Note: Descriptions are shown in the official language in which they were submitted.
CA 02153336 2003-02-18
77396-19
1
RECOMBINANT VIRUS IMMUNOTHERAPY
F~EhD OF THE I_NV~F ~O_N,
The present invention xelatas to a modified poxvirus
and to methods of making and using the same_ More in
s particular, the invention relates to improved vectors for
the insertion and expression of foreign genes for use as
safe immunization ~rehicles to protect against a variety
of pathogens, as well as for use in iaesunotherapy.
Several publications are referenced in this
1o application. Full citation to these references is found
at the end of the specification immediately preceding the
claims or where t::e w:.z.iblicat.icn is ~nenticred.. ':hese
publicaticns re~.ate to Che art to whic:: t he invent=on
pertains.
15 _ ELKHOUND OF THE INV'E~IT~.ON
Vaccinia virus and more recently other poxviruses
have been used far the insertion and expression of
foreign genes. The basic technique of inserting foreign
genes into live infectious poxvirus involves
20 recombination between pox DNA sequences flanking a
foreign genetic element in a donor plasmid and homologcus
sequences present in the rescuing poxvirus (Piccini et
al . , 1980 .
Specifically, the recombinant poxviruses are
25 constructed in two steps known in the art and analogous
to the methods for. c~aating syntheic recombinants of
poxviruses such as the vaccinia v=rus and avipox virus
described in U.S. patent Nos. 4,769,330, 4,772,848,
4,603,11:2, S,IOO,:aB'', and 5,179,993, the disclosures of
30 which are incorporated herein by reference.
Firs;., the DNa gene sequence tc be inserted int:, the
virus, pa=ticular~~r an open readirc frame :rom a ner.-pcx
source, is placed into an ... ccii plasmid const_uct intc
which DN~~ hemc? ogous to a section of DltA cf the poxwirus
3 S has been inserted . ~epar a to 1',r, the DNA gene sequence to
be inserted is ligated to a promoter. The promoter-Gene
WO 94116716 PCTIUS94I00888
.215 3.3 ~~~ _
;,. -. . 2
linkage is positioned in the plasmid construct so that
the promoter-gene linkage is flanked on both ends by DNA
homologous to a DNA sequence flanking a region of pox DNA
containing a nonessential locus. The resulting plasmid
construct is then amplified by growth within E. coli
bacteria (Clewell, 1972) and isolated (Clewell et al.,
1969; Maniatis et al., 1982).
Second, the isolated plasmid containing the DNA gene
sequence to be inserted is transfected into a cell
1o culture, e.g. chick embryo fibroblasts, along with the
poxvirus. Recombination between homologous pox DNA in
the plasmid and the viral genome respectively gives a
poxvirus modified by the presence, in a nonessential
region of its genome, of foreign DNA sequences. The term
"foreign" DNA designates exogenous DNA, particularly DNA
from a non-pox source, that codes for gene products not
ordinarily produced by the genome into which the
exogenous DNA is placed.
Genetic recombination is in general the exchange of
2o homologous sections of DNA between two strands of DNA.
In certain viruses RNA may replace DNA. Homologous
sections of nucleic acid are sections of nucleic acid
(DNA or RNA) which have the same sequence of nucleotide
bases.
Genetic recombination may take place naturally
during the replication or manufacture of new viral
genomes within the infected host cell. Thus, genetic
recombination between viral genes may occur during the
viral replication cycle that takes place in a host cell
3o which is co-infected with two or more different viruses
or other genetic constructs. A section of DNA from a
first genome is used interchangeably in constructing the
section of the genome of a second co-infecting virus in
which the DNA is homologous with that of the first viral
genome .
However, recombination can also take place between
sections of DNA in different genomes that are not
WO 94/16716 PCTIUS94I00888
3
perfectly homologous. If one such section is from a
first genome homologous with a section of another genome
except for the presence within the first section of, for
example, a genetic marker or a gene coding for an
s antigenic determinant inserted into a portion of the
homologous DNA, recombination can still take place and
the products of that recombination are then detectable by
the presence of that genetic marker or gene in the
recombinant viral genome. Additional strategies have
to recently been reported for generating recombinant
vaccinia virus (Scheiflinger et al., 1992; Merchlinsky
and Moss, 1992).
Successful expression of the inserted DNA genetic
sequence by the modified infectious virus requires two
i5 conditions. First, the insertion must be into a
nonessential region of the virus in order that the
modified virus remain viable. The second condition for
expression of inserted DNA is the presence of a promoter
in the proper relationship to the inserted DNA. The
2o promoter must be placed so that it is located upstream
from the DNA sequence to be expressed.
Vaccinia virus has been used successfully to
immunize against smallpox, culminating in the worldwide
eradication of smallpox in 1980. In the course of its
25 history, many strains of vaccinia have arisen. These
different strains demonstrate varying immunogenicity and
are implicated to varying degrees with potential
complications, the most serious of which are post-
vaccinial encephalitis and generalized vaccinia
30 (Behbehani, 1983).
With the eradication of smallpox, a new role for
vaccinia became important, that of a genetically
engineered vector for the expression of foreign genes.
Genes encoding a vast number of heterologous antigens
3s have been expressed in vaccinia, often resulting in
protective immunity against challenge by the
corresponding pathogen (reviewed in Tartaglia et al.,
WO 94116716 '. . . PCT/US94100888
21 ~'~~~~~.
4
1990a,b).
The genetic background of the vaccinia vector has
been shown to affect the protective efficacy of the
expressed foreign immunogen. For example, expression of
s Epstein Barr Virus (EBV) gp340 in the Wyeth vaccine
strain of vaccinia virus did not protect cottontop
tamarins against EBV virus induced lymphoma, while
expression of the same gene in the WR laboratory strain
of vaccinia virus was protective (Morgan et al., 1988).
1o A fine balance between the efficacy and the safety
of a vaccinia virus-based recombinant vaccine candidate
is extremely important. The recombinant virus must
present the immunogen(s) in a manner that elicits a
protective immune response in the vaccinated animal but
is lacks any significant pathogenic properties. Therefore
attenuation of the vector strain would be a highly
desirable advance over the current state of technology.
A number of vaccinia genes have been identified
which are non-essential for growth of the virus in tissue
2o culture and whose deletion or inactivation reduces
virulence in a variety of animal systems.
The gene encoding the vaccinia virus thymidine
kinase (TK) has been mapped (Hruby et al., 1982) and
sequenced (Hruby et al., 1983; Weir et al., 1983).
2s Inactivation or complete deletion of the thymidine kinase
gene does not prevent growth of vaccinia virus in a wide
variety of cells in tissue culture. TK- vaccinia virus
is also capable of replication in vivo at the site of
inoculation in a variety of hosts by a variety of routes.
3o It has been shown for herpes simplex virus type 2
that intravaginal inoculation of guinea pigs with TK-
virus resulted in significantly lower virus titers in the
spinal cord than did inoculation with TK+ virus
(Stanberry et al., 1985). It has been demonstrated that
3s herpesvirus encoded TK activity in vitro was not
important for virus growth in actively metabolizing
cells, but was required for virus growth in quiescent
PCT/US94/00888
- WO 94/16716
cells (Jamieson et al., 1974).
Attenuation of TK- vaccinia has been shown in mice
inoculated by the intracerebral and intraperitoneal
routes (Buller et al., 1985). Attenuation was observed
s both for the WR neurovirulent laboratory strain and for
the Wyeth vaccine strain. In mice inoculated by the
intradermal route, TK- recombinant vaccinia generated
equivalent anti-vaccinia neutralizing antibodies as
compared with the parental TK+ vaccinia virus, indicating
to that in this test system the loss of TK function does not
significantly decrease immunogenicity of the vaccinia
virus vector. Following intranasal inoculation of mice
with TK- and TK+ recombinant vaccinia virus (WR strain),
significantly less dissemination of virus to other
1s locations, including the brain, has been found (Taylor et
al., 1991a).
Another enzyme involved with nucleotide metabolism
is ribonucleotide reductase. Loss of virally encoded
ribonucleotide reductase activity in herpes simplex virus
20 (HSV) by deletion of the gene encoding the large subunit
was shown to have no effect on viral growth and DNA
synthesis in dividing cells in vitro, but severely
compromised the ability of the virus to grow on serum
starved cells (Goldstein et al., 1988). Using a mouse
25 model for acute HSV infection of the eye and
reactivatable latent infection in the trigeminal ganglia,
reduced virulence was demonstrated for HSV deleted of the
large subunit of ribonucleotide reductase, compared to
the virulence exhibited by wild type HSV (Jacobson et
3o al., 1989).
Both the small (Slabaugh et al., 1988) and large
(Schmitt et al., 1988) subunits of ribonucleotide
reductase have been identified in vaccinia virus.
Insertional inactivation of the large subunit of
3s ribonucleotide reductase in the WR strain of vaccinia
virus leads to attenuation of the virus as measured by
intracranial inoculation of mice (Child et al., 1990).
WO 94116716 PCTIUS94100888
6
The vaccinia virus hemagglutinin gene (HA) has been
mapped and sequenced (Shida, 1986). The HA gene of
vaccinia virus is nonessential for growth in tissue
culture (Ichihashi et al., 1971). Inactivation of the HA
s gene of vaccinia virus results in reduced neurovirulence
in rabbits inoculated by the intracranial route and
smaller lesions in rabbits at the site of intradermal
inoculation (Shida et al., 1988). The HA locus was used
for the insertion of foreign genes in the WR strain
(Shida et al., 1987), derivatives of the Lister strain
(Shida et al., 1988) and the Copenhagen strain (Guo et
al., 1989) of vaccinia virus. Recombinant HA- vaccinia
virus expressing foreign genes have been shown to be
immunogenic (Guo et al., 1989; Itamura et al., 1990;
Shida et al., 1988; Shida et al., 1987) and protective
against challenge by the relevant pathogen (Guo et al.,
1989; Shida et al., 1987).
Cowpox virus (Brighton red strain) produces red
(hemorrhagic) pocks on the chorioallantoic membrane of
2o chicken eggs. Spontaneous deletions within the cowpox
genome generate mutants which produce white pocks (Pickup
et al., 1984). The hemorrhagic function (u) maps to a 38
kDa protein encoded by an early gene (Pickup et al.,
1986). This gene, which has homology to serine protease
2s inhibitors, has been shown to inhibit the host
inflammatory response to cowpox virus (Palumbo et al.,
1989) and is an inhibitor of blood coagulation.
The a gene is present in WR strain of vaccinia virus
(Kotwal et al., 1989b). Mice inoculated with a WR
3o vaccinia virus recombinant in which the a region has been
inactivated by insertion of a foreign gene produce higher
antibody levels to the foreign gene product compared to
mice inoculated with a similar recombinant vaccinia virus
in which the a gene is intact (Zhou et al., 1990). The a
3s region is present in a defective nonfunctional form in
Copenhagen strain of vaccinia virus (open reading frames
B13 and B14 by the terminology reported in Goebel et al.,
WO 94116716 PCTIUS94100888
_ ~~ ~.~~~~~~~s
1990a,b).
Cowpox virus is localized in infected cells in
cytoplasmic A type inclusion bodies (ATI) (Kato et al.,
1959). The function of ATI is thought to be the
s protection of cowpox virus virions during dissemination
from animal to animal (Bergoin et al., 1971). The ATI
region of the cowpox genome encodes a 160 kDa protein
which forms the matrix of the ATI bodies (Funahashi et
al., 1988; Patel et al., 1987). Vaccinia virus, though
io containing a homologous region in its genome, generally
does not produce ATI. In WR strain of vaccinia, the ATI
region of the genome is translated as a 94 kDa protein
(Patel et al., 1988). In Copenhagen strain of vaccinia
virus, most of the DNA sequences corresponding to the ATI
15 region are deleted, with the remaining 3' end of the
region fused with sequences upstream from the ATI region
to form open reading frame (ORF) A26L (Goebel et al.,
1990a,b).
A variety of spontaneous (Altenburger et al., 1989;
2o Drillien et al., 1981; Lai et al., 1989; Moss et al.,
1981; Paez et al., 1985; Panicali et al., 1981) and
engineered (Perkus et al., 1991; Perkus et al., 1989;
Perkus et al., 1986) deletions have been reported near
the left end of the vaccinia virus genome. A WR strain
2s of vaccinia virus with a 10 kb spontaneous deletion (Moss
et al., 1981; Panicali et al., 1981) was shown to be
attenuated by intracranial inoculation in mice (Buller et
al., 1985). This deletion was later shown to include 17
potential ORFs (Kotwal et al., 1988b). Specific genes
3o within the deleted region include the virokine N1L and a
35 kDa protein (C3L, by the terminology reported in
Goebel et al., 1990a,b). Insertional inactivation of N1L
reduces virulence by intracranial inoculation for both
normal and nude mice (Kotwal et al., 1989a). The 35 kDa
3s protein is secreted like N1L into the medium of vaccinia
virus infected cells. The protein contains homology to
the family of complement control proteins, particularly
WO 94116716 , .~ PCT/US94/00888
8
the complement 4B binding protein (C4bp) (Kotwal et al.,
1988a). Like the cellular C4bp, the vaccinia 35 kDa
protein binds the fourth component of complement and
inhibits the classical complement cascade (Kotwal et al.,
1990). Thus the vaccinia 35 kDa protein appears to be
involved in aiding the virus in evading host defense
mechanisms.
The left end of the vaccinia genome includes two
genes which have been identified as host range genes, K1L
(Gillard et al., 1986) and C7L (Perkus et al., 1990).
Deletion of both of these genes reduces the ability of
vaccinia virus to grow on a variety of human cell lines
(Perkus et al., 1990).
Two additional vaccine vector systems involve the
is use of naturally host-restricted poxviruses,
avipo~viruses. Both fowlpoxvirus (FPV) and
canarypoxvirus (CPV) have been engineered to express
foreign gene products. Fowlpox virus (FPV) is the
prototypic virus of the Avipox genus of the Poxvirus
2o family. The virus causes an economically important
disease of poultry which has been well controlled since
the 1920's by the use of live attenuated vaccines.
Replication of the avipox viruses is limited to avian
species (Matthews, 1982b) and there are no reports in the
2s literature of avipoxvirus causing a productive infection
in any non-avian species including man. This host
restriction provides an inherent safety barrier to
transmission of the virus to other species and makes use
of avipoxvirus based vaccine vectors in veterinary and
3o human applications an attractive proposition.
FPV has been used advantageously as a vector
expressing antigens from poultry pathogens. The
hemagglutinin protein of a virulent avian influenza virus
was expressed in an FPV recombinant (Taylor et al.,
3s 1988a). After inoculation of the recombinant into
chickens and turkeys, an immune response was induced
which was protective against either a homologous or a
WO 94/16716 , ~ ~~~ CTIUS94100888
3 6~
9
heterologous virulent influenza virus challenge (Taylor
et al., 1988a). FPV recombinants expressing the surface
glycoproteins of Newcastle Disease Virus hare also been
developed (Taylor et al., 1990; Edbauer et al., 1990).
s Despite the host-restriction for replication of FPV
and CPV to avian systems, recombinants deri~red from these
viruses were found to express extrinsic pros=Bins in cells
of nonavian origin. Further, such recombinant viruses
were shown to elicit immunological responses directed
io towards the foreign gene product and where appropriate
were shown to afford protection from challenge against
the corresponding pathogen (Tartaglia et al., 1993 a,b;
Taylor et al., 1992; 1991b; 1988b).
In the past, viruses have been shown to have utility
15 in cancer immunotherapy, in that, they provide a means of
enhancing tumor immunoresponsiveness. Examples exist
showing that viruses such as Newcastle disease virus
(Cassel et al., 1983), influenza virus (Lindenmann, 1974;
Lindenmann, 1967), and vaccinia virus (Wallack et al.,
20 1986; Shimizu et al., 1988; Shimizu et al. 1984; Fujiwara
et al., 1984) may act as tumor-modifying antigens or
adjuvants resulting in inducing tumor-specific and tumor-
nonspecific immune effector mechanisms. Due to advances
in the fields of immunology, tumor biology, and molecular
25 biology, however, such approaches have yielded to more
directed immunotherapeutic approaches for cancer.
Genetic modification of tumor cells and immune effector
cells (i.e. tumor-infiltrating lymphocytes; TILs) to
express, for instance cytokines, have provided
3o encouraging results in animal models and humans with
respect to augmenting tumor-directed immune responses
(Pardoll, 1992; Rosenberg, 1992). Further, the
definition of tumor-associated antigens (TAAs) has
provided the opportunity to investigate their role in the
3s immunobiology of certain cancers which may eventually be
applied to their use in cancer prevention or therapy (van
der Bruggen, 1992).
r
WO 94!16716 PCT/US94/00888
2 ~i53~3~ -
io
Advances in the use of eukaryotic vaccine vectors
have provided a renewed interest in viruses in cancer
prevention and therapy. Among the viruses engineered to
express foreign gene products are adenoviruses, adeno-
associated virus, baculovirus, herpesviruses, poxviruses,
and retroviruses. Most notably, retrovirus-, adenovirus
and poxvirus-based recombinant viruses have been
developed with the intent of in vivo utilization in the
areas of vector-based vaccines, gene therapy, and cancer
to therapy (Tartaglia, in press; Tartaglia, 1990).
Immunotherapeutic approaches to combat cancers or
neoplasia can take the form of classical vaccination
schemes or cell-based therapies. Immunotherapeutic
vaccination is the concept of inducing or enhancing
i5 immune responses of the cancer patient to antigenic
determinants that are uniquely expressed or expressed at
increased levels on tumor cells. Tumor-associated
antigens (TAAs) are usually of such weak immunogenicity
as to allow progression of the tumor unhindered by the
2o patient's immune system. Under normal circumstances, the
severity of the disease-state associated with the tumor
progresses more rapidly than the elaboration of immune
responses, if any, to the tumor cells. Consequently, the
patient may succumb to the neoplasia before a sufficient
2s immune response is mounted to control and prevent growth
and spread of the tumor.
Poxvirus vector technology has been utilized to
elicit immunological responses to TAAs. Examples exist
demonstrating the effectiveness of poxvirus-based
3o recombinant viruses expressing TAAs in animal models in
the immunoprophylaxis and immunotherapy of.
experimentally-induced tumors. The gene encoding
carcinoembryonic antigen (CEA) was isolated from human
colon tumor cells and inserted into the vaccinia virus
3s genome (Kaufman et al., 1991). Inoculation of the
vaccinia-based CEA recombinant elicited CEA-specific,
antibodies and an antitumor effect in a murine mouse
WO 94116716 215333 PCTIUS94100888
1l ~ .
model. This recombinant virus has been shown to elicit
humoral and cell-mediated responses in rhesus macaques
(Kantor et al., 1993). The human melanoma TAA, p97, has
also been inserted into vaccinia virus and shown to
s protect mice from tumor transplants (Hu et al., 1988;
Estin et al., 1988). A further example was described by
Bernards et al. (1987). These investigators constructed
a vaccinia recombinant that expressed the extracellular
domain of the rat neu-encoded transmembrane glycoprotein,
to p185. Mice immunized with this recombinant virus
developed a strong humoral response against the neu gene
product and were protected against subsequent tumor
challenge. vaccinia virus recombinants expressing either
a secreted or membrane-anchored form of a breast cancer-
15 associated epithelial tumor antigen (ETA) have been
generated for evaluation in the active immunotherapy of
breast cancer (Hareuveni et al., 1991; 1990). These
recombinant viruses have been shown to elicit anti-ETA
antibodies in mice and to protect mice against a
2o tumorigenic challenge with a ras-transformed Fischer rat
fibroblast line expressing either form of ETA (Hareuveni
et al., 1990). Further, vaccinia virus recombinants
expressing the polyoma virus-derived T-Ag were shown
efficacious for prevention and therapy in a mouse tumor
2s model system (Lathe et al., 1987).
Recombinant vaccinia viruses have also been used to
express cytokine genes (Reviewed by Ruby et al., 1992).
Expression of certain cytokines (IL-2, IFN-a, TNF-a) lead
to self-limiting vaccinia virus infection in mice and, in
3o essence, act to attenuate the virus. Expression of other
cytokines (i.e. IL-5, IL-6) were found to modulate the
immune response to co-expressed extrinsic immunogens
(Reviewed by Ruby et al., 1992).
Frequently, immune responses against tumor cells are
35 mediated by T cells, particularly cytotoxic T lymphocytes
(CTLs); white blood cells capable of killing tumor cells
and virus-infected cells (Greenberg, 1991). The behavior
WO 94116716 ~ i PCTIUS94/00888
12
of CTLs is regulated by soluble factors termed cytokines.
Cytokines direct the growth, differentiation, and
functional properties of CTLs, as well as, other immune
effector cells.
Cell-based immunotherapy has been shown to provide -
effective therapy for viruses and tumors in animal models
(Greenberg, 1991; Pardoll, 1992; Riddel et al., 1992). '
Cytomegalovirus (CMV)-specific CTL clones from bone
marrow donors have recently been isolated. These clones
to were propagated and expanded in vitro and ultimately
returned to immunodeficient bone marrow patients. These
transferred CMV-specific CTL clones provided no toxic-
effects and provided persistent reconstitution of CD8+
CMV-specific CTL responses preventing CMV infection in
the transplant patient (Riddel et al., 1992).
There exists two forms of cell-based immunotherapy.
These are adoptive immunotherapy, which involves the
expansion of tumor reactive lymphocytes in vitro and
reinfusion into the host, and active immunotherapy, which
2o involves immunization of tumor cells to potentially
enhance existing or to elicit novel tumor-specific immune
responses and provide systemic anti-tumor immunity.
Immunotherapeutic vaccination is the concept of inducing
or enhancing immune responses of the cancer patient to
2s antigenic determinants that are uniquely expressed or
expressed at increased levels on tumor cells.
It can be appreciated that provision of novel
strains, such as NYVAC, ALVAC, and TROVAC having enhanced
safety would be a highly desirable advance over the
3o current state of technology. For instance, so as to
provide safer vaccines or safer products from the
expression of a gene or genes by a virus. '
OBJECTS OF THE INVENTION
It is therefore an object of this invention to
35 provide modified recombinant viruses, which viruses have
enhanced safety, and to provide a method of making such
recombinant viruses.
WO 94116716 33 PCTIUS94/00888
,. 3~
13
It is an additional object of this invention to
provide a recombinant poxvirus vaccine having an
increased level of safety compared to known recombinant
poxvirus vaccines.
It is a further object of this invention to provide
a modified vector for expressing a gene product in a
host, wherein the vector is modified so that it has
attenuated virulence in the host.
It is another object of this invention to provide a
to method for expressing a gene product in a cell cultured
in vitro using a modified recombinant virus or modified
vector having an increased level of safety.
These and other objects and advantages of the
present invention will become more readily apparent after
is consideration of the following.
STATEMENT OF THE INVENTION
In one aspect, the present invention relates to a
modified recombinant virus having inactivated virus-
encoded genetic functions so that the recombinant virus
2o has attenuated virulence and enhanced safety. The
functions can be non-essential, or associated with
virulence. The virus is advantageously a poxvirus,
particularly a vaccinia virus or an avipox virus, such as
fowlpox virus and canarypox virus. The modified
2s recombinant virus can include, within a non-essential
region of the virus genome, a heterologous DNA sequence
which encodes an antigenic protein, e.g., derived from a
pathogen, a tumor associated antigen, a cytokine, or
combination thereof.
