Note: Descriptions are shown in the official language in which they were submitted.
'YO 93/14634 2i 3 ~ ~ 415 PCI`/US93/00839
PROTECTIVE EFF}5CT~ OF MUTATED SUPERANq~IGE~7;
FIELD OF T~IE INVEN$ION
S This invention relates to methods for preventing
and treating antigen-mediated and antigen-initiated
diseases. Specifically, it relates to providing
protection against superantigen pathogens by
administration of molecules which are modified or
mutated superantigens which elicit a antibody response
against the superantigen without having the
~athological effect of the superantigen. The molecules
of this invention may also interact with the V~
elements of T cell receptors in a way which leads to
modifications in the way T cells respond to an antigen.
: BAC~G~OUND OF ~E INVENTION
: The vertebrate immune system evolved to protect
vertebrates from infection by microorganisms and large
20~ parasites. ~:The immune system responds to antigens in
one of two ways: (l) humoral antibody responses,
médiated through B cells, involving the production of
: protein:antibodies which circulate in the bloodstream
: a~d bind sp~ecifically to the foreign antigen which
~ i~duced;them.: The binding of the antibody to the
; : : antigen makes it çasier for phagocytic cells to ingest
the antigen and~often~activates a system of blood
: proteins~:~co11ectively: called complemen~, that helps
~: ~ destroy the ~ntigen; and (2~ cell-mediated immune
responses, mediated through T cells, involving the
production~of specialized cells ~hat react mainly with
~ Poreign ~antigens~on:~the surface of host cells, either
;~; killing the host~cell: if the antigen is an infecting
:: virus or induc:ing other;host cells, such as
:35 macrophages,:~to:destroy the~antigen (Molecular Biology
of the CeIl ~1~83), B. Al~erts et al. ~eds), chapter
::
. 17, pp. 952).~ ~
The production of antibodies requires a number of
.~ preceding events to occur which lead to stimulation of
.
WO93/14634 PCT/US93/00~
~ 4~ -2-
B cells producing the antibodies. One of the key
even~s involved in the processes leading to antibody
production is that of antigen recognition. Antigen
recognition requires the participation of ~hymus (T)
cells.
T cells have antigen-specific receptors on their
surfaces, termed T cell antigen receptors ~TGR).
Before T cells can recognize protein antigens, the
antigens must be presented on the surface of antigen-
presenting cells~ The antigens must first be processedby macrophages or other antigen presenting cells.
These cells essentially swallow antigens and chop them
into peptides which are displayed at the cell surface
in combination with major histocompability complex
(MHC) molecules.
: The major histocompatibility antigens are a fam.ily
of an~igens encoded by a complex of genes called the
: major histocompa~ibility complex. ~HC antigens are
~xpr~ssed on the cells of all higher vertebrates. In
;: 20 man they are called HLA antigens ~human-leucocyte-
associated antigens) because they were first
demonstrated on léucocytes. There are two principal~
cl~sses o MHC mol~cules, class I and class II, each
comprising a:set of cell-surface glycoproteins. The
two classes of MHC antigens stimulat~ different
su~populations of T cells. MHC class Il molecules are
involved in most responses to pathogens. In contrast,
NHC class I molecules are invol~ed when the pathogen is
a ~iru5 or when a malignant cell is involved. When MHC
class I is involved, antibody stimulation does not
~ result; rather,: the interaction of MHC class I
: ~ ~ processed antigen and T~cell leads to lysis of cells
~: infected with the pathogen.
The processed antigen peptide fits in a cleft on
~: 35 an MHC molecule. Once an antigen i5 displayed, the few
:~ : T cells in the body that ~ear receptors for that
particular pep~ide bind that complex. Most T cells
~ ~L 2 ~
~/093/14634 P~T/US93/00839
recognize antiyens on the surface of cells only in
association with sPlf-MHC glycoproteins expressed
the same cell surfaceO
The ability of the T cell to complex with the
processed antigen and MHC complex is dependent on the T
cell receptor (TCR). The TCR consists of two protein
chains, ~ and ~ Each chain contains a constant and a
variable domain. The variable domains are encoded in
two (~ or three (~) different gene segments ~variable
(V), diversity (D), joining (J)) (Siu et alv (1984)
Cell 37:393; Yanagi et al. (198S) Proc. Natl. Acad.
Sci. USA 82:3430). In each T cell, the combination of
V, D, and J domains of both the a and ~ chains
participates in antigen recognition in a manner which
is uniquely characteristic of that T cell and defines a
unique binding ~ite. See, Marrack et al. (lg88)
: : Immunol. Today 9:308; Toyonaga et al. (1987) Ann. Rev.
Immunol, 5:585; Davis (1985) Ann. Rev. Immunol. 4:529;
- Hendrick e ~1. (1982) Cell 30:141; Babbitt et al.
~20 (1985) Nakure 317:359; Buus et al. (1987) Science
~ 235:1353; Townsend et al. (1986) Cell 44:959; ~jorkman
: et al~ (1987) Nature 329:506). Generally, both the~
and ~ chains are involved in recognition of the ligand
formed by proc~ssed antigen and MHC.
When T:cells are stimulated by an antigen, they
divide and differ n iate into activated effector cells
that are responsible for various cell-mediated immune
reactions. At least three dif~erent reac~ions are
carried out:by T cells~ ytotoxic T cells
specifically kill foreign or virus-infec~ed vertebrate
: cells; (2) helper T cells help B lymphocytes; and (3)
suppressor T cells supress ~he responses o.f specific
l l s .
~ecently, it has been shown that a novel class of
antigens, termed "superantigens'l, are able to direc~ly
: stimulate T cells by binding to a particular V~
element, that is, the variable domain sf the ~ chain of
Wog3/1~ ~ 2 8 4~S PCT/US93/0083
the TCR (Kappler et al. (1987) Cell 49:~63; Kappler et
al. (1987) Cell 49:273; MacDonald et al. (1988) Nature
332:40; Pullen et al. (1988) Nature ~:796; Kappler et
al. (1988) Nature 332:35; Abe et al. (1988~ J. Immunol.
140:4132; White et al. (1989) Cell 56:27; Janeway et
al. (lg89) ~mmunol. ~ev. 107:61; Berkoff et al. (1988)
J. I~munol. 139:3189; Kappler et al. (1989) Science
244:811). Unlike recognition of conventional peptide
antigens, the other components of the T cell receptor
: 1~ (i.e., D~, J~, V~, Ja) appear to play little role in
the superantigen binding. Superantigens, while
: generally stimulatory to T cells, appear to interact
specifically with particular V~ elements present on the
stimulated T cell. Since the relative number of V~
genes is limited, many T cells within an individual
will bear a particular V~ element, and a gi~en
;~ superantigen is therefore capable of interacting with a
: large fraction of the T cell repertoire. Thus,
depending on the freguency of th2 responding V~
;20 populationts), ~-30% of the entire T cell repertoire
could be~st~imulated by a superantigPn, whereas the
responding~frequency to a conventional antigen is
: usually much less than 1 in 1,000. Although
superantigens interac~ with class II MHC molecules,
:~; : 25 they sppear to act as::intact proteins rather than as
:~: peptides, that is, they do not appear to bind within
: the conventional:peptide binding groove. Instead, they
seem to interact with amino acid residues that are on
the outer walls of the binding cleft. Xnown
superantigens and~references to their sequences and
structures are listed in Table I.
TWO distinct classes of superantigen have been
described. The first was noted nearly 20 years ago,
: when Festenstein showed marked responses in mixed
:~: 35 lymphocyte reactions between certain ~HC identical
strains. The stimulating antigens were called minor
lymphocyte stimulating (Mls) antigens (Festenstein
'~93/14634 PCT/US93/00839
(1973) Transplant Rev. 15:6~) to differentiate them
from MHC antigens. These supexantigens are encoded by
endogenous retro~iral genes (Palmer (1991) Curr. Bio.
1:74). The presence of these genes in the mouse leads
to a marked deletion of responding T cells, creating
potentially large holes in the animal's T cell receptor
repertoire (Pullen et al. (1988) suPra)~ The second
set of superantigen is represented by a growing list of
bacterial and viral proteins, capable of producing a
~0 variety of pathological effects after injection
(Marrack & Kappler (1990) Science 248:705).
Sta~hYlococcus aureus ( S . aureus ), a commcn human
pathogen, produces several enterotoxins, designated as
SEA (staphylococcal enkerotoxin A) through SEE, which
can be responsible for food poisoning and occasionally
shock in humans; ÇMarrack & Kappler (1990) suPra;
Bohach et al. ~1990) Crit. Rev. ~icrobio. 117:251).
