Note: Descriptions are shown in the official language in which they were submitted.
WO 93/~5201 2 1 2 ~ 7 ~ 2Pcr/US93/00586
NOVEL PROTEIN TYROSINE KINASES
Description
Backqround of the Invention
Transduction of signals that regulate cell growth and
5 differentiation is regulated in part by phosphorylation of
various cellular proteins. Protein tyrosine kinases are
enzymes that catalyze this process. Moreover, many act as
growth factor receptors.
Summarv of_the Invention
10The present invention relates to novel protein
tyrosine kinase genes present in human megakaryocytic and
lymphocytic cells, the proteins encoded by these genes,
antibodies specific for the encoded proteins, RNA nucleic
acid sequences which hybridize to the genes and methods of
15 use therefor.
The genes isolated as describe'd herein are referred
; to, collectively, as protein tyrosine kinase (pTK) genes.
The nucleic acid sequences of these genes, isolated as
discussed herèin, show significant ~omology with
;~ 20 previously identified protein tyrosine kinases containing
extracellular domains which function as growth factor
receptors. The pTK genes have been shown to be present in
both megakaryocytic and lymphocytic cells.
The pTK genes of the present invention show
25 significant sequence homology with members of the c-kit
subgroup of growth factor receptors with protein tyrosine
kinase activity. The c-kit subgroup of receptor tyrosine
kinases catalyze the phosphorylation of exogenous
substrates, as well as tyrosine residues within their own
30 polypeptide chains. (Ullrich, A. and Schlessinger, J.,
Cell, 61:203 (1990)). Members of the c-kit subgroup
include FLT/FLK (Fetal Liver Kinase), FGF (Fibroblast
RC\~ P-~-M-iE~-CHEi~ ~ : ;3~ : 18~ ;178filY-~ +~';3 8~ >.3'J~I~
. .
212S722
Grc)wth Factor Receptor) and NGr (Nerve ~;rc~h F~ctGr
~eceptor) .
In particular, f ourteen pT}C gene~ have been
identified. Two pTK ~enes, referred to as S~L-S1 and SAI.-
5 D4 (also referred t~ ~s meqakaryoc}~te deri~ed F~,r-like
recaptor tyrosine kina~;e) were identif ied in
~n~gakaryocytic cel ls. Fi~e pTK ~eneE;, re~er~ed to as
LpTXs, were identif ied in 1 y3~phocytic cel ~ s and have been
showr. to be presen~ in megakaryocytes a~ well. One p~:C
10 gene, referred to a HpTXs, was identified in hu~an
hepatoma cell~ Six pT~ genes, refer~ed to as bpTX genes,
~ound in human brai~ ti55ue
SAI,-Sl is related to the ~LT~FLK family o~ pTl~s..
SAL-D4 is rel~ted to the FG~ recep' or fa~ily of pTXs, ~nd
15 one LpTK tLpT~ 3 ) is related to the NGP receptor ~,~ily of
P~Rg .
Th2 p~ genes, which are the subj QC'C of ~e present
in~ention, were- ldentif'ed usin~ two ~ets of degenera~ive
oligonucleotide primers: a fir~ ~et which ~mplifie~ all
O pl'K DNA seg~en~s ~ SEQ ID NOS : t -2 ), and a second set which
a~plif ies hi~7hly conse~ved ~equence~ preseT~ the
cata~ytic domain or the c-kit sub~ up of p~X~; ~SEQ ID
NOS: 3-4) . l'he pT~; ~enes identifie~ in t2~is ~anner are
de~cribed below.
SAL-Sl is expressed in several ~ega}c~ocytiG cell
lines, but not in erythroid cell lines~ The nucleotide
~;eguen~e of SA~-Sl was obtained, revealing a se~auence
conta~ning 1~0 }~alse pair~. ~SE~ :CI) NO:5). This iso~ated
I~N~ fragment encoded an amino acid se~uence ( SEQ ID NO: 6)
30 which exhi~ited significant seguence homolo~y with known
protein tyrosine kinase~ of the FLTtE'LE~ ~amily. The full
~tUeC~TlT~JT~ ET
F~C\;: ~ 0~: t:PA-Ml~ H~ 4 ~ ; 1 7~3t; 1'~354U-- +~9 ~ 'J~1;5: ~J 1~)
~I*~8722
length ~ene sequence ~SEQ l~ NO: 17) co~tains 682~ b.p.
