Note: Descriptions are shown in the official language in which they were submitted.
212~21~
HUMANISEI~ ANTIBODIES
This application is a division of our co-pending application Serial No.
2,037,607 filed March 6, 1991.
Field of the Invention
S The present invention relates to humanised antibody molecules, to processes for
their production using recombinant DNA technology, and to their therapeutic
uses.
The term "humanised antibody molecule" is used to describe a molecule having
an antigen binding site derived from an immunoglobulin from a non-human
species, and rem~ining immunoglobulin-derived parts of the molecule being
derived from a human immunoglobulin. The antigen binding site typically
comprises complementarity determining regions (CDRs) which determine the
binding specificity of the antibody molecule and which are carried on app-
ropriate framework regions in the variable domains. There are 3 CDRs (CDRl,
CDR2 and CDR3) in each of the heavy and light chain variable domains.
In the description, reference is made to a number of publications by number.
The publications are listed in numerical order at the end of the description.
Back~round of the Invention
Natural immunoglobulins have been known for many years, as have the various
fragments thereof, such as the Fab, (Fab')2 and Fc fragments, which can be
derived by enzymatic cleavage. Natural immunoglobulins comprise a generally
Y-shaped molecule having an antigen-binding site towards the end of each
upper arm. The remainder of the structure, and particularly the stem of the Y,
mediates the effector functions associated with immunoglobulins.
Natural immunoglobulins have been used in assay, diagnosis and, to a more
limited extent, therapy. However, such uses, especially in therapy, were
hindered until recently by the polyclonal nature of natural immunoglobulins.
A significant step towards the realisation of the potential
' ' - 2 - 21~9213
Of ;mm-lnoglobulins as therapeutic agents was the discovery
of procedures for the production of monoclonal antibodies
(MAbs) of defined specificity (l).
However, most MAbs are produced by hybridomas which are
fusions of rodent spleen cells with rodent myeloma
cells. They are therefore essentially rodent proteins.
There are very few reports of the production of human MAbs.
Since most available MAbs are of rodent origin, they are
naturally antigenic in humans and thus can give rise to an
undesirable immune response termed the EAMA (Human
Anti-Mouse Antibody~ response. Therefore, the use of
rodent MAbs as therapeutic agent~ in humans is inherently
limited by the fact that the human subject will mount an
immunological response to the MAb and will either remove
it entirely or at least reduce its effectiveness. In
practice, MAbs of rodent origin may not be used in
patients for more than one or a few treatments as a ~AMA
response soon develops rendering the ~Ab ineffective as
well as giving rise to undesirable reactions. For
instance, OKT3 a mouse IgG2a/k MAb which recognises an
antigen in the T-cell receptor-CD3 complex has been
approved for use in many countries throughout the world
as an immunosuppressant in the treatment of acute
allograft rejection [Chatenoud et al (2) and Jeffers et al
(3)]. However, in view of the rodent nature of this and
other such MAbs, a significant HAMA response which may
include a major anti-idiotype component, may build up on
use. Clearly, it would be highly desirable to ~;mi n; sh
or abolish this undesirable ~AMA response and thus enlarge
the areas of use of these very useful antibodies.
Proposals have therefore been made to render non-human
MAbs less antigenic in humans. Such techniques can be
generically termed ~humanisation" techniques. These
~ 3 _ 2~ 2~2~
techniques typically involve the use of recombinant DNA
technology to manipulate DNA se~uences encoding the
polypeptide chains of the antibody molecule.
Early methods for humanising MAbs involved production o~
chimeric antibodies in which an antigen binding site
comprising the complete variable domains of one antibody
is linked to constant domains derived from another
antibody. Methods for carrying out such chimerisation
procedures are described in EP0120694 ~Celltech Limited),
EP0125023 (Genentech Inc. and City of Hope), EP-A-O 171496
(Res. Dev. Corp. Japan), EP-A-O 173 494 (Stanford
University), and WO 86fO1533 (Celltech Limited). This
latter Celltech application (WO 86/01533) discloses a
process for preparing an antibody molecule having the
variable domains from a mouse MAb and the constant ~om~; n~
from a human immunoglobulin. Such humanised chimeric
antibodies, however, still contain a significant
proportion of non-human amino acid sequence, i.e. the
complete non-human variable domains, and thus may still
elicit some HAMA response, particularly if ~m; n; stered
over a prolonged period tBegent et al (ref. 4)~.
In an alternative approach, described in EP-A-0239400
(Winter), the complementarity determining regions (CDRs)
o~ a mouse MAb have been grafted onto the framewor~
regions o~ the variable domains of a human immunoglobulin
by site directed mutagenesis using long oligonucleotides.
The present invention relates to humanised antibody
molecules prepared according to this alternative approach,
i.e. CDR-grafted humanised antibody molecules. Such
CDR-grafted humanised antibodies are much less likely to
give rise to a HAMA response than humanised chimeric
antibodies in view of the much lower proportion of
non-human amino acid se~uence which they contain.
_ 4 - ~ ~292~
The earliest wor~ on humanising MAbs by CDR-grafting was
carried out on MAbs recognising synthetic antigens, such
as the NP or NIP antigens. ~owever, examples in which a
mouse MAb recognising lysozyme and a rat MAb recognising
an antigen on human T-cells were hllmAn;sed by CDR-grafting
have been described by Verhoeyen et al (5) and Riech~nn
et al (6) respectively. The preparation of CDR-grafted
antibody to the antigen on human T cells is also described
in WO 89/07452 (Medical Research Council).
In Riechmann et al/Medical Research Council it wa~ found
that transfer of the CDR regions alone ras defined by
Kabat refs. (7) and (8)] was not sufficient to provide
satisfactory antigen binding activity in the CDR-grafted
product. Riechmann et al found that it was necessary to
convert a serine residue at position 27 of the human
sequence to the corresponding rat phenylalanine residue to
obtain a CDR-grafted product having improved antigen
binding activity. This residue at position 27 of the
heavy chain is within the structural loop adjacent to
CDR1. A further construct which additionally contained a
human serine to rat tyrosine change at position 30 of the
heavy chain did not have a significantly altered binding
activity over the humanised antibody with the serine to
phenylalanine change at position 27 alone. These results
indicate that changes to residues of the human sequence
outside the CDR regions, in particular in the structural
loop adjacent to CDR1, may be necessary to obtain
effective antigen binding activity for CDR-grafted
antibodies which recognise more complex antigens. Even
so the binding affinity of the best CDR-grafted antibodies
obtained wa~ still significantly less than the original
MAb.
Very recently Queen et al (9) have described the
preparation of a humanised antibody that binds to the
. - 5 - 2~292
.
interleukin 2 receptor, by combining the CDRs of a murine
MAb (anti-Tac) with human immunoglobulin framework and
constant regions. The human framework regions were
chosen to m~i m; se homology with the anti-Tac MAb
sequence. In addition computer modelling was used to
identify framework amino acid residues which were li~ely
to interact with the CDRs or antigen, and mouse ~;no
acids were used at these positions in the humanised
antibody.
In WO 90/07861 Queen et al propose four criteria for
designing humanised immunoglobulins. The first criterion
is to use as the human acceptor the framewor~ from a
particular human immunoglobulin that is unusually
homologou~ to the non-human donor immunoglobulin to be
humanised, or to use a consensus framework from many h~ n
antibodies. The second criterion is to use the donor
amino acid rather than the acceptor if the human acceptor
residue is unusual and the donor re~idue i~ typical for
human sequences at a specific residue of the framewor~.
The third criterion is to use the donor framework amino
acid residue rather than the acceptor at positions
immediately adjacent to the CDRs. The fourth criterion
is to use the donor amino acid residue at framewor~
positions at which the amino acid is predicted to have a
side chain atom within about 3 ~ of the CDRs in a
three-dimensional immunoglo~ulin model and to be capable
of interacting with the antigen or with the CDRs of the
humanised immunoglobulin. It is proposed that criteria
two, three or four may be applied in addition or
alternatively to criterion one, and may be applied singly
or in any combination.
WO 90/07861 describes in detail the preparation of a
single CDR-grafted humanised antibody, a humanised
antibody having specificity for the p55 Tac protein of the
~ 6 - 2~292~ ~
IL-2 receptor. The combination of all four criteria, as
above, were employed in designing this humanised antibody,
the variable region frameworks of the human antibody Eu
(7) being used as acceptor. In the resultant hllm~nised
antibody the donor CDRs were as defined by Kabat et al (7
and 8) and in addition the mouse donor residues were used
in place of the human acceptor residues, at positions 27,
30, 48, 66, 67, 89, 91, 94, 103, 104, 105 and 107 in the
heavy chain and at positions 48, 60 and 63 in the light
chain, of the variable region frameworks. The humanised
anti-Tac antibody obtained is reported to have an affinity
for p55 of 3 x 109 M-1, about one-third of that of the
murine MAb.
We have further investigated the preparation of CDR-
grafted humanised antibody molecules and have identified a
hierarchy of positions within the framework of the
variable regions (i.e. outside both the Kabat CDRs and
structural loops of the variable regions) at which the
amino acid identities of the residues are important for
obtaining CDR-grafted products with satisfactory binding
affinity. This has ena~led us to establish a protocol
for obtaining satisfactory CDR-grafted products which may
be applied very widely irrespective of the level of
homology between the donor ;~munoglobulin and acceptor
framework. The set of residues which we have identified
as being of critical importance does not coincide with the
residues identified by Queen et al (9).
Summary of the Invention
Accordingly, in a first aspect the invention provides a
CDR-grafted antibody heavy chain having a variable region
domain comprising acceptor framework and donor antigen
binding regions wherein the framework comprises donor
residues at at least one of positions 6, 23 and/or 24, 48
and/or 49, 71 and/or 73, 75 and/or 76 and/or 78 and 88 and/
or 91.
-
' _ 7 _ 21292
In preferred embodiment~, the heavy chain framewor~
comprises donor residues at positions 23, 24, 49, 71, 73
and 78 or at positions 23, 24 and 49. The residue~ at
positions 71, 73 and 78 of the heavy chain framework are
preferably either all acceptor or all donor residues.
In particularly preferred embodiments the heavy chain
framework additionally comprises donor residues at one,
some or all of positions 6, 37, 48 and 94. Also it is
particularly preferred that residues at positions of the
heavy chain framework which are commonly conserved across
species, i.e. positions 2, 4, 25, 36, 39, 47, 93, 103,
104, 106 and 107, if not conserved between donor and
acceptor, additionally comprise donor residues. ~ost
preferably the heavy chain framework additionally
lS comprises donor residues at positions 2, 4, 6, 25, 36, 37,
39, 47, 48, 93, 94, 103 r 104, 106 and 107.
In addition the heavy chain framework optionally comprises
donor residues at one, some or all of positions:
1 and 3,
72 and 76,
69 (if 48 is different between donor and acceptor),
38 and 46 (if 48 is the donor residue),
80 and 20 (if 69 is the donor residue),
67,
82 and 18 (if ~7 is the donor residue),
91,
88, and
any one or more of 9, 11, 41r 87, 108, 110 and 112.
In the first and other aspects of the present invention
reference is made to CDR-gra~ted antibody products
comprising acceptor framework and donor antigen binding
regions. It will be appreciated that the invention is
widely applicable to the CDR-grafting of anti~odies in
~c
- 8 - ~ 2~2~
. ~
general. Thus, the donor and acceptor antibodies may be
derived from ~n;mAls of the same species and even same
antibody class or sub-class. More usually, however, the
donor and acceptor antibodies are derived from ~n;~l S of
different species. Typically the donor antibody is a
non-human antibody, such as a rodent MAb, and the acceptor
antibody i5 a human antibody.