So~e S. aureus isolates also produce toxic shock
syndrome toxin-l (TSST-1~), which has been implicated in
the majorit~ of cases of human toxic shock syndrome as
well as the related exfoliative toxins (ExTF~, which
are associated with the scalded skin syndrome. ;~
S~ptococcus Ey3yg~ or group A streptococcus,
; another common human pathogen of the skin and pharynx,
al~o produces~toxin~ with superantigenic properties
(Abe~et al~. (1991) J. Immun. 46:3747). These have
been designated~strep~ococcal erythrogenic toxins A-C
(SPEA-C).
The amino acid sequence of the S._aureus toxins
30~ exhibit soma homology, but also exhibit marked
dif~erences (S e~ Bentley et al. (1988) J. Bacteriol.
70:34; Jones~et_al. (1986) ~. Bacteriol. 166:29; Lee
et al. (1988) J. Bacteriol. 1~:2954; Blomster-Hautamaa
et al. (1986) J.~Biol. Chem. 261:15783). S. aureus
~ has the ability to stimulate powerful T cell
proliferation responses in the presence of mouse cells
bearing MHC class II type molecules ~Carison et al.
:: :
WO93/14634 PCT/US93/008.
2~ J'~ ~5
.
--6--
(1988) J. Immunol. 140:2848; White et al. (198g) Cell
56:27). The S._aureus proteins selectiYely stimulate
murine cells bearing particular V~ elements.
The binding of toxins to class II M~IC molecules is
a prere~uisite for T cell recognition, but the process
is much more permissive for superantigens than that
. seen with conventional antigens. While peptide
antigens are very dependent on allelic MHC residues for
binding, the superantigens bind to a wide variety of
allelic and isotypic forms of MHC class II molecules
::~ (See, Hermann et al (1989) Eur. J. Immunol. 19:2171;
Herman et al. (1~90) J. Exp. Med. 172:709; Scholl et
al. (1990) J. Immunol. 144:226; Molleck et al (1991)
J. Immunol. 146:463)~. While T cells rarely recognize
peptide antigens ~ound to self-NHC (allo-MHC)
molecules, individual T cell clones can respond to
; ~:: toxins bound not only to various allelic forms of MHC,
but also to different class II isotypes and even to
xenogenic class II molecules.~ Such observation~
~ suggest that superantigens:bind at a relatively
conserv d site outside the allelically hypervariable
: groove thought to~bind conventional peptide antigens~.
Superantigens may contribute to autoimmune
d:lseases, in which components of the immune system
;25 a~tack normal tissue. : The process of deletion of T
: cells respon~ive to self, potentially harmful self-
reactive ~ ells,::is called t~lerance or negative
: selection (Kappler et al. (19873 Cell 49:273; Kapper et
: al. (1988) Nature ~ :35; MacDonald et al. tl988)
~ature 332::40; Finkel~et al.: (1989) Ce~l 58:1047). The
immune system normally deletes~ self-reactive T cells,
but occasionally a few appear to es~ape the
surveillance mechanism. It has been su~gested that the
: ability of superantigens to arouse 20 percent of a
~:~ 35 person's T cell repertoire~could lead to undesirable
replication of the few circulating T cells that
recognize self (Johnson et al. (1992) Scientific
'
212~
~V~93/146~ PCT/US93~00~3g
--7--
American 266:92). T cells bearing certain V~ types
have been implicated in various autoimmune conditions,
including arthritis and multiple sclerosis. These
findings imply that the destructive cells might be
activated by a superantigen that binds to the
identified V~ types (Johnson et al. (1992) supra).
Autolmmune diseases are a result of a failure of
the immune system to avoid recognition o~ self. The
at~ack by the immune system o~ host cells can result in
a large ~umber of disorders, includi~g such n~ural
; diseases as multiple sclerosis and myasthenia gravis,
diseases of the joints, such as rheumatoid arthritis,
attacks on nucleic acids, as observed with systemic
lupus erythematosus, and such other diseases associated
15 ~ with various organs, as psoriasis, juvenile onset
diabetes, Sjogren's disease, and thyroid disease.
These diseases can have a Yariety of symptoms, which
can vary from minor and irritating to life-threatening.
For example, rheumatoid arthritis ~RA) is a chronic,
recurrent inflammato~y disease primarily involving
joints, and affects 1-3% of North Americans, with a
female to male~ration of 3:1. Severe RA patients ten~
to exhibit extra-articular manisfestations includiny
~asculitis,~muscle atrophy,~subcutaneous nodules,
; 25 l ~ adenopathy,~ splenomegaly, and leukopenia~ It is
estimated that about 15% of RA patients become
:: :: : :
` completely incapacitated.
Several lines`of evidence suggest that T cells
:
specific for self~antigens may play a critical role in
30 ~ the initiation of autoimmune dlseases. In the case of
RA, the linkage of the disease to the DR4 and DRl
alleles of~the class ~II genes of MHC and the findings
tha~ sometimes oligo lonal, activated CD4' T cells in
synovial fluid and tissue of affected joints ~Stastny
et al. ~1976) Engl. J.~Med. 298:869; Gibofsky et al.
(1978) J. Exp. Med. 14~:1728~; McMichael et al. (1977)
Arth. Rheum. 20:1037; Schiff et al. (1982~ Ann. Rheum.
~ : :
W~93/146~ PCT/US93/008.` ~
!,5
Dis. 41:403; Duquestoy et al. (1984) Hum. Immunol.
10:165; Legrand et al. (1984) ~m. J. Hum. Genet.
36:690; Gregerse et al. (1987) Arth. Rheum. 32:15;
Burmester et al. (198~) Arth. Rheum. 24:1370; Fox et
al. (1982) J. Immunol. 128:351; Hemler et al. (1986) J.
Clin. Invest. 78:696; Stamenkoic et al. (1988) Proc.
Natl. Acad. Sci. USA 8$:1179) sug~est the involvement
of CD4+, ~TCR-b~aring, class II-restricted T cells in
the disease. This view is supported by the finding
that par~ial elimination or inhibition of T cells by a
varie~y of techniques can lead to an amelioration of
disease in certain patients (Paulus et al. ~19773 Arth.
Rheum. 20:1249; Karsh et al. (1979) Arth. Rheum.
~:1055; Kotzin et al. (1989) N. Eng. J. Med. 305:976;
lS Herzog et al. (1987) Lancet ii:l461; Yocum et al.
~1989~ Ann. Int. Med. 109:863).
U. S. patent application Serial No. 07/732,114,
herein specifically incorporated by refsrence,
establ~shes that specific V~ elements may be used to
diagnose for an autoimmune dis~ase~ specifically the
presence of a higher percentage of V~14~ T cells in
synovial ~luid may be used to diagnose R~.
Many in~estigative efforts have focused on
dev~loping methods for the treatment of autoimmune
diæeases. For example, European Patent Publication 340
1~9, entitled
autoimuune~d_sease treatment, and U.S. Patent ~o.
~,550,086, issued October 29, 1985 to Reinherz et al~,
entitled Monoclonal_antibodies that recoani2e human T
~ , des~ribe a method of detecting a particular
se~uence of the variable region gene of T cell
receptors associated with a particular disease and
~; ~ treating the disease with antibodies to that se~uence.
; U.S. Patent No. 4,886,743, issued December 12, 1989 to
Hood et al~, entitled: Diaanostic reaqents based on
un~iue sequences within the variable reqion of the T
cell receptor and uses thereof, describes a method of
~093/146~ ~1~ 8 ~ ~ 5 PCT/US93/OOX39
diagnosis diseases based on the presence of T cells
with a unique sequence in the V~ region associated with
a specific disease. PCT Patent Application Publication
WO 90/06758 describes a method for detecting specific
V~ regions associated with RA, specifically, V~3, v~s,
and V~lO, and for the treatment of RA with monoclonal
antibodies which recognize V~3, V~g, and V~lO.
Immunity
An animal that has never been exposed to a
pathogen has no specific defenses against it. However,
the animal can be immunized against khe pathogen by
injecting it with a non-virulent form of the pathogen
with a similar chemical structure as the pathogen but
lS without the ability to cause the pathological effect.
The animal wilI pr~duce anti~odies specific against the
non-virulen~ form o~ ~he:pathogen, and these antibodies
can protect the animal against ~ttack from the virulent
pathogen.
~: 20
; BRI~F 8n~YXRY OF T~IN~ENTION~
The present invention includes a method for
preventing the toxic effe ts of~a superantigen by
: ~ treatment with a molecule, wherein said molecule
:~:elicits antibody production without inducing T ce~l
activation.~
: The~present invention also includes molecules
consisting of mutated or modified deri~atives of
: superantigens.