and the d~duced amino acid sequence ~ SEQ ID NO~
contains 34 ~ re~;idues,
SAL-D4, also expressed in megakaryocyti~: cells, is
S DN~ fragnlent contain;ng the l~ucleotide se~;3uence of 14 7
base pairs. tS~;Q ID NO: 7) . This isolated l:)~lA fragment
- encoded an aa~lino ~cid ~;s~auence ~SEQ ID NO: 8) which
exh~b~ted ~igni~icant sequence homology with known protein
tyrosine kinases of the EG~ receptor fa~i~y.
The LpTKs, including LpTK 2, LpTK 3, LpTK 4, and ~pTX
13 and Lp~K 25, are expressed in ly~nph~cy~:ic cellsr as
well as ~egakaryocytic eells~ The nucleotid~ ~equence
~151 ~ase pair~) o~ the Lp~R 3 gen~ was o~ta~ned (SEQ ID
NO: 113, and e~hiblted s3ignificant homology with ~nown
15 protein tyrosine kinases of ~e NGF receptor fa~i~y. The
nuclQotide ~e~uences o' thÇ! I.pTX 2, LpqX 4, ~nd I,pTK-1
gene~ conta~nod 14~ ba~;e pa~s (SEQ ID N0:9), 137 base
pairs t5EQ ID ~10: ~3), and 211 base pairs (SEQ Il;) N0: 15~
respectiYely. Lpq'K 2S has a nucleotide sequence ~f 3120
~0 b.p. (S~Q ID N0: 22). A full ler~gth gene sequenc:e ha~;
been obtained for Lp~K 2 (SEQ ID N0: 19) ~hich cont~ins
7607 ~.p. Additional sequencing oI~ IpTX 4 revealed a
E;eguence o~ 404 b.p~ tSEQ ID ~0: 21~ .
The Hp'rK 5 gene, expres~ed in human hepato~ ~:ells, --
ha~ a nucleotide sequence 0~ 3`g69 }~.p. ~SE~ ID tlO: Z3).
Nucleotide ~equ~nces of the ~p~K's, including bp~K 1, bpl`~
2, bp~R 3, bpTR 4, bpT~ 5 and bp~rR 7 are expressed in
human brain t~ 8SU" encode proteins having the a~ino acid
se~uences of SEQ ID NOS: 25-3Q respecti~ely.
rhus the present invention includes DN~ isolat~d fro~
a human megakaryocytic cell :line, whicb hybridizcs to a
Y~B~;TITUTE S~ET
WO93/15201` PCT/US93/00586
~ 4_
DNA fragment which hybridizes to DNA encoding an amino
acid sequence which is highly conserved in the catalytic
domain of protein tyrosine kinases of the c-kit subgroup.
The present invention also includes the proteins
5 encoded by the pT~ genes identified as described herein,
which exhibit significant sequence homology with members
of the c-kit subgroup of pTks (i.e. FLT/FLX tSAL-Sl), FGF
receptor (SAL-D4) or NGF receptor (LpTKS)) as well as the
proteins encoded by HpTK 5 and the bpTKs. The present
10 invention also includes SAL-S1, SAL-D4, and LpTK, HpTK and
bpTK homologues or equivalents (i.e., proteins which have
amino acid sequences substantially similar, but not
identical, to that of SAL-S1, SAL-D4, the LpTKs HpTK and
the bpTKs, which exhibit tyrosine kinase activity.) This
15 invention further includes peptides (SAL-S1, SA~-D4, LpTK,
HpTK and bpTK fragments) which retain tyrosine kinase
activity, yet are less than the entire SAL-S1, SAL-D4,
LpTK, HpTK and bpTK sequences), monoclonal and polyclonal
antibodies specific for SAL-Sl, SAL-D4, the LpTKs, HpTK
20 and the bpTKs, and uses for the SAL-S1, SAL-D4, the LpTK,
HpTK and the bpTK nucleic acid sequences and SAL-S1, SAL-
D4, ~pTK, HpTK and bpTK equivalents.