In the first and other aspects of the present invention,
the donor antigen binding region typically comprises at
102 least one CDR from the donor antibody. Usually the donor
antigen binding region comprises at least two and
preferably all three CDRs of each of the heavy chain
and/or light chain variable regions. The CDRs may
comprise the Kabat CDRs, the structural loop CDRs or a
15 composite of the Kabat and structural loop CDRs and any
combination of any of these. Preferably, the antigen
binding regions of the CDR-grafted heavy chain variable
domain comprise CDRs corresponding to the Kabat CDRs at
CDR2 (residues 50-65) and CDR3 (residues 95-100) and a
20 composite of the Kabat and structural loop CDRs at CDRl
(residues 26-35).
The residue designations given above and elsewhere in the
present application are n1lmhered according to the Kabat
numbering ~refs. (7) and (8)]. Thus the residue
25 designations do not always correspond directly with the
linear numbering of the amino acid residues. The actual
linear amino acid se~uence may contain fewer or additional
aMino acids than in the strict Ka~at numbering
corresponding to a shortening of, or insertion into, a
30 structural component, whether framewor~ or CDR, of the
basic variable domain structure. For example, the heavy
chain variable region of the anti-Tac antibody described
by Queen et al (9) contains a single amino acid insert
(residue 52a) after residue 52 of CDR2 and a three amino
-
~ 9 ~ 212~2~
~
acid insert (residues 82a, 82b and 82c) after framework
residue 82, in the Rabat numhering. The correct Kabat
numbering of residues may be determined for a given
antibody by alignment at regions of homology of the
sequence of the antibody with a "st~n~Ard" Kabat numbered
sequence.
The invention also provides in a second aspect a CDR-
grafted antibody light chain having a variable region
domain comprising acceptor framework and donor antigen
binding regions wherein the framework comprises donor
residues at at least one of position~ 1 and/or 3 and 46
and/or 47. Preferably the CD~ grafted light chain of the
second aspect comprises donor residues at positions 46
and/or 47.
The invention also provides in a third aspect a
CDR-grafted antibody light chain having a variable region
domain comprising acceptor framework and donor antigen
binding regions wherein the framework comprises donor
residues at at least one of positions 46, 48, 58 and 71.
ZO In a preferred embodiment o~ the third aspect, the
framework comprises donor residues at all of positions 46,
48, 58 and 71.
In particularly preferred embodiments of the second and
third aspects, the framewor~ additionally comprises donor
residues at positions 36, 44, 47, 85 and 87. Similarly
positions of the light chain framework which are commonly
conserved across species, i.e. positions 2, 4, 6, 35, 49,
62, 64-69, 98, 99, 101 and 102, if not conserved between
donor and acceptor, additionally comprise donor residues.
Most preferably the light chain framework additionally
comprises donor residues at positions 2, 4, 6, 35, 36, 38,
44, 47, 49, 62, 64-69, 85, 87, 98, 99, 101 and 102.
~292~
-- 10 --
.
In addition the framewor~ of the second or third aspects
optionally comprises donor residues at one, some or all of
positions:
1 and 3,
63,
60 (if 60 and 54 are able to form at potential saltbridge),
70 (if 70 and 24 are able to form a potential saltbridge)r
73 and 21 (if 47 is different between donor and acceptGr),
37 and 45 (if 47 is different between donor and acceptor),
and
any one or more of 10, 12, 40, 80, 103 and 105.
Preferably, the antigen binding regions of the CDR-grafted
light chain variable domain comprise CDRs corresponding to
the Kabat CDRs at CDR1 (residue 24-34), CDR2 (residues
50-5~) and CDR3 (residues 89-97).
The invention further provides in a fourth aspect a
C~-grafted antibody molecule comprising at least one
CDR-grafted heavy chain and at least one CDR-grafted light
chain according to the first and second or first and third
aspect~ of the invention.
The humanised antibody molecules and chains of the present
in~ention may comprise: a complete antibody molecule,
having full length heavy and light chains; a fragment
thereof, such as a Fab, (Fab')2 or FV fragment; a light
chain or heavy chain monomer or dimer; or a single chain
antibody, e.g. a single chain FV in which heavy and light
chain variable regions are joined by a peptide lin~er; or
any other CD~-grafted molecule with the same specificity
as the original donor antibody. Similarly the
CD~-grafted heavy and light chain variable region may be
combined with other antibody d~m~; n5 as appropriate.
2~2921 ~
, ~
Also the heavy or light chains or humanised antihody
molecules of the present invention may have attached to
them an effector or reporter molecule. For instance, it
may have a macrocycle, for chelating a heavy metal atom,
or a toxin, such as ricin, attached to it by a covalent
bridging structure. Alternatively, the procedures of
recombinant DNA technology may be used to produce an
immunoglobulin molecule in which the Fc fragment or C~3
domain of a complete immunoglobulin molecule has been
replaced by, or has attached thereto by peptide linkage, a
functional non-immunoglobulin protein, such as an enzyme
or toxin molecule.
Any appropriate acceptor variable region framework
sequences may be used having regard to class/type of the
donor antibody from which the antigen binding regions are
derived. Preferably, the type of acceptor framework used
is of the same/similar class/type as the donor antibody.
Conveniently, the framewor~ may be chosen to m~;m; se/
optimise homology with the donor antibody sequence
particularly at positions close or adjacent to the CDRs.
However, a high level of homology between donor and
acceptor sequences is not important for application of the
present invention. The present invention identifies a
hierarchy of framework residue positions at which donor
residues may be lmportant or desirable for obt~;n;ng a
~DR-grafted antibody product having satisfactory binding
properties. The CDR-grafted products usually have
binding affinities of at lea~t 105 M-1, preferably at
lea~t about 108 M~1, or especially in the range 108-1012
~-l In principle, the present invention i8 applicable
to any combination of donor and acceptor antibodies
irre~pect~ve o~ the level of homology between their
sequences. A protocol for applying the invention to any
particular donor-acceptor antibody pair is given
hereinafter. Examples of human frameworks which may be
12 ~ ~1292~9
used are KOL, NEWM, REI, EU, LAY and POM (refs. 4 and 5)
and the like; for instance KOL and NEWM for the heavy
chain and REI for the light chain and EU, LAY and POM for
both the heavy chain and the light chain.
Also the constant region domains of the products of the
invention may be selected having regard to the proposed
function of the antibody in particular the effector
functions which may be required. For example, the
constant region domains may be human IgA, IgE, IgG or IgM
domains. In particular, IgG human constant region
domains may be used, especially of the IgGl and IgG3
isotypes, when the humanised antibody molecule is intended
for therapeutic uses, and anti~ody effector functions are
required. Alternatively, IgG2 and IgG4 isotypes may be
used when the humanised antibody molecul~ is intended for
therapeutic purposes and anti~ody effector functions are
not required, e.g. for simple blocking of lymphokine
activity.
However, the remainder of the antibody molecules need not
comprise only protein sequences from immunoglobulins.
For instance, a gene may be constructed in which a DNA
sequence encoding part of a human immunoglobulin chain is
fused to a DNA sequence encoding the amino acid sequence
of a functional polypeptide such as an effector or
Z5 reporter molecule.
Preferably the CDR-grafted antibody heavy and light chain
and antibody molecule products are produced by recombinant
DNA technology.
Thus in further aspects the invention also includes DNA
sequences coding for the CDR-grafted heavy and light
chains, cloning and expression vectors cont~;n;ng the DNA
sequences, host cell~ transformed with the DNA sequences
~ ~ 13 2~292~
and processes for producing the CDR-grafted chains and
antibody molecules comprising expressing the DNA sequences
in the transformed host cells.
The general methods by which the vectors may be
constructed, transfection methods and culture methods are
well ~nown per se and form no part of the invention. Such
methods are shown, for instance, in references 10 and 11.
The DNA sequences which encode the donor amino acid
sequence may be obtained by methods well known in the
art. For example the donor coding sequences may be
obtained by genomic cloning, or cDNA cloning from suitable
hybridoma cell lines. Positive clones may be screened
using appropriate probes for the heavy and light chain
genes in question. Also PCR cloning may be used.
DNA coding for acceptor, e.g. human acceptor, sequences
may be obtained in any appropriate way. For example DNA
sequences coding for preferred human acceptor fra~ewor~s
such as KOL, REI, EU and NEWM, are widely available to
wor~ers in the art.
The standard techniques o~ molecular biology may be used
to prepare DNA sequences coding for the CDR-grafted
products. Desired DNA sequences may be synthesised
completely or in part using oligonucleotlde synthesis
techniques. Site-directed mutagenesis and polymerase
chain reaction (PCR) techniques may be used as
appropriate. For example oligonucleotide directed
synthesis as described by Jones et al (ref. 20) may be
used. Also oligonucleotide directed mutagenesis of a
pre-exising variable region as, for example, described by
Verhoeyen et al (ref. 5) or Riechmann et al (ref. 6) may
be used. Also enzymatic filling in of gapped
~ - 14 - ~29~
oligonucleotides using T4 DNA polymerase as, for example,
described by Queen et al (ref. 9) may be used.
Any suitable host cell/vector system may be used for
expression of the DNA sequences coding for the CDR-grafted
heavy and light chains. Bacterial e.g. E. coli, and
other microbial systems may be used, in particular for
expression of antibody fragment~ such as FAb and (Fab')2
fragments, and especially FV fragments and ~ingle chain
antibody fragments e.g. single chain FVs. Eucaryotic
e.g. m~ lian host cell expression systems may be used
for production of larger CDR-grafted antibody products,
including complete antibody molecules. Suitable
m~m~ n host cells include C~O cells and myeloma or
hybridoma cell line~.
Thus, in a further aspect the present invention provides a
process for producing a CDR-grafted antibody product
comprising:
(a) producing in an expression vector an operon having a
DNA sequence which encodes an antibody heavy chain
according to the first aspect of the invention;
and/or
(b) producing in an expression vector an operon having a
DNA sequence which encodes a complementary antibody
light chain according to the second or third aspect
z5 of the invention;
(c) transfecting a host cell with the or each vector
o~ part (a) and/or part (b); and
(d) culturing the trans~ected cell line to produce the
CDR-gra~ted antibody product
A
,.~
- 15 - 212921~
.--
The CDR-grafted product may comprise only heavy or light
chain derived polypeptide, in which case only a heavy
chain or light chain polypeptide coding sequence is used
to transfect the host cells.
For production of products comprising both heavy and light
chains, the cell line may be transfected with two vectors,
the first vector may contain an operon encoding a light
chain-derived polypeptide and the second vector cont~; n; ng
an operon encoding a heavy chain-derived polypeptide.
Preferably, the vectors are identical, except in so far as
the coding sequences and selectable marker~ are concerned,
so as to ensure as far as possible that each polypeptide
chain is equally expressed. Alternatively, a single
vector may be used, the vector including the sequences
encoding both light chain- and heavy chain-derived
polypeptides.
The DNA in the coding sequence~ for the light and heavy
chains may comprise cDNA or genomic DNA or both.
However, it is preferred that the DNA sequence encoding
the heavy or light chain comprises at least partially,
genomic DNA, preferably a fusion of cDNA and genomic DNA.
The presen~ invention i5 applicab~e to antibodies of any
appropriate specificity. Advantageously, however, the
invention may be applied to the humanisation of non-human
antibodies which are used for in vivo therapy or
diagnosis. Thus the antibodies may be site-specific
antibodies such as tumour-specific or cell surface-
speciflc antibodies, suitable for use in in vivo therapy
or diagnosis, e.g. tumour imaging. Examples of cell
surface-specific antibodies are anti-T cell antibodies,
such as anti-CD3, and CD4 and adhesion molec~les, suc~ as
CR3, ICAM and E~AM. The antibodies may have specificity
for interleukins (including lymphokines, growth factors
and stimulating factors), hormone~ and other biologically
active compounds, and receptors for any of these. For
~.- ' 212~2~ ~
- 16 -
example, the antibodies may have specificity for any of
the following: InterferonsC~,~, ~ or~, IL1, IL2, I~3,
or IL4, etc., TNF, GCSF, GMCSF, EPO, hGH, or insulin, etc.
The the present invention also includes therapeutic and
diagnostic compositions comprising the CDR-grafted
products of the invention and uses of such compositions in
therapy and diagnosis.