~ ~The present~inventlon~further includes a method of
modifying T cell response elicited by an antigen
comprising adminlstering a molecule which in~eracts
with:either the V~ element alone or both the ~ and
chains of T céll~receptors (TCR).
The molecules of this invention can function by
~: leading to deletion or inactiYation/desensitization of
: : : ` :
.
WO93/146~ PCT/US~3/0083
2,~2~
--10--
at least one or more subpopulations of T cells which
present a particular V~ element.
To prevent the in vivo toxic effçct of
superantigen requires an exact understanding of how
their effect is achieved. Prior to this invention,
while it was known how superantigen interact with T
cells, the manner in which a subject animal developed a
pathological condition and whether a pathological
condition would develop was not well understood.
Various observations suggested that any of a number o~
mechanisms could be the cause of the toxicity.
It has now been found that the pathological
condition mediated or initiated by a superantigen can
be prevented or treated by administration of the mutant
superantigen molecules of the present invention~
Administration of the mutant toxins of the present
invention may cause antibody production against the
mutant molecule. Some of these antibodies also react
with the normal non-mutated toxin. Tharefore, when the
immunized individual is confronted with the normal
: toxin, these cross-reactive antibodies react with the
: normal toxin and inhibit its toxic activity.
BRI~ DE~RIP~ION OF ~E FIG~RE~
FIGURE 1 is ~ schematic ribbon drawing of the
three dimensional structure of SEB. Region 1 ~residues
9-23), region 2 (residues 40-53), and region 3
(residues 6~-61) are differentiated by shading. Sites
: 30 identified as involved in MHC or TCR binding are shown.
: Residues identified by mutational analysis as important
to MHC andjor TCR binding are indicated.
:~
FIGURE 2a show~ the SDS-PAGE analysis of 2 ug of
recombinant SEB purified from E. coli and wild-type SEB
purified from S. aureus cultures. Molecular mass
markers (in kD): ~-phosphorylase, 94; bovine albumin,
~0 93/14634 ~12 8 4 ~ 5 PCr/US9310~839
--11--
69; ovalbumin, ~5; carboxylase, 30: soybean trypsin
inhibitor, 21; lysozyme, 14. FIGURE 2b shows the SDS-
PAGE analysis of SEB binding to DR on ~G2 cells.
Molecular mass markers (in kD): bovine albumin, 69;
ovalbumin, 45; chymotrypsinogen, 27; soybean trypsin
inhibitor, 21; myoglobin, 17; lysozyme, 14.
FIGU~E 3 shows the sequences of the SEB mutants.
Dashed lines indicate identity to unmutated SEB. The
positions of the oligonucleotide~ used to generate the
SEB mutants are also shown.
FIGURE 4 shows the binding of SEB and SEB mutants
to DRl-bearing lymphoblastoid line LG2 cells.
F~GURE:5 shows stimulation of T cell hybridomas by
: region 1 SEB mutants. Preparations of purified SEB or
the region 1 mutants were tested for their ability to
stimulate a collection of T cell hybridomas bearing of
~he the V~ elements known to xecognize SEB: KS-20.15
(V~7),~KS-6.1 (V~8.2j, ~S-47.1 (V~8.3), K~6-57 (V~8.1).
: .
: FIGURE 6 shows~stimulation of T cell hybridomas by
region 2 SEB mutants. Preparations of puri~ied SEB
2S :were tested as in:Figure 5.
FIGURE 7 shows stimulation of T cell hybridomas by
reglon 3 SEB ~utants.~Preparations of puri~ied SEB
: were tested as in Figure 5.
: 30:
FIGU~E 8 shows the effects of SEB and its mutants
in vivo. Groups~ of three mice were. weighed and then
given balanced salt~solution ~BSS) containing nothing,
O ug (left), or 100 ug (right~ of rec~binant SEB or
the mutant SEBs BR~257 or BR-3S8.
':
W093/14634 PCT/US93/00~
2~2~ 4~ -12-
FIGURE 9 shows the protective effect of mutant
~oxins against challenge with SEB. Mice received dsses
of either saline or BR-257 three months prior to
challenge with wild-type SEB.
DET~I~E~ D~CRIPTION OF THE IN~NTI9N
The molecules of the present invention may be
effective in different ways i~ preventing or treating
antigen mediated or initiated diseases. Some of the
di~ferent ways in which the molecules of the present
invention may be effective inrlude modification of the
T sell response and production of antibodies which
pro~ide protection against pathogens. Specifically,
this invention presents a method of preventing or
treating superantigen-mediated or superantigen
initiated diseases. The method of this invention
generally involves preparing mutated superantigen
:~ molecules by methods known in the art and described
: herein, identifying antigen mutants able to bind eithe~
0 MHC or TCR, and testing for ability to prot~ct against
expo ur to ~he n~n-mutated superantigen.
The pr~sent inv~ntion describes the ~easibility of
the above-outlined approach in achieving protection
against a known superantigen. Mutants of recombinant~-
~
Staph~lococca~ ~er~Erp~o~in B (SEB3 were prepared and
: :purifi~d as described in Ex~mples l-4 below. SEB
~ut~nts able~to bi~d MHC molecules or TCR were ~elected
~y examining the binding of mutant SEB molecules to
~: HLA-DRl homozygo~s lymphoblastoid line L~2 cells and
stimulation of ~ cell hybridomas bearing di*ferent V~
elements. The SEB mutànt BR~257, which bound ~G2 cells
:~; in a manner indistinguishable from that of non-mutated
SEB and did not stimuIa*e T cell hybridomas, injected
into experimental animals 3 months prior to exposure to
~ 35 SEB provided complete protection against the toxic
: effects of SEB. Similar results were obtained in
~: primates.
: .
S~BSrlTUlE SHEE~
`~93/14634 2 1 2 ~ PCT/US93/0083
-13-
Although the present disclosure describes
: production of mutated SEB molecules able to protect
animals agains~ subsequent challenge with SEB, the
methods of the present in~ention are equally applicable
to o~her superantigens.
ThP ability to use the occurrence of specific V~
elements to diagnose aukoimmune diseases, as discussed
in detail above~ may be combined with the present
invention as a method of detecting and treating
autoimmune diseases mediated by superantigens~ The
existence of a superantigen-mediated disease may be
determined by a "footprintl' analysis, e.g., by
determining if there is an alteration in V~ elements in
a disease state. The finding of al~erations in V~
:: ~ 15 elemen~s, such as the increase in V~14' T cells in
: ~ s~novial fluid in RA,: suggests the presence of a
superantigen-mediated disease. Techniques known to the
art may then be applied in order to isolate and
identify the implicated cuperantigen. The V~ footprint
: 20 : ~ay ~e compared against that of a known sup~rantigen
for possible~implication of that superantigen in
initiation~or:proliferation of the disease. There ma.y
a: ~ear~h for genes coding for a superantigen when a
: : virus ox bacterial infection is associated with the
S~ initiation~of the:~disease. On~e a suparantigen is
identified~or;isolated, the method of the present
vention may be~applied to~produce a mutant
~, ~ superantigen molecule capable of conferring protection
against~exposure to the superantigen.
: 30 ~ Various terms are used in this specification, for
which it may be~helpful to have definitions. These are
; ~ provided herein,~and should be borne in mind when these
~;~ terms are used in the following examples.
;~ : As described above, the ~ey event in an immune
response is the interaction of ~HC molecules with
~: antigens to form a complex presented to T cells.
Generally, the T~cell response is quite specific, with
.
WO93/14634 PCT/US93/008~
o2,~
-14-
only very limited subpopulations of T cells responding
to specific complexes of anti~en and MHC molecules.
The response generally requires interaction of most ox
all of the components of the T cell receptor. In
certain circumstances, however, the presented antigen
need only interact with the V~ element of the receptor,
all other components are essentially irrelevant. This
means that the antigen can, and does, react with a much
greater array of T cells than is normally the case.
The molecules of this invention may interact with
the V~ elements of T cell receptors in a way which
leads to modifications in the way T cells respond to a
superantigen. "Modifying T cell responsiveness" means
that the mutant molecules are able to change the manner
in which the subject's T cells respond when provoked by
the administered molecule, or to an antigen
administered concurrently, previously, or afterward.
For example, it i5 believed that early in the
; development of T cells, certain subpopulations interact
with presented antigens and are deleted. The molecules
of this inv~ntion can function in this manner, i.e., by
leading to deletion or inactivation/desensitization of
at least one or more subpopulation of T cells which
present a par~icular V~ element.
~In a par*icular embodiment of the present
invention, the molecules modify the T cell response
without changing the B cell response that would
normally occur in the sub~ect under con ideration.