The present invention further includes nucleic acid
~ sequences which hybridize with DNA or RNA encoding the
;~ 25 proteins described herein, which exhibit significant
seguence homology with the FLT/F~K, FGF receptor or NGF
receptor family of protein tyrosine kinases contained
within the c-kit su~group. Such nucleic acid sequences
are useful as probes to identify pTK genes in other
30 vertebrates, particularly mammals, and in other cell
types. They can also be used as anti-sense
:
,.
..
WO93/15201 2 1 2 8 ~ 2 2 PCT/US93/~0586
oligonucleotides to inhibit protein tyrosine kinase
~ctivity, both in vitro and in vivo.
The SAL-Sl, SAL-D4, LpTK, HpTK and bpTX, tyrosine
kinases of the present invention can be used as target
5 proteins in conjunction with the development of drugs and
therapeutics to modulate cell growth, differentiation and
other metabolic functions. The SAL-Sl, SAL-D4, LpTK, HpTK
- or bpTX proteins can be used as agonists or antagonists to
other tyrosine kinases. The SAL-Sl, SAL-D4, LpTK, HpTX or
l0 bpTK tyrosine kinases can also be instrumental in the
modulation of megakaryocyte and/or platelet adhesion
interactions.
In addition, the SAL-Sl, SAL-D4, LpTK, HpTK and bpTK
~; tyrosine ki~lases can be used in screening assays to detect
15 cellular growth and/or differentiation factors. Using
standard laboratory techniques, the ligands of the pTKs of
the present invention can be identified. Once identified,
assays can be designed to detect these ligands present
; endogenously, within cells, as well as exogenously, in
20~ extra cellular fluids.~ Assays can also be designed as
diagnostic aids~to detect these ligands in body fluids
such as blood and urine.
Brief Description of the Drawinos
Figure l depicts the nucleotide sequence of SAL-Sl
(SEQ ID NO: 5) and the deduced amino acid sequence (SEQ ID
NO:6).
Figure 2 depicts the nucleotide sequence of SAL-D4
(SEQ ID NO:7) and its deduced amino acid sequence (SEQ ID
NO:8).
~,
I~c~ E~lA ~ lE~ .3~ 34 : ] ~: ~r~ i 175~ 15~ +~ J4 ~;r~
. .
~12S7~2
Figur~ 3A depi.cts t~e nucl~ot~ide sequence ( S Q ID
No: 9) and its deduced amino acid sequence (SEQ I~ N0
for LpTK 2.
Figure 3B depicts th~ nucleotide se~uence ISEQ I0
5 N0: ll) and its deduced a~ino acid sequ~nce (SEQ ID N0: 12)
f or LpTX 3 ~
Figure 3C depicts the n~cleotide sequence (SEQ ID
H0:13) and its ~}educed a~ino acid ~equence (SEQ ID N0:14
f ar LpT}~ 4 .
Fi~ure 3D depicts the nuclec)tide se~uence ~SEQ ID
N0:15) and its deduaed ar~ino acid seguence (SEQ ID N0:16)
~or the LpTX 13.
Figure 4~-4E~ depicts the full-ler~gth nucleo~ide
E,e~uence ~S~Q ID N0: 17~ and its ded~lced ~mino acid
15 6equence ~SEQ ID N0: 18~ for SA~-Sl.
Figure SA-SK depicts the full length nucleotide
- ~6equence ~SEQ ID N0: l9~ and the deduced amino acid
sequence ( SE;:~ I0 N0: 2 0 ) f or Lp~K2 .
Fign~re 6~ depict~; the partial nucleotide sequence
: 20. I~SEQ ID N0: 21) ~o~ ~pq~K4.
Figure 7A-7C depic~s the f~ll length nucleoti~e
sequence (SE~ ID N0: 2~) for Lp~25.
Flgure 8A-8I dep~.cts t~e full length nucl~otide ~,equer~ce
(SEQ II) N0: 23) and the deduced am~no acid ~e~luen~e (SEQ I~ N0: 24)
25 fo~ llpT~.
Figu~e 9 depicts the alnino acid sequence ~;EQ ID N0:
25~ o~ bpl~l.
