bonded complex had, in general, melted. The NH-N
resonance observed (in addition to those attributed to
Watson-Crick base pairing) at approximately 12 ppm was due
S to triplex formation. At high temperature, the triplex
was observed to directly disassociate into sinyle-stranded
form.
SUBSllTUlE SHEr ~
W093/07295 PCT/US92~0~58
21 1~89a 62
BIBLI0GRAPHY
1. Mosler, H.E., et al., Science 238:645-650 (1987).
2. Povsiz, T.J., et al., J. Am. Chem. Soc. 111:3059-3061
(1989).
3. Wells, R.D., et al., FASEB J. 2:2939-2949 (1988).
4. Dervan, P., Science 232:464-471 (1988).
5. Miller, P.S., et al., Anti-Cancer Drug Design, 2:117-
128 (1987).
6. Yarchoan, et al., "AIDS Therapies," Scientific
American, pp. 110-119 (October 1988).
7. Sarin, et al., Proc. Nat. Acad. Sci. (USA) 85:7448-
7451 (1988).
8. Cooney, M., et al., Science 241:456-459 (1988).
9. Wickstrom, E., et al., Proc. Nat. Acad. Sci. (USA)
85:1028-1032 (1988).
10. Arnoff, S., et al., J. Mol. Biol. 88:509-521 (1974).
11. Singh, U.C., et al., J. Comp. Chem. 5:129-145 (1984).
12. Singh, U.C., et al., AMBER (UCSF) Version 3.1 (1988).
13. Weiner, S.J., J. Comp. Chem. 7:230-252 (1986).
14. Jorgenson, W.J., et al., J. Chem. Phys. 79:926-935
(1983).
15. Berendsen, H.J.C., etj al., J. Chem. Phys. 81:3684-
3690 (1984).
16. Sanger, W., Frinciples of Nucle~c Acid Structure
(Springer-Verlag, New York, 1984).
17. Arnott, S., et al., N~ture 244:99-101 (1973).
18. Arnott, S., et al., Science 181:68-69 (1973).
19. Drew, H.R., et al., Proc. Nat. Acad. Sci. (USA)
78:2179-2183 (1981).
20. Seibel, G.L., et al., Proc. Nat. Acad. Sci. (USA)
82:6537-6540 (1985).
21. Bower, M., et al., Nucl. Acids Res. 1:4915_4930
(1987).
22. Donohue, J., et al. ! J. Mol. Bio. 2:363 (1960).
Sl~lllUlE 8HEE~. '
W093/07295 2 1 ~ 9 8 9 0 PCT/US92/0~58
.,
22a. Ts'o, P.O.P., Basic Princi~les in Nucleic Acid
Chemistry, pp. 453-584 (P.O.P. Ts'o ed., Academic
Press, New York, 1974).
23. Sundaralingham, N., Biopolymers 7:821 (1969).
24. Arnott, S., Proqr. Nucl. Acid Res. Mol. Biol. 10:183
tl970) -
25. Sasisekharan, V., et al., Conform. Biopolym., Pap.
Int. Symp. 1967, Vol. 2, p. 641 (1967).
26. Lakshminarayanan, A.V., et al., Biochem. Biophys.
Acta 204:49 (1970).
27. Lakshminarayanan, A.V., et al., Biopolymers 8:475 and
489 (1970).
28. Lee, B.L., et al., Nucl. Acids Res. 16:10681-10697
(1988).
29. Barone, A.D., et al., Nucl. ~cids. Res. 12:4051-4060
(1984).
30. Inoue, H., et al., Nucl. Acids. Res. 15:6131_6148
(1987).
31. Ono, A., et al., J. Am. Chem. Soc. 113:
(1991).
32. Ono, A., et al., J. Org. Chem. (1991), in press.
33. Beaucage, S.L., et al., Tetrahedron Lett. 22:1859-
1862 (1981).
34. Sinha, N.D., et al., Tetrahedron Lett. 24:5843-5846
(1983).
35. Lee, J.S., et al., Nucl. Acids Res. 6:3073-3091
(1979)-
36. Kan, J.S., et al., J. 8iolmol. Str. Syn., 911-933
(1991).
37. Kibler-Herzog, L., et al., Nucl. Acids. Res. 18:3545_
3s55 (1990).
38. Shea, R.G., et al., Nucl. Acids. Res. 18:4859_4866
(1990) .
SUBSlllUrE S~EE J