3o In another aspect, the present invention relates to
a vaccine for inducing an antigenic response in a host
animal inoculated with the vaccine, said vaccine
including a carrier and a modified recombinant virus
having inactivated nonessential virus-encoded genetic
35 functions so that the recombinant virus has attenuated
virulence and enhanced safety. The virus used in the
vaccine according to the present invention is
WO 94116716 , # .. -, PCT/US94/00888
~, ,. :.
21~~ '~ 3'~ ~6~ ~ __
14
advantageously a poxvirus, particularly a vaccinia virus
or an avipox virus, such as fowlpox virus and canarypox
virus. The modified recombinant virus can include,
within a non-essential region of the virus genome, a
s heterologous DNA sequence which encodes an antigenic
protein, e.g., derived from a pathogen, a tumor
associated antigen, a cytokine, or combination thereof.
In yet another aspect, the present invention relates
to an immunogenic composition containing a modified
1o recombinant virus having inactivated nonessential virus-
encoded genetic functions so that the recombinant virus
has attenuated virulence and enhanced safety. The
modified recombinant virus includes, within a non-
essential region of the virus genome, a heterologous DNA
is sequence which encodes an antigenic protein (e. g.,
derived from a pathogen, a tumor associated antigen, a
cytokine, or combination thereof) wherein the
composition, when administered to a host, is capable of
inducing an immunological response specific to the
2o protein encoded by the pathogen.
In a further aspect, the present invention relates
to a method for expressing a gene product in a cell
cultured in vitro by introducing into the cell a modified
recombinant virus having attenuated virulence and
25 enhanced safety. The modified recombinant virus can
include, within a non-essential region of the virus
genome, a heterologous DNA sequence which encodes an
antigenic protein, e.g., derived from a pathogen, a tumor
associated antigen, a cytokine, or combination thereof.
3o In a still further aspect, the present invention
relates to a modified recombinant virus having
nonessential virus-encoded genetic functions inactivated
therein so that the virus has attenuated virulence, and
wherein the modified recombinant virus further contains
3s DNA from a heterologous source in a nonessential region
of the virus genome. The DNA can code for a tumor
associated antigen, a cytokine, or a combination thereof.
CA 02153336 2004-04-19
77396-19
In particular, the genetic functions are inactivated by
deleting an open reading frame encoding a virulence factor
or by utilizing naturally host restricted viruses. The
virus used according to the present invention is
5 advantageously a poxvirus, particularly a vaccinia virus or
an avipox virus, such as fowlpox virus and canarypox virus.
Advantageously, the open reading frame is selected from the
group consisting of J2R, B13R + B14R, A26L, A56R, C7L - K1L,
and I4L (by the terminology reported in Goebel et al.,
10 1990a,b); and, the combination thereof. In this respect,
the open reading frame comprises a thymidine kinase gene, a
hemorrhagic region, an A type inclusion body region, a
hemagglutinin gene, a host range gene region or a large
subunit, ribonucleotide reductase; or, the combination
15 thereof. The modified Copenhagen strain of vaccinia virus
is identified as NYVAC (Tartaglia et al., 1992).
According to another aspect of the present
invention, there is provided a recombinant poxvirus
containing in a non-essential region of the poxvirus genome
exogenous DNA encoding at least one cytokine,
immunostimulatory molecule, or tumor-associated antigen,
wherein the poxvirus is a recombinant vaccinia virus in
which the regions C7L-K1L, J2R, B13R+B14R, A56R and I4L have
been deleted therefrom.
According to still another aspect of the present
invention, there is provided a recombinant poxvirus
containing in a non-essential region of the poxvirus genome
exogenous DNA encoding at least one cytokine,
immunostimulatory molecule, or tumor-associated antigen,
wherein the poxvirus is a recombinant vaccinia virus wherein
the open reading frames for the thymidine kinase gene, the
hemorrhagic region, the A type inclusion body region, the
hemagglutinin gene, the host range gene region, and the
CA 02153336 2005-08-25
77396-19
15a
large subunit ribonucleotide reductase gene have been
deleted therefrom.
According to yet another aspect of the present
invention, there is provided a recombinant poxvirus
containing in a non-essential region of the poxvirus genome
exogenous DNA encoding at least one cytokine,
immunostimulatory molecule, or tumor-associated antigen,
wherein the poxvirus vector is a recombinant NYVAC, wherein
the open reading frames for the thymidine kinase gene, the
hemorrhagic region, the A type inclusion body region, the
hemagglutinin gene, the host range gene region, and the
large subunit ribonucleotide reductase gene have been
deleted therefrom.
According to a further aspect of the present
invention, there is provided a recombinant poxvirus
containing therein exogenous DNA coding for a cytokine,
exogenous DNA encoding at least one cytokine,
immunostimulatory molecule, or tumor-associated antigen in a
non-essential region of the poxvirus genome, wherein the
poxvirus expresses the exogenous DNA, wherein the poxvirus
vector is the recombinant vaccinia virus NYVAC.
According to still a further aspect of the present
invention, there is provided a recombinant poxvirus
containing in a non-essential region of the poxvirus genome
exogenous DNA encoding at least one cytokine,
immunostimulatory molecule, or tumor-associated antigen,
wherein the poxvirus vector is ALVAC.
According to another aspect of the present
invention, there is provided a recombinant poxvirus selected
from the group consisting of vP1200, vP1101, vP1098, vP1239,
vP1241, vP1237, vP1244, vP1243, vP1248, NYVAC+IFNy+IL-2,
CA 02153336 2005-08-25
77396-19
15b
vP1250, vP1246, NYVAC+IL-12, vP1230, vP1245, NYVAC+IFNY+IR7,
vP1234, vP1233, vP1100 and vP1096.
BRIEF DESCRIPTION OF THE DRAWINGS
The following detailed description, given by way
of example, but not intended to limit the invention solely
to the specific embodiments described, may best be
understood in conjunction with the accompanying drawings, in
which:
FIG. 1 schematically shows a method for the
construction of plasmid pSD460 for deletion of thymidine
kinase gene and generation of recombinant vaccinia virus
vP410;
FIG. 2 schematically shows a method for the
construction of plasmid pSD486 for deletion of hemorrhagic
region and generation of recombinant vaccinia virus vP553;
FIG. 3 schematically shows a method for the
construction of plasmid pMP4940 for deletion of ATI region
and generation of recombinant vaccinia virus vP618;
FIG. 4 schematically shows a method for the
construction of plasmid pSD467 for deletion of
WO 94/16716 : ~ ~ ' PCTIUS94I00888
2 ~'~ ~
16
hemagglutinin gene and generation of recombinant vaccinia
virus vP723;
FIG. 5 schematically shows a method for the
construction of plasmid pMPCKl~ for deletion of gene
cluster [C7L - K1L) and generation of recombinant
vaccinia virus vP804;
FIG. 6 schematically shows a method for the
construction of plasmid pSD548 for deletion of large
subunit, ribonucleotide reductase and generation of
1o recombinant vaccinia virus vP866 (NYVAC);
FIG. 7 schematically shows a method for the
construction of plasmid pRW842 for insertion of rabies
glycoprotein G gene into the TK deletion locus and
generation of recombinant vaccinia virus vP879;
FIG. 8 shows the DNA sequence (SEQ ID N0:68) of a
canarypox PvuII fragment containing the C5 ORF.
FIGS. 9A and 9B schematically show a method for the
construction of recombinant canarypox virus vCP65 (ALVAC-
RG);
2o FIG. 10 shows schematically the ORFs deleted to
generate NYVAC;
FIG. 11 shows the nucleotide sequence (SEQ ID N0:77)
of a fragment of TROVAC DNA containing an F8 ORF;
FIG. 12 shows the DNA sequence (SEQ ID N0:78) of a
2356 base pair fragment of TROVAC DNA containing the F7
ORF;
FIGS. 13A to 13D show graphs of rabies neutralizing
antibody titers (REFIT, IU/ml), booster effect of HDC and
vCP65 (105-5 TCID50) in volunteers previously immunized
3o with either the same or the alternate vaccine (vaccines
given at days 0, 28 and 180, antibody titers measured at
days 0, 7, 28, 35, 56, 173, 187 and 208);
FIG. 14A to 14C show the nucleotide sequence of a
7351 by fragment containing the ALVAC C3 insertion site
(SEQ ID N0:127);
FIG. 15 shows the nucleotide sequences of H6/TNF-a
expression cassette and flanking regions from vCP245 (SEQ
WO 94116716 ~. ~ ~ ~ ~ ~ PCT/US94I00888
- 17 ,,
ID N0:79);
FIG. 16 shows the nucleotide sequence of the H6/TNF-
a expression cassette and flanking regions from vP1200
(SEQ ID N0:89);
FIG. 17 shows the nucleotide sequence of the H6/p53
(wildtype) expression cassette and flanking regions from
vP1101 (SEQ ID N0:99);
FIG. 18 shows the nucleotide sequence of the H6/p53
(wildtype) expression cassette and flanking regions from
vCP207 (SEQ ID N0:99);
FIG. 19 shows the nucleotide sequence of the
H6/MAGE-1 expression cassette and flanking region from
vCP235 (SEQ ID N0:109);
FIG. 20 shows the nucleotide sequence of the
H6/MAGE-1 expression cassette and flanking regions from
pMAW037 (SEQ ID NO:110);
FIG. 21A and B show the nucleotide sequence of the
p126.15 SERA cDNA insert along with the predicted amino
acid sequence (SEQ ID NOS:119; 120);
2o FIG. 22 shows the nucleotide sequence of the H6/CEA
expression cassette and flanking regions from
pH6.CEA.C3.2 (SEQ ID N0:144);
FIG. 23 shows the nucleotide sequence of the H6/CEA
expression cassette and flanking regions from pH6.CEA.HA
(SEQ ID N0:145);
FIG. 24 shows the nucleotide sequence of murine IL-2
from the translation initiation codon through the stop
codon (SEQ ID N0:150);
FIG. 25 shows the corrected nucleotide sequence of
3o human IL-2 from the translation initiation codon through
the stop codon (SEQ ID N0:159);
FIG. 26 shows the nucleotide sequence of the
I3L/murine IFN~y expression cassette (SEQ ID N0:163);
FIG. 27 shows the nucleotide sequence of the
I3L/human IFNy expression cassette (SEQ ID N0:168);
FIG. 28 shows the nucleotide sequence of the
canarypox insert in pC6HIII3kb (SEQ ID N0:169);
WO 94/16716 PCTIUS94100888
..,
2~~_~ .,:
FIG. 29 shows the nucleotide sequence pC6L (SEQ ID
N0:174);
FIG. 30 shows the nucleotide sequence of the
E3L/murine IL-4 expression cassette (SEQ ID N0:178);
s FIG. 31 shows the nucleotide sequence of the
expression cassette comprising the E3L promoted human IL-
4 gene (SEQ ID N0:186);
FIG. 32 shows the nucleotide sequence of the
vaccinia E3L/hGMCSF expression cassette (SEQ ID N0:191);
1o FIG. 33 shows the sequence of the EPV 42kDa/human
IL-12 P40 expression cassette (SEQ ID N0:194);
FIG. 34 shows the nucleotide sequence of the
vaccinia E3L/human IL-12 P35 expression cassette (SEQ ID
N0:199);
15 FIG. 35 shows the nucleotide sequence of the murine
B7 gene (SEQ ID N0:202);
FIG. 36 shows flow cytometric analysis of murine B7
expression in NYVAC and ALVAC infected murine tumor cell
lines;
2o FIG. 37 shows the nucleotide sequence for the human
B7 gene (SEQ ID N0:207);
FIG. 38 shows the murine p53 gene (SEQ ID N0:214);
and
FIG. 39 shows the coding sequence for the human p53
25 gene (SEQ ID N0:215).
DETAILED DESCRIPTION OF THE INVENTION
To develop a new vaccinia vaccine strain, NYVAC
(vP866), the Copenhagen vaccine strain of vaccinia virus
was modified by the deletion of six nonessential regions
30 of the genome encoding known or potential virulence
factors. The sequential deletions are detailed below.
All designations of vaccinia restriction fragments, open
reading frames and nucleotide positions are based on the
terminology reported in Goebel et al., 1990a,b.
35 The deletion loci were also engineered as recipient
loci for the insertion of foreign genes.
The regions deleted in NYVAC are listed below. Also
WO 94116716 ~ ~ , PCTIUS94100888
,= _
19
listed are the abbreviations and open reading frame
designations for the deleted regions (Goebe7_ et al.,
1990a,b) and the designation of the vaccini<< recombinant
(vP) containing all deletions through the deletion
s specified:
(1) thymidine kinase gene (TK; J2R) vF~410;
(2) hemorrhagic region (u; B13R + B14R) vP553;
(3) A type inclusion body region (ATI; A26L) vP618;
(4) hemagglutinin gene (HA; A56R) vP723;
(5) host range gene region (C7L - KiL) vP804; and
(6) large subunit, ribonucleotide reductase (I4L)
vP866 (NYVAC).
NYVAC is a genetically engineered vaccinia virus
strain that was generated by the specific deletion of
is eighteen open reading frames encoding gene products
associated with virulence and host range. NYVAC is
highly attenuated by a number of criteria including i)
decreased virulence after intracerebral inoculation in
newborn mice, ii) inocuity in genetically (nu+/nu+) or
2o chemically (cyclophosphamide) immunocompromised mice,
iii) failure to cause disseminated infection in
immunocompromised mice, iv) lack of significant
induration and ulceration on rabbit skin, v) rapid
clearance from the site of inoculation, and vi) greatly
2s reduced replication competency on a number of tissue
culture cell lines including those of human origin.
Nevertheless, NYVAC based vectors induce excellent
responses to extrinsic immunogens and provided protective
immunity.
3o TROVAC refers to an attenuated fowlpox that was a
plaque-cloned isolate derived from the FP-1 vaccine
strain of fowlpoxvirus which is licensed for vaccination
of 1 day old chicks. ALVAC is an attenuated canarypox
virus-based vector that was a plaque-cloned derivative of
3s the licensed canarypox vaccine, Kanapox (Tartaglia et
al., 1992). ALVAC has some general properties which are
the same as some general properties of Kanapox. ALVAC-
WO 94/16716 ~ v PCTIUS94/00888
t~
~j ~,> '-
based recombinant viruses expressing extrinsic immunogens
have also been demonstrated efficacious as vaccine
vectors (Tartaglia et al., 1993 a,b). This avipox vector
is restricted to avian species for productive
s replication. On human cell cultures, canarypox virus
replication is aborted early in the viral replication
cycle prior to viral DNA synthesis. Nevertheless, when
engineered to express extrinsic immunogens, authentic
expression and processing is observed in vitro in
mammalian cells and inoculation into numerous mammalian
species induces antibody and cellular immune responses to
the extrinsic immunogen and provides protection against
challenge with the cognate pathogen (Taylor et al., 1992;
Taylor et al., 1991). Recent Phase I clinical trials in
1s both Europe and the United States of a canarypox/rabies
glycoprotein recombinant (ALVAC-RG) demonstrated that the
experimental vaccine was well tolerated and induced
protective levels of rabiesvirus neutralizing antibody
titers (Cadoz et al., 1992; Fries et al., 1992).
2o Additionally, peripheral blood mononuclear cells (PBMCs)
derived from the ALVAC-RG vaccine demonstrated
significant levels of lymphocyte proliferation when
stimulated with purified rabies virus (Fries et al.,
1992).
NYVAC, ALVAC and TROVAC have also been recognized as
unique among all poxviruses in that the National
Institutes of Health ("NIH")(U.S. Public Health Service),
Recombinant DNA Advisory Committee, which issues
guidelines for the physical containment of genetic
3o material such as viruses and vectors, i.e., guidelines
for safety procedures for the use of such viruses and
vectors which are based upon the pathogenicity of the
particular virus or vector, granted a reduction in
physical containment level: from BL2 to BL1. No other
3s poxvirus has a BL1 physical containment level. Even the
Copenhagen strain of vaccinia virus - the common smallpox
vaccine - has a higher physical containment level;
WO 94/16716 'e .~~: . PCTIUS94I00888
21
namely, BL2. Accordingly, the art has recognized that
NYVAC, ALVAC and TROVAC have a lower pathogenicity than
any other poxvirus. .
Both NYVAC- and ALVAC-based recombinant viruses have
been shown to stimulate in vitro specific CD8+ CTLs from
human PBMCs (Tartaglia et al., 1993a). Mice immunized
with NYVAC or ALVAC recombinants expressing various forms
of the HIV-1 envelope glycoprotein generated both primary
and memory HIV specific CTL responses which could be
to recalled by a second inoculation (Tartaglia et al.,
1993a). ALVAC-env and NYVAC-env recombinants (expressing
the HIV-1 envelope glycoprotein) stimulated strong HIV-
specific CTL responses from peripheral blood mononuclear
cells (PBMC) of HIV-1 infected individuals (Tartaglia et
al., 1993a). Acutely infected autologous PBMC were used
as stimulator cells for the remaining PBMC. After 10
days incubation in the absence of exogenous IL-2, the
cells were evaluated for CTL activities. NYVAC-env and
ALVAC-env stimulated high levels of anti-HIV activities.
2o Thus, these vectors lend themselves well to ex vivo
stimulation of antigen reactive lymphocytes; for example,
adoptive immunotherapy such as the ex vivo expression of
tumor reactive lymphocytes and reinfusion into the host
(patient).
Immunization of the patient with NYVAC-, ALVAC-, or
TROVAC-based recombinant viruses expressing TAAs produced
by the patient's tumor cells can elicit anti-tumor immune
responses more rapidly and to sufficient levels to impede
or halt tumor spread and potentially eliminate the tumor
3o burden .
Clearly based on the attenuation profiles of the
NYVAC, ALVAC, and TROVAC vectors and their demonstrated
ability to elicit both humoral and cellular immunological
responses to extrinsic immunogens (Tartaglia et al.,
1993a,b; Taylor et al., 1992; Konishi et al., 1992) such
recombinant viruses offer a distinct advantage over
previously described vaccinia-based recombinant viruses.
WO 94/16716 PCTIUS94/00888
2 ~ ~~~~~~:
22
The immunization procedure for such recombinant
viruses as immunotherapeutic vaccines or compositions may
be via a parenteral route (intradermal, intramuscular or
subcutaneous). Such an administration enables a systemic
immune response against the specific TAA(s).
Alternatively, the vaccine or composition may be
administered directly into the tumor mass (intratumor).
Such a route of administration can enhance the anti-tumor
activities of lymphocytes specifically associated with
1o tumors (Rosenberg, 1992). Immunization of the patient
with NYVAC-, ALVAC- or TROVAC-based recombinant viruses
expressing TAAs produced by the patient's tumor cells can
elicit anti-tumor immune. responses more rapidly and to
sufficient levels to impede or halt tumor spread and
potentially eliminate the tumor burden. The heightened
tumor-specific immune response resulting from
vaccinations with these poxvirus-based recombinant
vaccines can result in remission of the tumor, including
permanent remission of the tumor. Examples of known TAAs
2o for which recombinant poxviruses can be generated and
employed with immunotherapeutic value in accordance with
this invention include, but are not limited to p53
(Hollstein et al., 1991), p21-ras (Almoguera et al.,
1988), HER-2 (Fendly et al., 1990), and the melanoma-
associated antigens IMAGE-1; MZE-2) (van der Bruggen et
al., 1991), and p97 (Hu et al., 1988) and the
carcinoembryonic antigen (CEA) associated with
colorecteal cancer (Kantor et al., 1993; Fishbein et al.,
1992; Kaufman et al., 1991).
3o More generally, the inventive vaccines or
compositions (vaccines or compositions containing the
poxvirus recombinants of the invention) can be prepared
in accordance with standard techniques well known to
those skilled in the pharmaceutical art. Such vaccines
or compositions can be administered to a patient in need
. of such administration in dosages and by techniques well
known to those skilled in the medical arts taking into
fVO 94116716 PCTlUS94100888
..
23
consideration such factors as the age, sex, weight, and
condition of the particular patient, and the route of
administration. The vaccines or compositions can be co-
administered or sequentially administered with other
s antineoplastic, anti-tumor or anti-cancer agents and/or
with agents which reduce or alleviate ill effects of
antineoplastic, anti-tumor or anti-cancer agents; again
taking into consideration such factors as the age, sex,
weight, and condition of the particular patient, and, the
1o route of administration.
Examples of vaccines or compositions of the
invention include liquid preparations for orifice, e.g.,
oral, nasal, anal, vaginal, etc., administration such as
suspensions, syrups or elixirs; and, preparations for
1s parental, subcutaneous, intradermal, intramuscular or
intravenous administration (e. g., injectable
administration) such as sterile suspensions or emulsions.
In such compositions the recombinant poxvirus may be in
admixture with a suitable carrier, diluent, or excipient
2o such as sterile water, physiological saline, glucose or
the like. The recombinant poxvirus of the invention can
be provided in lyophilized form for reconstituting, for
instance, in isotonic aqueous, saline buffer. Further,
the invention also comprehends a kit wherein the
25 recombinant poxvirus is provided. The kit can include a
separate container containing a suitable carrier, diluent
or excipient. The kit can also include an additional
anti-cancer, anti-tumor or antineoplastic agent and/or an
agent which reduces or alleviates ill effects of
3o antineoplastic, anti-tumor or anti-cancer agents for co-
or sequential-administration. Additionally, the kit can
include instructions for mixing or combining ingredients
and/or administration.
The poxvirus vector technology provides an appealing
s5 approach towards manipulating lymphocytes and tumor cells
for use in cell-based immunotherapeutic modalities for
cancer. Characteristics of the NYVAC, ALVAC and TROVAC
WO 94116716 ° . _ _ PCTIUS94I00888
21~3$~36~~ -
24
vectors providing the impetus for such applications
include 1) their apparent independence for specific
receptors for entry into cells, 2) their ability to
express foreign genes in cell substrates despite their
s species- or tissue-specific origin, 3) their ability to
express foreign genes independent of host cell
regulation, 4) the demonstrated ability of using poxvirus
recombinant viruses to amplify specific CTL reactivities
from peripheral blood mononuclear cells (PBMCs), and 5)
1o their highly attenuated properties compared to existing
vaccinia virus vaccine strains (Reviewed by Tartaglia et
al., 1993a; Tartaglia et al., 1990).
The expression of specific cytokines or the co-
expression of specific cytokines with TAAs by NYVAC-,
15 ALVAC-, and TROVAC-based recombinant viruses can enhance
the numbers and anti-tumor activities of CTLs associated
with tumor cell depletion or elimination. Examples of
cytokines which have a beneficial effect in this regard
include tumor necrosis factor-a (TNF-a). interferon-gamma
20 (INF-gamma), interleukin-2 (IL-2), interleukin-4 (IL-4),
and interleukin-7 (IL-7) (reviewed by Pardoll, 1992).
Cytokine interleukin 2 (IL-2) plays a major role in
promoting cell mediated immunity. Secreted by the TH1
subset of lymphocytes, IL-2 is a T cell growth factor
25 which stimulates division of both CD4+ and CD8+ T cells.