Accordingly in a further aspect the invention provides a
therapeutic or diagnostic composition comprising a
CDR-grafted antibody heavy or light chain or molecule
according to previous aspects of the invention in
combination with a pharmaceutically acceptable carrier,
diluent or excipient.
Accordingly also the invention provides a method of
therapy or diagnosis comprising administering an effective
amount of a CDR-grafted antibody heavy or light chain or
molecule according to previous aspects of the invention to
a human or ~ n; m~ 1 subject.
A preferred protocol for obtaining CDR-grafted antibody
heavy and light chains in accordance with the present
invention is set out below together with the rationale by
which we have derived this protocol. This protocol and
rationale are given without prejudice to the generality of
the invention as hereinbefore described and defined.
Protocol
It is first of all necessary to sequence the DNA coding
for the heavy and light chain variable regions of the
donor antibody, to determine their amino acid sequences.
It is also necessary to choose appropriate acceptor heavy
and light chain variable regions, of known amino acid
sequence. The CDR-grafted chain is then designed
212~21~
- 17 -
starting from the basis of the acceptor sequence. It
will be appreciated that in some cases the donor and
acceptor ~m;no acid residues may be identical at a
particular position and thus no change of acceptor
framework residue is required.
1. As a first step donor residues are su~stituted for
acceptor residues in the CDRs. For this purpose the
CDRs are preferably defined as follows:
~eavy chain - CDRl: residues 26-35
1~ - CDR2: residues 50-65
- CDR3: residues 95-102
~ight chain - CDRl: residues 24-34
- CDR2: residues 50-56
- CDR3: residues 8~-97
The positions at which donor residues are to be
substituted for acceptor in the framework are then
chosen as follows, first of all with respect to the
heavy chain and subsequently with respect to the
light chain.
2. ~eavy Chain
2.1 Choose donor residues at all of positions 23, 24, 49,
71, 73 and 78 of the heavy chain or all of positions
23, 2 4 and 49 (71, 73 and 78 are always either all
donor or all acceptor).
2. 2 Check that the following have the same ~;no acid in
donor and acceptor sequences, and if not preferably
choose the donor: 2, 4, 6, 25, 36, 37, 39, 41, 48,
93, g4, 103, 104, 106 and 107.
.
- 18 _ 212~9
.
2.3 To further optimise affinity consider choosing donor
residues at one, some or any of:
i. 1, 3
ii. 72, 76
iii. If 48 is different between donor and acceptor
se~uences, consider 69
iv. If at 48 the donor residue is chosen, conslder
38 and 46
v. If at 69 the donor residue is chosen, consider
80 and then 20
vi. 67
vii. If at 67 the donor residue is chosen, consider
82 and then 18
viii . 9 1
ix. 88
x. 9, 11, 41, 87, 108, 110, 112
3. Liqht Chain
3.1 Choose donor at 46, 48, 58 and 71
3.2 Check that the following have the same amino acid in
donor and acceptor sequences, if not preferably
choose donor:
2, 4, 6, 35, 38, 44, 47, 49, 62, 64-69 inclusive, 85,
87, 98, 99, 101 and 102
3.3 To further optimise affinity consider choosing donor
residues at one, some or any of:
i. 1, 3
ii. 63
''' ' -l9-2l2~2~
iii. 60, if 60 and 54 are able to form potential
saltbridge
iv. 70, if 70 and 24 are able to form potential
saltbridge
v. 73, and 21 if 47 is different between donor and
acceptor
vi. 37, and 45 if 47 is different between donor and
acceptor
vii. 10, 12, 40, 80, 103, 105
Rationale
In order to transfer the binding site of an antibody into
a different acceptor framework, a number of factor~ need
to be considered.
1. The extent of the CDRs
The CDRs (Complementary Determin;ng Regions) were
defined by Wu and ~abat (refs. 4 and 5) on the
basis of an analysis of the variability of
different regions of antibody variable regions.
Three regions per domain were recognised. In
the light chain the sequences are 24-34, 50-56,
89-97 (numbering according to ~abat (ref. 4), Eu
Index) inclusive and in the heavy chain the
sequences are 31-35, 50-65 and ~5-102 inclusive.
When antibody structures became available it
became apparent that these CDR regions
corresponded in the main to loop regions which
extended from the ~ barrel framewor~ of the light
and heavy variable domains. For Hl there was a
discrepancy in that the loop was from 26 to 32
inclusive and for H2 the loop was 52 to 56 and
for L2 from 50 to 53. ~owever, with the
exception of ~1 the CDR regions encompassed the
loop regions and extended into the ~ strand
2~ 29~ ~
- 20 -
framewor~s. In Hl residue 26 tends to be a
serine and 27 a phenylalanine or tyro~ine,
residue 29 is a phenylalanine in most case~.
Residues 28 and 30 which are surface residue~
exposed to solvent might be involved in
antigen-binding. A prudent definition of the ~1
CDR therefore would include residues 26-35 to
include both the loop region and the
hypervariable residues 33-35.
It is of interest to note the example of
Riechm~nn et al (ref. 3), who used the residue
31-35 choice for CDR-Hl. In order to produce
efficient antigen binding, residue 27 also needed
to be recruited from the donor (rat) antibody.
2. Non-CDR residues which contribute to antiqen
bindinq
By examination of available X-ray structures we
have identified a number of residues which may
have an effect on net antigen binding and which
can be demonstrated by experiment. These
residues can be sub-divided into a number of
groups.
2.1 Surface residues near CDR tall numbering as in
Kabat et al (ref. 7)].
2.1.1. Heavy Chain - Key residues are 23, 71 and 73.
Other residues which may contribute to a lesser
extent are 1, 3 and 76. Finally 25 is usually
conserved but the murine residue should be used
if there is a difference.
2.1.2 Light Chain - Many residues close to the CDRs,
e.g. 63, 65, 67 and 69 are conserved. If
conserved none of the surface residues in the
light chain are likely to have a ma~or effect.
However, if the murine residue at these positions
~ 2~2~2~
- 21 -
is unusual, then it would be of benefit to
analyse the likely contribution more closely.
Other residues which may also contri~ute to
~inding are 1 and 3, and also 60 and 70 if the
residues at these positions and at 54 and 24
respectively are potentially able to form a salt
bridge i.e. 60 + 54; 70 + 24.
2.2 Packing residues near the CDRs.
2.2.1. Heavy Chain - Rey residues are 24, 49 and 78.
Other key residues would be 36 if not a
tryptophan, 94 if not an arginine, 104 and 106 if
not glycines and 107 if not a threonine.
Residues which may make a further contribution to
stable packing of the heavy chain and hence
improved affinity are 2, 4, 6, 38, 46, 67 and
69. 67 packs against the CDR residue 63 and
this pair could be either both mouse or both
human. Finally, residues which contribute to
packing in this region but from a longer range
are 18, 20, 80, 82 and 86. 82 packs against 67
and in turn 18 packs against 82. 80 packs
against 69 and in turn 20 packs against 80. 86
forms an ~ bond network with 38 and 46. Many of
the mouse-human differences appear minor e.g.
~eu-Ile, but could have an minor impact on
correct packing which could translate into
altered positioning of the CDRs.
2.2.2. Light Chain - Key residues are 48, 58 and 71.
Other key residues would be 6 if not glutamine,
35 if not tryptophan, 62 if not phenylalanine or
tryosine, 64, 66, 68, 99 and 101 if not glycines
and 102 if not a threonine. Residues which make
a further contribution are 2, 4, 37, 45 and 47.
Finally residues 73 and 21 and 19 may make long
distance packing contributions of a minor nature.
~ 22 21~2~9
_
-
2.3. Residues at the variable domain interface ~etween
heavy and light chains - In both the light and
heavy chains most of the non-CDR interface
residues are conserved. If a conserved residue
is replaced by a residue of different character,
e.g. size or charge, it should be considered for
retention as the murine residue.
2.3.1. Heavy Chain - Residues which need to be
considered are 37 if the residue is not a valine
but is of larger side chain volume or has a
charge or polarity. Other residues are 39 if
not a glutamine, 45 if not a leucine, 47 if not a
tryptophan, 91 if not a phenylalanine or
tyrosine, 93 if not an alanine and 103 if not a
tryptophan. Residue 89 is also at the interface
but is not in a position where the side chain
could be of great impact.
2.3.2. Light Chain - Residues which need to be
considered are 36, if not a tyrosine, 38 if not a
glutamine, 44 if not a proline, 46, 49 if not a
tyrosine, residue 85, residue 87 if not a
tyrosine and 98 if not a phenylalanine.
2.4. Variable-Constant region interface - The elbow
angle between variable and constant regions may
be affected by alterations in packing of key
residues in the variable region against the
constant region which may affect the position of
VL and VH with respect to one another.
Therefore it is worth noting the residues likely
to be in contact with the constant region. In
the heavy chain the surface residues potentially
in contact with the variable region are conserved
between mouse and human antibodies therefore the
variable region contact residues may influence
the V-C interaction. In the light chain the
amino acids found at a number of the constant
' ~ ~ 23 2~ 2~2~
_
-
region contact points vary, and the V ~ C regions
are not in such close proximity as the heavy
chain. Therefore the influences of the light
chain V-C interface may be minor.
2.4.1. Heavy Chain - Contact residues are 7, 11, 41, 87,
108, 110, 112.
2.4.2. Light Chain - In the light chain potentially
contacting residues are 10, 12, 40, 80, 83, 103
and 105.
The above analysis coupled with our considerable practical
experimental experience in the CDR-grafting of a number of
different antibodies have lead us to the protocol given
a~ove.
The present invention is now described, by way of example
only, with reference to the accompanying Figures 1 - 13.
Brief Description of the Figures
Figure 1 shows DNA and amino acid sequences of the OKT3
light chain;
Figure 2 shows DNA and amino acid sequences of the OKT3
heavy chain;
Figure 3 shows the alignment of the OKT3 light variable
region amino acid sequence with that of the
light variable region of the human anti~ody REI;
Figure 4 shows the alignment of the OKT3 heavy variable
region amino acid sequence with that of the
heavy variable region of the human antibody KOL;
F-gure 5 sh~wc the hea~.~ v~riable region am-ino aGid
sequences of OKT3, KOL and various
corresponding CDR grafts;
Figure 6 shows the light variable region amino acid
sequences of OKT3, REI and various
corresponding CDR grafts;
~- 24 - 2129i~-~ 3
Figure 7 shows a graph of binding assay results for
various grafted OKT3 antibodies'
Figure 8 shows a graph of blocking assay results for
various grafted OKT3 antibodies;
Figure 9 shows a similar graph of blocking assay results;
Figure 10 shows similar graphs for both binding assay and
blocking assay results;
Figure 11 shows further similar graphs for both binding
assay and blocking assay results;
10Figure 12 shows a graph of competition assay results for
a m;n;m~lly grafted OKT3 antibody compared with
the OKT3 murine reference standard, and
Figure 13 shows a similar graph of competition assay
results comparing a fully grafted OKT3 antibody
15with the murine reference standard.
~ - 25 - 2 ~ 2 ~ 2 ~ 9
DE~TTRn ~ESCRIPTION OF ~MBODI~ENTS OF TEE lNv~Nl~lON
EXAMPL~ 1
CDR-GRAFTING OF OKT3
MATERIAL AND METHODS
1. INCOMING C~LLS
~ybridoma cells producing antibody OKT3 were provided
by Ortho (seedlot 4882.1) and were grown up in
antibiotic free Dulbecco's Modified Eagles Medium
(DMEM) supplemented with glutamine and 5~ foetal calf
serum, and divided to provide both an overgrown
supernatant for evaluation and cells for extraction
of RNA. The overgrown supernatant was shown to
contain 250 ug/mL murine IgG2a/kappa antibody. The
supernatant was negative for murine lambda light
chain and IgGl, IgG2b, IgG3, IgA and IgM heavy
chain. 20mL of supernatant was assayed to confirm
that the antibody present was ORT3.