This t~pe of material is useful, for example, for
providing passive~immunity to a subject, or serving as
a vaccine. When superantigèn derivatives are used,
these derivatives are-no l~onger superantigenic, as they
~- wiI1 not provoke a restricted T cell response, but~will
::
still serve as antigens in that they generate a B cell
response. The superantigen derivatives of the present
inventi~jn are a~le *o elicit normal antibody production
against the superantigen protein.
:: :
~093/14634 ~ 4 1~ PCT/US93/00~39
The molecules of the present invention may also be
seen as competitors for other antiyens. If the
molecules described herein interact with MHC elements
otherwise required for generation of a full scale
response to an antigen or superantigen, they may
prevent or reduce the extent of that response.
The molecules of the present invention may also be
viewed as "enhancers" in some instances, where an
individual's T cell responsiveness is impaired or
weakened by any of a number of causes. Via
administration of the molecules encompassed by the
present invention, the T cell populations of the
individual can be greatly expanded.
The term "modifying T cell responsiveness" as used
lS herein is always relative to a second element ~e.g., an
antigen), and; always refers in particular to
responsivenes~ of T cells presenting a particular V~
element as part of their T cell re~eptors, other
compone~ts of the receptors being essentially
irrelèvant. ~
The molecules of the present invention contain, at
least, an amino acid sequence of sufficient size to
bind~to an MHC moleculeJ The rest of the molecule may
consis~ of ami~o acids, or may con~ain carbohydrate or
2S 1ipid~structures.~
"Reducing~ responsiveness" is construed to also
include deleting~the~portion of T cells expressing a
particular V~ element.
'~Superantigen derivative~' as used herein refers to
a molecule whose structure, at the least, contains an
amino acid sequence~su~stantially identical to an amino
acid sequence presented by a superantigen or portions
of a superantigen required for binding to either the
MHG or the T cell.
"Modified" superantigen derivative (or fragment),
differs from "muta~ed" superantigen derivative (or
fra~ment). The term "modified superantigen" is defined
WO93/1~634 PCT/US93/00~3' .
?,~.?~ 4~ j
to refer to molecules which contain an amino ac.id
sequence identical to an amino acid sequence of
superantigen, but contain modifications not found in
the superantigen molecule itself. For example, if a
superantigen contains amino acids 1-250, a "modified'
superantigen derivative may contain a sequence
identical to amino acids 50-75, positioned in between
stretches of amino acids not found in the native
superantigen molecule. Additional modifications may
include, for example, differing or absent glycosylation
patterns, or glycosylation where there normally i5
none.
'IMutated'' superantig4n refer to structures where
the actual amino acid sequence of the mutation has been
: 15 al~ered relative to the native form of the molecule.
For example, if a superantigen contains amino acids 1-
250, a mutated superantigen may include amino acids 50-
~8 an~ 72-75 which are identical to the corresponding
nativ~ sequence~ but differ in amino acids 69-71~ The
: 2Q difference may be one of "substitution" where different
amino acids are used, "addition" where more amino acids
are included so that the sequence is longer than the
native form, or "deletion" where the amino acids are
missing. :
: 25 "Vaccine" refers t~ a formul~tion when
administered to a subject provokes khe same type of
response typical of vaccines in general, e.g., active
immunological prophylaxis. The vaccine may contain
adjuvant, or~other materials.
It is known that the class of molecules known as
superantigens interact with particular V~ regions of T
cell receptors, leading to massive proliferation of
particular T cell su~populations. This interaction,
which assumes prior interaction between an MHC molecule
and the superantigen, is almost completely independent
: of any other region of the T cell receptor.
~-~093/146~ 2 1 2 ~ PCT/US93/00839
In connection with the interaction of MHC and
peptide, it must be noted that MHC molecules are
available in a variety of "phenotypes1', and different
phenotypes are specific ~or various presented peptides
and antigens. For example, HLA-DR is known to be
associated with presentation of SEB. Thus, different
MHC phenotypes will be of value for different antigens,
but determination of HLA phenotype and correlation to
: presentation of a particular antigen or antigen famil~
10 i5 well within the skill of the artisan in this field.
:Thus, this invention involves the modification of
the T cell response via admini~tration to a subject of
a mole~ule which interacts with both an MHC molecule
and at least one ~ e~ement on T cell receptors. This
interaction may a~ffect:the T cell response in any
number of ways. Perhaps the most elementary manner of
af~ecting the response is one where a molecule
interacts with the~MHC molecule, preventing the binding
; of other molecules to~th~ MHC. If th~ competing
20~ `moIecule has been modified:or does not naturally
pr~voke proliferation of T cells, then there will be a
lessening or elimination of the~response because
molecules such~as~ normal antigens:or superantigens
cannot form the reguisite complex with the MHC to
Z5 gene~xate a T cell~proliferative response.
Another mannér:o modify~ing the T cell response is
: : via l'desensitizlng"j "inactivating", or '1anergizing"
the T cells. This mechanism involves interaction of
MHC molecule, antigen, and T cell receptor, with
subsequent down regulation or inactivation of the T
;: cells. This mechanism is more~common in mature
~: ~ subjects~than the~deletion phenomenon, which occurs in
:fetal su~jects.~The latter phenomenon is one where via
:~ : interaction of the three units, various subpopulations
of T cells are in ~act removed from the organism.
The modif~ication of the T cell response can also
involve stimulatlon of T cell subpopulations.
WO93/146~ PCT/U~93/00~ ;
4i~
-18-
Knowledge of the mechanisms described herein permits
the artisan to administer to a subject a material which
interacts with the MHC and a particular subpopulation
of T cells, where proliferation of the T cell
subpop~lation results. This approach is particularly
.desirable in the treatment of conditions where a
particular V~ subpopulation or subpopulations are
associated with a pathological condition, such as an
autoimmune disease.
It should be understood that an immune response,
when fully considered, includes both a B cell and a T
cell response. One zspect of the invention involves
the use of molecules which modify the T cell response
without modifying the B cell response. Such makerials
~:~ 15 are especially useful as ~accinPs, as discussed below.
~;: The molecules of the invention ~re pre~erably, but
: : not exelusi~ely, superantigen derivatives. These
derivatives may be modified or mutated, as discussed
a~o~e. Thesa~ or any other mole~ules used herein, are
administered in an:~amQunt sufficient to madify the T
: cell response in the manner described. The amount of
: material used wil~l vary, depending on the actual
m~terial, the response desired, and the subject matter
of ~he treatment.
The molecules~may also serve as vaccines. These
~ vaccines confer protec~ive immunity on the subject in
:~ that they generate~a ~ cell response without the full T
cell response normally associated with the normal form
of the molecule. Example 7 shows one manifestation of
this effect for SEB.~ Again, depending upon the
parameters within the control of the knowledge of the
artisan, including the condition being treated, the V~
~ molecule to be regulated, and so forth, the material
: chosen for the vaccine is up to the artisan. The
vaccine may contain other materials which are normally
found in vaccine compositions, including adjuvants,
carriers, etc.
`~`'V093/14634 2 1 2 ~ 4 1 ~ PCT/US93/00839
--19~
The mode of administration of the materials
described herein may vary as well, including
intravenous, intraperitoneal, and intramuscular
injections, as well as all of the other standard
methods for admin}stering therapeutic agents to a
: subject.
The inven~ion also discloses how to make.
particular mutants us~ful in the foregoing
methodologies, including isolated nucleic acid
sequences coding for mutants, cell lines transformed by
: these and the vectors and plasmids used therefor, as
well as the isolated mutant molecules, inc~uding mutant
superantigens.
;~ Other applications of the invention described
lS herein will be apparent to the skilled artisan and need
not be repeated here.
: The terms and expressions which have been employed
are used as terms of description and not of limitation,
and~there is no intention in the use of such terms and
: expres ions~of excluding any equivalents of the
features shown and~described or portions thereof, it
being recognized:tha~ ~arious modi~ications are ~5
possible within the~scope of the invention.