In addition, IL-2 also has been shown to activate B
cells, monocytes and natural killer cells. To a large
degree the biological effects of IL-2 are due to its role
in inducing production of IFNy. Recombinant vaccinia
3o virus expressing IL-2 is attenuated in mice compared to
wild-type vaccinia virus. This is due to the ability of
the vaccinia-expressed IL-2 to stimulate mouse NK cells
to produce IFNy, which limits the growth of the
recombinant vaccinia virus (Karupiah et al., 1990).
35 Similarly, it has been shown that inoculation of
immunodeficient athymic nude mice with recombinant
vaccinia virus expressing both IL-2 and the HA gene of
WO 94116716 ~ ~ ~ PCTIUS94/00888
~'
r 1R
influenza can protect these mice from subsequent
challenge with influenza virus (Karupiah et al., 1992).
Cytokine interferon y (IFNy) is secreted by the TH1
subset of lymphocytes. IFNy promotes the TH1 cell
5 mediated immune response, while inhibiting the TH2
(antibody) response. IFNY induces the expression of
major histocompatibility complex (MHC) molecules on
antigen presenting cells, and induces the expression of
the B7 costimulatory molecule on macrophages. In
io addition to enhancing the phagocytic activity of
macrophages, IFNy enhances the cytotoxic activity of NK
cells. When expressed in replicating recombinant
vaccinia virus, IFN~y limits the growth of the recombinant
virus. This allows T cell immunodeficient mice to
15 resolve the infection (Kohonen-Corish et al., 1990).
Cytokine interleukin 4 (IL-4) is secreted by the TH2
subset of lymphocytes. IL-4 promotes the TH2 (antibody)
response, while inhibiting the TH1 cell mediated immune
response. Recombinant vaccinia virus expressing IL-4
2o shows increased pathogenicity in mice compared to wild-
type vaccinia virus (Ramshaw et al., 1992).
Cytokine granulocyte macrophage colony stimulating
factor (GMCSF) is pleiotropic. In addition to
stimulating the proliferation of cells of both the
25 granulocyte and macrophage cell lineages, GMCSF, in
cross-competition with interleukins 3 and 5 (IL-3 and IL-
5), influences many other aspects of hematopoiesis and
may play a role in facilitation of tumor cell growth
(Lopez et al., 1992). GMCSF is used clinically for
3o hematopoietic reconstitution following bone marrow
transplantation.
Cytokine interleukin 12 (IL-12), formerly known as
natural killer (NK) cell stimulatory factor, is a
heterodimer composed of 35kDa and 40kDa subunits. IL-12
is produced by monocytes, macrophages, B cells and other
accessory cells. IL-12 has pleiotropic effects on both
NK cells and T cells. Partly through its role in
WO 94/16716 PCTIUS94/00888
'~i ~ .
;,
26
inducing IFNy production, IL-12 plays a major role in
promoting the TH1 cell mediated immune response, while
inhibiting the TH2 response (reviewed in Trinchieri,
1993). Recently, recombinant murine IL-12 has been
demonstrated to have potent antitumor and antimetastatic
effects in mice (Brunda et al., 1993).
B7(BB-1), a member of the immunoglobin superfamily,
is present on the surface of antigen presenting cells.
Interaction of the B7 molecule on antigen presenting
1o cells with its receptors on T cells provides
costimulatory signals, including IL-2, which are
necessary for T cell activation (Schwartz, 1992).
Recently it was shown that experimental co-expression of
B7 along with a tumor antigen on murine melanoma cells
can lead to regression of tumors in mice. This was
accomplished by the B7-assisted activation of tumor-
specific cytotoxic T cells (Chen et al, 1992).
The c-erb-B-2 gene, which is conserved among
vertebrates, encodes a possible receptor protein. The
185 kDa translation product contains a kinase domain
which is highly homologous to the kinase domain of the
epidermal growth factor (EGF) receptor. The c-erb-B-2
gene is conserved among vertebrates, and is the same as
the rat neu gene, which has been detected in a number of
2s rat neuro/glioblastomas. The human c-erb-B-2 gene, also
known as HER2, is amplified in certain neoplasias, most
notably breast cancer. In the gastric cancer cell line,
MKN-7, both the normal 4.6 kb transcript encoding c-erb-
B-2 and a 2.3 kb transcript which specifies only the
3o extracellular domain of the putative receptor are
synthesized at elevated levels (Yamamoto et al., 1986).
The extracellular domain has been suggested as a
potential immunogen for active specific immunotherapy of
breast cancer (Fendly et al., 1990).
35 Utility of NYVAC-, ALVAC-, and TROVAC-based
recombinant viruses expressing TAAs plus or minus
specific cytokines for adoptive immunotherapy can take
WO 94/16716 PCT/US94/00888
27
several forms. For one, genetic modification of PBMCs
can be accomplished by vector-mediated introduction of
TAAs, cytokine genes, or other genes and then directly
reintroduced into the patient. Such administration
relies on the drainage or movement of modified PBMCs to
lymphoid tissue (i.e. spleen; lymph nodes) via the
reticuloendothelial system (RES) for elicitation of the
tumor-specific immune response. PBMCs modified by
infection with the pertinent NYVAC-, ALVAC-, and TROVAC-
1o based recombinant can be employed, for instance, in
vitro, to expand TAA-specific CTLs for reinfusion into
the patient. Tumor-infiltrating lymphocytes (TILs)
derived from the tumor mass can be isolated, expanded,
and modified to express pertinent genes using NYVAC-,
ALVAC-, or TROVAC-based recombinants viruses prior to
reinfusion into the patient. TILs retain the capability
of returning to tumors (homing) when re-introduced into
the subject (Rosenberg, 1992). Thus, they provide a
convenient vehicle for delivery of cytotoxic or
2o cytostatic cytokines to tumor masses.
Cell-based active immunotherapy can also take on
several potential modalities using the NYVAC-, ALVAC-,
and TROVAC vectors. Tumor cells can be modified to
express TAAs, cytokines, or other novel antigens (i.e.
class I or class II major histocompatibility genes).
Such modified tumor cells can subsequently be utilized
for active immunization. The therapeutic potential for
such an administration is based on the ability of these
modified tumor cells to secrete cytokines and to alter
3o the presentation of TAAs to achieve systemic anti-tumor
activity. The modified tumor cells can also be utilized
to expand tumor-specific CTLs in vitro for reinfusion
into the patient.
A better understanding of the present invention and
of its many advantages will be had from the following
examples, given by way of illustration.
CA 02153336 2003-02-18
77396wy
za
EXAMPLES
nNb r~onina anc~ Synthesis. Plasmids were
constructed, screened and grown by standard procedures
(Maniat:is et al., 5.982; Perkus et al., 1985; Piccini et
s al., 1987). Restriction endonucleases were obtained from
Bethesda Research Laboratories, Gaithersburg, MD, New
England Biolabs, Beverly, MA; and Boehringer Mannheim
Biochemicals, Indianapolis, IN. Klenow fragment of E.
coli palymerase was obtained from Boehringer Mannheim
1o Hiochemicals. BAL-31 exonuclease and phage T4 DNA ligase
were obtained from New England Biolabs. The reagents
were used as saec~.~:ied by the various suppliers.
Synthetic oligodeoxyribonucleotides were prepared on
a Biosearch 8750 car Applied Biosystems 3808 DNA
15 synthesizer as previously described (Perkus et al.,
1989). DNA sequencing was performed by the dideoxy-chain
termination method (Sanger et al., 1977) using Sequenase
(Tabor et al., 198"') as previously described (Guo et al.,
1989). DNA amplification by polymerase chain reaction
20 (PCR) for sequence verification (Engelke et al., 1988)
was performed using custom synthesized oligonucleotide
primers and GeneAmp DNA amplification Reagent Kit (Perkin
Elmer Cetus, Norwal:~, CT) in an automated Perkin Elmer
Cetus DNA Thermal Cycles. Excess DNA sequences were.
25 deleted :from plasmids by restriction endanuclease
digestion followed by limited digestion by BAL-31
exonuclease and mr.~tagenesis (Mandecki, 1986) using
synthetics oligonucleotides.
Cells, Virus, and Transfection. The origins anal
3o conditions of cultvivation of the Copenhagen strain cf
vaccini.a virus has been previously described (Guo et al.,
1989) . Generati:,~n ci recc~;.binant virus b~r recombination,
fi
i_~. sitr~ hybridization o_ nitrccell°slose f filters and
SCr°_e:21.?1C~ fOr B-yalaCtOSldaS2 aC~lVlty as? aS preVlOll~~ V
35 described (P:iccini et al., 1987).
The origins a.nd conditions o~ cultivation of th.e
Copenhagen strain o' vaccinia v2=us and N'~VAC has been
* Trade-mar:c
WO 94116716 ~r~'~ t PCTIUS94l00888
f ~ ~.. n d!: ~r 7
29
previously described (Guo et al., 1989; Tartaglia et al.,
1992). Generation of recombinant virus by recombination,
in situ hybridization of nitrocellulose filters and
screening for B-galactosidase activity are as previously
described (Panicali et al., 1982; Perkus et al., 1989).
The parental canarypox virus (Rentschler strain) is
a vaccinal strain for canaries. The vaccine strain was
obtained from a wild type isolate and attenuated through
more than 200 serial passages on chick embryo
io fibroblasts. A master viral seed was subjected to four
successive plaque purifications under agar and one plaque
clone was amplified through five additional passages
after which the stock virus was used as the parental
virus in in vitro recombination tests. The plaque
purified canarypox isolate is designated ALVAC.
The strain of fowlpox virus (FPV) designated FP-1
has been described previously (Taylor et al., 1988a). It
is an attenuated vaccine strain useful in vaccination of
day old chickens. The parental virus strain Duvette was
obtained in France as a fowlpox scale from a chicken.
The virus was attenuated by approximately 50 serial
passages in chicken embryonated eggs followed by 25
passages on chicken embryo fibroblast cells. The virus
was subjected to four successive plaque purifications.
One plaque isolate was further amplified in primary CEF
cells and a stock virus, designated as TROVAC,
established.
NYVAC, ALVAC and TROVAC viral vectors and their
derivatives were propagated as described previously
(Piccini et al., 1987; Taylor et al., 1988a,b). Vero
cells and chick embryo fibroblasts (CEF) were propagated
as described previously (Taylor et al., 1988a,b).
Example 1 - CONSTRUCTION OF PLASMID pSD460 FOR
DELETION OF THYMIDINE RINASE GENE (J2R)
Referring now to FIG. 1, plasmid pSD406 contains
vaccinia HindIII J (pos. 83359 - 88377) cloned into pUC8.
pSD406 was cut with HindIII and PvuII, and the 1.7 kb
.~.a .;:
~'; g. , ;, ~ ;.
VVO 94116716 -' '' PCT/US94I00888
215333
fragment from the left side of HindIII J cloned into pUC8
cut with HindIII/SmaI, forming pSD447. pSD447 contains
the entire gene for J2R (pos. 83855 - 84385). The
initiation codon is contained within an NIaIII site and
s the termination codon is contained within an SSpI site.
Direction of transcription is indicated by an arrow in
FIG. 1.
To obtain a left flanking arm, a 0.8 kb
HindIII/EcoRI fragment was isolated from pSD447, then
1o digested with NIaIII and a 0.5 kb HindIII/NIaIII fragment
isolated. Annealed synthetic oligonucleotides
MPSYN43/MPSYN44 (SEQ ID NO:1/SEQ ID N0:2)
SmaI
MPSYN43 5' TAATTAACTAGCTACCCGGG 3'
15 MPSYN44 3' GTACATTAATTGATCGATGGGCCCTTAA 5'
NIaIII EcoRI
were ligated with the 0.5 kb HindIII/NIaIII fragment into
pUCl8 vector plasmid cut with HindIII/EcoRI, generating
2o plasmid pSD449.
To obtain a restriction fragment containing a
vaccinia right flanking arm and pUC vector sequences,
pSD447 was cut with SSpI (partial) within vaccinia
sequences and HindIII at the pUC/vaccinia junction, and a
25 2.9 kb vector fragment isolated. This vector fragment
was ligated with annealed synthetic oligonucleotides
MPSYN45/MPSYN46 (SEQ ID N0:3/SEQ ID N0:4)
HindIII SmaI
MPSYN45 5' AGCTTCCCGGGTAAGTAATACGTCAAGGAGAAAACGAA
30 MPSYN46 3' AGGGCCCATTCATTATGCAGTTCCTCTTTTGCTT
NotI SSpI
ACGATCTGTAGTTAGCGGCCGCCTAATTAACTAAT 3' MPSYN45
TGCTAGACATCAATCGCCGGCGGATTAATTGATTA 5' MPSYN46
generating pSD459.
To combine the left and right flanking arms into one
plasmid, a 0.5 kb HindIII/SmaI fragment was isolated from
pSD449 and ligated with pSD459 vector plasmid cut with
4o HindIII/SmaI, generating plasmid pSD460. pSD460 was used
as donor plasmid for recombination with wild type
parental vaccinia virus Copenhagen strain VC-2. 32P
PCTIUS94100888
WO 94116716 . ; .,
~~ s.: s; Y'; a.
31
labelled probe was synthesized by primer extension using
MPSYN45 (SEQ ID N0:3) as template and the complementary
20mer oligonucleotide MPSYN47 (SEQ ID N0:5)
(5' TTAGTTAATTAGGCGGCCGC 3') as primer. Recombinant
s virus vP410 was identified by plaque hybridization.
Example 2 - CONSTROCTION OF PLASMID p8D486 FOR
- DELETION OF HEMORRHAGIC REGION
(B13R + B14R)
Referring now to FIG. 2, plasmid pSD419 contains
to vaccinia SalI G (pos. 160,744-173,351) cloned into pUC8.
pSD422 contains the contiguous vaccinia SalI fragment to
the right, SalI J (pos. 173,351-182,746) cloned into
pUC8. To construct a plasmid deleted for the hemorrhagic
region, u, B13R - B14R (pos. 172,549 - 173,552), pSD419
is was used as the source for the left flanking arm and
pSD422 was used as the source of the right flanking arm.
The direction of transcription for the a region is
indicated by an arrow in FIG. 2.
To remove unwanted sequences from pSD419, sequences
2o to the left of the NcoI site (pos. 172,253) were removed
by digestion of pSD419 with NcoI/SmaI followed by blunt
ending with Klenow fragment of E. coli polymerase and
ligation generating plasmid pSD476. A vaccinia right
flanking arm was obtained by digestion of pSD422 with
2s HpaI at the termination codon of B14R and by digestion
with NruI 0.3 kb to the right. This 0.3 kb fragment was
isolated and ligated with a 3.4 kb HincII vector fragment
isolated from pSD476, generating plasmid pSD477. The
location of the partial deletion of the vaccinia a region
3o in pSD477 is indicated by a triangle. The remaining B13R
coding sequences in pSD477 were removed by digestion with
ClaI/HpaI, and the resulting vector fragment was ligated
with annealed synthetic oligonucleotides SD22mer/SD20mer
(SEQ ID N0:6/SEQ ID N0:7)
3s ClaI BamHI HpaI
SD22mer 5' CGATTACTATGAAGGATCCGTT 3'
SD20mer 3' TAATGATACTTCCTAGGCAA 5'
generating pSD479. pSD479 contains an initiation codon
~.t ~. ,~~1 y'~ r ? ~ a..
a .~
WO 94/16716 PCT/US94/00888
213335
32
(underlined) followed by a BamHI site. To place E. coli
Beta-galactosidase in the B13-B14 (u) deletion locus
under the control of the a promoter, a 3.2 kb BamHI
fragment containing the Beta-galactosidase gene (Shapira
et al., 1983) was inserted into the BamHI site of pSD479,
generating pSD479BG. pSD479BG was used as donor plasmid
for recombination with vaccinia virus vP410. Recombinant
vaccinia virus vP533 was isolated as a blue plaque in the
presence of chromogenic substrate X-gal. In vP533 the
1o B13R-B14R region is deleted and is replaced by Beta-
galactosidase.
To remove Beta-galactosidase sequences from vP533,
plasmid pSD486, a derivative of pSD477 containing a
polylinker region but no initiation codon at the a
deletion junction, was utilized. First the ClaI/H~aI
vector fragment from pSD477 referred to above was ligated
with annealed synthetic oligonucleotides SD42mer/SD40mer
(SEQ ID N0:8/SEQ ID N0:9)
Clal Sacl Xhol Hpal
2o SD42mer 5' CGATTACTAGATCTGAGCTCCCCGGGCTCGAGGGATCCGTT 3'
SD40mer 3' TAATGATCTAGACTCGAGGGGCCCGAGCTCCCTAGGCAA 5'
B~c III Smal BamHl
generating plasmid pSD478. Next the EcoRI site at the
pUC/vaccinia junction was destroyed by digestion of
pSD478 with EcoRI followed by blunt ending with Klenow
fragment of E. coli polymerase and ligation, generating
plasmid pSD478E-. pSD478E- was digested with BamHI and
HpaI and ligated with annealed synthetic
3o oligonucleotides HEMS/HEM6 (SEQ ID NO:10/SEQ ID N0:11)
BamHI EcoRI HbaI
HEMS 5' GATCCGAATTCTAGCT 3'
HEM6 3' GCTTAAGATCGA 5'
generating plasmid pSD486. pSD486 was used as donor
plasmid for recombination with recombinant vaccinia virus
vP533, generating vP553, which was isolated as a clear
plaque in the presence of X-gal.
WO 94116716 21 ~3~3 PCT/US94100888
_. ,,
Example 3 - CONSTROCTION OF PLABMID pMP494~
FOR DELETION OF ATI REGION (A26L)
Referring now to FIG. 3, pSD414 contains SalI B
cloned into pUC8. To remove unwanted DNA sequences to
the left of the A26L region, pSD414 was cut with XbaI
within vaccinia sequenOes (pos. 137,079) and with HindIII
at the pUC/vaccinia junction, then blunt ended with
Klenow fragment of E. coli polymerase and ligated,
1o resulting in plasmid pSD483. To remove unwanted vaccinia
DNA sequences to the right of the A26L region, pSD483 was
cut with EcoRI (pos. 140,665 and at the pUC/vaccinia
junction) and ligated, forming plasmid pSD484. To remove
the A26L coding region, pSD484 was cut with NdeI
(partial) slightly upstream from the A26L ORF (pos.
139,004) and with HpaI (pos. 137,889) slightly downstream
from the A26L ORF. The 5.2 kb vector fragment was
isolated and ligated with annealed synthetic
oligonucleotides ATI3/ATI4 (SEQ ID N0:12/SEQ ID N0:13)
2o Ndei
AT13 5'TATGAGTAACTTAACTCTTTTGTTAATTAAAAGTATATTCAAAAAATAAGT
AT14 3' ACTCATTGAATTGAGAAAACAATTAATTTTCATATAAGTTTTTTATTCA
B~c III EcoRl Hpal
TATATAAATAGATCTGAATTCGTT 3' ATI3
ATATATTTATCTAGACTTAAGCAA 5' ATI4
reconstructing the region upstream from A26L and
replacing the A26L ORF with a short polylinker region
3o containing the restriction sites BalII, EcoRI and HpaI,
as indicated above. The resulting plasmid was designated
pSD485. Since the BQ1II and EcoRI sites in the
polylinker region of pSD485 are not unique, unwanted
BalII and EcoRI sites were removed from plasmid pSD483
(described above) by digestion with BctlII (pos. 140,136)
and with EcoRI at the pUC/vaccinia junction, followed by
blunt ending with Klenow fragment of E. coli polymerase
and ligation. The resulting plasmid was designated
pSD489. The 1.8 kb ClaI (pos. 137,198)/EcoRV (pos.
139,048) fragment from pSD489 containing the A26L ORF was
replaced with the corresponding 0.7 kb polylinker-
WO 94116716 PCTIUS94I00888
34
containing ClaI/EcoRV fragment from pSD485, generating
pSD492. The BQ1II and EcoRI sites in the pc>lylinker
region of pSD492 are unique.
A 3.3 kb BQ1II cassette containing the E. coli Beta-
galactosidase gene (Shapira et al., 1983) under the
control of the vaccinia 11 kDa promoter (Bertholet et
al., 1985; Perkus et al., 1990) was inserted into the
BcrlII site of pSD492, forming pSD493KBG. Plasmid
pSD493KBG was used in recombination with rescuing virus
to vP553. Recombinant vaccinia virus, vP581, containing
Beta-galactosidase in the A26L deletion region, was
isolated as a blue plaque in the presence of X-gal.
To generate a plasmid for the removal of Beta-
galactosidase sequences from vaccinia recombinant virus
vP581, the polylinker region of plasmid pSD492 was
deleted by mutagenesis (Mandecki, 1986) using synthetic
oligonucleotide MPSYN177 (SEQ ID N0:14)
(5' AAAATGGGCGTGGATTGTTAACTTTATATAACTTATTTTTTGAATATAC 3') . In
the resulting plasmid, pMP4940, vaccinia DNA encompassing
2o positions [137,889 - 138,937], including the entire A26L
ORF is deleted. Recombination between the pMP494A and
the Beta-galactosidase containing vaccinia recombinant,
vP581, resulted in vaccinia deletion mutant vP618, which
was isolated as a clear plaque in the presence of X-gal.
Example 4 - CONSTRUCTION OF PLASMID p8D467 FOR
DELETION OF HEMAGGLUTININ GENE (A56R)
Referring now to FIG. 4, vaccinia SalI G restriction
fragment (pos. 160,744-173,351) crosses the HindIII A/B
3o junction (pos. 162,539). pSD419 contains vaccinia SalI G
cloned into pUC8. The direction of transcription for the
hemagglutinin (HA) gene is indicated by an arrow in FIG.
4. Vaccinia sequences derived from HindIII B were
removed by digestion of pSD419 with HindIII within
vaccinia sequences and at the pUC/vaccinia junction
followed by ligation. The resulting plasmid, pSD456,
contains the HA gene, A56R, flanked by 0.4 kb of vaccinia
sequences to the left and 0.4 kb of vaccinia sequences to
WO 94/16716 ~ ~ ~ ~ PCT/US94100888
the right. A56R coding sequences were removed by cutting
pSD456 with RsaI (partial; pos. 161,090) upstream from
A56R coding sequences, and with Ea~I (pos. 162,054) near
the end of the gene. The 3.6 kb RsaI/Ea4I vector
5 fragment from pSD456 was isolated and ligated with
annealed synthetic oligonucleotides MPSYN59 (SEQ ID
N0:15), MPSYN62 (SEQ ID N0:16), MPSYN60 (SEQ ID N0:17),
and MPSYN61 (SEQ ID N0:18)
RsaI
l0 MPSYN59 5' ACACGAATGATTTTCTAAAGTATTTGGAAAGTTTTATAGGT-
MPSYN62 3' TGTGCTTACTAAAAGATTTCATAAACCTTTCAAAATATCCA-
MPSYN59 AGTTGATAGAACAAAATACATAATTT 3'
MPSYN62 TCAACTATCT 5'
MPSYN60 5' TGTAAAAATAAATCACTTTTTATA-
MPSYN61 3' TGTTTTATGTATTAAAACATTTTTATTTAGTGAAAAATAT-
BqlII SmaI PstI EagI
MPSYN60 CTAAGATCTCCCGGGCTGCAGC 3'
MPSYN61 GATTCTAGAGGGCCCGACGTCGCCGG 5'
reconstructing the DNA sequences upstream from the A56R
ORF and replacing the A56R ORF with a polylinker region
as indicated above. The resulting plasmid is pSD466.