2. MOLECULAR BIOLOGY PROCEDURRS
Basic molecular biology procedures were as described
in Maniatis et al (ref. 9) with, in some cases, minor
modifications. DNA sequencing was performed as
described in Sanger et al (ref. ll) and the Amersham
International Plc sequencing handbook. Site
directed mutagenesis was as described in Kramer et al
~ref. 12~ and the Anglian Biotechnology Ltd.
handbook. COS cell expression and metabolic
labelling studies were as described in Whittle et al
(ref. 13)
~ - 26 - 2~29~
.
3. RESEARCH ASSAYS
3.1. ASSEMBLY ASSAYS
Assembly assays were performed on supernatants
from transfected COS cells to determine the amount
of intact IgG present.
3.1.1. COS CELLS TRANSF~CTED WITH MOUSE OKT3 GENES
The assembly assay for intact mouse IgG in COS
cell supernatants was an ELISA with the following
format:
96 well microtitre plates were coated with F(ab' )2
goat anti-mouse IgG Fc. The plates were washed
in water and samples added for 1 hour at room
temperature. The plates were wa~hed and F(ab') 2
goat anti-mouse IgG F(ab' )2 (HRPO con~ugated) was
then added. Substrate was added to reveal the
reaction. UPC10, a mouse IgG2a myeloma, was used
as a standard.
3.1.2. COS AND CHO CELLS TRANSFECTED WITH CHIMERIC OR
CDR-GRAFT~D ORT3 GENES
The assembly assay for chimeric or CDR-grafted
antibody in COS cell supernatants was an ELISA
with the following ~ormat:
96 well microtitre plates were coated with F(ab' )2
goat anti-human IgG Fc. The plates were washed
and samples added and incubated for 1 hour at room
temperature. The plates were washed and
monoclonal mouse anti-human ~appa chain was added
for 1 hour at room temperature.
The plates were washed and F(ab')2 goat anti-mouse
IgG Fc (HRPO conjugated) was added. Enzyme
substrate was added to reveal the reaction.
Chimeric B72.3 (IgG4) (ref. 13) was used as a
standard. The use of a monoclonal anti-kappa
chain in this assay allows grafted antibodies to
be read from the chimeric standard.
~ 27 - 2129~
3.2. ASSAY FOR ANTIGEN BINDING ACTIVITY
Material from COS cell supernatants was assayed
for OKT3 antigen binding activity onto CD3
positive cells in a direct assay. The procedure
was as follows:
~UT 78 cells (human T cell line, CD3 positive)
were maintained in culture. ~onolayers of HUT 78
cells were prepared onto 96 well ELISA plates
using poly-L-lysine and glutaraldehyde. Samples
were added to the monolayers for 1 hour at room
temperature.
The plates were washed gently using PBS. F(ab' )2
goat anti-human IgG Fc (~RPO conjugated) or F(ab' )2
goat anti-mouse IgG Fc (~RPO con~ugated) was added
as appropriate for humanised or mouse samples.
Substrate was added to reveal the reaction.
The negative control for the cell-based assay was
chimeric B72.3. The positive control was mouse
Orthomune OKT3 or chimeric ORT3, when available.
This cell-based assay was difficult to perform,
and an alternative assay was developed for
CDR-grafted OKT3 which was more sensitive and
easier to carry out.
In this syste~ CDR-grafted ORT3 produced by COS
cells was tested for its ability to bind to the
CD3-positive ~PB-ALL (human peripheral blood acute
lymphocytic leukemia) cell line. It was also
tested for its ability to block the binding of
murine OKT3 to these cells. Binding was measured
by the following procedure: ~PB-ALL cells were
harvested from tissue culture. Cells were
incubated at 4~C for 1 hour with various dilutions
of test antibody, positive control antibody, or
negative control antibody. The cells
were washed;~nce and incubated at 4~C for 1 hour
with an FITC-labelled goat anti-human IgG (Fc-
212~2~9
. ~ - 28 -
specific, mouse absorbed). The cells were washed
twice and analysed by cytofluorography. Chimeric
OKT3 was used as a positive control for direct
binding. Cells incubated with mock- transfected
COS cell supernatant, followed by the FITC-labelled
goat anti-human IgG, provided the negative control.
To test the ability of CDR-grafted OKT3 to block
murine OKT3 binding, the ~PB-ALL cells were
incubated at 4~C for l hour with various dilutions
of test antibody or control antibody. A fixed
saturating amount of FITC OKT3 was added. The
samples were incubated for l hour at 4~C, washed
twice and analysed by cytofluorography.
FITC-labelled ORT3 was used as a positive control
to determine m~;mum binding. Unlabelled murine
OKT3 served as a reference standard for
blocking. Negative controls were unstained cells
with or without mock-transfected cell supernatant.
The ability of the CDR-grafted ORT3 light chain to
bind CD3-positive cells and block the binding of
murine OKT3 was initially tested in combination
with the chimeric OKT3 heavy chain. The chimeric
OKT3 heavy chain is composed of the murine OKT3
variable region and the human IgG4 constant
region. The chimeric heavy chain gene is
expressed in the same expression vector used for
the CDR-grafted genes. The CDR-grafted light
chain expression vector and the chimeric heavy
chain expression vector were co-transfected into
COS cells. The fully chimeric OKT3 antibody
(chimeric light chain and chimeric heavy chain)
was ~ound to be fully capable of binding to CD3
po~itive cells and blocking the binding of murine
OKT3 to these cells.
3.3 DETERMINATION OF RELATIVE BINDING AFFINITY
The relative binding affinities of CDR-grafted
- 29 -
anti-CD3 monoclonal antibodies were determined by
competition binding (ref. 6) using the ~PB-AL~
human T cell line as a source of CD3 antigen, and
fluorescein-conjugated murine ORT3 (Fl-O~T3) of
known binding affinity as a tracer antibody. The
binding affinity of Fl-OKT3 tracer antibody was
determined by a direct binding assay in which
increasing amounts of Fl-OKT3 were incubated with
~PB-ALL (5xl05) in PBS with 5% foetal calf serum
for 60 min. at 4~C. Cells were washed, and the
fluorescence intensity was determined on a FACScan
flow cytometer calibrated with quantitative
microbead standards (Flow Cytometry St~n~rds,
Research Triangle Park, NC). Fluorescence
intensity per antibody molecule (F/P ratio) was
determined hy using microbeads which have a
predetermined number of mouse IgG antibody binding
sites (Simply Cellular bead~, Flow Cytometry
' Standards). F/P equals the fluorescencs intensity
of beads saturated with Fl-OKT3 divided by the
n~ ~r of binding sites per bead. The amount of
bound and free Fl-OKT3 was calculated from the
mean fluorescence intensity per cell, and the
ratio of bound/free was plotted against the number
of moles of antibody bound. A linear fit wa~
used to determine the affinity of binding
(absolute value of the slope).
For competitive binding, increasing amounts of
competitor antibody were added to a sub-saturating
dose of Fl-OKT3 and incubated with 5x105 ~PB-AL~ in
200 ml of PBS with 5% foetal calf serum, for 60 min
at 4~C. The fluorescence intensities of the cells
were measured on a FACScan flow cytometer
calibrated with quantitative microbead standards.
The concentrations of bound and free Fl-OKT3 were
calculated. The affinities of competing anti-
* Trade-mark
_ 30 _ 2~29~1~
.~
bodies were calculated from the equation
[X]-[ORT3] = (l/Kx) - (l/Ka), where Ra i8 the
affinity of murine OKT3, Kx is the affinity of
competitor X, [ ] is the concentration of
competitor antibody at which bound/free binding is
R/2, and R is the m~;m~l bound/free binding.
4. cDNA LIBRARY CONSTRUCTION
4.1. mRNA PREPARATION AND cDNA SYNTHESIS
OKT3 producing cells were grown as described above
and 1.2 x 109 cells harvested and mRNA extracted
using the guanidinium/LiCl extraction procedure.
cDNA was prepared by priming from Oligo-dT to
generate full length cDNA. The cDNA was
methylated and EcoRl linkers added for cloning.
4.2. LIBRARY CONSTRUCTION
The cDNA library was ligated to pSP65 vector DNA
which had been EcoRl cut and the 5' phosphate
groups removed by calf intestinal phosphatase
(EcoRl/CIP3. The ligation was used to transform
high transformation efficiency Escherichia coli
(E.coli) HB101. A cDNA li~rary was prepared.
3600 colonies were screened for the light chain
and 10000 colonies were screened for the heavy
chain.
5. SCREENING
E.coli colonies positive for either heavy or light
chain probes were identified by oligonucleotide
screening using the oligonucleotides:
5' TCCAGATGTTAACTGCTCAC for the light chain, which
is complementary to a sequence in the mouse kappa
constant region, and 5' CAG~G&CCAGTGGATGGATAGAC
for the heavy chain which is complementary to a
se~uence in the mouse IgG2a constant CHl domain
region. 12 light chain and 9 heavy chain clones
212~213
- 31 -
were identified and taken for second round
screening. Positive clones from the second round
of screening were grown up and DNA prepared. The
sizes of the gene inserts were estimated by gel
electrophoresis and inserts of a size capable of
contA; n i ng a full length cD,NA were subcloned into
M13 for ~A sequencing.
6. DNA SEQUENCING
Clones representing four size classes for both
heavy and light chains were obtained in M13. DNA
sequence for the 5' untranslated regions, signal
sequences, variable regions and 3' untranslated
regions of full length cDNAs ~Figures l(a) and
2(a)] were obtained and the corresponding amino
acid sequences predicted [(Figures l(b) and
2(b)]- In Figure l(a) the untranslated DNA
regions are shown in uppercase, and in both
Figures 1 and 2 the signal sequences are
underlined.
20 7. CONSTRUCTION OF cDNA EXPR SSION VECTORS
Celltech expression vectors are based on the
plasmid pEE6hCMV (ref. 14). A polylinker for the
insertion of genes to be expressed has been
introduced after the major immediate early
2 5 promoter/enhancer of the human Cytomegalovirus
(hCMV). Marker genes for selection of the
plasmid in transfected eukaryotic cells can be
inserted as BamH1 cassettes in the unique Bam~1
site of pEE6 hCMV; for instance, the neo marker
to provide pEE6 hCMV neo. It is usual practice
to insert the neo and gpt markers prior to
insertion of the gene of interest, whereas the GS
marker is inserted last because of the presence of
internal EcoRl sites in the ca~sette.
~ 32 _ 2 1 ~ ~ 2 ~ ~
,,
The selectable markers are expressed from the SV40
late promoter which also provides an oriqin of
replication so that the vectors can be used for
expression in the COS cell transient expression
system.
The mouse sequences were excised from the M13
based vectors described above as EcoRl fragments
and cloned into either pEE6-hCMV-neo for the heavy
chain and into EE6-hCMV-gpt for the light chain to
yield vectors pJA136 and pJA135 respectively.
8. EXPRESSION OF cDNAS IN COS CELLS
Plasmids pJA135 and pJA136 were co-transfected
into COS cells and supernatant from the transient
expression experiment was shown to contain
assembled antibody which bound to T-cell enriched
lymphocytes. Metabolic labelling experiments
using 35S methionine showed expression and
assembly of heavy and light chains.
9. CONSTRUCTION OF CHIMERIC GENES
Construction of chimeric genes followed a
previously described strategy ~Whittle et al (ref.
13)]. A restriction site near the 3' end o~ the
variable domain sequence is identified and used to
attach an oligonucleotide adapter coding for the
remainder of the mouse variable region and a
suitable restriction site for attachment to the
constant region of choice.
9.1. LIG~T CXAIN GENE CONSTRUCTION
The mouse light chain cDNA sequence contains an
Aval site near the 3' end of the variable region
[Fig- l(a)]. The majority of the se~uence of the
variable region was isolated as a 396 bp.