Polymerase Chain Reaction IPCR) and standard
25~ : ~ molecular biological methodologies, described in
: Example l, were used in the construction and expression
of- recombinant SEB. SEB mutants were generated in one
of two ways, as described in Example 2. The first way
: introduced random mutations along the entire length of
~he SEB gene. :A~second method introduced random
mutation~ in approximately 60-75 base-defined r~e~ions
~ of the SEB gene.:;;Initial ident~fication of potential
: mutan* SEBs tested the lysate from transfo~mants for
the presence of functional toxin by stimulation of
:murine ~ cell hybridomas bearing different ~ elements
in a human DR-expressing ceLl line. Lysates negative
for T cell hybridoma stimulations were tested for the
W~93/146~ PCT/US93/008~
~,~2~
-20-
presence of SEB with the use of monoclonal antibodies
(mAbs) against SEB (Example 3). Transforman~s
producing non-functional SEB were sequenced and the
mutation identified. Transformants producing mutant
SEBs were grown, mutant SEBs purified as described in
Example 4. Analysis of the location and effect of the
mutation was performed. Since binding to MHC ~lass II
molecules is a prerequisite for toxin recognition by T
cells, the ability of mutant SEBs to bind human MHC
antigen HLA-DRl was tested as described in Example 5.
Mutant SEBs, such as region 3 mutants, were produced
which selectively stimulate some, but not all, of the
hybridomas bearing specific V~ elements stimulated by
the non-mu*ated toxin. Thus, the mutated superantigens
: 15 of the present invention may be used to sel~ctively
stimulate only some of the T cell populations
stimulated by the wild-type superantigen.
~ ~ ~ Three regions were identified in the N-terminus
:~ ~ . part of SE8 that a~fect MHC and/or TCR binding (Example
20: 4 and Figure lj. Mutations in region 1 (residues 9-23)
: affected both MHC and TCR binding. The results
~:: suggested that 23N~was particularly important. When ;~
the s~quences of the S. aureus enterotoxins are aligned
for maximum homology ~Marrack & Kapple (1990) supra),
25 ~ this residue is conserved~among all of the enterotoxins
and toxic shock ~oxin as~well. The mutations in region
2 (residues 41-53~drastically reduced the ability of
the toxin to bind to:MHC class II with a similar effect
on their ability to stimulate T cells. About half of
the mutations inv~l~ed F44. Again, this residue is
: conserved among all the enterotoxins, indicating that
this residue probahly plays a critical rol~ in the
~: binding of all of~ the toxins to MHC. Interestingly,
:~ none of the mutations in either region 1 or 2
completeIy obliterated toxin binding to MHC, and in
both cases the T cell-stimulating ability of the
mutants could be recovered by adding a large excess of
093/14634 2 ~ PCT/US93/~0~39
-21--
toxin. Mutations in region 3 (60N, 61Y) did not affect
binding of the toxins to MHC, but did affect their
interaction with two V~s, 7 and 8.1. This V~-specific
effect suggests that these amino acids are important
for interaction with some, but perhaps not other, TCR
V,~s .
: The toxicity of mutant SEBs in anima~s was tested
as described in Example 6. Mice were injected with
either bala~ced salt solution (BSS), recombinant SEB,
~: 10 or region 1 SEB mutants at F44 (BR-3~8) or at N~3 (BR-
257). Mice receiving 50 ug of either mutant SEB were
ind~stinguishable from those receiving BSS, while those
receiving recombinant SEB died within 5 days.
The ability of mutant SEB to provide immune
15~ protection from SEB was tested in vivo (Example 7).
ice receiving loO ug o~ mutant SEB 8~-257 three months
prior:to challenge with SEB were ~ully protected from
; ; t~e toxi~ effect of SEB, whereas those animals not
injected with~B~-257 died 4-5:days after challenge with
SEB. Similar results were obtained with primates.
Mutant:SEB BR-358~and BR-257 were either ineffective or
much less effect;ive~in eliciting an emetic response i~n
monkeys (Example 7).
Example 8~describes~.he application o~ the aboYe
29 : procedure to~the SEA~toxin:and the production of a SEA
mutant~whicb behaves~the~same as the corresponding SEB
mutant.
~: :
Example 1. Construction and Expression of
30 ~ R~c~mbinant SEB.
: Polymerase~chain~Reactlon~(pcRL. PCRs (Saiki et
: al. (1988~ Science:~232:487) were performed using
Ampl:iTaq recombinant Taq polymerase and the DNA Thermal
~;~ Cycler from Perkin~Elmer Cetus (Norwalk, CT). ~0-30
~ ;35 cycles were performed with~l-min denaturing and
- ~ annealing steps~, and an extension step of 1 min for
~ synthesis ~ 500~bp and 2 min for those > Soo bp.
:
Template concentrations were 1-10 nM and
oligonucleotides primer concentrations were 1 uM. The
concentration of the dNTPs was 200 uM, except when
attempting to introduce mutations, where the
concentration of one of the dNTPs was reduced to 20 mM.
SE~ Construct. The gene for superantigen SEB was
overexpressed in E. coli as follows. A linearized
plasmid containing the genomic SEB gene (Ranelli et al.
(1985) Proc. Natl. Acad. Sci. USA 82:5850) was used as
a te~plate in a PCR utilizing oligonuc~eotide primers
that flanked the portion of the gene encoding the
mature SEB without the signal peptide. The 5' primer
was (S~Q ID NO~
TAGGGAATTCCATGGAGAGTCAACCAGA-3'
This primer contains an EcoRI site which places
the SEB gene in-frame with the LacZ gene when cloned
into plas~id pTZ18R (Pharmacia Fine Chemicals,
Piscataway, NJ). This oIigonucleotide primer also
con~ains an NcoI site which adds an ATG between the
LacZ gene ~ragment and the beginning of the SEB gene so
that the SEB gene could be moved easily to other
plasmids carrying its own initiation ATG. The 3'
pr.imer containe~ a HindIII site after the termination
co~on of~the SEB gene (SEQ ID NO~2):
5'-AGCTAAGCTTCACTTTTTCTTTGTCG-3'
The PCR fragmant was digested with EcoRI and
HindIII and Iigated into EcoRI/HindIII-digested pTZ18R.
Qoli XLl-Blue (Stra~agen, La Jolla, CA) was
transformed with the plasmid, a single transformant
picked, and the insert (pSE82) was sequenced to check
that it had no mutations.
Upon induction the pSEB2 construct led to
overproduction of mostly cytoplasmic SEB (~ 10 ug/ml of
~0~3/1~634 2 1 2 8 ~1 ~ PCT/US93/00839
-23-
broth). However, rather than producing a LacZ/SEB
fusion protein, the bacteria produced a protein with
the same apparent molecular weight as secreted SEB from
S. aureus (Fig. la). Either the LacZ portion of the
fusion protein was cleaved in vivo from the majority of
SEB or the ATG introduced between LacZ and SEB was a
more efficient translation initiation site than that of
LacZ.
Example 2. Generation o~ SEB Mutants.
SEB mutants were generated in one of two ways.
One way introduced random mutations along the entire
length of the SEB gene. To do 50, the SEB construct of
Example 1 was prepared but PCR was performed with
concentrati~ns of either dATP or dTTP reduced 10 fold
~: in order to increa~e Taq polymerase error rate (Innis
et al. (1988) Proc. Natl. Acad. Sci. USA ~5:9436~.
This reduces the product amount 5 10 fold. Products of
the two reactions were combined, clon~d into pTZ18R as
described in Example 1, and individual transformants
were screened for mutant SEB as described in Example 3
for BR~mutants. Of approximately 400 toxin-produci~g
: transformants screened, 10 were identified as
functional mutants by their reduced ability to
: 25 stimulate T cel~s. Low concentrations of dCTP and dGTP
were triéd as well, but less reduction in product
resul~s and no:mutants were detected in screening
approximately:200 transformants .
A second PCR method was used for introducing
random mutations in approximately 60-75 base-defin~d
~ regions of the~EB gene. The following oligonucleotide
; primers t~ (SEQ ID No:3:j:~ B (SEQ ID NO:4~, and C (SEQ
ID NO:5~) positioned as~shown in Figure 2, were
synthesized with each position containing 1% each of
the three incorrect bases:
A-: 5'ATTCCCTAACTTAGTGTCCTTAATAGAATATATTAAGTCAAAGTATAG
AAATTGATCTATAGA3'
WO93/14634 PCT/US93/008
-24-
B~: 5'AGCTAGATCTTTGTTTTTAAATTCGACTCGAACATTATCATAATTCCC
GAGCTTA3'
C+: 5'CCGGATCCTAAACCAGATGAGCTCCACAAATCTTCCAATTCACAGGCC
5TGATGG~AAATATGAAAGTTTGTAT3'
These mutant oligonucleotides served as primers in
a PCR reaction with either a vector (A and B) or
internal SEB (c) oligonucleotide as the other primer,
and the SEB gene as the template. Each molecule of
synthesi2ed SE~ fra~men~ was predicted to have 2-3
random base mutations in the region corresponding to
mutant primer. Mutant fragments were incorporated into
the SEB gene, either alone or with another fragment
containing the 3'-portion of the gene as mixed template
in a PCR reaction to resynthesized a full length SEB2
gene (Ho et al. (1989) ~ene 77:51; Pullen et al. (1990)
Cell 61:1365). Alternativelyr this was accomplished by
digestion with appropriate restriction enzym~s and
ligation into pSEB2 from which the corresponding region
had been removed~
DNA Se~a~encing. Plasmid inserts were sequenced
directly by the dideoxynu~leotide method of Sanger et
ak (1977) Proc. Natl. Acad. Sci. USA 74:5463, using
Sequanase (U~S. Biochemical Corp., Cleveland, OH) and a
modifica~ion for double stranded supercoiled plasmid
templates (Weickert and Chambliss (1989) in Editorial
Comments, U. S. Bioch2mical Corp., Cleveland, OH, pg.