The vaccinia deletion in pSD466 encompasses positions
[161,185-162,053]. The site of the deletion in pSD466 is
indicated by a triangle in FIG. 4.
A 3.2 kb BctlII/BamHI (partial) cassette containing
3o the E. coli Beta-galactosidase gene (Shapira et al.,
1983) under the control of the vaccinia 11 kDa promoter
(Bertholet et al., 1985; Guo et al., 1989) was inserted
into the BalII site of pSD466, forming pSD466KBG.
Plasmid pSD466KBG was used in recombination with rescuing
virus vP618. Recombinant vaccinia virus, vP708,
containing Beta-galactosidase in the A56R deletion, was
isolated as a blue plaque in the presence of X-gal.
Beta-galactosidase sequences were deleted from vP708
using donor plasmid pSD467. pSD467 is identical to
4o pSD466, except that EcoRI, SmaI and BamHI sites were
removed from the pUC/vaccinia junction by digestion. of
pSD466 with EcoRI/BamHI followed by blunt ending with
WO 94/16716 . °' PCTIUS94100888
2 ~~=~ ~~ ~ ~~~ _
36
Klenow fragment of E. coli polymerase and ligation.
Recombination between vP708 and pSD467 resulted in
recombinant vaccinia deletion mutant, vP723, which was
isolated as a clear plaque in the presence of X-gal.
s Example 5 - CONSTRUCTION OF PLA8MID pMPC8R1A
FOR DELETION OF OPEN READING FRAMES
fC7L-R1L1
Referring now to FIG. 5, the following vaccinia
io clones were utilized in the construction of pMPCSKl~.
pSD420 is SalI H cloned into pUC8. pSD435 is KpnI F
cloned into pUCl8. pSD435 was cut with SphI and
religated, forming pSD451. In pSD451, DNA sequences to
the left of the SphI site (pos. 27,416) in HindIII M are
1s removed (Perkus et al., 1990). pSD409 is HindIII M
cloned into pUC8.
To provide a substrate for the deletion of the [C7L-
K1L] gene cluster from vaccinia, E. coli Beta-
galactosidase was first inserted into the vaccinia M2L
2o deletion locus (Guo et al., 1990) as follows. To
eliminate the BqlII site in pSD409, the plasmid was cut
with BqlII in vaccinia sequences (pos. 28,212) and with
BamHI at the pUC/vaccinia junction, then ligated to form
plasmid pMP409B. pMP409B was cut at the unique SphI site
25 (pos. 27,416). M2L coding sequences were removed by
mutagenesis (Guo et al., 1990; Mandecki, 1986) using
synthetic oligonucleotide
BalII
MPSYN82 (SEQ ID N0:19) 5' TTTCTGTATATTTGCACCAATTTAGATCTT-
3o ACTCAAAATATGTAACAATA 3'
The resulting plasmid, pMP409D, contains a unique BQ1II
site inserted into the M2L deletion locus as indicated
above. A 3.2 kb BamHI (partial)/BQ1II cassette
3s containing the E. coli Beta-galactosidase gene (Shapira
et al., 1983) under the control of the 1l kDa promoter.
(Bertholet et al., 1985) was inserted into pMP409D cut
with BqlII. The resulting plasmid, pMP409DBG (Guo et
al., 1990), was used as donor plasmid for recombination
4o with rescuing vaccinia virus vP723. Recombinant vaccinia
WO 94116716 ~~4. PCTIUS94100888
37
virus, vP784, containing Beta-galactosidase inserted into
the M2L deletion locus, was isolated as a blue plaque in
the presence of X-gal.
A plasmid deleted for vaccinia genes [C7L-KiL] was
assembled in pUC8 cut with SmaI, HindIII and blunt ended
with Klenow fragment of E. coli polymerase. The left
flanking arm consisting of vaccinia HindII:C C sequences
was obtained by digestion of pSD420 with XbaI (pos.
18,628) followed by blunt ending with Klenow fragment of
1o E. coli polymerase and digestion with BalII (pos.
19,706). The right flanking arm consisting of vaccinia
HindIII K sequences was obtained by digestion of pSD451
with BqlII (pos. 29,062) and EcoRV (pos. 29,778). The
resulting plasmid, pMP581CK is deleted for vaccinia
sequences between the BglII site (pos. 19,706) in HindIII
C and the BQ1II site (pos. 29,062) in HindIII K. The
site of the deletion of vaccinia sequences in plasmid
pMP581CK is indicated by a triangle in FIG. 5.
To remove excess DNA at the vaccinia deletion
2o junction, plasmid pMP581CK, was cut at the NcoI sites
within vaccinia sequences (pos. 18,811; 19,655), treated
with Bal-31 exonuclease and subjected to mutagenesis
(Mandecki, 1986) using synthetic oligonucleotide MPSYN233
(SEQ ID N0:20)
5'-TGTCATTTAACACTATACTCATATTAATAAAAATAATATTTATT-3'.
The resulting plasmid, pMPCSKl~, is deleted for vaccinia
sequences positions 18,805-29,108, encompassing 12
vaccinia open reading frames [C7L - K1L]. Recombination
between pMPCSKl~ and the Beta-galactosidase containing
3o vaccinia recombinant, vP784, resulted in vaccinia
deletion mutant, vP804, which was isolated as a clear
plaque in the presence of X-gal.
Example 6 - CONSTRUCTION OF PLASMID pSD548 FOR DELETION
OF LARGE SUBUNIT, RIBONUCLEOTIDE REDUCTASE
I4L
Referring now to FIG. 6, plasmid pSD405 contains
vaccinia HindIII I (pos. 63,875-70,367) cloned in pUC8.
pSD405 was digested with EcoRV within vaccinia sequences
WO 94116716 215 3 3 ~ ~ PCTlUS94/00888
38
(pos. 67,933) and with SmaI at the pUC/vaccinia junction,
and ligated, forming plasmid pSD518. pSD518 was used as
the source of all the vaccinia restriction fragments used
in the construction of pSD548.
s The vaccinia I4L gene extends from position 67,371-
65,059. Direction of transcription for I4L is indicated
by an arrow in FIG. 6. To obtain a vector plasmid
fragment deleted for a portion of the I4L coding
sequences, pSD518 was digested with BamHI (pos. 65,381)
1o and HpaI (pos. 67,001) and blunt ended using Klenow
fragment of E. coli polymerase. This 4.8 kb vector
fragment was ligated with a 3.2 kb SmaI cassette
containing the E. coli Beta-galactosidase gene (Shapira
et al., 1983) under the control of the vaccinia 11 kDa
15 promoter (Bertholet et al., 1985; Perkus et al., 1990),
resulting in plasmid pSD524KBG. pSD524KBG was used as
donor plasmid for recombination with vaccinia virus
vP804. Recombinant vaccinia virus, vP855, containing
Beta-galactosidase in a partial deletion of the I4L gene,
2o was isolated as a blue plaque in the presence of X-gal.
To delete Beta-galactosidase and the remainder of
the I4L ORF from vP855, deletion plasmid pSD548 was
constructed. The left and right vaccinia flanking arms
were assembled separately in pUC8 as detailed below and
25 presented schematically in FIG. 6.
To construct a vector plasmid to accept the left
vaccinia flanking arm, pUC8 was cut with BamHI/EcoRI and
ligated with annealed synthetic oligonucleotides
518A1/518A2 (SEQ ID N0:21/SEQ ID N0:22)
3o BamHl Rsai
518A1 5' GATCCTGAGTACTTTGTAATATAATGATATATATTTTCACTTTATCTCAT
518A2 3' GACTCATGAAACATTATATTACTATATATAAAAGTGAAATAGAGTA
B~c III EcoRl
35 TTGAGAATAAAAAGATCTTAGG 3' S18A1
AACTCTTATTTTTCTAGAATCCTTAA 5' 518A2
forming plasmid pSD531. pSD531 was cut with RsaI
(partial) and BamHI and a 2.7 kb vector fragment
4o isolated. pSD518 was cut with BctlII (pos. 64,459)/ RsaI
WO 94/16716 5 ~ '~ ~ ~ PCTIUS94/00888
jf-,r= ;, ~\; ,,
39 ~ ' ,
(pos. 64,994) and a 0.5 kb fragment isolated. The two
fragments were ligated together, forming pSD537, which
contains the complete vaccinia flanking arm left of the
I4L coding sequences.
s To construct a vector plasmid to accept the right
vaccinia flanking arm, pUC8 was cut with BamHI/EcoRI and
ligated with annealed synthetic oligonucleotides
518B1/518B2 (SEQ ID N0:23/SEQ ID N0:24)
BamHl Bgll Smal
io 51881 5' GATCCAGATCTCCCGGGAAAAAAATTATTTAACTTTTCATTAATAG
518B2 3' GTCTAGAGGGCCCTTTTTTTAATAAATTGAAAAGTAATTATC
Rsal _EcoRt
GGATTTGACGTATGTAGCGTACTAGG 3' S18B1
1 s CCTAAACTGCATACTACGCATGATCCTTAA 5' S18B2
forming plasmid pSD532. pSD532 was cut with RsaI
(partial)/EcoRI and a 2.7 kb vector fragment isolated.
pSD518 was cut with RsaI within vaccinia sequences (pos.
20 67,436) and EcoRI at the vaccinia/pUC junction, and a 0.6
kb fragment isolated. The two fragments were ligated
together, forming pSD538, which contains the complete
vaccinia flanking arm to the right of I4L coding
sequences.
2s The right vaccinia flanking arm was isolated as a
0.6 kb EcoRI/BalII fragment from pSD538 and ligated into
pSD537 vector plasmid cut with EcoRI/BglII. In the
resulting plasmid, pSD539, the I4L ORF (pos. 65,047-
67,386) is replaced by a polylinker region, which is
3o flanked by 0.6 kb vaccinia DNA to the left and 0.6 kb
vaccinia DNA to the right, all in a pUC background. The
site of deletion within vaccinia sequences is indicated
by a triangle in FIG. 6. To avoid possible recombination
of Beta-galactosidase sequences in the pUC-derived
3s portion of pSD539 with Beta-galactosidase sequences in
recombinant vaccinia virus vP855, the vaccinia I4L
deletion cassette was moved from pSD539 into pRCll, a pUC
derivative from which all Beta-galactosidase sequences
have been removed and replaced with a polylinker region
40 (Colinas et al., 1990). pSD539 was cut with EcoRI/PstI
WO 94/16716 PCTIUS94/00888
,v '
~2r15~3 3 3 ~ 40
and the 1.2 kb fragment isolated. This fragment was
ligated into pRCll cut with EcoRI/PstI (2.35 kb), forming
pSD548. Recombination between pSD548 and the Beta-
galactosidase containing vaccinia recombinant, vP855,
s resulted in vaccinia deletion mutant vP866, which was
isolated as a clear plaque in the presence of X-gal.
DNA from recombinant vaccinia virus vP866 was
analyzed by restriction digests followed by
electrophoresis on an agarose gel. The restriction
1o patterns were as expected. Polymerase chain reactions
(PCR) (Engelke et al., 1988) using vP866 as template and
primers flanking the six deletion loci detailed above
produced DNA fragments of the expected sizes. Sequence
analysis of the PCR generated fragments around the areas
15 of the deletion junctions confirmed that the junctions
were as expected. Recombinant vaccinia virus vP866,
containing the six engineered deletions as described
above, was designated vaccinia vaccine strain "NYVAC."
Example 7 - INSERTION OF A RABIES GLYCOPROTEIN
20 G GENE INTO NYVAC
The gene encoding rabies glycoprotein G under the
control of the vaccinia H6 promoter (Taylor et al.,
1988a,b) was inserted into TK deletion plasmid pSD513.
25 pSD513 is identical to plasmid pSD460 (FIG. 1) except for
the presence of a polylinker region.
Referring now to FIG. 7, the polylinker region was
inserted by cutting pSD460 with SmaI and ligating the
plasmid vector with annealed synthetic oligonucleotides
3o VQ1A/VQ1B (SEQ ID N0:25/SEQ ID N0:26)
SmaI BglII XhoI PstI NarI BamHI
VQ1A 5' GGGAGATCTCTCGAGCTGCAGGGCGCCGGATCCTTTTTCT 3'
VQ1B 3' CCCTCTAGAGAGCTCGACGTCCCGCGGCCTAGGAAAAAGA 5'
35 to form vector plasmid pSD513. pSD513 was cut with SmaI
and ligated with a SmaI ended 1.8 kb cassette containing
the gene encoding the rabies glycoprotein G gene under
the control of the vaccinia H6 promoter (Taylor et al.,
1988a,b). The resulting plasmid was designated pRV~i842.
4o pRW842 was used as donor plasmid for recombination with
WO 94116716 PCT/US94/00888
21533
36
NYVAC rescuing virus (vP866). Recombinant vaccinia virus
vP879 was identified by plaque hybridization using 32P-
labelled DNA probe to rabies glycoprotein G coding
sequences.
The modified recombinant viruses of the present
invention provide advantages as recombinant vaccine
vectors. The attenuated virulence of the vector
advantageously reduces the opportunity for the
possibility of a runaway infection due to vaccination in
io the vaccinated individual and also diminishes
transmission from vaccinated to unvaccinated individuals
or contamination of the environment.
The modified recombinant viruses are also
advantageously used in a method for expressing a gene
product in a cell cultured in vitro by introducing into
the cell the modified recombinant virus having foreign
DNA which codes for and expresses gene products in the
cell.
Example 8 - CONSTRUCTION OF TROVAC-NDV EXPRESSING THE
FUSION AND HEMAGGLUTININ-NEURAMINIDASE
GLYCOPROTEINS OF NEWCASTLE DISEASE VIRUS
This example describes the development of TROVAC, a
fowlpox virus vector and, of a fowlpox Newcastle Disease
Virus recombinant designated TROVAC-NDV and its safety
and efficacy. A fowlpox virus (FPV) vector expressing
both F and HN genes of the virulent NDV strain Texas was
constructed. The recombinant produced was designated
TROVAC-NDV. TROVAC-NDV expresses authentically processed
3o NDV glycoproteins in avian cells infected with the
recombinant virus and inoculation of day old chicks
protects against subsequent virulent NDV challenge.
Cells and Viruses. The Texas strain of NDV is a
velogenic strain. Preparation of cDNA clones of the F
and HN genes has been previously described (Taylor et
al., 1990; Edbauer et al., 1990). The strain of FPV
designated FP-1 has been described previously (Taylor et
al., 1988a). It is a vaccine strain useful in
vaccination of day old chickens. The parental virus
WO 94/16716 PCT/US94/00888
2~.~3~~~~
42
strain Duvette was obtained in France as a fowlpox scab
from a chicken. The virus was attenuated by
approximately 50 serial passages in chicken embryonated
eggs followed by 25 passages on chicken embryo fibroblast
s cells. The virus was subjected to four successive plaque
purifications. One plaque isolate was further amplified
in primary CEF cells and a stock virus, designated as
TROVAC, established. The stock virus used in the in
vitro recombination test to produce TROVAC-NDV had been
to subjected to twelve passages in primary CEF cells from
the plaque isolate.
Construction of a Cassette for NDV-F. A 1.8 kbp
BamHI fragment containing all but 22 nucleotides from the
5' end of the F protein coding sequence was excised from
1s pNDV81 (Taylor et al., 1990) and inserted at the BamHI
site of pUClB to form pCEl3. The vaccinia virus H6
promoter previously described (Taylor et al., 1988a,b;
Guo et al., 1989; Perkus et al., 1989) was inserted into
pCEl3 by digesting pCEl3 with SalI, filling in the sticky
2o ends with Klenow fragment of E. coli DNA polymerase and
digesting with HindIII. A HindIII - EcoRV fragment
containing the H6 promoter sequence was then inserted
into pCEl3 to form pCE38. A perfect 5' end was generated
by digesting pCE38 with KpnI and NruI and inserting the
2s annealed and kinased oligonucleotides CE75 (SEQ ID N0:27)
and CE76 (SEQ ID N0:28) to generate pCE47.
CE75:
CGATATCCGTTAAGTTTGTATCGTAATGGGCTCCAGATCTTCTACCAGGATCCCGG
TAC
3o CE76:
CGGGATCCTGGTAGAAGATCTGGAGCCCATTACGATACAAACTTAACGGATATCG.
In order to remove non-coding sequence from the 3' end of
the NDV-F a SmaI to PstI fragment from pCEl3 was inserted
into the SmaI and PstI sites of pUCl8 to form pCE23. The
3s non-coding sequences were removed by sequential digestion
of pCE23 with SacI, BamHI, Exonuclease III, SI nuclease
and EcoRI. The annealed and kinased oligonucleotides
VVO 94116716 ~ ~ PCTIUS94/00888
43
CE42 (SEQ ID N0:29) and CE43 (SEQ ID N0:30) were then
inserted to form pCE29.
CE42: AATTCGAGCTCCCCGGG
CE43: CCCGGGGAGCTCG
The 3' end of the NDV-F sequence was then inserted into
plasmid pCE20 already containing the 5' end of NDV-F by
cloning a PstI - SacI fragment from pCE29 into the PstI
and SacI sites of pCE20 to form pCE32. Generation of
pCE20 has previously been described in Taylor et al.,
1990.
In order to align the H6 promoter and NDV-F 5'
sequences contained in pCE47 with the 3' NDV-F sequences
contained in pCE32, a HindIII - PstI fragment of pCE47
was inserted into the HindIII and PstI sites of pCE32 to
form pCE49. The H6 promoted NDV-F sequences were then
transferred to the de-ORFed F8 locus (described below) by
cloning a HindIII - NruI fragment from pCE49 into the
HindIII and SmaI sites of pJCA002 (described below) to
form pCE54. Transcription stop signals were inserted
2o into pCE54 by digesting pCE54 with SacI, partially
digesting with BamHI and inserting the annealed and
kinased oligonucleotides CE166 (SEQ ID N0:31) and CE167
(SEQ ID N0:32) to generate pCE58.
CE166: CTTTTTATAAAAAGTTAACTACGTAG
CE167: GATCCTACGTAGTTAACTTTTTATAAAAAGAGCT
A perfect 3' end for NDV-F was obtained by using the
polymerase chain reaction (PCR) with pCE54 as template
and oligonucleotides CE182 (SEQ ID N0:33) and CE183 (SEQ
ID N0:34) as primers.
3o CE182: CTTAACTCAGCTGACTATCC
CE183: TACGTAGTTAACTTTTTATAAAAATCATATTTTTGTAGTGGCTC
The PCR fragment was digested with PvuII and HpaI and
cloned into pCE58 that had been digested with HpaI and
partially digested with PvuII. The resulting plasmid was
designated pCE64. Translation stop signals were inserted
by cloning a HindIII - HpaI fragment which contains the
complete H6 promoter and F coding sequence from pCE64
WO 94/16716 PCT/US94100888
44
into the HindIII and HpaI sites of pRW846 to generate
pCE7l, the final cassette for NDV-F. Plasmi.d pRW846 is
essentially equivalent to plasmid pJCA002 (described
below) but containing the H6 promoter and transcription
s and translation stop signals. Digestion of pRW846 with
HindIII and HpaI eliminates the H6 promoter but leaves
the stop signals intact. -
Construction of Cassette for NDV-HN. Construction
of plasmid pRW802 was previously described in Edbauer et
1o al., 1990. This plasmid contains the NDV-HN sequences
linked to the 3' end of the vaccinia virus H6 promoter in
a pUC9 vector. A HindIII - EcoRV fragment encompassing
the 5' end of the vaccinia virus H6 promoter was inserted
into the HindIII and EcoRV sites of pRW802 to form
15 pRW830. A perfect 3' end for NDV-HN was obtained by
inserting the annealed and kinased oligonucleotides CE162
(SEQ ID N0:35) and CE163 (SEQ ID N0:36) into the EcoRI
site of pRW830 to form pCE59, the final cassette for NDV-
HN.
20 CE162
AATTCAGGATCGTTCCTTTACTAGTTGAGATTCTCAAGGATGATGGGATTTAATTTT
TATAAGCTTG
CE163:
AATTCAAGCTTATAAAAATTAAATCCCATCATCCTTGAGAATCTCAACTAGTAAAGG
25 AACGATCCTG
Construction of FPV Insertion Vector. Plasmid
pRW731-15 contains a lOkb PvuII - PvuII fragment cloned
from genomic DNA. The nucleotide sequence was determined
on both strands for a 3660 by PvuII - EcoRV fragment.
3o The limits of an open reading frame designated here as F8
were determined. Plasmid pRW761 is a sub-clone of
pRW731-15 containing a 2430 by EcoRV - EcoRV fragment.
The F8 ORF was entirely contained between an XbaI site
and an SspI site in pRW761. In order to create an
3s insertion plasmid which on recombination with TROVAC
genomic DNA would eliminate the F8 ORF, the following
steps were followed. Plasmid pRW761 was completely
WO 94116716 PCT/US94/00888
digested with XbaI and partially digested with SSpI. A
3700 by XbaI - SspI band was isolated from the gel and
ligated with the annealed double-stranded
oligonucleotides JCA017 (SEQ ID N0:37) and JCA018 (SEQ ID
5 N0:38).
JCA017:5'
CTAGACACTTTATGTTTTTTAATATCCGGTCTTAAAAGCTTCCCGGGGATCCTTATA
CGGGGAATAAT
JCA018:5'
l0 ATTATTCCCCGTATAAGGATCCCCCGGGAAGCTTTTAAGACCGGATATTAAAAAACA
TAAAGTGT
The plasmid resulting from this ligation was designated
pJCA002.
Construction of Double Insertion Vector for NDV F
15 and HN. The H6 promoted NDV-HN sequence was inserted
into the H6 promoted NDV-F cassette by cloning a HindIII
fragment from pCE59 that had been filled in with Klenow
fragment of E. coli DNA polymerase into the HpaI site of
pCE71 to form pCE80. Plasmid pCE80 was completely
2o digested with NdeI and partially digested with BalII to
generate an NdeI - BctlII 4760 by fragment containing the
NDV F and HN genes both driven by the H6 promoter and
linked to F8 flanking arms. Plasmid pJCA021 was obtained
by inserting a 4900 by PvuII - HindII fragment from
25 pRW731-15 into the SmaI and HindII sites of pBSSK+.
Plasmid pJCA021 was then digested with NdeI and BalII and
ligated to the 4760 by NdeI - BglII fragment of pCE80 to
form pJCA024. Plasmid pJCA024 therefore contains the
NDV-F and HN genes inserted in opposite orientation with
30 3' ends adjacent between FPV flanking arms. Both genes
are linked to the vaccinia virus H6 promoter. The right
flanking arm adjacent to the NDV-F sequence consists of
2350 by of FPV sequence. The left flanking arm adjacent
to the NDV-HN sequence consists of 1700 by of FPV
35 sequence.
Development of TROVAC-NDV. Plasmid pJCA024 was
transfected into TROVAC infected primary CEF cells by
WO 94116716 PCT/US94/00888
:..,:~ i.~.~~3:~ 5 _
46
using the calcium phosphate precipitation method
previously described (Panicali et al., 1982; Piccini et
al., 1987). Positive plaques were selected on the basis
of hybridization to specific NDV-F and HN radiolabelled
s probes and subjected to five sequential rounds of plaque
purification until a pure population was achieved. One
representative plaque was then amplified and the
resulting TROVAC recombinant was designated TROVAC-NDV
(vFP96).
to Immunofluorescence. Indirect immunofluorescence was
performed as described (Taylor et al., 1990) using a
polyclonal anti-NDV serum and, as mono-specific reagents,
sera produced in rabbits against vaccinia virus
recombinants expressing NDV-F or NDV-HN.