EcoR1-Aval fragment. An oligonucleotide adapter
was designed to replace the remainder of the 3'
sr- ~ 292~ ~
- 33 -
region of the variable region from the Aval site
and to include the 5' residues of the human
constant region up to and including a unique Narl
site which had been previously engineered into the
constant region.
A Hindlll site was introduced to act as a marker
for insertion of the linker.
The linker was ligated to the VL fragment and the
413 bp EcoR1-Narl adapted fragment was purified
from the ligation mixture.
The constant region was isolated as an Narl-BamHl
fragment from an M13 clone NW361 and was ligated
with the variable region DNA into an
EcoR1/BamH1/ClP pSP65 treated vector in a three
way reaction to yield plasmid JA143. Clones were
isolated after transformation into E.coli and the
linker and junction sequences were confirmed by
the presence of the Hindlll site and by DNA
sequencing.
9.2 LIGHT CHAIN GENE CONSTRUCTION - VERSION 2
The construction of the flrst chimeric light chain
gene produces a fusion of mouse and human amino
acid sequences at the variable-constant region
junction. In the case of the OKT3 light chain
the amino acids at the chimera junction are:
........ Leu-Glu-Ile-Asn-Arq/ -/Thr-Val-Ala -Ala
VARIABLE CONSTANT
This arrangement of sequence introduces a
potential site for Asparagine (Asn) lin~ed
(N-lin~ed) glycosylation at the V-C junction.
Therefore, a second version of the chimeric light
chain oligonucleotide adapter was designed in
which the threonine (Thr), the first ~;no acid of
the human constant region, was replaced with the
equivalent amino acid from the mouse constant
region, Alanine (Ala).
' _ 34 _ 21292~9
. --
An internal ~indlll site was not included in this
adapter, to differentiate the two chimeric light
chain genes.
The variable region fragment was isolated a~ a 376
bp EcoRl-Aval fragment. The oligonucleotide
linker was ligated to Narl cut pNW361 and then the
adapted 396bp constant region was isolated after
recutting the modified pN~361 with EcoRl. The
variable region fragment and the modified constant
region fragment were ligated directly into
EcoRl/ClP treated pEE6hCMVneo to yield p~A137.
Initially all clones e~m; ned had the insert in
the incorrect orientation. Therefore, the insert
was re-isolated and recloned to turn the insert
round and yield plasmid pJA141. Several clones
with the insert in the correct orientation were
obtained and the adapter sequence of one was
confirmed by DNA sequencing
9.3. ~EAVY CHAIN GENE CONSTRUCTION
g.3.1. CHOICE OF HEAVY CHAIN GENE ISOTYPB
The constant region isotype chosen for the heavy
chain was human IgG4.
9.3.2. GENE CONSTRUCTION
The heavy chain cDNA sequence showed a Banl site
near the 3' end of the variable region [Fig. 2(a)].
The majority of the sequence of the variable
region was isolated as a 426bp. EcoRl/ClP/Banl
fragment. An oligonucleotide adapter was
designated to replace the remainder of the 3'
region of the variable region from the Banl site
up to and including a unique ~indIII site which
had been previously engineered into the first two
~;no acids of the constant region.
The linker was ligated to the V~ fragment and the
EcoRl-~indlll adapted fragment wa~ purified from
the ligation mixture.
2~ 9
- 35 -
. ~
The variable region was ligated to the constant
region by cutting pJA91 with EcoRl and Hindlll
removing the intron fragment and replacing it with
the VH to yield pJA142. Clones were isolated
after transformation into E.coli JM101 and the
lin~er and junction sequences were confirmed by
DNA sequencing. (N.B. The Hindlll site is lost
on cloning).
10. /CONSTRUCTION OF CHIMERIC EXPRESSION VECTORS
10.1. neo AND gpt VECTORS
The chimeric light chain ~version 1) was removed
from pJA143 as an EcoRl fragment and cloned into
EcoRl/ClP treated pE~6hC~Vneo expression vector to
yield pJA145. Clones with the insert in the
correct orientation were identified by restriction
mapping.
The chimeric light chain (version 2) was
con~tructed as described above.
The chimeric heavy chain gene was isolated from
pJA142 as a 2.5Kbp EcoRl/BamHl fragment and cloned
into the EcoRl/Bcll/ClP treated vector fragment of
a derivative of pEE6hC~Vgpt to yield plasmid
pJA144.
10.2. GS SEPARAT~ VECTORS
GS versions of pJA141 and pJA144 were constructed
by replacing the neo and gpt cassettes by a
Bam~l/Sall/ClP treatment of the plasmids,
isolation of the vector fragment and ligation to a
GS-containing fragment from the plasmid pRO49 to
yield the light chain vector pJA179 and the heavy
chain vector pJA180.
10.3. GS SINGLE VECTOR CONSTRUCTION
Single vector constructions containing the cL
(chimeric light), cH (chimeric heavy) and GS genes
on one plasmid in the order c~-cH-GS, or cH-cL-GS
~ ~29~ ~
~ - 36 -
.
and with transcription of the genes being head to
tail e.g. cL>cH>GS were constructed. These
plasmids were made by treating pJA179 or pJA180
with B~l/ClP and ligating in a Bglll/~indlll
hCMV promoter cassette along with either the
Hindlll/BamHl fragment from pJA141 into pJA180 to
give the cH-cL-GS plasmid pJA182 or the
Hindlll/BamHl fragment from pJA144 into pJA179 to
give the cL-cK-GS plasmid pJA181.
11. EXPRESSION OF CHIMERIC GENES
11.1. EXPRESSION IN COS CELLS
The chimeric antibody plasmid pJA145 (cL) and
pJA144 (cH) were co-transfected into COS cells and
supernatant from the transient expression
experiment was shown to contain assembled antibody
which bound to the HUT 78 human T-cell line.
Metabolic labelling experiments using 35S
methionine showed expression and assembly of heavy
and light chains. ~owever the light chain
mobility seen on reduced gels suggested that the
potential glycosylation site was being
glycosylated. Expression in COS cells in the
presence of tunicamycin showed a reduction in size
of the light chain to that shown for control
chimeric antibodies and the OKT3 mouse light
chain. Therefore JA141 was constructed and
expressed. In this case the light chain did not
show an aberrant mobility or a size shift in the
presence or absence of tunicamycin. This second
version of the chimeric light chain, when
expressed in association with chimeric heavy (cH)
chain, produced antibody which showed good b; n~; ng
to ~UT 78 cells. In both cases antigen binding
was equivalent to that of the mouse antibody.
212~2~ ~
- 37 -
11.2 EXPRESSION IN CHINESE HAMSTER OVARY (C~O) CELLS
Stable cell line5 have been prepared from plasmids
PJA141/pJA144 and from pJA179/pJA180, pJA181 and
pJA182 by transfection into CHO cells.
5 12. CDR-GRAFTING
The approach taken was to try to introduce
sufficient mouse residues into a human variable
region framework to generate antigen binding
activity comparable to the mouse and chimeric
antibodies.
12.1. VARIABLE REGION ANALYSIS
From an examination of a small database of
structures of antibodies and antigen-antibody
complexes it is clear that only a small number of
antibody residues make direct contact with
antigen. Other residues may contribute to
antigen binding by positioning the contact
residues in favourable configurations and also by
inducing a stable packing of the individual
variable domains and stable int~raction of the
light and heavy chain variable domains.
The residues chosen for transfer can be identified
in a number of ways:
(a) By examination of antibody X-ray crystal
structures the antigen binding surface can
be predominantly located on a series of
loops, three per domain, which extend from
the B-barrel framework.
(b) By analysi~ of antibody variable domain
sequences regions of hypervariability
[termed the Complementarity Det~rmining
Regions (CDRs) by Wu and Kabat (ref. 5)]
can be identified. In the most but not
all cases these CDRs correspond to, but
extend a short way beyond, the loop regions
noted above.
38 - 212~2~
_
-
(c) Residues not identified by (a) and (b) may
contribute to antigen binding directly or
indirectly by affecting antigen b;n~;ng
site topology, or by inducing a stable
packing of the individual variable dom~; n~
and stabilising the inter-variable domain
interaction. These residues may be
identi~ied either by superimposing the
sequences for a given antibody on a known
structure and looking at key residues for
their contribution, or by sequence
alignment analysis and noting
"idiosyncratic" residues followed by
examination of their structural location
and likely effects.
12.1.1. LIGHT C~AIN
Figure 3 shows an alignment of sequences for the
human framework region RE1 and the OKT3 light
variable region. The structural loops (LOOP) and
CDRs ~KABAT) believed to correspond to the antigen
binding region are marked. Also marked are a
number of other residues which may also contribute
to antigen binding as described in 13.1(c).
Above the sequence in Figure 3 the residue type
indicates the spatial location of each residue
side chain, derived by examination of resolved
structures from X-ray crystallography analysis.
The key to this residue type designation is as
follows:
N - near to CDR (From X-ray Structures)
P - Packing B - Buried Non-Packing
S - Surface E - Exposed
I - Interface * - Interface
- Packing/Part Exposed
? - Non-CDR Residues which may require to be left
as Mouse sequence.
_ 3g _ 2~2~2~
~ . ~
Residues underlined in Figure 3 are amino acids.
REl was chosen as the human framework because the
light chain i8 a kappa chain and the kappa
variable regions show higher homology with the
mouse sequences than a lambda light variable
region, e.g. KOL (see below). RE1 was chosen in
preference to another kappa light chain because
the X-ray structure of the light chain has been
determined so that a structural ~m; nAtion of
individual residues could be made.
12.1.2. HEAVY C~AIN
Similarly Figure 4 shows an alignment of sequences
for the human framework region ROL and the OKT3
heavy variable region. The structural loops and
CDRs believed to correspond to the antigen binding
region are marked. Also marked are a number of
other residues which may also contribute to
antigen binding as described in 12.1~c). The
residue type key and other indicators used in
Figure 4 are the same as those used in Figure 3.
KOL was chosen as the heavy chain framework
because the X-ray structure has been determined to
a better resolution than, for example, NEWM and
also the sequence alignment of OKT3 heavy variable
region showed a slightly better homology to KOL
than to NEWM.
12.2. ~ESIGN OF VARIABLE GENES
The variable region domains were designed with
mouse variable region optimal codon usage
[Grantham and Perrin (ref. 15)] and used the B72.3
signal sequences [Whittle et al (ref. 13)]. The
sequences were designed to be attached to the
constant region in the same way as for the
chimeric genes described above. Some constructs
contained the ~Kozak consensus sequence" t~ozak
(ref. 16)] directly linked to the 5' of the signal
' ~ - 40 - 2~2~2t~
sequence in the gene. This sequence motif is
believed to have a beneficial role in translation
initiation in eukaryotes.
12.3. GENE CONSTRUCTION
To build the variable regions, various strategies
are available. The sequence may be assembled by
using oligonucleotides in a manner similar to
Jones et al (ref. 17) or by simultaneously
replacing all of the CDRs or loop regions by
oligonucleotide directed site specific mutagenesis
in a manner similar to Verhoeyen et al (ref. 2).
Both strategies were used and a list of
constructions is set out in Tables 1 and 2 and
Figures 4 and 5. It was noted in several cases
that the mutagenesis approach led to deletions and
rearrangements in the gene being remodelled, while
the success of the assembly approach was very
sensitive to the quality of the oligonucleotides.
13. CONSTRUCTION OF EXPRESSION VECTORS
Genes were isolated from M13 or SP65 based
intermediate vectors and cloned into pEE6hCMVneo
for the light chains and pEE6hC~Vgpt for the heavy
chains in a manner similar to that for the
chimeric genes as described above.
~ 41 - 212921~
ABLE 1 CD~_GRAFTED GENE C~N~1~UCTS
DE MOUSE SEQUENCE METHOD OF KOZAK
CONTENT CONSTRUCTION SEQUENCE
+
_ _ _ _
LIGHT CHAIN ALL HUMAN FRAMEWORK REl
121 26-32, 50-56, 91-96 inclusive SDM and gene assembly + n.d.