5-6.
Exa~ple 3. Screenina of Transformants for SEB
Mutants.
Anti~SEB Monoclonal Antibodies (mAbs)~ 10 mAbs
specific for at least five epitopes of SEB were
produced by standard methods from B10.Q(~BR~ immunized
multiple times with SEB. One of these antibodies,
B344.1f was used both for ~uantitation and
immunoaffinity purification of SEB and SEB mutants.
B344.1 is an IgG1 that was chosen because initial
,93/14634 2~ 15 PCr/US93/00839
-25-
characterization showed that it had a high affinity for
SEB, bound equally well to all of the SEB functional
mutants, could detect and immunoprecipitate SEB bound
to MHC class II molecules, and did not block T cell
recognition of SE~ bound to DR (data not shown).
ELISA for S~B. The amount of SEB in preparations
wad determine~ by ELISA. Microtiter wells were coated
overnight with a solution of 6 ug/ml natural SEB (Sigma
Chemical Co.l St. Louis, MO). The wells were then
incubated with 25% FCS and washed throughly~ Var~ous
concentrations of known and unknown SEB preparations
were added to the wells as inhibitor followed by a
constant amount of anti-SEB antibody (polyclonal rabbit
anti-SEB(Toxin Technvlogy, Madison, WI) in BR
::. :15 experiments and monoclonal anti-SE8, B344, in BA, BB,
and BC experiments). After 1 hour, the wells were
: washed thoroughly, and the bo~nd antibody was detected
by ~tandard techniques using alkaline phosphatase
: :coupling either to goat anti-rabbit IgG (5igma Chemical
~ Co.j or to p-nitrophenyl phosphate as substrate. The
: OD of the reaction at 405 nm was related to the dose of
inhibitor and the~concentration of he SEB in the
unknown estimated by computer analysis of the data.
,
Initial Screeninq_o~_P~tentiallY Nutant 5EB. For ~:
25: primary screening,~totaly lysàtes were prepared as
described from individual transformants containing a
potentially mutant SEB gene. Aliquots of each lysate
were tested for the presence of functional toxin by
stimulation of murine T cell hybridomas bearing ~/~
receptors~with either V~7 or V~8.3, using human DR- :
: expressing cell lines as presenting cells. Lysates
deficient in stimula~ing either of these hybridomas
were assayed for~:the presence of SEB protein to rule
out mutations affecting the level or the ~ull length of
the SEB produced.~: Plasmids from those producing
proteins were sequenced to locate the mutation the
sequences of the mutants are shown in Figure 2.
W093/14634 PC~-/US93/00~39
4~
-26-
The Taq polymerase error-induced random mutants
(BR) were clustered in three regions (1, 2, 4), all in
the NH2-terminal 93 amino acids of the molecule (except
an additional conservative mutation in one case, BR-
374, in the COOH-terminal half of the molecule). As
predicted by their method of generation, all but one of
these mutations involved a nucleotide substitution of A
to G or T to C, and only one silent mutation was found
elsewhere in their sequence~ (data not shown).
Additional mutants were generated in region 1 or 2 with
mutant oligonucleotide C or A (BC, BA mutants). Region
3 was ori~inally discovered as a single mutant (BA-62)
involving the last amino acid covered by
oligonucleotide A. The mutant had a different
: : 15 phenotype than the other BA mutants. Additionalmutants were produced in this region with mutant
~: ; oligonucleotide B (BB m~tants). Mutations in region 4
were eliminated from ~urther analysis, because it was
felt that interfering~with the conserved disulfide
: 20 forming cys~eine at position 93 could have far reaching
unpredictabIe~effects.~ In~addition, several mutants
were not further characterized either because they ~.~
involvéd more than~one region (Br-474~ BA-72), produced
~ highly degraded toxin (BR-267), or were identical to an
; ~ 25~ already exist$n~ mutant:(BA-50).
Example 4~ Preparation of Recombinant SEB.
For initial screening, individual colonies of
transformants picked~from agar plates were transferred
~: 30 to well`s of 96-well microtiter plates containing 100 ul
~ of 2XYT and carbenicillin. A replicate plate was
:~ prepared except that the media con~ained 1 mM IPTG as
~:: well. Both were~incubated overnight at 37C with
shaking. 50 ul o* glycerol was added to each well of
3S the first plate,:whi~h was mixed and then stored at -
: 70OC... To prepare SEB-containin~ lysates, each well of
~ the second plate received 50 ul of HNM buffer (10 mM
~93/146~ ~ PCT/US93/00839
-27-
Hepes, pH 7.0, 30 mM NaCl, 5 mM MgC12) containing 3
mg/ml lysozyme and 300 ug/ml DNAse I. The plate was
incubated at 37C for 15 min, frozen, thawed three
times, and centrifuged to pellet debris. The
supernatants were trans~erred to a new plate and tested
for the presence of SEB both by ELISA and T cell
hybridoma stimulation. Th~s method produced
preparations containing 0.3 and lO ub/ml of SEB.
'l'o produce purified mutant SEB, transformants were
recovered from the 9~-well plate stored at -700C.
Bacteria from overnight cultures ( 1 vol ) containing
IPTG were collected by centri~ugation, resuspended in a
1:10 vol of HNM buffer containing 1-2 mg/ml lysozyme
and lO ug~ml DNAse I, and frozen and thawed three
times~ The suspension was c~ntrifuged at 15,000 g for
2 0 min to remove bacterial debris, and the supernatant
: was harvested and f iltered ( 0 . 2 u) . The f iltrate was
passed through a colum~ containing a 1: 50 volume of
Sepharose 4B beads coupled with 2-3 mg/ml of a mAb to
~: 20 SEB (B344). The beads were washed thoroughly with PBS
: ~ and the toxin was eluted with O.l M glycine-~Cl (pH
~ 2:.7) and neutralized w~ith l M Na2CO3. The SEB was
: : concentrat~d to l mg/ml and its buffer çhanged to BSS
using CentriconlO microconcentrators (Amicon Corp.,
Denvers, MA). This method yiel~ed 3-lO mg of toxin per
: liter of bacteria} cul~ure.~ SEB and its mutants
p~oduced in this manner were ~ 95% pure as judged by
SD5-PAGE. Region l SEB mutants are listed in Table II,
region l and 2 mutants are listed in Table III, and
: region 3 mutants~are listed~in Table IV.
:The ~utations described all in~olve a nucleotide
substitution of A to G, or T to C, which would be
predicted by the methodology used for their generation.
When mutations were generated using mutant
ol~gonucleotides C or A, these mutations were
~concentrated in amino acids 9-23 (Region l), or 41-53
(Region 2) of the SEB sequence ~Table III).
WO93/14634 PCT/US93/00839:
- -28-
When the oligonucleotide primer B was used, the
mutants listed in Table IV were generated.
Amino acid 93 is cysteine in normal SEB. To that
end, mutations in this region were not considered
further because of the poten~ial interference with
disulfide binding~ Thus, mutants BR-30 and BR-311 were
eliminated.
Those mutants containing changes in more than one
region (NOT more than one mutant), i.e., BR-474 and BA-
7~, were also eliminatedt as was BR-267l because the
toxin was highly degraded. BA-50 is a know~ mutant and
was not studied further.
: ~ Structural Studies of SEB.
The three-dimensional crystal structure of SEB,
perhaps the most widely studied member of the
: staphylococcal enterotoxins, has been recently reported~; : (Swaminathan et al. (1992) Nature 359:8~1). A
sche~atic drawing of SEB is shown in Figure 1. The SEB
molecule cQntains t~o domains. The first is composed
o~ residues 1-120 and the second of residues 127-239.