; Figure 10 depicts the a~ino acid sequence tSE~ ID N0:
26) c~P bp~X2.
3 o Figure 11 depicts the ar~ino acid sec~uence (SEQ ID ~10:
z l l ~f ~pTK3 .
~CB~TITUTE ~T
W~93/15201 PCT/US93/00586
722
Figure 12 depicts the amino acid sequence (SEQ ID NO:
28) of bpTK4.
Figure 13 depicts the amino acid sequence (SEQ ID NO:
29) of bpTK5.
Figure 14 depicts the amino acid cequence (SEQ ID NO:
30) of bpTK7.
Detailed Des~ri~tion of the Invention
Novel protein tyrosine kinase genes have been
identified, their nucleic acid sequences determined, and
lo the amino acid ~equences of the encoded proteins
deduced. The genes isolated as described herein are
referred to, collectively, as protein tyrosine kinase
(pTK) genes. The nucleic acid sequences of these genes,
isolated as discussed herein, show significant homology to
15 with previously identified protein tyrosine kinases
containing extracellular domains which function as growth
fact~r receptors. These yenes have been shown to be
present in both megakaryocytic and lymphocytic cells.
To facilitate the isolation and identification of
20 these novel pTKs, two sets of DNA probes were used, as
described in the Exemplification. The first set consisted
of two degenerative oligonucleotide seguences, pTK 1 (SEQ
ID N0:1) and pTK 2 (SEQ ID NO:2) (Matthews, W. Cell 65:
1143 (1991; Wilks, A. F. Proc. Natl. Acad. Sci._USA
25 86:1603 (1989)). These sequences were used as primers in
a polymerase chain reaction to amplify tyrosine kinase DNA
segments. (Mullis, K. et al., Cold S~rinq Harbor Symp.
Advan. Biol. 51:263 (1986).
The second set consisted of two oligonucleotide
30 sequences ! pTK 3 (SEQ ID NO:3) and pTKKW tSEQ ID NO:4)
WO93/15201 PCT/US93/00586
designed to amplify the nucleic acid sequence which
encodes the highly conserved regions of the catalytic
domains of the c-kit family df protein tyrosine kinases.
These sequences were used as primers in the polymerase
5 chain reaction in a second round of DNA amplification.
Using this two-step amplification procedure, DNA fragments
which hybridized to these pTK primers were identified,
isolated and subsequently sequenced.
In particular, fourteen pTK genes exhibiting
10 significant homology with the c-kit subgroup of protein
tyrosine kinases have been identified. Two pTK genes,
referred to as SAL-Sl and SAL-D4 (also referred to as
; megakaryocyte derived FGF-like receptor) were identified
~; in several megakaryocytic cell lines, including CMK 11-5,
15 DAMI, UT-7 and UT-7 grown in erythropoietin, but not in
the erythroid cell lines ~EL, PMA stimulated HEL cells, or
K562. Five pTK genes, referred to as LpTKs, were
identified in lymphocytic, as well as in megakaryocytic
cells. One pTK gene, referred to as HpTK5 was identified
20 in human hepatoma cells and six genes, referred to as
bpTKs, were identified in human brain tissue.
SAL-Sl (SEQ ID NO:6 and 18) encoded by the nucleic
acid seque~ce SEQ ID NOS:5 and 17, exhibits significant
; homology with the FLT/FLK family of pTKs. SAL-D4 (SEQ ID
25 NO:8) encoded by SEQ ID NO:7, is related to the FGF
receptor family of pTKs, and one LpTK (LpTK 3 (SEQ ID
NO:12) encoded by the SEQ ID NO:ll, is related to the NGF
receptor family of pTKs. The remaining LpTKs, LpTK2 (SEQ
ID NO:10) encoded by SEQ ID NO:9; LpTK4 (SEQ ID NO:14)
30 encoded by SEQ ID NO:13; LpTK13 (SEQ ID NO:1~) encoded by
SEQ ID NO:15 LpTK25 encoded by SEQ ID NO: 22, also exhibit
WO93/152~1 PCT/US93/00586
. .
7 2 ~
~e~uence homology with known protein tyrosine kinases
(Data not ~hown).