121A 26-32, 50-56, 91-96 incluslve Partial gene assembly n.d. +
+1, 3, 46, 47
121B 26-32, 50-56, 91-96 inclusive Partial gene assembly n.d. +
+ 46, 47
10 221 24-24, 50-56, 91-96 inclusive Partial gene assembly + +
22LA 24-34, 50-56, 91-96 inclusive Partial gene assembly + +
+1, 3, 46, 47
221B 24-34, 50-56, 91-96 inclusive Partial gene assemb~y + +
+1, 3
15 221C 24-34, 50-56, 91-96 inclusive Partial gene assembly + +
HEAVY CHAIN ALL HUMAN FRAMEWORK KOL
121 26-32, 50-56, 95-lOOB inclusive Gene assembly n.d. +
131 26-32, 50-58, 95-lOOB inclusive Gene assembly n.d. +
141 26-32, 50-65, 95-lOOB inclusive Partial gene assembly + n.d.
20 321 26-35, 50-56, 95-lOOB inclusive Partial gene assembly + n.d.
331 26-35, 50-58, 95-lOOB inclusive Partial gene assembly +
Gene assembly +
341 2~-35, 50-65, 95-lOOB inclusive SDM +
Partial gene assembly +
25 34LA 26-35, 50-65, 95-lOOB inclusive Gene assembly n.d. +
+6, 23, 24, 48, 49, 71, 73, 76,
78, 88, 91 (+63 human)
341B 26-35, 50-65, 95-lOOB inclusive Gene assembly n.d. +
+ 48, 49, 71, 73, 76, 78, 88, 91
(+63 + human)
KEY
n.d. not done
SDM Site directed mutagenesis
Gene assembly Variable region assembled entirely from oligonucleotides
Partial gene Variable region assembled by combination of restriction
assembly fragments either from other genes originally created by SDM
and gene assembly or by oligonucleotide assembly of part of
the variable region and reconstruction with restriction
fragments from other genes originally created by SDM and gene
assembly
~12~2~ ~
- 42 -
14. EXPRESSION OF CDR-GRAFT~D GENES
14.1. PRODUCTION OF ANTIBODY CONSISTING OF GRAETED LIGHT
(gL) CHAINS WIT~ MOUSE HEAVY ~mH) OR CHIMERIC
HEAVY (cH) CHAINS
All gL chains, in association with mH or cH
produced reasonable amounts of antibody.
Insertion of the Kozak consensus sequence at a
position 5' to the ATG (kgL constructs) however,
led to a 2-5 fold improvement in net expression.
1 Over an extended series of experiments expression
levels were raised from approximately 2QOng/ml to
approximately 50Q ng/ml for kgL/cH or kgL/mH
combinations.
When direct binding to antigen on HUT 78 cells was
15' measured, a construct designed to include mouse
sequence based on loop length (gL121) did not lead
to active antibody in association with mH or cH.
A construct designed to include mouse sequence
based on Kabat CDRs (gL221) demonstrated some weak
binding in association with mH or cH. However,
when framework residues 1, 3, 46, 47 were changed
from the human to the murine OKT3 equivalents
based on the arguments outlined in Section 12.1
antigen binding was demonstrated when both of the
new constructs, which were termed 12lA and 22lA
were co-expressed with cH. When the ef~ects of
thesa residues were examined in more detail, it
appears that residues 1 and 3 are not major
contri~uting residues as the product of the g~22lB
gene shows little detectable binding activity in
association with cH. The light chain product of
gL221C, in which mouse sequences are present at 46
and 47, shows good ~inding activity in association
with cH.
- 2~29~1~
~ - 43 -
.
14.2 PRODUCTION OF ANTIBODY CO~SISTING OF GRAFTED HEAVY
(gH) CHAINS WITH MOUSE LIGHT (mL) OR CHIMERIC
LIGHT (cL~ C~AINS
Expression of the gH genes proved to be more
difficult to achieve than for gL. First,
inclusion of the Rozak sequence appeared to have
no marked effect on expression of g~ genes.
Expression appears to be slightly improved but not
' to the same degree as seen for the grafted light
chain.
Also, it proved difficult to demonstrate
production of expected quantities of material when
the loop choice (amino acid 26-32) for CDR1 is
used, e.g. gH121, 131, 141 and no conclusions can
be drawn about these constructs.
Moreover, co-expression of the gH341 gene with cL
or mL has been variable and has tended to produce
lower amounts of antibody than the cH/cL or mH/mL
combinations. The alterations to gH341 to
produce g~34lA and gH34lB lead to improved levels
o~ expression.
This may be due either to a general increase in
the ~raction o~ mouse sequence in the variable
region, or to the alteration at position 63 where
the residue is returned to the human amino acid
Valine (Val) from Phenylalanine (Phe) to avoid
possi~le internal packing problems with the rest
of the human framework. This arrangement also
occurs in gH331 and g~321.
When gH321 or gH331 were expressed in association
with cL, antibody was produced but antibody
binding activity was not detected.
When the more conservative gH341 gene was used
antigen binding could be detected in association
with cL or mL, but the activity was only
marginally above the background level.
. .
., 2~2~2~
~ - 44 -
.
When further mouse residue5 were substituted based
on the arguments in 12.1, antigen binding could be
clearly demonstrated for the antibody produced
when kgH34lA and kgH34lB were expressed in
asso~iation with cL.
14.3 PRODUCTION OF FULLY CDR-GRAFTED ANTIBODY
The kgL221A gene was co-expressed with kgH341,
kgH34lA or kg~34lB. For the combination
kg~22lA~kgH341 very little material was produced
in a normal COS cell expression.
For the combinations kgL22lA/kgH34lA or
kgH22lA/kgH34lB amounts of antibody similar to
gL/c~ was produced.
In several experiments no antigen binding activity
could be detected with kgH221A/g~341 or
kgH22lA/kg~341 com~binations, although expression
levels were very low.
Antigen binding was detected when kgL221A/kg~341A
or kgH22lA/kgH34lB combinations were expressed.
In the case of the antibody produced from the
kgL22lA/kgH34lA combination the antigen binding
was very similar to that of the chimeric antibody.
An analysis of the above results is given below.
15. DISCUSSION OF CDR-GRAFTING RESULTS
In the design of the fully humanised antibody the
aim was to transfer the m;n;mllm number of mouse
amino acids that would confer antigen binding onto
a human antibody framework.
15.1. LIGHT C~AIN
15.1.1. EXTENT OF THE CDRs
For the light chain the regions defining the loops
known from structural studies of other antibodies
to contain the antigen contacting residues, and
_ 45 _ 2~2~219
. ~
those hypervariable sequences defined by Kabat et
al (refs. 4 and 5) as Complementarity Determ;n;ng
Regions (CDRs) are equivalent for CDR2. For CDRl
the hypervariable region extends from residue~
24-34 inclusive while the structural loop extends
from 26-32 inclusive. In the case of OKT3 there
is only one amino acid difference between the two
options, at amino acid 24, where the mouse
sequence is a serine and the human framework REl
has glutamine. For CDR3 the loop extends from
residues 91-96 inclusive while the Kabat
hypervariability extends from residues 89-97
inclusive. For OKT3 amino acids 89, 90 and 97
are the same between OKT3 and R~1 (Fig. 3). When
constructs based on the loop choice for CDRl
(gL121) and the Kabat choice (gL221) were made and
co-expressed with mH or c~ no evidence for antigen
binding activity could be found for gL121, but
trace activity could be detected for the gL221,
suggesting that a single extra mouse residue in
the grafted variable region could have some
detectable effect. Both gene constructs were
reasonably well expressed in the transient
expression system.
15.1.2. FRAMEWORK RESIDUES
The r~m~i n; ng ~ramework residues were then further
~;ned, in particular amino acids known from
X-ray analysis of other antibodies to be close to
the CDRs and also those amino acids which in OKT3
showed differences from the consensus framework
for the mouse subgroup (subgroup VI) to which OKT3
shows most homology. Four positions 1, 3, 46 and
47 were identified and their possible contribution
was examined by substituting the mouse amino acid
for the human amino acid at each position.
Therefore gL221A (gL221 + DlQ, Q3~, L46R, L47W,
~ ~ - 46 - ~ 2~ ~
see Figure 3 and Table 1) was made, cloned in
E~6hCMVneo and co-expressed with cH (pJA144). The
resultant antibody was well expressed and showed
good bi n~; ng activity. When the related genes
gL221B (gL221 + DlQ, Q3V) and gL221C (gL221 +
L46R, L47W) were made and similarly tested, while
both genes produced antibody when co-expressed
with c~, only the gL221C/cH combination showed
good antigen binding. When the gL12lA (gL121
DlQ, Q3V, L46R, L47W) gene was made and
co-expressed with cH, antibody was produced which
also bound to antigen.
15.2. HEAVY CHAIN
15.2.1. EXTENT OF THE CDRs
For the heavy chain the loop and hypervariability
analyses agree only in CDR3. For CDR1 the loop
region extends from residues 26-32 inclusive
whereas the Kabat CDR extends from residues 31-35
inclusive. For CDR2 the loop region is from
50-58 inclusive while the hypervariable region
covers amino acids 50-65 inclusive. Therefore
humanised heavy chains were constructed using the
framewor~ from antibody KOL and with various
com~inations of these CDR choices, including a
shorter choice for CDR2 of 50-56 inclusive as
there was some uncertainty as to the definition of
the end point for the CDR2 loop around residues 56
to 5B. The genes were co-expressed with mL or cL
initially. In the case of the gH genes with loop
choices for CDR1 e.g. gH121, gH131, gH141 very
little antibody was produced in the culture
supernatants. As no free light chain was
detected it was presumed that the antibody was
being made and assembled inside the cell but that
the heavy chain was aberrant in some way, possibly
incorrectly folded, and therefore the antibody was
2~ 2'~21~
- 47 -
being degraded internally. In some experiment~
trace amounts of antibody could be detected in 35S
labelling studies.
As no net antibody was produced, analysis of these
constructs was not pursued further.
When, however, a combination of the loop choice
and the Kabat choice for CDRl was tested (mouse
amino acids 26-35 inclusive) and in which residues
31 (Ser to Arg), 33 (Ala to Thr), and 35 (Tyr to
His) were changed from the human residues to the
mouse residue and compared to the first series,
antibody was produced ~or gH321, kgH331 and kgH341
when co-expressed with cL. Expression was
generally low and could not be markedly improved
by the insertion of the Kozak consensus sequence
5' to the ATG of the signal sequence of the gene,
as distinct from the case of the gL genes where
such insertion led to a 2-5 fold increase in net
antibody production. However, only in the case
of gH341JmL or kgH341/cL could marginal antigen
binding activity be demonstrated. ~hen the
kgH341 gene was co-expressed with kgL22lA, the net
yield of antibody was too low to give a signal
above the background level in the antigen binding
Z5 assay.
15 . 2 . 2 . FRAMEWORK RESIDUES
As in the case of the light chain the heavy chain
frameworks were re-examined. Possibly because of
the lower initial homology between the mouse and
human heavy variable domains compared to the light
chains, more amino acid positions proved to be of
lnterest. Two genes kgH34lA and kgH34lB were
constructed, with 11 or 8 human residues
respectively substituted by mouse residues
compared to gH341, and with the CDR2 residue ~3
returned to the human amino acid potentially to
- 48 -
improve dom~ i n packing. Both showed antigen
binding when combined with c~ or kgL221A, the
kgH34lA gene with all 11 changes appearing to be
the superior choice.
5 15.3 INTERIM CONCLUSIONS
It has been demonstrated, therefore, for OKT3 that
to transfer antigen binding ability to the
humanised antibody, mouse residues outside the CDR
regions defined by the Kabat hypervariability or
structural loop choices are required for both the
light and heavy chains. Fewer extra residues are
needed for the light chain, possibly due to the
higher initial homology between the mouse and
human kappa variable regions.