15 Immunoprecipitation. Immunoprecipitation reactions
were performed as described (Taylor et al., 1990) using a
polyclonal anti-NDV serum obtained from SPAFAS Inc.,
Storrs, CT.
The stock virus was screened by in situ plaque
2o hybridization to confirm that the F8 ORF was deleted.
The correct insertion of the NDV genes into the TROVAC
genome and the deletion of the F8 ORF was also confirmed
by Southern blot hybridization.
In NDV-infected cells, the F glycoprotein is
25 anchored in the membrane via a hydrophobic transmembrane
region near the carboxyl terminus and requires post-
translational cleavage of a precursor, Fo, into two
disulfide linked polypeptides F1 and F2. Cleavage of Fo
is important in determining the pathogenicity of a given
3o NDV strain (Homma and Ohuchi, 1973; Nagai et al., 1976;
Nagai et al., 1980), and the sequence of amino acids at
the cleavage site is therefore critical in determining
viral virulence. It has been determined that amino acids
at the cleavage site in the NDV-F sequence inserted into
35 FPV to form recombinant vFP29 had the sequence Arg - Arg -
Gln - Arg - Arg (SEQ ID N0:39) (Taylor et al., 1990)
which conforms to the sequence found to be a requirement
WO 94116716 ; . ~~ ~ ~ ~ PCTIUS94/00888
47
for virulent NDV strains (Chambers et al., :1986; Espion
et al., 1987; Le et al., 1988; McGinnes and Morrison,
1986; Toyoda et al., 1987). The HN glycoprotein
synthesized in cells infected with virulent strains of
NDV is an uncleaved glycoprotein of 74 kDa. Extremely
avirulent strains such as Ulster and Queens:land encode an
HN precursor (HNo) which requires cleavage :For activation
(Garten et al., 1980).
The expression of F and HN genes in TROVAC-NDV was
io analyzed to confirm that the gene products were
authentically processed and presented. Indirect-
immunofluorescence using a polyclonal anti-NDV chicken
serum confirmed that immunoreactive proteins were
presented on the infected cell surface. To determine
that both proteins were presented on the plasma membrane,
mono-specific rabbit sera were produced against vaccinia
recombinants expressing either the F or HN glycoproteins.
Indirect immunofluorescence using these sera confirmed
the surface presentation of both proteins.
2o Immunoprecipitation experiments were performed by
using (35S) methionine labeled lysates of CEF cells
infected with parental and recombinant viruses. The
expected values of apparent molecular weights of the
glycolysated forms of F1 and F2 are 54.7 and 10.3 kDa
respectively (Chambers et al., 1986). In the
immunoprecipitation experiments using a polyclonal anti-
NDV serum, fusion specific products of the appropriate
size were detected from the NDV-F single recombinant
vFP29 (Taylor et al., 1990) and the TROVAC-NDV double
3o recombinant vFP96. The HN glycoprotein of appropriate
size was also detected from the NDV-HN single recombinant
VFP-47 (Edbauer et al., 1990) and TROVAC-NDV. No NDV
specific products were detected from uninfected and
parental TROVAC infected CEF cells.
In CEF cells, the F and HN glycoproteins are
appropriately presented on the infected cell surface
where they are recognized by NDV immune serum.
WO 94116716 ~ PCTIUS94100888
21533~G'
48
Immunoprecipitation analysis indicated that the Fo
protein is authentically cleaved to the F1 and F2
components required in virulent strains. Similarly, the
HN glycoprotein was authentically processed in CEF cells
infected with recombinant TROVAC-NDV.
Previous reports (Taylor et al., 1990; Edbauer et
al., 1990; Boursnell et al., 1990a,b,c; Ogawa et al.,
1990) would indicate that expression of either HN or F
alone is sufficient to elicit protective immunity against
to NDV challenge. Work on other paramyxoviruses has
indicated, however, that antibody to both proteins may be
required for full protective immunity. It has been
demonstrated that SV5 virus could spread in tissue
culture in the presence of antibody to the HN
glycoprotein but not to the F glycoprotein (Merz et al.,
1980). In addition, it has been suggested that vaccine
failures with killed measles virus vaccines were due to
inactivation of the fusion component (Norrby et al.,
1975). Since both NDV glycoproteins have been shown to
2o be responsible for eliciting virus neutralizing antibody
(Avery et al., 1979) and both glycoproteins, when
expressed individually in a fowlpox vector are able to
induce a protective immune response, it can be
appreciated that the most efficacious NDV vaccine should
2s express both glycoproteins.
Example 9 - CONSTRUCTION OF ALVAC RECOMBINANTS
EXPRESSING RABIES VIRUS GLYCOPROTEIN G
This example describes the development of ALVAC, a
3o canarypox virus vector and, of a canarypox-rabies
recombinant designated as ALVAC-RG (vCP65) and its safety
and efficacy.
Cells and Viruses. The parental canarypox virus
(Rentschler strain) is a vaccinal strain for canaries.
35 The vaccine strain was obtained from a wild type isolate
and attenuated through more than 200 serial passages on
chick embryo fibroblasts. A master viral seed was
subjected to four successive plaque purifications under
21 ~ 3 3 ~ ~ , , ~T~S94/00888
WO 94116716
49
agar and one plaque clone was amplified through five
additional passages after which the stock virus was used
as the parental virus in in vitro recombination tests.
The plaque purified canarypox isolate is designated
ALVAC.
Construction of a Canarypox Insertion Vector. An
880 by canarypox PvuII fragment was cloned between the
PvuII sites of pUC9 to form pRW764.5. The sequence of
this fragment is shown in FIG. 8 between positions 1372
1o and 2251. The limits of an open reading frame designated
as C5 were defined. It was determined that the open
reading frame was initiated at position 166 within the
fragment and terminated at position 487. The C5 deletion
was made without interruption of open reading frames.
Bases from position 167 through position 455 were
replaced with the sequence (SEQ ID N0:39)
GCTTCCCGGGAATTCTAGCTAGCTAGTTT. This replacement sequence
contains HindIII, SmaI and EcoRI insertion sites followed
by translation stops and a transcription termination
2o signal recognized by vaccinia virus RNA polymerase (Yuen
et al., 1987). Deletion of the C5 ORF was performed as
described below. Plasmid pRW764.5 was partially cut with
RsaI and the linear product was isolated. The RsaI
linear fragment was recut with BalII and the pRW764.5
fragment now with a RsaI to BalII deletion from position
156 to position 462 was isolated and used as a vector for
the following synthetic oligonucleotides:
RW145 (SEQ ID N0:40):
ACTCTCAAAAGCTTCCCGGGAATTCTAGCTAGCTAGTTTTTATAAA
RW146 (SEQ ID N0:41):
GATCTTTATAAAAACTAGCTAGCTAGAATTCCCGGGAAGCTTTTGAGAGT
Oligonucleotides RW145 and RW146 were annealed and
inserted into the pRW 764.5 RsaI and BalII vector
described above. The resulting plasmid is designated
pRW831.
Construction of Insertion Vector Containing the
Rabies G Gene. Construction of pRW838 is illustrated
WO 94116716 ,. . t PCTIUS94/00888
2153336 50
below. Oligonucleotides A through E, which overlap the
translation initiation codon of the H6 promoter with the
ATG of rabies G, were cloned into pUC9 as pRW737.
Oligonucleotides A through E contain the H6 promoter,
s starting at NruI, through the HindIII site of rabies G
followed by BalII. Sequences of oligonucleotides A
through E ((SEQ ID N0:42)-(SEQ ID N0:46)) are:
A (SEO ID N0:42): CTGAAATTATTTCATTATCGCGATATCCGTTAA
GTTTGTATCGTAATGGTTCCTCAGGCTCTCCTGTTTGT
to B (SEA ID N0:43): CATTACGATACAAACTTAACGGATATCGCGATAA
TGAAATAATTTCAG
C (SEO ID N0:44): ACCCCTTCTGGTTTTTCCGTTGTGTTTTGGGAAA
TTCCCTATTTACACGATCCCAGACAAGCTTAGATCTCAG
D (SEO ID N0:45): CTGAGATCTAAGCTTGTCTGGGATCGTGTAAATA
15 GGGAATTTCCCAAAACA
E (SEQ ID N0:46): CAACGGAAAAACCAGAAGGGGTACAAACAGGAGA
GCCTGAGGAAC
Th.e diagram of annealed oligonucleotides A through E is
as follows:
2o A C
B E D
Oligonucleotides A through E were kinased, annealed
25 (95°C for 5 minutes, then cooled to room temperature),
and inserted between the PvuII sites of pUC9. The
resulting plasmid, pRW737, was cut with HindIII and BctlII
and used as a vector for the 1.6 kbp HindIII-BalII
fragment of ptg155PR0 (Kieny et al., 1984) generating
3o pRW739. The ptg155PR0 HindIII site is 86 by downstream
of the rabies G translation initiation codon. BctlII is
downstream of the rabies G translation stop codon in
ptg155PR0. pRW739 was partially cut with NruI,
completely cut with BctlII, and a 1.7 kbp NruI-BalII
3s~ fragment, containing the 3' end of the H6 promoter
previously described (Taylor et al., 1988a,b; Guo et al.,
WO 94116716 ~ ~ ~ ~ PCTIUS94100888
:-, ,.
51 . . s
1989; Perkus et al., 1989) through the entire rabies G
gene, was inserted between the NruI and BamHI sites of
pRW824. The resulting plasmid is designated pRW832.
Insertion into pRW824 added the H6 promoter 5' of NruI.
The pRW824 sequence of BamHI followed by SmaI is (SEQ ID
N0:47): GGATCCCCGGG. pRW824 is a plasmid that contains a
nonpertinent gene linked precisely to the vaccinia virus
H6 promoter. Digestion with NruI and BamHI completely
excised this nonpertinent gene. The 1.8 kbp pRW832 SmaI
1o fragment, containing H6 promoted rabies G, was inserted
into the SmaI of pRW831, to form plasmid pRW838.
Development of ALVAC-RG. Plasmid pRW838 was
transfected into ALVAC infected primary CEF cells by
using the calcium phosphate precipitation method
1s previously described (Panicali et al., 1982; Piccini et
al., 1987). Positive plaques were selected on the basis
of hybridization to a specific rabies G probe and
subjected to 6 sequential rounds of plaque purification
until a pure population was achieved. One representative
2o plaque was then amplified and the resulting ALVAC
recombinant was designated ALVAC-RG (vCP65) (see also
FIG. 9). The correct insertion of the rabies G gene into
the ALVAC genome without subsequent mutation was
confirmed by sequence analysis.
25 Immunofluorescence. During the final stages of
assembly of mature rabies virus particles, the
glycoprotein component is transported from the golgi
apparatus to the plasma membrane where it accumulates
with the carboxy terminus extending into the cytoplasm
3o and the bulk of the protein on the external surface of
the cell membrane. In order to confirm that the rabies
glycoprotein expressed in ALVAC-RG was correctly
presented, immunofluorescence was performed on primary
CEF cells infected with ALVAC or ALVAC-RG.
3s Immunofluorescence was performed as previously described
(Taylor et al., 1990) using a rabies G monoclonal
antibody. Strong surface fluorescence was detected on
WO 94/16716 PCTIUS94/00888
215~~3G -
52
CEF cells infected with ALVAC-RG but not with the
parental ALVAC.
Immunoprecipitation. Preformed monolayers of
primary CEF, Vero (a line of African Green monkey kidney
cells ATCC # CCL81) and MRC-5 cells (a fibroblast-like
cell line derived from normal human fetal lung tissue
ATCC # CCL171) were inoculated at 10 pfu per cell with
parental virus ALVAC and recombinant virus ALVAC-RG in
the presence of radiolabelled 35S-methionine and treated
1o as previously described (Taylor et al., 1990).
Immunoprecipitation reactions were performed using a
rabies G specific monoclonal antibody. Efficient
expression of a rabies specific glycoprotein with a
molecular weight of approximately 67 kDa was detected
with the recombinant ALVAC-RG. No rabies specific
products were detected in uninfected cells or cells
infected with the parental ALVAC virus.
Secruential PassaginQ Experiment. In studies with
ALVAC virus in a range of non-avian species no
2o proliferative infection or overt disease was observed
(Taylor et al., 1991b). However, in order to establish
that neither the parental nor recombinant virus could be
adapted to grow in non-avian cells, a sequential
passaging experiment was performed.
The two viruses, ALVAC and ALVAC-RG, were inoculated
in 10 sequential blind passages in three cell lines:
(1) Primary chick embryo fibroblast (CEF) cells
produced from 11 day old white leghorn embryos;
(2) Vero cells - a continuous line of African Green
3o monkey kidney cells (ATCC # CCL81); and
(3) MRC-5 cells - a diploid cell line derived from
human fetal lung tissue (ATCC # CCL171).
The initial inoculation was performed at an m.o.i. of 0.1
pfu per cell using three 60mm dishes of each cell line
containing 2 X 106 cells per dish. One dish was
inoculated in the presence of 40~.g/ml of Cytosine
arabinoside (Ara C), an inhibitor of DNA replication.
WO 94/16716 ~ ~ ~ ~ ~ ~ PCTIUS94/00888
,.
j. ga ' , , t w
53
After an absorption period of 1 hour at 37°C, the
inoculum was removed and the monolayer washed to remove
unabsorbed virus. At this time the medium was replaced
with 5m1 of EMEM + 2% NBCS on two dishes (samples t0 and
t7) and 5m1 of EMEM + 2% NBCS containing 40 ~,g/ml Ara C
on the third (sample t7A). Sample t0 was frozen at -70°C
to provide an indication of the residual input virus.
Samples t7 and t7A were incubated at 37°C for 7 days,
after which time the contents were harvested and the
io cells disrupted by indirect sonication.
One ml of sample t7 of each cell line was inoculated
undiluted onto three dishes of the same cell line (to
provide samples t0, t7 and t7A) and onto one dish of
primary CEF cells. Samples t0, t7 and t7A were treated
as for passage one. The additional inoculation on CEF
cells was included to provide an amplification step for
more sensitive detection of virus which might be present
in the non-avian cells.
This procedure was repeated for 10 (CEF and MRC-5)
or 8 (Vero) sequential blind passages. Samples were then
frozen and thawed three times and assayed by titration on
primary CEF monolayers.
Virus yield in each sample was then determined by
plaque titration on CEF monolayers under agarose.
Summarized results of the experiment are shown in Tables
1 and 2.
The results indicate that both the parental ALVAC
and the recombinant ALVAC-RG are capable of sustained
replication on CEF monolayers with no loss of titer. In
3o Vero cells, levels of virus fell below the level of
detection after 2 passages for ALVAC and 1 passage for
ALVAC-RG. In MRC-5 cells, a similar result was evident,
and no virus was detected after 1 passage. Although the
results for only four passages are shown in Tables 1 and
2 the series was continued for 8 (Vero) and 10 (MRC-5)
passages with no detectable adaptation of either virus to
growth in the non-avian cells.
WO 94116716 PCTlUS94100888
.,
215 3 ~'3'~~ ". . _
54
In passage 1 relatively high levels of virus were
present in the t7 sample in MRC-5 and Vero cells.
However this level of virus was equivalent to that seen
in the t0 sample and the t7A sample incubated in the
presence of Cytosine arabinoside in which no viral
replication can occur. This demonstrated that the levels
of virus seen at 7 days in non-avian cells represented
residual virus and not newly replicated virus.
In order to make the assay more sensitive, a portion
of the 7 day harvest from each cell line was inoculated
onto a permissive CEF monolayer and harvested at
cytopathic effect (CPE) or at 7 days if no CPE was
evident. The results of this experiment are shown in
Table 3. Even after amplification through a permissive
cell line, virus was only detected in MRC-5 and Vero
cells for two additional passages. These results
indicated that under the conditions used, there was no
adaptation of either virus to growth in Vero or MRC-5
cells.
2o Inoculation of Macagues. Four HIV seropositive
macaques were initially inoculated with ALVAC-RG as
described in Table 4. After 100 days these animals were
re-inoculated to determine a booster effect, and an
additional seven animals were inoculated with a range of
doses. Blood was drawn at appropriate intervals and sera
analyzed, after heat inactivation at 56°C for 30 minutes,
for the presence of anti-rabies antibody using the Rapid
Fluorescent Focus Inhibition Assay (Smith et al., 1973).
Inoculation of Chimpanzees. Two adult male
3o chimpanzees (50 to 65 kg weight range) were inoculated
intramuscularly or subcutaneously with 1 X 10~ pfu of
vCP65. Animals were monitored for reactions and bled at
regular intervals for analysis for the presence of anti-
rabies antibody with the RFFI test (Smith et al., 1973).
Animals were re-inoculated with an equivalent dose 13
weeks after the initial inoculation.
WO 94/16716 PCT/US94/00888
2~ ~~3,,3~f~ .
_ i ; ~..,
Inoculation of Mice. Groups of mice were inoculated
with 50 to 100 ~,1 of a range of dilutions of different
batches of vCP65. Mice were inoculated in the footpad.
On day 14, mice were challenged by intracranial
s inoculation of from 15 to 43 mouse LDSO of the virulent
CVS strain of rabies virus. Survival of mice was
monitored and a protective dose 50% (PDSO) calculated at
28 days post-inoculation.
Inoculation of Dogs and Cats. Ten beagle dogs, 5
1o months old, and 10 cats, 4 months old, were inoculated
subcutaneously with either 6.7 or 7.7 loglo TCIDSO of
ALVAC-RG. Four dogs and four cats were not inoculated.
Animals were bled at 14 and 28 days post-inoculation and
anti-rabies antibody assessed in an RFFI test. The
15 animals receiving 6.7 loglo TCIDSO of ALVAC-RG were
challenged at 29 days post-vaccination with 3.7 loglo
mouse LDSO (dogs) or 4.3 loglo mouse LDSO (cats) of the
NYGS rabies virus challenge strain.
Inoculation of Squirrel Monkeys. Three groups of
2o four squirrel monkeys (Saimiri sciureus) were inoculated
with one of three viruses (a) ALVAC, the parental
canarypox virus, (b) ALVAC-RG, the recombinant expressing
the rabies G glycoprotein or (c) vCP37, a canarypox
recombinant expressing the envelope glycoprotein of
25 feline leukemia virus. Inoculations were performed under
ketamine anaesthesia. Each animal received at the same
time: (1) 20 ~1 instilled on the surface of the right eye
without scarification; (2) 100 ~,1 as several droplets in
the mouth; (3) 100 ~,1 in each of two intradermal
3o injection sites in the shaven skin of the external face
of the right arm; and (4) 100 ~1 in the anterior muscle
of the right thigh.
Four monkeys were inoculated with each virus, two
with a total of 5.0 loglo pfu and two with a total of 7.0
35 loglo pfu. Animals were bled at regular intervals and
sera analyzed for the presence of antirabies antibody
using an RFFI test (Smith et al., 1973). Animals were
WO 94/16716 '" ~ ~' ~'' ~- PCTIUS94/00888
215333
56
monitored daily for reactions to vaccination. Six months
after the initial inoculation the four monkeys receiving
ALVAC-RG, two monkeys initially receiving vCP37, and two
monkeys initially receiving ALVAC, as well as one naive
monkey were inoculated with 6.5 loglo pfu of ALVAC-RG
subcutaneously. Sera were monitored for the presence of
rabies neutralizing antibody in an RFFI test (Smith et
al., 1973).
Inoculation of Human Cell Lines with ALVAC-RG. In
io order to determine whether efficient expression of a
foreign gene could be obtained in non-avian cells in
which the virus does not productively replicate, five
cell types, one avian and four non-avian, were analyzed
for virus yield, expression of the foreign rabies G gene
and viral specific DNA accumulation. The cells
inoculated were:
(a) Vero, African Green monkey kidney cells, ATCC #
CCL81;
(b) MRC-5, human embryonic lung, ATCC # CCL 171;
(c) WISH human amnion, ATCC # CCL 25;
(d) Detroit-532, human foreskin, Downs's syndrome,
ATCC # CCL 54; and
(e) Primary CEF cells.
Chicken embryo fibroblast cells produced from 11 day
old white leghorn embryos were included as a positive
control. All inoculations were performed on preformed
monolayers of 2 X 106 cells as discussed below.
A. Methods for DNA analysis.
Three dishes of each cell line were inoculated at 5
3o pfu/cell of the virus under test, allowing one extra
dish of each cell line un-inoculated. One dish was
incubated in the presence of 40 ~,g/ml of cytosine
arabinoside (Ara C). After an adsorption period of
60 minutes at 37°C, the inoculum was removed and the
monolayer washed twice to remove unadsorbed virus.
Medium (with or without Ara C) was then replaced.
Cells from one dish (without Ara C) were harvested
WO 94/16716 PCTlUS94100888
21~~33
57
as a time zero sample. The remaining dishes were
incubated at 37°C for 72 hours, at which time the
cells were harvested and used to analyze DNA
accumulation. Each sample of 2 X 106 cells was
s resuspended in 0.5 ml phosphate buffered saline
(PBS) containing 40 mM EDTA and incubated for 5
minutes at 37°C. An equal volume of 1.5~ agarose
prewarmed at 42°C and containing 120 mM EDTA was
added to the cell suspension and gently mixed. The
io suspension was transferred to an agarose plug mold
and allowed to harden for at least 15 min. The
agarose plugs were then removed and incubated for
12-16 hours at 50°C in a volume of lysis buffer (1%
sarkosyl, 100 ~,g/ml proteinase K, 10 mM Tris HC1 pH
15 7.5, 200 mM EDTA) that completely covers the plug.
The lysis buffer was then replaced with 5.0 ml
sterile 0.5 X TBE (44.5 mM Tris-borate, 44.5 mM
boric acid, 0.5 mM EDTA) and equilibrated at 4°C for
6 hours with 3 changes of TBE buffer. The viral DNA
2o within the plug was fractionated from cellular RNA
and DNA using a pulse field electrophoresis system.
Electrophoresis was performed for 20 hours at 180 V
with a ramp of 50-90 sec at 15°C in 0.5 X TBE. The
DNA was run with lambda DNA molecular weight
2s standards. After electrophoresis the viral DNA band
was visualized by staining with ethidium bromide.
The DNA was then transferred to a nitrocellulose
membrane and probed with a radiolabelled probe
prepared from purified ALVAC genomic DNA.
3o B. Estimation of virus yield.
Dishes were inoculated exactly as described above,
with the exception that input multiplicity was 0.1
pfu/cell. At 72 hours post infection, cells were
lysed by three successive cycles of freezing and
35 thawing. Virus yield was assessed by plaque
titration on CEF monolayers.
WO 94/16716 ,~. . .-~ PCT/US94/00888
215 3;~'~ 6~v it r v _
58
C. Analysis of expression of Rabies G gene.
Dishes were inoculated with recombinant or parental
virus at a multiplicity of l0 pfu/cell, allowing an
additional dish as an uninfected virus control.
s After a one hour absorption period, the medium was
removed and replaced with methionine free medium.