HpTX5 (SEQ ID NO: 24) encoded by SEQ ID NO: 23 and
the bpTKs l, 2, 3, 4, 5 and 7 (SEQ ID NOS: 25-30
5 respectively, also exhibit sequence homology with known
protein tyrosine kinases.
Thus, as described above, DNA which hybridize with
DNA encoding amino acid sequences present in the catalytic
domain of a protein tyrosine kinase of the c-kit subgroup
l0 of protein kinases have been isolated and sequenced.
These isolated DNA sequences, collectively referred to as
pTKs genes, (and their deduced amino acid ~equences) have
been shown to exhibit significant sequence homology with
known members of receptor tyrosine kinase families.
~:
Once isolated, these DNA fragments can be amplified
- using known standard techniques such as PCR. These
amplified fragments can then be cloned into appropriate
cloning vectors and their DNA sequences determined.
; These DNA sequences czn be excised from the cloning
20 vectors, labeled with a radiolabeled nucleotide such as
32p and used to screen appropriate cDNA libraries to
obtain the full-length cDNA clone.
The pTk genes as described above have been isolated
from the source in which they occur naturally, i.e.
25 megakaryocyte and lymphocytic cells. The present invention
is intended to include pTk genes produced using genetic
engineering techniques, such as recombinant technology, as
well as pTk genes that are synthesized chemically.
The deduced amino acid sequences of the pTK genes
30 include amino acid sequences which encode peptides
exhibiting significant homology with the catalytic domain
.
WO93/15201 PCT/US93/00586
of protein tyrosine kinases of the c-kit subgroup of
tyrosine kinases. These proteins, encoded by the pTk
genes, can i~clude seguences in which functionally
equivalent amino acid residues are su~stituted for
5 residues within the sequence, resulting in a silent
change, that is a change not detected phenotypically. For
example, one or more amino acid residues within the
sequence can be substituted by another amino acid of a
similar polarity which acts as a functional equivalent,
lO resulting in a silent substitution.
In addition, the protein structure can be modified by
deletions, additions, inversion, insertions or
substitutions of one or more amino acid residues in the
sequence which do not substantially detract from the
15 desired functional tyrosine kinases properties of the
peptide.
Modified pTKs of the present invention, with receptor
tyrosine kinasè activity can be made using recombinant DNA
techniques, such as excising it from a vector containing a
;~ 20 cDNA encoding such a protein, or by synthesizing DNA
encoding the desired protein mechanically and/or
chemically using known techniques.
m~ ~ An alternate approach to producing the pTKs of the
present invention is to use peptide synthesis to make a
25 peptide or polypeptide having the amino acid sequence of
such a protein. The peptides or modified equivalents
~` thereof, can be synthesized directly by standard solid or
liquid phase chemistries for peptide synthesis.
Preferably, the pTKs of the present invention will be
30 produced by inserting DNA encoding the proteins into an
appropriate vector/host system where it will be expressed.
WO93/1~201 PCT/US93/00586
212~7.~2
The DNA sequences can be obtained from sources in which
they ~ccur naturally, can be chemically synthesized or can
be produced using ~tandard recombinant technology.
Thi~ invention also pertains to an expression vector
5 comprising a pTK gene of the present invention, encoding
for a protein which exhibits receptor tyrosine kinase
activity.
The pTK genes of the present invention can be used
for a number of diagnostic and therapeutic purposes. ~or
10 example, the nucleic acid sequences of the pTK genes can
be used as probes to identify other protein tyrosine
kinases present in other cell types, including eukaryotic
and prokaryotic cell types.
The nucleic acid sequences can be used to design
15 drugs that directly inhibit the kinase activity of protein
tyrosine kinases, or to design peptides that bind to the
catalytic domain of tyrosine kinases, thus inhibiting
their activity. These sequences can also be used to
~;; design anti-sense nucleotides that can also inhibit, or
0 destroy, tyrosine kinase activity. Such inhibition of
~yrosine kinase activity would be desirable in
pathological states where decreased cellular prolifération
would be beneficial, such as leukemias or other
ma~ignancies.