Of the changes seven (1 and 3 from the light chain
and 6, 23, 71, 73 and 76 from the heavy chain) are
predicted from a knowledge of other antibody
structures to be either partly exposed or on the
antibody surface. It has been shown here that
residues l and 3 in the light chain are not
absolutely required to be the mouse sequence; and
for the heavy chain the gH341B heavy chain in
combination with the 22lA light chain generated
only weak binding activity Therefore the
Z5 presence of the 6, 23 and 24 changes are important
to maintain a binding affinity similar to that of
the murine antibody. It was important,
therefore, to further study the individual
contribution of othe other 8 mouse residues of the
kgH34lA gene compared to kg~341.
16. FURTHER CDR-GRAFTING ~XPERIMENTS
Additional CDR-grafted heavy chain genes were
prepared substantially as described above. With
reference to Table 2 the further heavy chain genes
were based upon the gh341 (plasmid pJAl78) and
~' _ 49 2~2~2~
gH341A (plasmid pJA185) with either mouse O~T3 or
human KOL residues at 6, 23, 24, 48, 49, 63, 71,
73, 76, 78, 88 and 91, as indicated. The CDR-
gra~ted light chain genes used in these further
experiments were gL221, gL22lA, gL22lB and gL22lC
as described above.
2~ 2~2~
- 50 -
TABLE 2
OKT3 HEAVY CHAIN CDR GRAFTS
1. gH341 and derivatives
RES NUM 623 24 48 49 63 71 73 76 7888 91
5 OKT3vh Q K A I G F T K S A A Y
gH341 E S S V A F R N N L G F JA178
gH341A Q K A I G V T K S A A Y JA185
gH341E Q K A I G V T K S A G G JA198
gH341* Q K A I G V T K N _ G F JA207
10 gH341* Q K A I G V R N N _ G F JA209
gH341D Q K A I G V T K N L G F JA197
gH341* Q K A I G V R N N L G F JAl99
gH341C Q K A V A _ R N N L G F JA184
gH341* Q S A I G V T K S A A Y JA203
15gH341* E S A I G V T K S A A Y JA205
gH341B ~ S S I G V T K S A A Y JA183
gH341* ~ S A I G V T K S A G F JA204
gH34L* E S A I G V T K S A G F JA206
gH341* Q S A I G V T K N _ G F JA208
20 KOL E S S V A R N N L G F
OKT3 LIGHT CHAIN CDR GRAFTS
2. gL221 and derivatives
RES NUM 1 3 46 47
OKT3vl Q V R W
25 GL221 ~ Q L L DA221
gL22lA Q V R W DA22lA
gL221B Q V L L DA221B
GL221C D Q R W DA221C
REl D Q L L
MURINE RESIDUES ARE UNDERLINED
51 2~2~ 9
The CDR-grafted heavy and light chain genes were
co-expressed in COS cells either with one another in
various combinations but also with tha corresponding
murine and chimeric heavy and light chain genes
substantially as described above. The resultant antibody
products were then assayed in binding and blocking assays
with HPB-ALL cells as described above.
The results of the assays for various grafted heavy chains
co-expressed with the gL221C light chain are given in
Figures 7 and 8 (for the JA184, JA185, JA197 and JA198
constructs - see Table 2), in Figure g (for the JA183,
JA184, JA185 and JA197 constructs) in Figure 10 (for the
chimeric, JA185, JA199, JA204, JA205, JA207, JA208 and
JA209 constructs) and in Figure 11 (for the JA183, JA184,
JA185, JA198, JA203, JA205 and JA206 constructs).
The basic grafted product without any human to murine
changes in the variable framewor~s, i.e. gL221
co-expressed with gh341 (JA178), and also the "fully
grafted" product, having most human to murine changes in
the grafted heavy chain framework, i.e. gL221C
co-expressed with gh341A (JA185), were assayed for
relative binding affinity in a competition assay against
murine OKT3 reference standard, using ~PB-ALL cells. The
assay used was as described a~ove in section 3.3. The
results obtained are given in Figure 12 for the basic
grafted product and in Figure 13 for the fully graf~ed
product. These results indicate that the basic grafted
product has neglibible binding ability as compared with
the OKT3 murine reference st~n~rd; whereas the "fully
grafted" product has a binding ability very similar to
that of the OKT3 murine reference standard.
The binding and blocking assay results indicate the
following:
~ - 52 _ 2~2~2~9
The JA198 and JA207 constructs appear to have the best
binding characteristics and S;mi lar binding abilities,
both substantially the same as the chimeric and fully
grafted gH341A products. This indicates that position~
88 and 91 and position 76 are not highly critical for
maintaining the OKT3 binding ability; whereas at lea~t
some of positions 6, 23, 24, 48, 49, 71, 73 and 78 are
more important.
This is borne out by the finding that the JA209 and JA199,
although of similar binding ability to one another, are of
lower binding ability than the JA198 and JA207
constructs. This indicates the importance of having
mouse residues at positions 71, 73 and 78, which are
either completely or partially human in the JA199 and
JA209 constructs respectively.
Moreover, on comparing the results obtained for the JA205
and JA183 constructs it is seen that there is a decrease
in binding going from the JA205 to the JA183 constructs.
This indicates the importance of retA; n; ng a mouse re~idue
at position 23, the only position changed between JA205
and JA183.
These and other results lead us to the conclusion that of
the 11 mouse framewor~ residues used in the gH341A (JA185)
construct, it is important to retain mouse residues at all
of positions 6, 23, 24, 48 and 49, and possibly for
m~;ml1m binding affinity at 71, 73 and 78.
Similar Experiments were carried out to CDR-graft a number
of the rodent antibodies including antikodies having
specificity for CD4 (OKT4), ICAM-1 (R6-5), TAG72 (B72.3),
and TNF~<(6lE71, 101.4, hTNF1, hTNF2 and hTNF3).
- 53 ~
~ EXAMPLE 2
CDR-~RAFTING OF A MURINE ANTI-CD4 T CELL
RECEPTOR ANTIBODY, OKT4A
Anti OKT4A CDR-gra~ted heavy and light chain genes
were prepared, expressed and tested substantially as
described above in Example 1 ~or CDR-grafted OKT3.
The CDR grafting of OKT4A is described in detail in
Ortho patent application PCT/GB90/02015 of even date
herewlth entitled "Humanised Antibodies". A number
of CDR-grafted OKT4 antibodies have been prepared.
Presently the CDR-grafted OKT4A of choice is the
combination of the grafted light chai~ LCDR2 and
the grafted heavy chain HCDR10
T~E LIGHT CHAIN
The human acceptor framewor~ used for the grafted light
chains was RE1. The preferred LCDR2 light chain has
human to mouse changes at positions 33, 34, 38, 49 and 89
in addition to the structural loop CDRs. Of these
changed positions, positions 33, 34 and 89 fall withln the
preferred extended CDRs of the present invention
(positions 33 and 34 in CDRl and position 89 in CDR3).
The human to murine changes at positions 38 and 49
corresponds to positions at which the amino acid residues
are preferably donor murine amino acid res-idues in
accordance with the present invention.
A comparison o~ the amino acid sequences of the donor
murlne light chain variable domain and the ~E1 human
ac~eptor light chain variable further reveals that the
murine and human residues are identical at all of
positions 46, 48 and 71 and at all of positions 2, 4, 6,
35, 36, 44, 47, 62, 64-69, 85, 87, 98, 99 and 101 and 102.
However the amino acid residue at position 58 in LCDR2 is
A'
~ _ 54 _ 2~292~
.
the human RE1 framework residue not the mouse OKT4 residue
as would be preferred in accordance with the present
invention.
T~E E~EAVY C~AIN
The human acceptor framewor~ used for the grafted heavy
chains was KOL.
The preferred CDR graft HCDR10 heavy chain has human to
mouse changes at positions 24, 35, 57, 58, 60, 88 and 91
in addition to the structural loop CDRs.
of these positions, positions 35 (CDRl~ and positions 57,
58 and 60 (CDR2) fall within the preferred extended CDR~
.of the present invention. Also the hllm~n to mouse change
at position 24 corresponds to a po~ition at which the
amino acid residue is a donor murine residue in ac~ordance
with the present invention. Moreover, the human to mouse
changes at positions 88 and 91 correspond to position~ at
which the ~;no acid re~idues are optionally donor murine
residues.
Moreover, a comparison of the murine OKT4A and human KOL
Xeavy chain variable amino acid sequences reveals that the
murine and human residues are identical at all of
positions 23, 49, 71, 73 and 78 and at all of positions 2,
4, 6, 25, 36, 37, 39, 47, 48, 93, 94, 103, 104, 106 and
107.
Thus the OKT4A CDR-grafted heavy chain ~CDR10 corresponds
to a particularly preferred embodiment according to the
present invention.
~ _ 55 _ ~ 1~ 92~3
EXAMPI~ 3
CDR-GRAFTING OF AN ANTI-MUCIN SPECIFIC MURINE
ANTIBODY, B72.3
The cloning of the genes coding for the anti-mucin
specific murine monoclonal antibody B72.3 and the
preparation of B72.3 mouse-human chimeric antibodies has
been described previously (ref. 13 and WO 89/01783).
CDR-grafted versions of B72.3 were prepared as follows.
(a) B72.3 Liqht Chain
CDR-grafting of this light chain was accomplished
by direct transfer of the murine CDRs into the
framework of the human light chain RE1.
The regions transferred were:
CDR Number Residues
1 24-34
2 50-56
3 90-96
The activity of the resulting grafted light chain
was assessed by co-expression in COS cells, of
20genes for the combinations:
B72.3 c~/B72.3 c~
and B72.3 c~/B72.3 gL
Supernatants were assayed for antibody
concentration and for the ability to bind to
microtitre plates coated with mucin. The
results obtained indicated that, in combination
with the B72.3 c~ chain, B72.3 cL and B72.3 gL
had similar binding properties.
Comparison o~ the murine B72.3 and REI light chain ~m; no
acid se~uences reveals that the residues are identical at
positions 46, 58 and 71 but are different at position 48.
~ 56 _ 2 ~29
.
Thus changing the human residue to the donor mouse residue
at position 48 may further improve the binding
characteristics of the CDR-grafted light chain, (B72.3 gL)
in accordance with the present invention.
(b) B72.3 heavy chain
i. Choice of framework
At the outset it was necessary to make a
choice of human framework. Simply put,
the question was as follows: Was it
necessary to use the framework regions from
an antibody whose crystal structure was
known or could the choice be made on some
other criteria~
For B72.3 heavy chain, it was reasoned
that, while knowledge of structure was
important, transfer of the CDRs fro_ mouse
to human frameworks ~ight be facilitated if
the overall homology between the donor and
receptor frameworks was m~x; m; sed.
2D Comparison of the B72.3 heavy chain
sequence with those in Kabat (ref. 4) for
human heavy chains showed clearly that
B72.3 had poor homology for ROL and NEWM
(for which crystal structures are
available) but was very homologous to the
heavy chain for EU.
On this basis, EU was chosen for the
CDR-grafting and the following residues
transferred as CDRs.
CDR Number Residues
1 27-36
2 50-63
3 93-102
~ 212~21 ~ ~ - 57 -
.
Also it was noticed that the FR4 region of
EU was unlike that of any other hl~an (or
mouse) antibody. Consequently, in the
grafted heavy chain genes this was also
changed to produce a Uconsensus'' human
sequence. (Preliminary experiments showed
that grafted heavy chain genes cont~; n; ng
the EU FR4 sequence exprsssed very poorly
in transient expression systems.)
ii. Results with grafted heavy chain gene~
Expression of grafted heavy chain genes
containing all human framework regions with
either gL or c~ genes produced a grafted
antibody with little ability to bind to
mucin. The grafted antibody had about 1%
the activity of the chimeric antibody.
In these experiments, however, it was noted
that the activity of the grafted antibody
could be increased to~ 10~ of B72.3 by
exposure to pHs of 2-3.5.
This observation provided a clue as to how
the activity of the grafted antibody could
be improved without acid treatment. It
was postulated that acid exposure brought
about the protonation of an acidic residue
(pRa of aspartic acid = 3.86 and of
glutamine acid = 4.25) which in turn caused
a change in structure of the CDR loop~, or
allowed better access of antigen.