After a 30 minute period, this medium was replaced
with methionine-free medium containing 25 uCi/ml of
35S-Methionine. Infected cells were labelled
io overnight (approximately 16 hours), then lysed by
the addition of buffer A lysis buffer.
Immunoprecipitation was performed as previously
described (Taylor et al., 1990) using a rabies G
specific monoclonal antibody.
1s Results: Estimation of Viral Yield. The results of
titration for yield at 72 hours after inoculation at 0.1
pfu per cell are shown in Table 5. The results indicate
that while a productive infection can be attained in the
avian cells, no increase in virus yield can be detected
2o by this method in the four non-avian cell systems.
Analysis of Viral DNA Accumulation. In order to
determine whether the block to productive viral
replication in the non-avian cells occurred before or
after DNA replication, DNA from the cell lysates was
2s fractionated by electrophoresis, transferred to
nitrocellulose and probed for the presence of viral
specific DNA. DNA from uninfected CEF cells, ALVAC-RG
infected CEF cells at time zero, ALVAC-RG infected CEF
cells at 72 hours post-infection and ALVAC-RG infected
3o CEF cells at 72 hours post-infection in the presence of
40 ~,g/ml of cytosine arabinoside all showed some
background activity, probably due to contaminating CEF
cellular DNA in the radiolabelled ALVAC DNA probe
preparation. However, ALVAC-RG infected CEF cells at 72
3s hours post-infection exhibited a strong band in the
region of approximately 350 kbp representing ALVAC-
specific viral DNA accumulation. No such band is
PCT/US94100888
'WO 94/16716 ~ ri ,_ ,~.. F v
detectable when the culture is incubated in the presence
of the DNA synthesis inhibitor, cytosine arabinoside.
Equivalent samples produced in Vero cells showed a very
faint band at approximately 350 kbp in the ALVAC-RG
infected Vero cells at time zero. This level represented
residual virus. The intensity of the band was amplified
at 72 hours post-infection indicating that some level of
viral specific DNA replication had occurred in Vero cells
which had not resulted in an increase in viral progeny.
1o Equivalent samples produced in MRC-5 cells indicated that
no viral specific DNA accumulation was detected under
these conditions in this cell line. This experiment was
then extended to include additional human cell lines,
specifically WISH and Detroit-532 cells. ALVAC infected
is CEF cells served as a positive control. No viral
specific DNA accumulation was detected in either WISH or
Detroit cells inoculated with ALVAC-RG. It should be
noted that the limits of detection of this method have
not been fully ascertained and viral DNA accumulation may
2o be occurring, but at a level below the sensitivity of the
method. Other experiments in which viral DNA replication
was measured by 3H-thymidine incorporation support the
results obtained with Vero and MRC-5 cells.
Analysis of Rabies Gene Expression. To determine if
2s any viral gene expression, particularly that of the
inserted foreign gene, was occurring in the human cell
lines even in the absence of viral DNA replication,
immunoprecipitation experiments were performed on 35S-
methionine labelled lysates of avian and non-avian cells
3o infected with ALVAC and ALVAC-RG. The results of
immunoprecipitation using a rabies G specific monoclonal
antibody illustrated specific immunoprecipitation of a 67
kDa glycoprotein in CEF, Vero and MRC-5, WISH and Detroit
cells infected with ALVAC-RG. No such specific rabies
35 gene products were detected in any of the uninfected and
parentally infected cell lysates.
WO 94/16716 ~~ ~ ~ PCTIUS94/00888
215333'° ~'
The results of this experiment indicated that in the
human cell lines analyzed, although the ALVAC-RG
recombinant was able to initiate an infection and express
a foreign gene product under the transcriptional control
s of the H6 early/late vaccinia virus promoter, the
replication did not proceed through DNA replication, nor
was there any detectable viral progeny produced. In the
Vero cells, although some level of ALVAC-RG specific DNA
accumulation was observed, no viral progeny was detected
io by these methods. These results would indicate that in
the human cell lines analyzed the block to viral
replication occurs prior to the onset of DNA replication,
while in Vero cells, the block occurs following the onset
of viral DNA replication.
15 In order to determine whether the rabies
glycoprotein expressed in ALVAC-RG was immunogenic, a
number of animal species were tested by inoculation of
the recombinant. The efficacy of current rabies vaccines
is evaluated in a mouse model system. A similar test was
2o therefore performed using ALVAC-RG. Nine different
preparations of virus (including one vaccine batch (J)
produced after 10 serial tissue culture passages of the
seed virus) with infectious titers ranging from 6.7 to
8.4 loglo TCIDSO per ml were serially diluted and 50 to
2s 100 ~.1 of dilutions inoculated into the footpad of four
to six week old mice. Mice were challenged 14 days later
by the intracranial route with 300 ~1 of the CVS strain
of rabies virus containing from 15 to 43 mouse LD5a as
determined by lethality titration in a control group of
3o mice. Potency, expressed as the PD50 (Protective dose
50%), was calculated at 14 days post-challenge. The
results of the experiment are shown in Table 6. The
results indicated that ALVAC-RG was consistently able to
protect mice against rabies virus challenge with a PD5o
35 value ranging from 3.33 to 4.56 with a mean value of 3.73
. (STD 0.48). As an extension of this study, male mice
were inoculated intracranially with 50 ~C1 of virus
WO 94/16716 , PCT/US94/00888
61
containing 6.0 loglo TCIDSO of ALVAC-RG or with an
equivalent volume of an uninfected cell suspension. Mice
were sacrificed on days 1, 3 and 6 post-inoculation and
their brains removed, fixed and sectioned.
Histopathological examination showed no evidence for
neurovirulence of ALVAC-RG in mice.
In order to evaluate the safety and efficacy of
ALVAC-RG for dogs and cats, a group of 14, 5 month old
beagles and 14, 4 month old cats were analyzed. Four
to animals in each species were not vaccinated. Five
animals received 6.7 loglo TCIDSO subcutaneously and five
animals received 7.7 loglo TCIDSO by the same route.
Animals were bled for analysis for anti-rabies antibody.
Animals receiving no inoculation or 6.7 loglo TCIDSO of
ALVAC-RG were challenged at 29 days post-vaccination with
3.7 loglo mouse LDSO (dogs, in the temporal muscle) or 4.3
loglo mouse LDSO (cats, in the neck) of the NYGS rabies
virus challenge strain. The results of the experiment
are shown in Table 7.
2o No adverse reactions to inoculation were seen in
either cats or dogs with either dose of inoculum virus.
Four of 5 dogs immunized with 6.7 loglo TCIDSO had
antibody titers on day 14 post-vaccination and all dogs
had titers at 29 days. All dogs were protected from a
challenge which killed three out of four controls. In
cats, three of five cats receiving 6.7 loglo TCIDSO had
specific antibody titers on day 14 and all cats were
positive on day 29 although the mean antibody titer was
low at 2.9 IU. Three of five cats survived a challenge
3o which killed all controls. All cats immunized with 7.7
loglo TCIDSO had antibody titers on day 14 and at day 29
the Geometric Mean Titer was calculated as 8.1
International Units.
The immune response of squirrel monkeys (Saimiri
sciureus) to inoculation with ALVAC, ALVAC-RG and an
unrelated canarypox virus recombinant was examined.
Groups of monkeys were inoculated as described above and
.~; ,,
WO 94116716 ~ . '-.~ PCT/US94100888
2153335 62
sera analyzed for the presence of rabies specific
antibody. Apart from minor typical skin reactions to
inoculation by the intradermal route, no adverse
reactivity was seen in any of the monkeys. Small amounts
of residual virus were isolated from skin lesions after
intradermal inoculation on days two and four post-
inoculation only. All specimens were negative on day
seven and later. There was no local reaction to intra-
muscular injection. All four monkeys inoculated with
1o ALVAC-RG developed anti-rabies serum neutralizing
antibodies as measured in an RFFI test. Approximately
six months after the initial inoculation all monkeys and
one additional naive monkey were re-inoculated by the
subcutaneous route on the external face of the left thigh
with 6.5 loglo TCIDSO of ALVAC-RG. Sera were analyzed for
the presence of anti-rabies antibody. The results are
shown in Table 8.
Four of the five monkeys naive to rabies developed a
serological response by seven days post-inoculation with
2o ALVAC-RG. All five monkeys had detectable antibody by 11
days post-inoculation. Of the four monkeys with previous
exposure to the rabies glycoprotein, all showed a
significant increase in serum neutralization titer
between days 3 and 7 post-vaccination. The results
2s indicate that vaccination of squirrel monkeys with ALVAC-
RG does not produce adverse side-effects and a primary
neutralizing antibody response can be induced. An
amnanestic response is also induced on re-vaccination.
Prior exposure to ALVAC or to a canarypox recombinant
3o expressing an unrelated foreign gene does not interfere
with induction of an anti-rabies immune response upon re-
vaccination.
The immunological response of HIV-2 seropositive
macaques to inoculation with ALVAC-RG was assessed.
35 Animals were inoculated as described above and the
presence of anti-rabies serum neutralizing antibody
assessed in an RFFI test. The results, shown in Table 9,
WO 94!16716 ~ PCT/US94/00888
63
indicated that HIV-2 positive animals inoculated by the
subcutaneous route developed anti-rabies antibody by 11
days after one inoculation. An anamnestic response was
detected after a booster inoculation given approximately
s three months after the first inoculation. No response
was detected in animals receiving the recombinant by the
oral route. In addition, a series of six animals were
inoculated with decreasing doses of ALVAC-RG given by
either the intra-muscular or subcutaneous routes. Five
io of the six animals inoculated responded by 14 days post-
vaccination with no significant difference in antibody
titer.
Two chimpanzees with prior exposure to HIV were
inoculated with 7.0 loglo pfu of ALVAC-RG by the
15 subcutaneous or intra-muscular route. At 3 months post-
inoculations both animals were re-vaccinated in an
identical fashion. The results are shown in Table 10.
No adverse reactivity to inoculation was noted by
either intramuscular or subcutaneous routes. Both
2o chimpanzees responded to primary inoculation by 14 days
and a strongly rising response was detected following re-
vaccination.
WO 94/16716 ~ PCT/US94I00888
2Z~333~~ _
64
Table 1. Sequential Passage of ALVAC in Avian and non-Avian Cells.
CEF Vero M RC-5
Pass 1
Sample toe 2.4 3.0 2.6
t7 7.0 1.4 0.4
t7A' 1.2 1.2 0.4
io Pass 2
Sample to 5.0 0.4 N.D.d
t7 7.3 0.4 N.D.
t7A 3.9' N. D. N. D.
Pass 3 .
i5 Sample to 5.4 0.4 N.D.
t7 7.4 N.D. N.D.
t7A 3.8 N.D. N.D.
Pass 4
Sample to 5.2 N.D. N.D.
2o t7 7.1 N.D. N.D.
t7A 3.9 N. D. N. D.
a: This sample was harvested at zero time and
represents the residual input virus. The titer is
2s expressed as loglopfu per ml.
b: This sample was harvested at 7 days post-infection.
c: This sample was inoculated in the presence of 40
30 ~.g/ml of Cytosine arabinoside and harvested at 7
days post infection.
d: Not detectable
215 3 ,~ 3 ~ PCTIUS94/00888
WO 94/16716
'. ~ '
65
Table 2. Sequential Passage of ALVAC-RGAvian and non-Avian
in Cells
CEF Vero MRC-5
Pass 1
Sample 3.0 2.9 2.9
t0a
t7b 7.1 1.0 1.4
t7A' 1.8 1.4 1.2
Pass 2
to Sample 5.1 0.4 0.4
t0
t7 7.1 N.D.d N.D.
t7A 3.8 N.D. N.D.
Pass 3
Sample 5.1 0.4 N.D.
t0
t7 7.2 N.D. N.D.
t7A 3.6 N.D. N.D.
Pass 4
Sample 5.1 N.D. N.D.
t0
t7 7.0 N.D. N.D.
2o t7A 4.0 N.D. N.D
a: This sample was harvested at ero time and
z
represents virus. The titer is
the residual
input
expressed
as loglopfu
per ml.
b: This sample was harvested at days post-infection.
7
. c: This sample was inoculated in the presence of 40
~.g/m l of Cytosine arabinoside and harvested at 7
days post-infection.
d: Not detectable.
WO 94116716 21 ~ 3 3 ,~ ~ ,y '.~' ~1 . ~T~S94I00888
66
Table 3. Amplification of residual virus by passage in CEF cells
CEF Vero MRC-5
s a) ALVAC
Pass 2$ 7.0b 6.0 5.2
3 7.5 4.1 4.9
4 7.5 N.D.' N.D.
7.1 N.D. N.D.
to
b) ALVAC-RG
PASS 2a 7.2 5.5 5.5
3 7.2 5.0 5.1
4 7.2 N.D. N.D.
5 7.2 N.D. N.D.
a: Pass 2 represents the amplification in CEF cells of
the 7 day sample from Pass 1.
2o b: Titer expressed as loglo pfu per ml
c: Not Detectable
WO 94/16716 215 3 3.,~ ?~ , ~ ..4 r . PCT/US94100888
67
Table 4. Schedule of inoculation of rhesus macaques with ALVAC-RG
(vCP65)
Animal Inoculation
176L Primary: 1 X pfu of vCP65 orally in TANG
108
Secondary: 1 X pfu of vCP65 plus 1 X 10' pfu
10' of vCP82a by
SC route
l0 185 L Primary: 1 X pfu of vCP65 orally in Tang
108
Secondary: 1 X pfu of vCP65 plus 1 X 10' pfu
10' of vCP82 by SC
route
177 L Primary: 5 X pfu SC of vCP65 by SC route
10'
Secondary: 1 X pfu of vCP65 plus 1 X 10' pfu
10' of vCP82 by SC
i 5 route
186L Primary: 5 X pfu of vCP65 by SC route
10'
Secondary: 1 X pfu of vCP65 plus 1 X 10' pfu
10' of vCP82 by SC
route
178L Primary: 1 X pfu of vCP65 by SC route
10'
20 182L Primary: 1 X pfu of vCP65 by IM route
10'
179L Primary: 1 X pfu of vCP65 by SC route
106
183L Primary: 1 X pfu of vCP65 by IM route
106
180L Primary: 1 X pfu of vCP65 by SC route
106
184L Primary: 1 X pfu of vCP65 by IM route
105
25 187L Primary 1 X pfu of vCP65 orally
10'
a: vCP82 is a canarypox virus recombinant expressing
the measles virus fusion and hemagglutinin genes.
WO 94/16716
215 3..3x3;=sw - , y PCTIUS94100888
68
Table 5. Analysis of yield in avian and non-avian cells
inoculated with ALVAC-RG
Sample Time
Cell Type t0 t72 t72A°
Expt 1
CEF 3.3a 7.4 1.7
Vero 3.0 1.4 1.7
to MRC-5 3.4 2.0 1.7
Expt 2
CEF 2.9 7.5 < 1.7
WISH 3.3 2.2 2.0
Detroit-532 2.8 1.7 < 1.7
a: Titer expressed as loglo pfu per ml
b: Culture incubated in the presence of 40 ~,g/ml of
Cytosine arabinoside
WO 94/16716 ~ , PCT/US94100888
69
Table 6. Potency of ALVAC-RG as tested in mice
Test Challenge Dosea PDSO°
s Initial seed 43 4.56
Primary seed 23 3.34
Vaccine Batch H 23 4.52
Vaccine Batch I 23 3.33
Vaccine Batch K 15 3.64
io Vaccine Batch L 15 4.03
Vaccine Batch M 15 3.32
Vaccine Batch N 15 3.39
Vaccine Batch J 23 3.42
15 a: Expressed as mouse LD5o
b: Expressed as loglo TCIDSo
WO 94116716 PCTIUS94100888
2153336
Table 7. Efficacy of ALVAC-RG in dogs and cats
Doas Cats
Dose Antibodya Survival° Antibody Survival
6.7 11.9 5/5 2.9 3/5
7.7 10.1 N.T. 8.1 N.T.
a: Antibody at day 29 post inoculation expressed as the
1o geometric mean titer in International Units.
b: Expressed as a ratio of survivors over animals
challenged
21~,~~'
WO 94116716 PCTIUS94100888
71
Table 8. Anti-rabies serological response of Squirrel monkeys
inoculated with canarypox recombinants
Monkey Previous Rabies serum-neutralizing antibodya
# Exposure -196° 0 3 7 11 21 28
22 ALVAC' NT9 < < < 2.1 2.3 2.2
1.2 1.2 1.2
51 ALVAC' NT < < 1.7 2.2 2.2 2.2
1.2 1.2
39 vCP37 NT < < 1.7 2.1 2.2 N.T.9
1.2 1.2
55 vCP37 NT < < 1.7 2.2 2.1 N.T.
1.2 1.2
37 ALVAC-RGe 2.2 < < 3.2 3.5 3.5 3.2
1.2 1.2
53 ALVAC-RGe 2.2 < < 3.6 3.6 3.6 3.4
1.2 1.2
38 ALVAC-RG' 2.7 < < 3.2 3.8 3.6 N.T.
1.7 1.7
54 ALVAC-RG' 3.2 < < 3.6 4.2 4.0 3.6
1.7 1.5
57 None NT < < 1.7 2.7 2.7 2.3
1.2 1.2
a: As determined by RFFI test on days
indicated
and
expressed in Internat ionalUnits
b: Day-196 represents se rum after primary
from
day
28
2o vaccination
c: Animals received 5.0 logloTCIDSO ALVAC
of
d: Animals received 5.0 logloTCIDSO vCP37
of
e: Animals received 5.0 logloTCIDSO ALVAC-RG
of
f: Animals received 7.0 logloTCID50 ALVAC-RG
of
g: Not tested.
WO 94/16716 PCTIUS94/00888
72
Table 9. Inoculation of rhesus macaques with ALVAC-RGa
C~ Days Route of Primary Inoculation
post
inocu
G~t lation
or Tan SC SC SC IM SC IM SC IM OR
1 176L 185L177L 186L 178L 182L 179L 183L 180L 184L184L
~ 1-87L~
_g4 . -
-g - . . . . _
3 - - - -
s _ _
11 - - 1sd 129
19 - 32 128 - -
35 - 32 512
2 59 - 64 256
0
75 - 64 128 - .
99~ - - 64 256 - . . _ - -
2 - - 32 256 - - - - . . -
6 - - 512 512 - - - - . . -
2 15 16 16 512 512 64 32 64 128 32 - -
5
29 16 32 256 256 64 64 32 128 32 - -
55 32 32 32 16
57 16 128 128 16 16 -
30
a: See Table 9 for schedule of inoculations.
b: Animals 176L and 185L received 8.0 loglo pfu by the
35 oral route in 5 ml Tang. Animal 187L received 7.0
loglo pfu by oral route not in Tang.
c: Day of re-vaccination for animals 176L, 185L, 177L
and 186L by S.C. route, and primary vaccination for
4o animals 178L, 182L, 179L, 183L, 180L, 184L and
187L.
d: Titers expressed as reciprocal of last dilution
showing inhibition of fluorescence in an RFFI test.
WO 94/16716 ~~ PCTIUS94100888
73
Table 10. Inoculation of chimpanzees with ALVAC-RG
Weeks post- Animal 431 Animal 457
Inoculation I.M. S.C.
0 <88 <8
1 <8 <8
2 8 32
4 16 32
l0 8 16 32
12/0 16 8
13/1 128 128
15/3 256 512
20/8 64 128
26/12 32 128
a: Titer expressed as reciprocal of last dilution
showing inhibition of fluorescence in an RFFI test
b: Day of re-inoculation
WO 94/16716 PCT/US94I00888
74
Example 10 - IMMUNIZATION OF HUMANS USING CANARYPOX
EXPRESSING RABIES GLYCOPROTEIN
(ALVAC-RG; yCP65)
G~ 5 ALVAC-RG (vCP65) was generated as described in
Example 9 and FIGS. 9A and 9B. For scaling-up and
vaccine manufacturing ALVAC-RG (vCP65) was grown in
primary CEF derived from specified pathogen free eggs.
Cells were infected at a multiplicity of 0.01 and
io incubated at 37°C for three days.
The vaccine virus suspension was obtained by
ultrasonic disruption in serum free medium of the
infected cells; cell debris were then removed by
centrifugation and filtration. The resulting clarified
15 suspension was supplemented with lyophilization
stabilizer (mixture of amino-acids), dispensed in single
dose vials and freeze dried. Three batches of decreasing
titer were prepared by ten-fold serial dilutions of the
virus suspension in a mixture of serum free medium and
20 lyophilization stabilizer, prior to lyophilization.
Quality control tests were applied to the cell
substrates, media and virus seeds and final product with
emphasis on the search for adventitious agents and
innocuity in laboratory rodents. No undesirable trait
25 was found.
Preclinical data. Studies in vitro indicated that
VERO or MRC-5 cells do not support the growth of ALVAC-RG
(vCP65); a series of eight (VERO) and 10 (MRC) blind
serial passages caused no detectable adaptation of the
3o virus to grow in these non avian lines. Analyses of
human cell lines (MRC-5, WISH, Detroit 532, HEL, HNK or
EBV-transformed lymphoblastoid cells) infected or
inoculated with ALVAC-RG (vCP65) showed no accumulation
of virus specific DNA suggesting that in these cells the
3s block in replication occurs prior to DNA synthesis.
Significantly, however, the expression of the rabies
virus glycoprotein gene in all cell lines tested
indicating that the abortive step in the canarypox
replication cycle occurs prior to viral DNA replication.
WO 94/16716 ~ l 5 3 3 3 ~ PCT/US94100888
The safety and efficacy of ALVAC-RG (vC:P65) were
documented in a series of experiments in animals. A
number of species including canaries, chickens, ducks,
geese, laboratory rodents (suckling and adult mice),
5 hamsters, guinea-pigs, rabbits, cats and dogs, squirrel
monkeys, rhesus macaques and chimpanzees, wE:re inoculated
with doses ranging from 105 to 108 pfu. A variety of
routes were used, most commonly subcutaneous,
intramuscular and intradermal but also oral (monkeys and
to mice) and intracerebral (mice).
In canaries, ALVAC-RG (vCP65) caused a "take" lesion
at the site of scarification with no indication of
disease or death. Intradermal inoculation of rabbits
resulted in a typical poxvirus inoculation reaction which
15 did not spread and healed in seven to ten days. There
was no adverse side effects due to canarypox in any of
the animal tests. Immunogenicity was documented by the
development of anti-rabies antibodies following
inoculation of ALVAC-RG (vCP65) in rodents, dogs, cats,
2o and primates, as measured by Rapid Fluorescent Focus
Inhibition Test (RFFIT). Protection was also
demonstrated by rabies virus challenge experiments in
mice, dogs, and cats immunized with ALVAC-RG (vCP65).
Volunteers. Twenty-five healthy adults aged 20-45
25 with no previous history of rabies immunization were
enrolled. Their health status was assessed by complete
medical histories, physical examinations, hematological
and blood chemistry analyses. Exclusion criteria
included pregnancy, allergies, immune depression of any
3o kind, chronic debilitating disease, cancer, injection of
immune globins in the past three months, and
seropositivity to human immunodeficiency virus (HIV) or
to hepatitis B virus surface antigen.
Study design. Participants were randomly allocated
35 to receive either standard Human Diploid Cell Rabies
Vaccine (HDC) batch no E0751 (Pasteur Merieux Serums &
Vaccine, Lyon, France) or the study vaccine ALVAC-RG
WO 94/16716 PCTIUS94100888
76
(vCP65).