The nucleic acid sequences can also be used to desi~n
drugs, peptides or anti-sense nucleotides as above, but
with enhancing, rather than inhibitory effects, on
tyrosine kinases. Such enhanced tyrosine kinase activity
would result in increasing the phosphorylation of
30 substrates (exogenous, as well as endogenous tyrosine
residues). Enhanced effects would be desirable in states
~" ~ ~",. , , . , " .~, '. ~ i . ' ' ,' ', ' " ' ' , '
WO93/1~201 PCT/US93/00586
.
-12-
wh~re increased cellular proliferation would be
beneficial, ~uch as anemias, bleeding di~orders and during
surgical procedures.
The pTK genes of the present invention can also be
5 used to o~*ain ~oluble fragments of receptor tyrosine
kinases, capable of binding their respective ligands (i.e.
fibroblast growth factor).
` pTK genes encoding soluble receptor tyrosine kinase
fragments can be produced using recombinant DNA techniques
l0 or synthetically. In either case, the ~NA obtained
encodes a soluble pTK fragment which lacks a substantial
portion of the hydrophobic transmembrane region to permit
solubilization of the fragment.
These soluble pTK protein fragments can be introduced
15 exogenously to act as competitors with the endogenous,
membrane bound pTK for their respective ligands, thus
inhibiting tyrosine kinase activity. Alternately, a
modified soluble pTK protein fragment can be introduced
which binds the ligand but does not activate kinase
20 activity.
These soluble pTK protein fragments can also be used
in binding assays to detect ligands such as growth and
differentiation factors. Once these ligands are
identified, they may be altered or modified to inhibit or
25 enhance kinase activity. For example, the ligands may be
modified or attached to substances that are toxic to the
cell, such a ricin, thus destroying the target cell. The
substance may be a super-activating substance which, after
binding to the pTK, may substantially increase the kinase
30 activity, or activate other growth factors.
WO93/1520~ PCT/US93/00586
'~128722
-13-
pTk genes of the present invention would also be
useful to develop diagnostic tools for in Yitro screening
assays for ligands such as growth factors or
differentiation factors that inhibit or enhance kinase
5 activity. The proteins encoded by the pTK genes can also
be used in such assays, or as immunogens to produce
monoclonal or polyclonal antibodies to be used in such
assays.
Such antibodies can also be used in methods ~f
10 treating conditions in which an individual would benefit
therapeutically if protein tyrosine kinase activity could
be modified, such as increasing platelet production in
bleeding disorders.
The present invention will now be illustrated by the
15 following Exemplification, which is not intended to be
~: limiting in any way.
Exem~l_fication: The Identification and Isolation of the
pTK Genes
To facilitate the isolation and identification of
20 these novel pTK genes, two sets of DNA probes were used.
(See Table).
The first set consisted of two degenerative
oligonucleotide sequences, pTK 1 (SEQ ID NO:l) and pTK
2(SEQ ID NO:2). These sequences were used as polymerase
25 chain reaction (PCR) primers, using standard PCR
techniques, to amplify tyrosine kinase DNA segments.
The second set consisted of two oligonucleotide
sequences, pTK 3 ~SEQ ID NO:3) and pTKKW (SEQ ID NO:4)
selected from the highly conserved regions of the
30 catalytic domains of the c-kit subgroup of protein
WO93/15201 PCT/US93/0058~
C~
-14-
tyrosine kinases. These sequences were also used as
polymerase chain reaction primers in a second round of DNA
amplification. Using this two-step amplification
procedure, DNA fragments which hybridized to these pTK
5 primers were identified, isolated and subsequently
sequenced using known laboratory techniques.
TABLE
- ~irst Round of AmDlification
PTKl
10 CGGATCCACAGNGACCT
PTK2
"
~ GGAATTCCAAAGGACCAGACGTC
`~ Second Round of Am~lification
PTK3 (~it family specific)
15 CGGATCCATCCACAGAGATGT
PTKKW ~kit family specific)
GGAATTCCTTCAGGAGCCATCCACTT
E~uivalents
Those skilled in the art will recognize, or be able
20 to ascertain using no more than routine experimentation,
many equivalents to the specific embodiments of the
invention described herein. Such equivalents are intended
to be encompassed by the following claims.
.