From comparison of the se~uences of ~72.3
(ref. 13) and EU (refs. 4 and 5), it was
clear that, in going from the mouse to
human frameworks, only two positions had
been changed in such a way that acidic
residues had been introduced. These
' ~ - 58 - 2~ 213
positions are at residues 73 and 81, where
K to E and Q to E changes had been made,
respectively.
Which of these positions might be important
was determined by ex~mi n; ng the crystal
structure of the ~OL antibody. In RO~
heavy chain, position 81 is far removed
from either of the CDR loops.
Position 73, however, is clo5e to both CDRs
1 and 3 of the heavy chain and, in this
position it was pos~ible to envisage that a
K to E change in this region could have a
detrimental effect on antigen binding.
iii. Framework changes in B72.3 g~ qene
On the basis of the above analysis, E73 was
mutated to a lysine (~. It was found
that this change had a dramatic effect on
the ability of the grafted Ab to bind to
mucin. Further the ability of the grafted
B72.3 produced by the mutated gH/gL
combination to bind to mucin was similar to
that of the B72.3 chimeric antibody.
iv. Other ~ramework changes
In the course of the above experiments,
other changes were made in the heavy chain
framework regions. Within the accuracy of
the assays used, none of the changes,
either alone or together, appeared
beneficial.
v. Other
All assays used measured the ability of the
grafted A~ to bind to mucin and, as a whole,
indicated that the single framework change
at position 73 is sufficient to generate an
antibody with similar binding properties to
B72.3.
~12~
- 59 -
Comparison of the B72.3 murine and EU heavy
chain sequences reveals that the mouse and
human residues are identical at positions
23, 24, 71 and 78.
Thus the mutated CDR-grafted B72.3 heavy
chain corresponds to a preferred em~odiment
of the present invention.
2 1292 1~
- ~ - 60 -
EXAMPLE 4
CDR-GRAFTING OF A MURINE ANTI-ICAM-1 MONOCLONAL
ANTIBQDY
A murine antibody, R6-5-D6 (EP 0314863) having
speci~icity for Intercellular Adhesion Molecule 1
(ICAM-1) was CDR-grafted substa~tially as described
above in previous examples. This work is described
in greater detail in published European application
EP-A-0 528 951.
The human EU framewo~k was used as the acceptor framework
for ~oth heavy and light chains. The CDR-grafted
antibody currently of choice is provided by co-expression
of grafted light chain gL22lA and grafted heavy chain
gH341D which has a binding affinity for ICAM 1 of about
75~ of that of the corresponding mouse-human chimeric
antibody.
LIGHT C~AIN
gL221A has murine CDRs at positions 24-34 (CDRl), 50-56
(CDR2) and 89-97 (CDR3). In addition several framewor~
residues are also the murine amino acid. These residues
were chosen after consideration of the possible
contribution of these residues to domain pac~ing and
stability of the conformation of the antigen ~inding
region. The residues which have been retained as mouse
are at positions 2, 3, 48 (?), 60, 84, 85 and 87.
Comparison of the murine anti-ICAM 1 and human EU light
chain amino acid sequences reveals that the murine and
human residues are identical at positions 46, 58 and 71.
~EAVY C~AIN
gH341D has murine CDRs at positions 26-35 (CDRl), 50-56
(CDR2) and94-lOOB (CDR3). In addition murine residues
were used in g~341D at positions 24, 48, 69, 71, 73, 80,
88 and 91. Comparison of the murine anti-ICAM 1 and
human EU heavy chain amino acid sequences are identical at
positions 23, 49 and 78.
.. . .
, . -
- 61 - ~12~2
EXAMP~ 5
CDR-Graftinq of murine anti-TNFa antibodies
A num~er of murine anti-TNFa monoclonal antibodies were
CDR-grafted substantially as described above in previous
examples. These antibodies include the murine monoclonal
antibodies designated 61 E71, hTNFl, hTNF3 and 101.4 A
brief summary of the CDR-grafting of each of these
antibodies is given below.
6lE71
A similar analysis as described above (Example 1, Section
12.1.) was done for 61E71 and for the heavy chain 10
residues were identified at 23, 24, 48, 4g, 68, 69, 71,
73, 75 and 88 as residues to potentially retain as
murine. The human frameworks chosen for CDR-grafting of
this antibody, and the hTNF3 and 101.4 antibodies were RE1
for the light chain and KOL for the heavy chain.
Three genes were built, the first of which contained 23,
24, 48, 49, 71 and 73 [gH341(6)] as murine residues. The
second gene also had 75 and 88 as murine residues
tgH341~8)] while the third gene additionally had 68, 69,
75 and 8~ as murine residues tgH341(10)]. Each was
co-expressed with gL221, the ~;n;~ll~ grafted light chain
~DRs only). The gL221/gH341(6) and gL221/q~341(8)
antihodies both bound as well to TNF as murine 6lE71.
The gL221/gH341(10) antibody did not express and this
combination was not taken further.
Subsequently the gL221/gH341(6) antibody was assessed in
an ~929 eell eom~et~tion ascay in whi~h the antibody
competes against the TNF receptor on L929 cells for
binding to TNF in solution. In this assay the
gL221/gH341(6) antibody was approximately 10~ as active as
murine 6lE71.
~ - 62 - ~ 2 ~ ~
hTNF1
hTNF1 is a monoclonal antibody which recognises an epitope
on human TNF-~ . The E~ human framework was used for
CDR-grafting of both the heavy and light variable dom~; n~ .
~eavy Chain
In the CDR-grafted heavy chain (ghTNF1) mouse CDRs were
used at positions 26-~5 (CDR1), 50-65 (CDR2) and 95-102
(CDR3). Mouse residues were also used in the framewor~s
at positions 48, ~7, 69, 71, 73, 76, 89, 91, 94 and 108.
Comparison of the TNF1 mouse and EU human heavy chain
residues reveals that these are identical at positions 23,
24, 29 and 78.
~ight Chain
In the CDR-grafted light chain (gLhTNF1) mouse CDRs wre
used at po~itions 24-34 (CDR1), 50-56 (CDR2) and 89-97
(CDR3). In addition mouse residues wer~ used in the
framewor~s at positions 3, 42, 48, 49, 83, 106 and 108.
Comparison of the hTNF1 mouse and ~U human light chain
residues reveals that these are identical at positions 46,
58 and 71.
The grafted hTNF1 heavy chain was co-expressed with the
chimeric light chain and the binding a~ility of the
product compared with that of the chimeric-light
chain/chimeric heavy chain product in a TNF binding assay.
The grafted heavy chain product appeared to have bin~;ng
ability for TNF slightly ~etter than the fully chimeric
product.
Similarly, a grafted heavy chain/grafted light chain
product was co-expressed and compared with the fully
chimeric product and found to have closely similar b;n~;ng
propertie~ to the latter product.
P~" "
- 63 -
hTNF3
hTNF3 recognises an epitope on human TNF- ~. The
sequence of hTNF3 shows only 21 differences compared to
61E71 in the light and heavy chain variable regions, 10 in
the light chain (2 in the CDRs at positions 50, 96 and 8
in the framework at 1, 19, 40, 45, 46, 76, 103 and 106)
and 11 in the heavy chain (3 in the CDR regions at
positions 52, 60 and 95 and 8 in the framework at 1, 10,
38, 40, 67, 73, 87 and 105). The light and heavy chains
of the 6lE71 and hTNF3 chimeric antibodies can be
exchanged without loss of activity in the direct binding
assay. ~owever 61E71 is an order of magnitude less able
to compete with the TNF receptor on L929 cells for TNF-a
compared to hTNF3. Based on the 6lE71 CDR gra~ting data
gL221 and gH341(+23, 24, 48, 4~ 71 and 73 as mouse) genes
have been built for hTNF3 and tested and the resultant
grafted antibody binds well to TNF-a, but competes very
poorly in the L929 assay. It is possible that in this
case also the framework residues identified for OKT3
programme may improve the competitive binding ability of
this antibody.
101.4
101.4 is a further mlrine monoclonal antibody able to
recognise human TNF-a. The heavy chain of this antibody
shows good homology to KOL and so the CDR-grafting has
been based on REl for the light chain and ROL for the
heavy chain. Several grafted heavy chain genes have been
constructed with conservative choices for the CDR's
(gH341) and which have one or a small number of non-CDR
residues at positions 73, 78 or 77-79 inclusive, as the
mouse amino acids. These have been co-expressed with cL
or gL221. In all cases binding to TNF equivalent to the
chimeric antibody is seen and when co-expressed with cL
the resultant antibodies are able to compete well in the
L929 assay. However, with gL221 the resultant antibodies
- 64 _ 2~ 29~ 1~
are at least an order of magnitude less able to compete
for TNF against the TNF receptor on L929 cells.
Mouse residues at other positions in the heavy chain, for
example, at 23 and 24 together or at 76 have been
demonstrated to provide no improvement to the competitive
ability of the grafted antibody in the L929 assay.
A num~er of other antibodies including antibodies having
specificity for interleukins e.g. IL1 and cancer markers
such as carcinoembryonic antigen (CEA) e.g. the monoclonal
antibody A5B7 (ref. 21), have been successfully
CDR-grafted according to the present invention.
It will be appreciated that the foregoing examples are
given by way of illustration only and are not intended to
limit the scope of the claimed invention. Changes and
modifications may be made to the methods described whilst
still falling within the spirit and scope of the invention.
~ - 65 _ 2~2~
References
1. Kohler & Milstein, Nature, 265, 295-497, 1975.
2. Chatenoud et al, (1986), J. Immunol. 137, 830-838.
3. Jeffers et al, (1986), Transplantation, 41, 572-578.
4. Begent et al, Br. J. Cancer 62: 487 (1990).
5. Verhoeyen et al, Science, 239, 1534-1536, 1988.
6. Riechmann et al, Nature, 332, 323-324, 1988.
7. Kabat, E.A., Wu, T.T., Reid-Miller, M., Perry, H.M.,
Gottesman, R.S., 1987, in Sequences of Proteins of
Immunological Interest, US Department of ~ealth and
Human Services, NIH, USA.
8. Wu, T.T., and Rabat, E.A., 1970, J. Exp. Med. 132
211-250.
.
9. Queen et al, (1989), Proc. Natl. Acad. Sci. USA, 86,
10029-10033 and WO 90/07861
10. Maniatis et al, Molecular Cloning, Cold Spring
Harbor, New York, 1989.
11. Primrose and Old, Principles of Gene Manipulation,
Blac~well, Oxford, 1980.
12. Sanger, F., Nic~len, S., Coulson, A.R., 1977, Proc.
Natl. Acad. Sci. USA, 74 5463
~ - 66 - ~12~21~
13. Kramer, W., Drutsa, V., Jansen, H.-W., Rramer, B.,
Plugfelder, M., Fritz, H.-J., 1984, Nucl. Acids Res.
12, 9441
14. Whittle, N., Adair, J., Lloyd, J.C., Jenkins, E.,
Devine, J., Schlom, J., Raubitshek, A., Colcher, D.,
Bodmer, M., 1987, Protein Engineering 1, 499.
15. Sikder, S.S., Akolkar, P.N., Raledas, P.M., Morrison,
S.L., Rabat, B.A., 1985, J. Immunol. 135, 4215.
16. Wallick, S.C., Rabat, E.A., Morri~on, S.L., 1988,
J. Exp. Med. 168, 1099
17. Bebbington, C.R., Published International Patent
Application W0 89 / 010 3 6.
18. Granthan and Perrin 1986, Immunology Today 7, 160.
19. Rozak, M., 1987, J. Mol. Biol. 196, 947.
20. Jones, T.P., Dear, P.H., Foote, J., Neuberger, M.S.,
~inter, G., 1986, Nature, 321, 522
21. Harwood et al, Br. J. Cancer, 54, 75-82 (1986).