The trial was designated as a dose escalation study.
Three batches of experimental ALVAC-RG (vCP65) vaccine
were used sequentially in three groups of volunteers
s (Groups A, B and C) with two week intervals between each
step. The concentration of the three batches was 1035,
104'5, 105'5 Tissue Culture Infectious Dose (TCID50) per
dose, respectively.
Each volunteer received two doses of the same
1o vaccine subcutaneously in the deltoid region at an
interval of four weeks. The nature of the injected
vaccine was not known by the participants at the time of
the first injection but was known by the investigator.
In order to minimize the risk of immediate
15 hypersensitivity at the time of the second injection, the
volunteers of Group B allocated to the medium dose of
experimental vaccine were injected 1 h previously with
the lower dose and those allocated to the higher dose
(Group C) received successively the lower and the medium
2o dose at hourly intervals.
Six months later, the recipients of the highest
dosage of ALVAC-RG (vCP65) (Group C) and HDC vaccine were
offered a third dose of vaccine; they were then
randomized to receive either the same vaccine as
2s previously or the alternate vaccine. As a result, four
groups were formed corresponding to the following
immunization scheme: 1. HDC, HDC - HDC; 2. HDC, HDC -
ALVAC-RG (vCP65); 3. ALVAC-RG (vCP65), ALVAC-RG (vCP65)
- HDC; 4. ALVAC-RG (vCP65), ALVAC-RG (vCP65), ALVAC-RG
30 (vCP65).
Monitoring of Side Effects. All subjects were
monitored for 1 h after injection and re-examined every
day for the next five days. They were asked to record
local and systemic reactions for the next three weeks and
35 were questioned by telephone two times a week.
Laboratory Investigators. Blood specimens were
obtained before enrollment and two, four and six days
WO 94/16716 ~ ~ ~ PCTlUS94100888
77
after each injection. Analysis included complete blood''
cell count, liver enzymes and creative kinase assays.
Antibody assays. Antibody assays were performed
seven days prior to the first injection and at days 7
28, 35, 56, 173, 187 and 208 of the study.
The levels of neutralizing antibodies to rabies were
determined using the Rapid Fluorescent Focus Inhibition
test (RFFIT) (Smith & Yaeger, In Laboratory Techniques on
Rabies). Canarypox antibodies were measured by direct
to ELISA. The antigen, a suspension of purified canarypox
virus disrupted with 0.1% Triton X100, was coated in
microplates. Fixed dilutions of the sera were reacted
for two hours at room temperature and reacting antibodies
were revealed with a peroxidase labelled anti-human IgG
goat serum. The results are expressed as the optical
density read at 490nm.
Analysis. Twenty-five subjects were enrolled and
completed the study. There were 10 males and 15 females
and the mean age was 31.9 (2l to 48). All but three
2o subjects had evidence of previous smallpox vaccination;
the three remaining subjects had no typical scar and
vaccination history. Three subjects received each of the
lower doses of experimental vaccine (103'5 and 104-s
TCIDSO), nine subjects received 105'5 TCIDSO and ten
received the HDC vaccine.
Safety (Table 11). During the primary series of
immunization, fever greater than 37.7°C was noted within
24 hours after injection in one HDC recipient (37.8°C)
and in one vCP65 105'5 TCIDSO recipient (38°C). No other
3o systemic reaction attributable to vaccination was
observed in any participant.
Local reactions were noted in 9/10 recipients of HDC
vaccine injected subcutaneously and in 0/3, 1/3 and 9/9
recipients of vCP65 103'5, 104'5, 105'5 TCIDSO,
respectively.
Tenderness was the most common symptoms and was
always mild. Other local symptoms included redness and
WO 94/16716 w PCT/US94/00888
induration which were also mild and transient. All
symptoms usually subsided within 24 hours and never
lasted more than 72 hours.
There was no significant change in blood cell
s counts, liver enzymes or creatine kinase values.
Immune Responses; Neutralizing Antibodies to Rabies
(Table 121. Twenty eight days after the first injection
all the HDC recipients had protective titers (>_0.5
IU/ml). By contrast none in groups A and B (103-5 and
104'5 TCIDS~) and only 2/9 in group C (105'5 TCIDSO) ALVAC-
RG (vCP65) recipients reached this protective titer.
At day 56 (i.e. 28 days after the second injection)
protective titers were achieved in 0/3 of Group A, 2/3 of
Group B and 9/9 of Group C recipients of ALVAC-RG (vCP65)
vaccine and persisted in all 10 HDC recipients.
At day 56 the geometric mean titers were 0.05, 0.47,
4.4 and 11.5 IU/ml in groups A, B, C and HDC
respectively.
At day 180, the rabies antibody titers had
2o substantially decreased in all subjects but remained
above the minimum protective titer of 0.5 IU/ml in 5/10
HCD recipients and in 5/9 ALVAC-RG (vCP65) recipients;
the geometric mean titers were 0.51 and 0.45 IU/ml in
groups HCD and C, respectively.
Antibodies to the Canarypox virus yTable 13~. The
pre-immune titers observed varied widely with titers
varying from 0.22 to 1.23 O.D. units despite the absence
of any previous contact with canary birds in those
subjects with the highest titers. When defined as a
3o greater than two-fold increase between preimmunization
and post second injection titers, a seroconversion was
obtained in 1/3 subjects in group B and in 9/9 subjects
in group C whereas no subject seroconverted in groups A
or HDC.
Booster Infection. The vaccine was similarly well
tolerated six months later, at the time of the booster
injection: fever was noted in 2/9 HDC booster recipients
WO 94/16716 ~ ~ PCT/US94100888
79
and in 1/10 ALVAC-RG (vCP65) booster recipients. Local
reactions were present in 5/9 recipients of HDC booster
and in 6/10 recipients of the ALVAC-RG (vCP65) booster.
Observations. FIG. 13 shows graphs of rabies
s neutralizing antibody titers (Rapid Fluorescent Focus
Inhibition Test or RFFIT, IU/ml): Booster effect of HDC
and vCP65 (105'5 TCIDSO) in volunteers previously
immunized with either the same or the alternate vaccine.
Vaccines were given at days 0, 28 and 180. Antibody
1o titers were measured at days 0, 7, 28, 35, 56, 173, and
187 and 208.
As shown in FIGS. 13A to 13D, the booster dose given
resulted in a further increase in rabies antibody titers
in every subject whatever the immunization scheme.
15 However, the ALVAC-RG (vCP65) booster globally elicited
lower immune responses than the HDC booster and the
ALVAC-RG (vCP65), ALVAC-RG (vCP65) - ALVAC-RG (vCP65)
group had significantly lower titers than the three other
groups. Similarly, the ALVAC-RG (vCP65) booster
2o injection resulted in an increase in canarypox antibody
titers in 3/5 subjects who had previously received the
HDC vaccine and in all five subjects previously immunized
with ALVAC-RG (vCP65).
In general, none of the local side effects from
25 administration of vCP65 was indicative of a local
replication of the virus. In particular, lesions of the
skin such as those observed after injection of vaccine
were absent. In spite of the apparent absence of
replication of the virus, the injection resulted in the
3o volunteers generating significant amounts of antibodies
to both the canarypox vector and to the expressed rabies
glycoprotein.
Rabies neutralizing antibodies were assayed with the
Rapid Fluorescent Focus Inhibition Test (RFFIT) which is
3s known to correlate well with the sero neutralization test
in mice. Of 9 recipients of 105'5 TCIDSO, five had low
level responses after the first dose. Protective titers
WO 94116716 ' PCT/US94100888
cl.~~ of rabies antibodies were obtained after the second
injection in all recipients of the highest dose tested
and even in 2 of the 3 recipients of the medium dose. In
~1~ this study, both vaccines were given subcutaneously as
s usually recommended for live vaccines, but not for the
inactivated HDC vaccine. This route of injection was
selected as it best allowed a careful examination of the
injection site, but this could explain the late
appearance of antibodies in HDC recipients: indeed, none
to of the HDC recipients had an antibody increase at day 7,
whereas, in most studies where HDC vaccine is give
intramuscularly a significant proportion of subjects do
(Klietmann et al., Int'1 Green Cross - Geneva, 1981;
Kuwert et al., Int'1 Green Cross - Geneva, 1981).
15 However, this invention is not necessarily limited to the
subcutaneous route of administration.
The GMT (geometric mean titers) of rabies
neutralizing antibodies was lower with the
investigational vaccine than with the HDC control
2o vaccine, but still well above the minimum titer required
for protection. The clear dose effect response obtained
with the three dosages used in this study suggest that a
higher dosage might induce a stronger response.
Certainly from this disclosure the skilled artisan can
2s select an appropriate dosage for a given patient.
The ability to boost the antibody response is
another important result of this Example; indeed, an
increase in rabies antibody titers was obtained in every
subject after the 6 month dose whatever the immunization
3o scheme, showing that preexisting immunity elicited by
either the canarypox vector or the rabies glycoprotein
had no blocking effect on the booster with the
recombinant vaccine candidate or the conventional HDC
rabies vaccine. This contrasts findings of others with
3s vaccinia recombinants in humans that immune response may
be blocked by pre-existing immunity (Gooney et al.,
Lancet 1991, 337:567-72; Etlinger et al., Vaccine 9:470-
WO 94116716 215 3 3 3 6 pCTNS94/00888
81
72, 1991).
Thus, this Example clearly demonstrates that a non-'.
replicating poxvirus can serve as an immunizing vector inJ:
humans, with all of the advantages that replicating
s agents confer on the immune response, but without the
safety problem created by a fully permissive virus.
TABLE 11: Reactions in the 5 days following vaccination
to vCP65 dosage1Q3'5 104.5 l0s.s H
(TCID50) D
C
control
Injection 1 st 2nd 1 2nd 1 2nd 1 2nd
st st st
No. vaccinees3 3 3 3 9 9 10 10
temp > 37.7C0 0 0 0 0 1 1 0
15 soreness 0 0 1 1 6 8 8 6
redness 0 0 0 0 0 4 5 4 I
induration 0 0 0 0 0 4 5 4
WO 94/16716 PCTNS94l00888
82
c~~ TABLEl2: Rabieseutralizingantibodies (REFIT;U/ml) dual nd
geom n rs (GMT) I Indivi titers
etric a
mean
tite
Days
No. TCID50/dose0 7 28 35 56
1 103'5 < 0.1 < 0.1 < 0.1 < 0.1 0.2
3 103.5 < 0.1 < 0.1 < 0.1 < 0.1 < 0.1
4 103.5 < 0.1 < 0.1 < 0.1 < 0.1 < 0.1
G.M.T. < 0.1 < 0.1 < 0.1 < 0.1 < 0.1
6 104.5 < 0.1 < 0.1 < 0.1 < 0.1 < 0.1
7 104.s < 0.1 < 0.1 < 0.1 2.4 1.9
10 10'x.' < 0.1 < 0.1 < 0.1 1.6 1.1
G.M.T. < 0.1 < 0.1 0.1 0.58 0.47
11 105' < 0.1 < 0.1 1.0 3.2 4.3
13 10~' < 0.1 < 0.1 0.3 6.0 8.8
14 1055 < 0.1 < 0.1 0.2 2.1 9.4
17 a 105.5 < 0.1 < 0.1 < 0.1 1.2 2.5
18 105.5 < 0.1 < 0.1 0.7 8.3 12.5
105-'' < 0.1 < 0.1 < 0.1 0.3 3.7
21 105.5 < 0.1 < 0.1 0.2 2.6 3.9
2 0 23 105 5 < 0.1 < 0.1 < 0.1 1.7 4.2
105 5 < 0.1 < 0.1 < 0.1 0.6 0.9
G.M.T. < 0.1 < 0.1 0.16 1.9 4.4*
2 HDC < 0.1 < 0.1 0.8 7.1 7.2
5 HDC < 0.1 < 0.1 9.9 12.8 18.7
25 8 HDC < 0.1 < 0.1 12.7 21.1 16.5
9 HDC < 0.1 < 0.1 6.0 9.9 14.3
12 HDC < 0.1 < 0.1 5.0 9.2 25.3
15 HDC < 0.1 < 0.1 2.2 5.2 8.6
i6 HDC <: 0.1 < 0.1 2.7 7.7 20.7
19 HDC < 0.1 < 0.1 2.6 9.9 9.1
22 HDC < 0.1 < 0.1 1.4 8.6 6.6
24 HDC < 0.1 < 0.1 0.8 5.8 4.7
G.M.T. < 0.1 < 0.1 2.96 9.0 11.5*
N = u.um smaern ~ iest
WO 94116716
215 3 3 3 G ~T~S94100888
83
TABLE 13: Canarypox antibodies: ELISA Geometric Mean Titers*
Days
vCP65 dosage 0 7 28 35 56
TCID50/dose
1035 0.69 ND 0.76 ND 0.68
1045 0.49 0.45 0.56 0.63 0.87
105'5 0.38 0.38 0.77 1.42 1.63
HDC control 0.45 0.39 0.40 0.35 0.39
to
* optical density at 1 /25 dilution
WO 94/16716 , PCT/US94100888
84
Example 11 - COMPARISON OF THE LDSO OF ALVAC AND NYVAC
WITH VARIOUS VACCINIA VIRUS STRAINS
Mice. Male outbred Swiss Webster mice were
purchased from Taconic Farms (Germantown, NY) and
maintained on mouse chow and water ad libitum until use
at 3 weeks of age ("normal" mice). Newborn outbred Swiss
Webster mice were of both sexes and were obtained
following timed pregnancies performed by Taconic Farms.
1o All newborn mice used were delivered within a two day
period.
Viruses. ALVAC was derived by plaque purification
of a canarypox virus population and was prepared in
primary chick embryo fibroblast cells (CEF). Following
purification by centrifugation over sucrose density
gradients, ALVAC was enumerated for plaque forming units
in CEF cells. The WR(L) variant of vaccinia virus was
derived by selection of large plaque phenotypes of WR
(Panicali et al., 1981). The Wyeth New York State Board
of Health vaccine strain of vaccinia virus was obtained
from Pharmaceuticals Calf Lymph Type vaccine Dryvax,
control number 302001B. Copenhagen strain vaccinia virus
VC-2 was obtained from Institut Merieux, France.
Vaccinia virus strain NYVAC was derived from Copenhagen
VC-2. All vaccinia virus strains except the Wyeth strain
were cultivated in Vero African green monkey kidney
cells, purified by sucrose gradient density
centrifugation and enumerated for plaque forming units on
Vero cells. The Wyeth strain was grown in CEF cells and
3o enumerated in CEF cells.
Inoculations. Groups of 10 normal mice were
inoculated intracranially (ic) with 0.05 ml of one of
several dilutions of virus prepared by 10-fold serially
diluting the stock preparations in sterile phosphate-
buffered saline. In some instances, undiluted stock
virus preparation was used for inoculation.
Groups of 10 newborn mice, 1 to 2 days old, were
inoculated is similarly to the normal mice except that an
WO 94!16716
215 3 3 3 ~ pCT~S94100888
injection volume of 0.03 ml was used.
All mice were observed daily for mortality for a
period of 14 days (newborn mice) or 21 days (normal mice)
after inoculation. Mice found dead the morning following
5 inoculation were excluded due to potential death by
trauma.
The lethal dose required to produce mortality for
50% of the experimental population (LDSO) was determined
by the proportional method of Reed and Muench.
1o Comparison of the LDSO of ALVAC and NYVAC with
Various Vaccinia Virus Strains for Normal Youna Outbred
Mice by the is Route. In young, normal mice, the
virulence of NYVAC and ALVAC were several orders of
magnitude lower than the other vaccinia virus strains
15 tested (Table 14). NYVAC and ALVAC were found to be over
3,000 times less virulent in normal mice than the Wyeth
strain; over 12,500 times less virulent than the parental
VC-2 strain; and over 63,000,000 times less virulent than
the WR(L) variant. These results would suggest that
2o NYVAC is highly attenuated compared to other vaccinia
strains, and that ALVAC is generally nonvirulent for
young mice when administered intracranially, although
both may cause mortality in mice at extremely high doses
(3.85x10 PFUs, ALVAC and 3x108 PFUs, NYVAC) by an
25 undetermined mechanism by this route of inoculation.
Comparison of the LDSO of ALVAC and NYVAC with
Various Vaccinia Virus Strains for Newborn Outbred Mice
by the is Route. The relative virulence of 5 poxvirus
strains for normal, newborn mice was tested by titration
3o in an intracranial (ic) challenge model system (Table
15). With mortality as the endpoint, LDSO values
indicated that ALVAC is over 100,000 times less virulent
than the Wyeth vaccine strain of vaccinia virus; over
200,000 times less virulent than the Copenhagen VC-2
35 strain of vaccinia virus; and over 25,000,000 times less
virulent than the WR-L variant of vaccinia virus.
Nonetheless, at the highest dose tested, 6.3x10 PFUs,
WO 94/16716 PCT/US94100888
86
1000 mortality resulted. Mortality rates of 33.3% were
observed at 6.3x106 PFUs. The cause of death, while not
actually determined, was not likely of toxicological or
traumatic nature since the mean survival time (MST) of
mice of the highest dosage group (approximately 6.3 LDSO)
was 6.7 ~ 1.5 days. When compared to WR(L) at a
challenge dose of 5 LDSO, wherein MST is 4.8 ~ 0.6 days,
the MST of ALVAC challenged mice was significantly longer
(P=0.001).
1o Relative to NYVAC, Wyeth was found to be over 15,000
times more virulent; VC-2, greater than 35,000 times more
virulent; and WR(L), over 3,000,000 times more virulent.
Similar to ALVAC, the two highest doses of NYVAC, 6x108
and 6x10 PFUs, caused 1000 mortality. However, the MST
i5 of mice challenged with the highest dose, corresponding
to 380 LD5o, was only 2 days (9 deaths on day 2 and 1 on
day 4). In contrast, all mice challenged with the
highest dose of WR-L, equivalent to 500 LDSO, survived to
day 4.
WO 94/16716 21 ~ 3 3 ~ ~ ~~594/00888
87
Table 14. Calculated 50% Lethal Dose for mice by various vaccinia
virus
strains and for canarypox virus
(ALVAC) by the is route.
POXVIRUS CALCULATED
STRAIN LDP (PFUs)
WR(L) 2.5
VC-2 1.26x10
io
WYETH 5.00x10'
NYVAC 1.58x108
ALVAC 1.58x108
Table 15. Calculated 50% Lethal Dose for newborn mice by various vaccinia
virus strains and
for canarypox virus
(ALVAC) by the is
route.
POXVIRUS CALCULATED
STRAIN LDSO (PFUs)
WR(L) 0.4
3 o VC-2 0.1
WYETH 1.6
NYVAC 1.58x10
ALVAC 1.00x10'
CA 02153336 2003-02-18
77396-19
88
FxamDle Z2 - EVALDATION O$ PYVAC (vP866y AND NYQAC-RG
(vP879)
~mmuno8recinitatzons. Preformed monalayers of avian
or non-avian cells were inoculated with l0 pfu per cell
of parental NYVAC (vp866) or NYVAC-RG (vP879) virus. The
inoculation was performed in EME'~i free of methionine awd
supplemented wit.' 2 j dialyzed fetal bovine serum. After
a one hour incubat:.on , the inoculum was removed and the
1o medium replaced with E~ (methionine free) containing 20
~Ci/ml of 35S-methionine. After an overnight incubation
of approximately ~6 hours, cells were lysed by the
addition of Buffer A (1a NGnidet P-40, 10 mM Tris pH7.4,
150 mM NaCl ,, ? ~nM ~DTA, 0. t; I ~ scd:.um azide, 500 uni is per
is ml of aprcti.-~n, and 0.0~~ phenyl met:'~y1 sulfonyl
fluoride). Immunoprecipitation was performed using a
rabies glycoproteiz speci.i.c monoclonal antibody
designated 24-3F10 supplied by Dr. C. Trinarchi, Griff ith
Laboratories, New York State Department of Health,
zo Albany, New York, and a rat anti-mouse conjugate obtained
from Boehri.nger Mannheim Corporation (Cat. X605-500).
Protein A Sepharose CL-43 obtained from Pharmacia LKB
Biotechnology Inc., Piscataway, New Jersey, was used as a
suppor t mat:-ix . L;~:.iunoprQcipi t3t2S Wer a fr ac tionated on
25 10% palyacrylami~~e gels according to the method of
Dreyfuss et. al. (.984). ~e!s were fixed, treated far
fluoragraphy wi~~h 1M Na-salicylate for one hour, and
exposed to Kodak XAR-~ film to visualize the
immunoprecipitated protein species.
3o Seu~ces of Animals. New Zealand White rabbits were
obtained from Hare-Marland (Hewitt, New Jersey). Three
week old male Swiss Webst~r autbred mice, timed pregnant
female Swiss We~~ste= outbr=_d mice, and four week oLd
Swiss wecstsr nude (nu nu mice were obtained from
3~ Taconic Far,:~s, inc. (Ge;~nant~wn, Ne~H Yor:~c) . A' 1 arn:rals
were maintained according to NIH guvdelroes. All aE~imal
prctocpls were approved by the ir.stit::tiora'_ IAC~C. Whet
deemed necessary%, trice which were obv~'_ousl~~~ terminally
* . y ode - max:c
WO 94/16716 PC'T/US94/00888
2153335
89
ill were euthanized.
Evaluation of Lesions in Rabbits. Each of two
rabbits was inoculated intradermally at multiple sites
with 0.1 ml of PBS containing 104, 105, 106, 10~, or 108
pfu of each test virus or with PBS alone. The rabbits
were observed daily from day 4 until lesion resolution.
Indurations and ulcerations were measured and recorded.
Virus Recovery from Inoculation Sites. A single
rabbit was inoculated intradermally at multiple sites of
1o 0/1 ml of PBS containing 106, 10~, or 108 pfu of each test
virus or with PBS alone. After 11 days, the rabbit was
euthanized and skin biopsy specimens taken from each of
the inoculation sites were aseptically prepared by
mechanical disruption and indirect sonication for virus
recovery. Infectious virus was assayed by plaque
titration on CEF monolayers.
Virulence in Mice. Groups of ten mice, or five in
the nude mice experiment, were inoculated ip with one of
several dilutions of virus in 0.5 ml of sterile PBS.
2o Reference is also made to Example 11.
Cyclophosphamide ICY) Treatment. Mice were injected
by the ip route with 4 mg (0.02 ml) of CY (SIGMA) on day
-2, followed by virus injection on day 0. On the
following days post infection, mice were injected ip with
CY: 4 mg on day 1; 2 mg on days 4, 7 and 11; 3 mg on days
14, 18, 21, 25 and 28. Immunosuppression was indirectly
monitored by enumerating white blood cells with a Coulter
Counter on day 11. The average white blood cell count
was 13,500 cells per ~1 for untreated mice (n=4) and
4,220 cells per ~,l for CY-treated control mice (n=5).
Calculation of LDSO. The lethal dose required to
produce 50% mortality (LDSO) was determined by the
proportional method of Reed and Muench (Reed and Mu~ench
1938 ) .