As discussed above, three regions have been identi~i~d
~ ~ (Ka pl~r et al.~(l992) J. Exp. Med. 175:387~ in the N-: ; : te~minus part of the SEB that affect ~HC class II ~:binding and/or T cell activation. In each of the
regions the specific amino acids that are responsible ::
were determined.~ Some of the identified residues
: affect both ~HC class II binding and T cell activation,whereas other affect only the latter. As superantigen-
MHC class II binding:;is a prerequisite for T cell
activativn, residues affecting MHC class II binding
will also influence T cell activation, thus no T cell
binding information can be inferred from them. But
they do provide information about MHC class II binding
~: ; 35 sites on the superantigen. On the other hand, those
residues that influence T cell activation but not MHC
.
~.J93/146~ ~ ~ 8 ~ I ~ PCT/USg3/00839
-29-
class II binding are likely to be in the T cell binding
site on SEB.
Region l, defined as the stretch of amino acid
residues from 9-23, is bifunctional as it affects both
TCR and MHC class II binding. Mutations in this region
included residues in positions l0, 14, 17 and 23, as
either a single or a double mutation (Table II).
Asparagine at residue 23 ~N23) i5 on the a-helix, ~2,
with the side chain pointed towards the solvent. It is
the most important residue, being conserved among all
staphylococcal enterotoxins and critical for TCR
activation. Only five mutations at posi~ion 23
affected MHC class II binding, but all of them affected
TCR activity. Mutations at residue 14 and 17 affected
both MHC class II binding and TCR activation. Residue
~ Sl4 is on a very short a-helix ~al) and is exposed to
::: the sol~ent whereas Fl7 is locat@d at the other end of
aI. The locations of Sl4, Fl7, and N23 (Figure l) on
~ the surface of ~he toxln are fa~orable ~or making
: 20 critical: contacts~ with MHC class II molecules and/or
: ~ V~. Residue Fl7~points inwards and lies in a loop
sandwiched between two other loops, of residues l74-~79
and 203-209~ This sugg~sts that its replacement by
serine (Fl75~ may have introduced structural changes
25: :which reduce MHC~class II binding and cytokine
production. The~association of Sl4 (on ~l) with MHC
class II binding, and N23 (on a2) with TCR activity,
reveals the structural bas~is underlying the
bifunctional role of region l. Although the region
consists ~f a small number of sequential amino acids,
:there are distributed on separated but adjacent
elements of the secondary structure ~hat are engaged in
. different functions. The proximity of ~l and ~2 is
consistent with the suggestion (Kappler et al. (1992)
supra) that the amino acids in region l are situated in
the trim~lecular complex near the junction of ~ and
MHC class II.
W093/14~34 PCT/US93/0083
Region 2 is defined as residues 40-53 and was
sugges~ed to be important in all staphylococcal
enterotoxins in mediating binding to MHC class II.
About half of the mutations in this region involved the
conserved residue F44 (Table III). Other mutations
involved residues 41, 45, 48, 52, and 53. These
changes affected MHC class II binding and consequently
the TCR activation. Thus, this re~ion is probably
specific for MHC class II binding. Residues 48-52 are
in ~-strand ~2. Resid~e F44 is on a tuxn connecting ~1
and ~2 with the side chains exposed to solvent. It is
situated favorably ~or engaging in critical hydrophobic
binding contacts with MHC class II.
Region 3 is made up of ~wo residues, 60 and 61,
: 15 and mutation of either one af~ects the TCR activation
but not MHC class II binding. Residues 60 and 61 are
~ in the loop connecting ~2 and ~3 and are exposed to
: : solvent ~Table IV).
~: 20 Example 5. Bindinq of Mutant SEB to H~-DR.
Since binding to M~C class II is a prerequisite
. for toxin recognition by T cells, the mutations coul~d~
: have affecte~ either the ability of ~he toxin to bind
: to DR molecules or the recognition of this complex ~y
the TCR-a/~. To~help distinguish these two
possibilities, the HL~-~Rl homozygous lymphoblastoid
line LG~ was used (Gatti and Leibold (1979j Tissue-
Antigens 3:35). l2sI-labelled LG2 cells were incuba~ed
with or without 50 ug/ml recombinant SEB for 2 hours at
37C. A cell free lysate was prepared in 1% digitonin
and incubated for 4 hours at room temperature with
Sepharose beads~coupled with 3 mg/ml B344 anti-SEB I~b.
The beads were washed thoroughly, and the labeled bound
material was analyzed by SDS-PAGE under reducing
conditions (Laemmlli (lg70~ Nature 22Z:680) and
autoradiography. As a control, beads bearing the anti-
DR mAb, L243 (Lampson and Levy (1980) J. Immunol.
2~3~1~ PCT/US93/00839
-31~
125:293) were used ~1/20 the volume of lysate used with
the anti-SEB beads).
SEB binds to DR molecules on LG2 ~Figure 2b).
Immunoa~finity-purified toxins were prepared and
assessed for their ability to bind to LG2 using flow
cytometry with the same anti-SEB mAb used to purify the
SEB and its mutants. 3 x 104 LG2 cells were incubated
in 100 ul of tissue culture medium overni~ht at 37C
with vrious concentrations of SEB or its mutants. The
cells were washed ~horoughly and incubated for 30 min
at 4C with approximately 1 ug/ml of the anti-SEB mAb,
B344.1. The cells were washed again and incubated for
15 min at ~C with fluoresceinated goat anti-mouse IgG1
(Fisher Scientific Co.). The cells were washed again
.~nd analyzed for surface fluorescence of the cells
corrected for the fluorescence seen with the secondary
reagent alone v.s the amount of toxin added. The
: ~esults, shown in Figure 4, are presented for mutations
in each of regions ~1, 2, and 3.
~: 20 ~he binding by four of the region 1 mutants to LG2
: ~ . was indistiDguishabl~ from that of unmutated SEB. The
: ~ o~her three mu~ants were reduced in their binding
capacity by approximately 100 fold~ These resulks
suggest that residues between 14 and 23 within region 1
are important in MHC ~inding. Five of the seven
mutations involved residue 23N. In only one case (BR~
291, 23N-S) did this mutation reduce MHC binding.
These results suggest residue 23N may be important in
~ both MHC binding and V~ in~eraction. Region 2 mutants
all bound poorly to LG~, approximately l,OOO times
poorer than SEB, lndicating that region 2 defines a
stretch of amino acids, especial~y 44F, important in
binding of the toxin to class II MHC. Region 3 mutants
were essentially unaffected in binding to LG2, strongly
suggesting that this two-amino acid region ~60N, 61Y)
is important in V~ interaction.
W093/146~ PCT/US93/00839
fl ~
-32-
Example 5. Effect of Mutations on T Cells Bearin~
Di~ferent V~ Elements.
The SEB mutants were originally identi~ied because
they stimulated either a V~7' or a V~8.3' T cell
hybridoma poorly. To assess the effect of the SEB
mutations on T cell recognition in more detail, the
purified mutant toxins were retested at various doses
on additional T cell hybridomas bearing each of the
four murine ~ elements known to recognize SEB (V~7,
V~8.1-3, (White et al (1989) supra; Callahan et al.
(1989~ su~a; Herman et al. (1991) su~ra). Varying
concentrations of toxins were incubated at 37~C
overnight with 3 x 104 DR~ cells in 200 ul of tissue
culture medium. 5 x 104 T cell hybridomas of requisite
V~ specificity were added in 50 ult and the mixture
incubated overnight. Response of T cell hybridomas was
; measured as IL-2 secre ed, following Kappler et al.
1981) J. Exp. Med~. 53:1198 and Mosmann (1983) J.
Immunol. Meth. 65:55. The results are shown in Figures
5-7.
Among ~he region I mutants (Figure 5), the five
involving 2~3N (~BR-257, BR-291, BC-6, BC-66, BC-88)
stimulated all; ~f the hybridomas poorly, d spite the
fact ~hat four of these bound to D~ as well ~s
unmutated SEB did. These results indicate that re~idue
23N is~ an~important amino acid for V~ interaction1 but
because the fifth mutant i m olving this amino acid, BR-
291, bound poorly to MHC, this amino acid may in~luence
~HC bindingias well. The other two regions 1 mutants
also s~imulated poorly. In the case of BR-75, this may
have been due primarily to its poor binding to DR, but
the effect o~ the BR-210 mutation was several orders of
magnitude greater~on T;cell stimulation than on binding
to DR. Taken together, these results are evidence that
during T cell recognition of SEB bound to DR, the amino
acids 1n region l are situated in the trimolecular
.' ~ r
~93/146~ PCT/US93/00839
~ 28'11~
-33-
complex at the junction between V~ and MHC, so that
individual residues may interact wi~h either component.
The mutations in the other regions produced less
complicated phenotypes. All of the region 2 mutants
were defective in stimulation of all of the T cell
hybridomas, regardless of the V~ element in their
receptors ~Figure 6). There were small differences,
but in general the effect of mutations on stimulation
was about the same as that seen on DR binding. These
results were consi~ent with the conclusion that
mutations in region 2 primarily affect DR binding.
The two-amino acid region 3 mutants were the most
discriminating (Figure 7). Despite the fact that
random mutants in a 20-amino acid strech flanking this
region were generated, all mutations affecting functisn
; were found in these two amino acids. These mutants
failed to stimulate the hybridomas bearing V~7 and
V~8.1, but not V~8.2 or~V~B.3. To insure that this
prop~rty ~as not peculiar to these particular
hybridomas, the toxins~were tPsted with f our other T
cell hybridomas: one V~7' . two V~8.1~, and one V~8.3'.
The results~were indistinguishable from those in Fi~re
~ 7~(data not shown).~
;~ ~ 25 Example 6. R~egyirement for T Cell Interaction for
In Vivo Effects of SEB.
The question of how important the superantigen
properties of the bacterial toxins are to their in vivo
toxic effects is~unresolved. Previous experiments by
the inventors suggested;that the toxicity of SEB in
mice was related~to its ability to stimulate T cells in
~a V~-specific manner, since the toxi-~ effect of SF,B was
direc~ly related to the frequency of T cells bearing
the relevant V~ elements (Marrack et al. (1990) J. Exp.
Med. 71:455). However, the ability of some of S
aureus~toxins to bind to class II on monocytes and
stimulate the production of cytokines such as TNF and
WO93/146~ PCT/US93/00839
~a 4~
-34-
IL-l (Parsonnet (1989) Rev. Infect. Dis. 1:263) opens
the possibility that direct monocyte stimulation may be
sufficient to account for much of the toxin pathology
in some situations.
To test this idea, mice were injected with various
concentrations of region I mutant BR-257, which binds
v ry well to class II MHC but does not stimulate T
cells except at extremely high levels. Unmutated S~
and mutant BR-358, which like all of the region 2
mutants binds very poorly to class II MHC, were used as
contrsls. To minimize the effects of LPS, which might
contaminate the preparations, C3H/HeJ mice were used, a
strain defective in LPS responsiveness. Since rapid
weight loss is one of the most obvious immediate toxic
effects of SEB in mice (Marrack et al. (1~90) suPra),
the mice were weighed daily after the injection on day
O. ::
Groups of three mice were weighed and then given
balanced salt solution (BSS) containing either nothing,
S0 ug, or 100 ug o recombinant SEB, mutant SEB BR-257,
or mutant SEB BR-358. The mice were weighed daily at
the same time of~day until they died. The results a~r~
shown in Figure 8. R~sults are presented as the
~: average perGent change from the starting weight for the
survivirlg mice. ~
Mice given:either 50 or 100 ug of recombinant SEB
l~st weight rapidly over 3-4 days, and all of the mice
were dead by day 5. Mice gi~en mutant BR-35~ showed no
effects and were indistinguishable from those given BSS
~ 30 alone.~ Mice given 50 ug of BR-2~7 were unaffected as
: : well; however~ those given 100 ug of BR-257 showed a
;~ slight weight loss ~ followed by recovery.
~:~ These results confirm that in mice the majority of
: the toxicity of~SEB is dependent on its ability to
stimu~ake T:cells, suggesting ~hat T cell-derived
lymphokines themselves or those produced by other cells
activated by T ~cells are very important in the mode of
:
~93/14b34 ~ 2 8 g l 5 PCT/US93/00839
-35-
action of this toxin. However, the small effect of BR-
257 at the higher dose raises the possibility of a
contribution from class II-bearing cells directly
stimulated by bound SEB without T cell involvement.
Example 7. Protective Effect of SEB Mutants.
The protective effect of SEB mutants was tested.
In these experiments, mice received doses of saline
solution or l00 ug BR-257 three months prior to a
challenge with wild-type SEB. On the day of the
challenge ~day "0"), the mice received 50 ug of SEB
intraperitoneal. Weight change and survi~al were
measured. Results are shown in Figure 9.
All mice whi~h had received the control died 4-5
days after challengs with SEB, whereas there was a
protectiYe effect shown in the mice which had been
immunized with the SEB mutant.
; Example B. Production of SEA Mutants and Their
Prote~tive Effects in Animals.
Staphylococcal enterotoxin A (SEA) mutants were
produced according to the procedures described above;~
Superimposing the amino acid se~uence of SEA on that o f
SEB, it has;been bound that a mut2tion at po~ition 45
inhibits SEA's ability to bind to MHC, in a similar
manner to that observed with the position 45 SEB
mut~nt.
iSimilar studies were conducted with primates.
Monkeys received either wild~type SEB, or either of the
30~ ~ reion l SEB mutants BR-257 (mutated at F44) or BR-358
(mutated at N23), and the induction of an emetic
response assessed. Both mutant SEB molecules were
either ineffective or much less effective in inducing
an emetic response in primates, than wild-type SEB.
These results confirm that the method of producing
mutant superantigen described in this disclosure is
applicable generally to all superantigens, and provides
W093/146~ PC~IUS93/00~39
~8 ~5 -36-
a method of protecting patients from the pathological
effect of superankigens.
,-~
2 ~L 2 8 ~ 1 ~ PCI/US~3J00839
) 93/14634
--37--
_ j _........... ~c _ ._
,~oo ool a'~ ~ ~ ~Dl O l
~ ~o-o ~ ~ . ~ I
~D U' I t~ - ~ In . ~ ,4 C~ C ..o I
o ~ ~2 i u~ ~ a) ~ ,, m ~ ~ a~ ~ ~ co I
o ~ , 1~ ~ l~t` I t~ ~ .~n O o ~ ~, , ln ~1 I
~ao ~ 1 a ~u ~
~ ~ . o~ ~ â~ . ~ ~ ~ _ X 0~
~ \~ r ~ _ ~ ~ ~ a ~ S~ O ~ ~ u~
~ r
@ ~ ~v_~ o ~ ~ ¦ o c v ~ c r o
~: ~
~ ~ zloxlo' lo Ioo~l '1 1 lu.ol
V~ ¦ ~ ~ ~ ~ ~ l i ~ .~ ~
~----- ~: ----
~ ~u: ~ ~ ~ ~ :; ~ : ~o ~ oo ~ ~
: I ~, ~ : I ~ ~ ~, ~ ~
. I ~ . ~1 ~n ~
p~ : : l: ` ~: ~xo ~x'E~ 1~ :~
E-~ !~ J ~ = _ 5~ __ ___ ~= ~
:` ; ~ '
W093/146~ PCT/US93tO0839
-38-
TABLE II. REGION 1 SEB MUTANTS.
_ ~
Mutant Name Position Change(s) _
_ _ __ ,
BR-75 F17 Phe-Ser l
. _ I
BR-210 514 Ser-Leu
_ _ _. I
BR-257 10, N23 _Asp-Asn; Asn-Asp
j BR~291 NZ3 Asn-5er
BR-358 F44 Phe-Ser
I _ _ _
BR-374 D48, 160 Asp-
I
BR-30 Y91 Tyr~Cys
I _ _ __ I
¦ BR-3~1 C93 Cys-Arg
¦ BR-474 _ 46, C93Tyr-Ser; Cys-Arg
BR-267 F44, 54, 55Phe-Ser; Lys-Arg; Asp-Val
~ _--_ _ _ ____
TABLE III. REGION 1 AND 2 SEB MUTANTS GENERATED WITH
T~T OLIGONUCLE ~ _ _ _
:Mutant Name ¦ Posltion Change(s)
¦ _ BC-6 _ N23 _ Asn-Ile
BC-66 N23 Asn-Tyr
_ _ , . .
BC-88 N~3 Asn-Lys l
__ _ ~ _ ~ I
: BA 3 F44 Phe-Cys l
__ ~ _ _ _ _ I
: BA-15 ~ L45 _ ;_ Leu-Val _
: B~-24 41, 53 Ile-Arg; Gln Val l
~ ~ _ I
_ 31 _ :46, 52 _ Tyr-Leu; Ser-Phe
BA~50 F44 Phe-Ser
_ __ _ ~
: BA-53 F44,~_43_ _Phe-Leu: Ile-Arg
BA-62 Y61, 189 Gln-Ser: Ile-Arg
BA-72 ~45, N60 Leu-Tyr; Asn-Lys
_ _ _ ~ .
rABLE IV. REGION 3 SE3 ~ ~
! Mutant Name Position Chang (s)
: BB-14 ~ ~
: BB-21 N60 Gln-Asn _
BB-47 Y61 Tyr-Gln
, ~