Potency Testing of NYVAC-RG in Mice. Four to six
week old mice were inoculated in the footpad with 50 to
100 ~,1 of a range of dilutions (2.0 - 8.0 loglo tissue
WO 94/16716 PCT/US94100888
culture infective dose 50% (TCIDSO)) of either VV-RG
(Kieny et al., 1984), ALVAC-RG (Taylor et al., 1991b), or
the NYVAC-RG. Each group consisted of eight mice. At 14
days post-vaccination, the mice were challenged by
s intracranial inoculation with 15 LDSO of the rabies virus -
CVS strain (0.03 ml). On day 28, surviving mice were
counted and protective does 50% (PDSO) calculated.
Derivation of NYVAC (vP866). The NYVAC strain of
vaccinia virus was generated from VC-2, a plaque cloned
1o isolate of the COPENHAGEN vaccine strain. To generate
NYVAC from VC-2, eighteen vaccinia ORFs, including a
number of viral functions associated with virulence, were
precisely deleted in a series of sequential manipulations
as described earlier in this disclosure. These deletions
1s were constructed in a manner designed to prevent the
appearance of novel unwanted open reading frames. FIG.
10 schematically depicts the ORFs deleted to generate
NYVAC. At the top of FIG. 10 is depicted the HindIII
restriction map of the vaccinia virus genome (VC-2 plaque
20 isolate, COPENHAGEN strain). Expanded are the six
regions of VC-2 that were sequentially deleted in the
generation of NYVAC. The deletions were described
earlier in this disclosure (Examples 1 through 6). Below
such deletion locus is listed the ORFs which were deleted
2s from that locus, along with the functions or homologies
and molecular weight of their gene products.
Replication Studies of NYVAC and ALVAC on Human
Tissue Cell Lines. In order to determine the level of
replication of NYVAC strain of vaccinia virus (vP866) in
3o cells of human origin, six cell lines were inoculated at
an input multiplicity of 0.1 pfu per cell under liquid
culture and incubated for 72 hours. The COPENHAGEN
parental clone (VC-2) was inoculated in parallel.
Primary chick embryo fibroblast (CEF) cells (obtained
3s from 10-11 day old embryonated eggs of SPF origin,
Spafas, Inc., Storrs, CT) were included to represent a
permissive cell substrate for all viruses. Cultures were
WO 94/16716 215 3 3 3 ~ ~T~S94100888
91
analyzed on the basis of two criteria: the occurrence of
productive viral replication and expression of an
extrinsic antigen. r-
The replication potential of NYVAC in a number of
human derived cells are shown in Table 16. Both VC-2 and
NYVAC are capable of productive replication in CEF cells,
although NYVAC with slightly reduced yields. VC-2 is
also capable of productive replication in the six human
derived cell lines tested with comparable yields except
to in the EBV transformed lymphoblastoid cell line JT-1
(human lymphoblastoid cell line transformed with Epstein-
Barr virus, see Rickinson et al., 1984). In contract,
NYVAC is highly attenuated in its ability to productively
replicate in any of the human derived cell lines tested.
Small increases of infectious virus above residual virus
levels were obtained from NYVAC-infected MRC-5 (ATCC
#CCL171, human embryonic lung origin), DETROIT 532 (ATCC
#CCL54, human foreskin, Downs Syndrome), HEL 299 (ATCC
#CCL137, human embryonic lung cells) and HNK (human
2o neonatal kidney cells, Whittiker Bioproducts, Inc.
Walkersville, MD, Cat #70-151) cells. Replication on
these cell lines was significantly reduced when compared
to virus yields obtained from NYVAC-infected CEF cells or
with parental VC-2 (Table 16). It should be noted that
the yields at 24 hours in CEF cells for both NYVAC and
VC-2 is equivalent to the 72-hour yield. Allowing the
human cell line cultures to incubate an additional 48
hours (another two viral growth cycles) may, therefore,
have amplified the relative virus yield obtained.
3o Consistent with the low levels of virus yields
obtained in the human-derived cell lines, MRC-5 and
DETROIT 532, detectable but reduced levels of NYVAC-
specific DNA accumulation were noted. The level of DNA
accumulation in the MRC-5 and DETROIT 532 NYVAC-infected
cell lines relative to that observed in NYVAC-infected
CEF cells paralleled the relative virus yields. NYVAC-
specific viral DNA accumulation was not observed in~any
WO 94116716 " , PCTIUS94/00888
of the other human-derived cells.
An equivalent experiment was also performed using
~t the avipox virus, ALVAC. The results of virus
replication are also shown in Table 16. No progeny virus
s was detectable in any of the human cell lines consistent
with the host range restriction of canarypox virus to
avian species. Also consistent with a lack of productive
replication of ALVAC in these human-derived cells is the
observation that no ALVAC-specific DNA accumulation was
1o detectable in any of the human-derived cell lines.
Expression of Rabies Glycoprotein by NYVAC-RG
1vP879) in Human Cells. In order to determine whether
efficient expression of a foreign gene could be obtained
in the absence of significant levels of productive viral
is replication, the same cell lines were inoculated with the
NYVAC recombinant expressing the rabies virus
glycoprotein (vP879, Example 7) in the presence of 35S-
methionine. Immunoprecipitation of the rabies
glycoprotein was performed from the radiolabelled culture
20 lysate using a monoclonal antibody specific for the
rabies glycoprotein. Immunoprecipitation of a 67kDa
protein was detected consistent with a fully glycosylated
form of the rabies glycoprotein. No serologically
crossreactive product was detected in uninfected or
2s parental NYVAC infected cell lysates. Equivalent results
were obtained with all other human cells analyzed.
Inoculations on the Rabbit Skin. The induction and
nature of skin lesions on rabbits following intradermal
(id) inoculations has been previously used as a measure
30 of pathogenicity of vaccinia virus strains (Buller et
al., 1988; Child et al., 1990; Fenner, 1958, Flexner et
al., 1987; Ghendon and Chernos 1964). Therefore, the
nature of lesions associated with id inoculations with
the vaccinia strains WR (ATCC #VR119 plaque purified on
3s CV-1 cells, ATCC #CCL70, and a plaque isolate designated
L variant, ATCC #VR2035 selected, as described in
Panicali et al., 1981)), WYETH (ATCC #VR325 marketed as
WO 94/16716 215 3 3 3 6 ~TNS94100888
93
DRYVAC by Wyeth Laboratories, Marietta, PA), COPENHAGEN
(VC-2), and NYVAC was evaluated by inoculation of two
rabbits (A069 and A128). The two rabbits displayed
different overall sensitivities to the viruses, with
rabbit A128 displaying less severe reactions than rabbit
A069. In rabbit A128, lesions were relatively small and
resolved by 27 days post-inoculation. On rabbit A069,
lesions were intense, especially for the WR inoculation
sites, and resolved only after 49 days. Intensity of the
to lesions was also dependent on the location of the
inoculation sites relative to the lymph drainage network.
In particular, all sites located above the backspine
displayed more intense lesions and required longer times
to resolve the lesions located on the flanks. All
lesions were measured daily from day 4 to the
disappearance of the last lesion, and the means of
maximum lesion size and days to resolution were
calculated (Table 17). No local reactions were observed
from sites injected with the control PBS. Ulcerative
lesions were observed at sites injected with WR, VC-2 and
WYETH vaccinia virus strains. Significantly, no
induration or ulcerative lesions were observed at sites
of inoculation with NYVAC.
Persistence of Infectious Virus at the Site of
Inoculation. To assess the relative persistence of these
viruses at the site of inoculation, a rabbit was
inoculated intradermally at multiple sites with 0.1 ml
PBS containing 106, 10~ or 108 pfu of VC-2, WR, WYETH or
NYVAC. For each virus, the 10~ pfu dose was located above
3o the backspine, flanked by the 106 and 108 doses. Sites of
inoculation were observed daily for 11 days. WR elicited
the most intense response, followed by VC-2 and WYETH
(Table 18). Ulceration was first observed at day 9 for
WR and WYETH and day 10 for VC-2. Sites inoculated with
NYVAC or control PBS displayed no induration or
ulceration. At day 11 after inoculation, skin samples
from the sites of inoculation were excised, mechanically
WO 94116716 PCTIUS94/00888
94
disrupted, and virus was titrated on CEF cells. The
results are shown in Table 18. In no case was more virus
recovered at this timepoint than was administered.
Recovery of vaccinia strain, WR, was approximately 106
s pfu of virus at each site irrespective of amount of virus
administered. Recovery of vaccinia strains WYETH and VC-
2 was 103 to 104 pfu regardless of amount administered.
No infectious virus was recovered from sites inoculated
with NYVAC.
1o Inoculation of Genetically or Chemically Immune
Deficient Mice. Intraperitoneal inoculation of high
doses of NYVAC (5 X 108 pfu) or ALVAC (109 pfu) into nude
mice caused no deaths, no lesions, and no apparent
disease through the 100 day observation period. In
15 contrast, mice inoculated with WR (103 to 104 pfu), WYETH
(5 x log or 5 x 108 pfu) or VC-2 (104 to 109 pfu)
displayed disseminated lesions typical of poxviruses
first on the toes, then on the tail, followed by severe
orchitis in some animals. In mice infected with WR or
2o WYETH, the appearance of disseminated lesions generally
led to eventual death, whereas most mice infected with
VC-2 eventually recovered. Calculated LDso values are
given in Table 19.
In particular, mice inoculated with VC-2 began to
2s display lesions on their toes (red papules) and 1 to 2
days later on the tail. These lesions occurred between
11 and 13 days post-inoculation (pi) in mice given the
highest doses (109, 108, 10~ and 106 pfu), on day 16 pi in
mice given los pfu and on day 21 pi in mice given 104 pfu.
3o No lesions were observed in mice inoculated with 103 and
102 pfu during the 100 day observation period. Orchitis
was noticed on day 23 pi in mice given 109 and 108 pfu,
and approximately 7 days later in the other groups (10~ to
io4 pfu). Orchitis was especially intense in the 109 and
3s 108 pfu groups and, although receding, was observed until
the end of the 100 day observation period. Some pox-like
lesions were noticed on the skin of a few mice, occurring
WO 94/16716 215 3 3 3 5 P~~S94100888
around 30-35 days pi. Most pox lesions healed normally,
between GO-90 days pi. Only one mouse died in the group
inoculated with 109 pfu (Day 34 pi) and one mouse died in.
the group inoculated with 108 pfu (Day 94 pi). No other
5 deaths were observed in the VC-2 inoculated mice.
Mice inoculated with 104 pfu of the WR strain of
vaccinia started to display pox lesions on Day 17 pi.
These lesions appeared identical to the lesions displayed
by the VC-2 injected mice (swollen toes, tail). Mice
to inoculated with 103 pfu of the WR strain did not develop
lesions until 34 days pi. Orchitis was noticed only in
the mice inoculated with the highest dose of WR (104
pfu). During the latter stages of the observation
period, lesions appeared around the mouth and the mice
1s stopped eating. All mice inoculated with 104 pfu of WR
died or were euthanized when deemed necessary between 21
days and 31 days pi. Four out of the 5 mice injected
with 103 pfu of WR died or were euthanized when deemed
necessary between 35 days and 57 days pi. No deaths were
20 observed in mice inoculated with lower doses of WR (1 to
100 pfu).
Mice inoculated with the WYETH strain of vaccinia
virus at higher doses 5 x 10~ and 5 x 108 pfu) showed
lesions on toes and tails, developed orchitis, and died.
25 Mice injected with 5 x 106 pfu or less of WYETH showed no
signs of disease or lesions.
As shown in Table 19, CY-treated mice provided a
more sensitive model for assaying poxvirus virulence than
did nude mice. LDSO values for the WR, WYETH, and VC-2
3o vaccinia virus strains were significantly lower in this
model system than in the nude mouse model. Additionally,
lesions developed in mice injected with WYETH, WR and VC-
2 vaccinia viruses, as noted below, with higher doses of
each virus resulting in more rapid formation of lesions.
35 As was seen with nude mice, CY-treated mice injected with
NYVAC or ALVAC did not develop lesions. However, unlike
nude mice, some deaths were observed in CY-treated mice
WO 94/16716 PCT/US94I00888
96
challenged with NYVAC or ALVAC, regardless of the dose.
These random incidences are suspect as to the cause of
death.
Mice injected with all doses of WYETH (9.5 x 104 to
9.5 x 108 pfu) displayed pox lesions on their tail and/or
on their toes between 7 and 15 days pi. In addition, the
tails and toes were swollen. Evolution of lesions on the
tail was typical of pox lesions with formation of a
papule, ulceration and finally formation of a scab. Mice
1o inoculated with all doses of VC-2 (1.65 x 105 to 1.65 x
109) also developed pox lesions on their tails and/or
their toes analogous to those of WYETH injected mice.
These lesions were observed between 7-12 days post
inoculation. No lesions were observed on mice injected
is with lower doses of WR virus, although deaths occurred in
these groups.
Potency Testinq of NYVAC-RG. In order to determine
that attenuation of the COPENHAGEN strain of vaccinia
virus had been effected without significantly altering
2o the ability of the resulting NYVAC strain to be a useful
vector, comparative potency tests were performed. In
order to monitor the immunogenic potential of the vector
during the sequential genetic manipulations performed to
attenuate the virus, a rabiesvirus glycoprotein was used
25 as a reporter extrinsic antigen. The protective efficacy
of the vectors expressing the rabies glycoprotein gene
was evaluated in the standard NIH mouse potency test for
rabies (Seligmann, 1973). Table 20 demonstrates that the
PDSO values obtained with the highly attenuated NYVAC
3o vector are identical to those obtained using a
COPENHAGEN-based recombinant containing the rabies
glycoprotein gene in the tk locus (Kieny et al., 1984)
and similar to PDSO values obtained with ALVAC-RG, a
canarypox based vector restricted to replication to avian
35 species.
Observations. NYVAC, deleted of known virulence
genes and having restricted in vitro growth
WO 94/16716 21 ~ 3 3 3 6 ~T~S94100888
97
characteristics, was analyzed in animal model systems to-~
assess its attenuation characteristics. These studies
were performed in comparison with the neurovirulent
vaccinia virus laboratory strain, WR, two vaccinia virus
vaccine strains, WYETH (New York City Board of Health)
and COPENHAGEN (VC-2), as well as with a canarypox virus
strain, ALVAC (See also Example 11). Together, these
viruses provided a spectrum of relative pathogenic
potentials in the mouse challenge model and the rabbit
1o skin model, with WR being the most virulent strain, WYETH
and COPENHAGEN (VC-2) providing previously utilized
attenuated vaccine strains with documented
characteristics, and ALVAC providing an example of a
poxvirus whose replication is restricted to avian
species. Results from these in vivo analyses clearly
demonstrate the highly attenuated properties of NYVAC
relative to the vaccinia virus strains, WR, WYETH and
COPENHAGEN (VC-2) (Tables 14-20). Significantly, the LD5o
values for NYVAC were comparable to those observed with
2o the avian host restricted avipoxvirus, ALVAC. Deaths due
to NYVAC, as well as ALVAC, were observed only when
extremely high doses of virus were administered via the
intracranial route (Example 11, Tables 14, 15, 19). It
has not yet been established whether these deaths were
due to nonspecific consequences of inoculation of a high
protein mass. Results from analyses in immunocompromised
mouse models (nude and CY-treated) also demonstrate the
relatively high attenuation characteristics of NYVAC, as
compared to WR, WYETH and COPENHAGEN strains (Tables 17
3o and 18). Significantly, no evidence of disseminated
- vaccinia infection or vaccinial disease was observed in
NYVAC-inoculated animals or ALVAC-inoculated animals over
the observation period. The deletion of multiple
virulence-associated genes in NYVAC shows a synergistic
3s effect with respect to pathogenicity. Another measure of
the innocuity of NYVAC was provided by the intradermal
administration on rabbit skin (Tables 17 and 18).
WO 94/16716 PCT/US94/00888
98
,~~ Considering the results with ALVAC, a virus unable to
replicate in nonavian species, the ability to replicate
at the site of inoculation is not the sole correlate with
reactivity, since intradermal inoculation of ALVAC caused
s areas of induration in a dose dependent manner.
Therefore, it is likely that factors other than the
replicative capacity of the virus contribute to the
formation of the lesions. Deletion of genes in NYVAC
prevents lesion occurrence.
1o Together, the results in this Example and in
foregoing Examples, including Example 11, demonstrate the
highly attenuated nature of NYVAC relative to WR, and the
previously utilized vaccinia virus vaccine strains, WYETH
and COPENHAGEN. In fact, the pathogenic profile of
15 NYVAC, in the animal model systems tested, was similar to
that of ALVAC, a poxvirus known to productively replicate
only in avian species. The apparently restricted
capacity of NYVAC to productively replicate on cells
derived from humans (Table 16) and other species,
2o including the mouse, swine, dog and horse, provides a
considerable barrier that limits or prevents potential
transmission to unvaccinated contacts or to the general
environment in addition to providing a vector with
reduced probability of dissemination within the
25 vaccinated individual.
Significantly, NYVAC-based vaccine candidates have
been shown to be efficacious. NYVAC recombinants
expressing foreign gene products from a number of
pathogens have elicited immunological responses towards
3o the foreign gene products in several animal species,
including primates. In particular, a NYVAC-based
recombinant expressing the rabies glycoprotein was able
to protect mice against a lethal rabies challenge. The
potency of the NYVAC-based rabies glycoprotein
35 recombinant was comparable to the PDSO value for a
COPENHAGEN-based recombinant containing the rabies
glycoprotein in the tk locus (Table 20). NYVAC-based
WO 94!16716 21 ~ 3 3 3 fi PCT~S94/00888
99
recombinants have also been shown to elicit measles virus r
neutralizing antibodies in rabbits and protection against
pseudorabies virus and Japanese encephalitis virus
challenge in swine. The highly attenuated NYVAC strain
s confers safety advantages with human and veterinary
applications (Tartaglia et al., 1990). Furthermore, the
use of NYVAC as a general laboratory expression vector
system may greatly reduce the biological hazards
associated with using vaccinia virus.
1o By the following criteria, the results of this
Example and the Examples herein, including Example 11,
show NYVAC to be highly attenuated: a) no detectable
induration or ulceration at site of inoculation (rabbit
skin); b) rapid clearance of infectious virus from
15 intradermal site of inoculation (rabbit skin); c) absence
of testicular inflammation (nude mice); d) greatly
reduced virulence (intracranial challenge, both three-
week old and newborn mice); e) greatly reduced
pathogenicity and failure to disseminate in
2o immunodeficient subjects (nude and cyclophosphamide
treated mice); and f) dramatically reduced ability to
replicate on a variety of human tissue culture cells.
Yet, in spite of being highly attenuated, NYVAC, as a
vector, retains the ability to induce strong immune
25 responses to extrinsic antigens.
WO 94/16716 : . PCTIUS94100888
loo
TABLE Replication
16 of COPENHAGEN
(VC-2),
NYVAC and
ALVAC in
avian or human ines
derived
cell
l
Cells Hours post- Yields % Yield
infection
VC-2 NYVAC ALVAC
s CEF 0 3.8 3.7 4.5
24 8.3 7.8 6.6
48 8.6 7.9 7.7
72 8.3 7.7 7.5 25
72A' < 1.8 3.1
1.4
io MRC-5 0 3.8 3.8 4.7
72 7.2 4.6 3.8 0.25
72A 2.2 2.2 3.7
WISH 0 3.4 3.4 4.3
72 7.6 2.2 3.1 0.0004
1 72A -d 1.9 2.9
s
DETROIT 0 3.8 3.7 4.4
72 7.2 5.4 3.4 1.6
72A 1.7 1.7 2.9
HEL 0 3.8 3.5 4.3
2 72 7.5 4.6 3.3 0.125
0
72A 2.5 2.1 3.6
JT-1 0 3.1 3.1 4.1
72 6.5 3.1. 4.2 0.039
72A 2.4 2.1 4.4
2s HNK 0 3.8 3.7 4.7
72 7.6 4.5 3.6 0.079
72A 3.1 2.7 3.7
a: Yield of NYVAC at 72 hours post-infection expressed as a percentage of
3o yield of VAC-2 after 72 hours on the same cell line.
b: Titer expressed as LOGso pfu per ml.
c: Sample was incubated in the presence of 40~g/ml of cytosine arabinoside.
d: Not determined.
*: ATCC #CCL25 Human amnionic cells.
WO 94/16716 215 3 3 3 ~ PCT/US94/00888
101
Table 17. Induration and ulceration at the site of
intradermal inoculation of the rabbit skin
INDURA TION ULCER ATION
VIRUS DOSEa
STRAIN Sizeb Days' Size Days
WR 104 386 30 88 30
105 622 35 149 32
106 1057 34 271 34
10' 877 35 204 35
108 581 25 88 26
WYETH 10 32 5 --d --
105 116 15 __ __
10~' 267 17 3 15
10~ 202 17 3 24
10s 240 29 12 31
VC-2 10 64 7 -- --
105 86 8 __ __
10~ 136 17 -- --
10~ 167 21 6 10
108 155 32 6 8
NYVAC 10 -- -- -- --
__ __ __ __
10s __ __ __ __
2 5 10~ __ __ __ __
1OA __ __ __ __
a pfu of indicated vaccinia virus in 0.1 ml PBS inoculated intradermally into
one site.
h mean maximum size of lesions (mm2~
' mean time after inoculation for complete healing of lesion.
" no lesions discernable.
WO 94/16716 PCTIUS94I00888
~"a io2
Table 18. Persistence of poxviruses at the site of intradermal
inoculation
Virus Inoculum Dose Total Virus Recovered
s W R 8.08 6.14
7.0 6.26
6.0 6.21
WYETH 8.0 3.66
7.0 4.10
i 6.0 3.59
o
VC-2 8.0 4.47
7.0 4.74
6.0 3.97
NYVAC 8.0 0
15 7.0 0
6.0 0
a: expressed as logo pfu.
215~33f
WO 94/16716 PCTlUS94/00888
103
Table 19. Virulence studies in immunocompromised mice
POxviruS LDsoa
Strain
Nude mice Cyclophosphamide
treated mice
s W R 422 42
VC-2 > 109 < 1.65 x 10''
WYETH 1.58 x 10' 1.83 x 106
NYVAC > 5.50 x 108 7.23 x 108
ALVAC > 109 25.00 x 108
to
a: Calculated 50% lethal dose (pfu) for nude or cyclophosphamide treated
mice by the indicated vaccinia viruses and for ALVAC by intraperitoneal
route.
is b: 5 out of 10 mice died at the highest dose of 5 x 108 pfu.
2o Table 20. Comparative efficacy of NYVAC-RG and ALVAC-RG in mice
Recombinant PDsoa
W-RG 3.74
ALVAC-RG 3.86
2 NYVAC-RG 3.70
a: Four to six week old mice were inoculated in the footpad with 50-1001 of a
range of dilutions (2.0 - 8.0 logo tissue culture infection dose 50% (TCIDso)
of either the W-RG (Kieny et al., 1984), ALVAC-RG (vCP65) or NYVAC-RG
30 (vP879). At day 14, mice of each group were challenged by intracranial
inoculation of 301 of a live CVS strain rabies virus corresponding to 15
lethal dose 50% (LDSO) per mouse. At day 28, surviving mice were counted
and a protective dose 50% (PDso) was calculated.
WO 94/16716 PCT/US94100888
io4
Example 13 - CONSTRUCTION OF TROVAC RECOMBINANTS
C1' EXPRESSING THE HEMAGGLUTININ GLYCOPROTEINS
OF AVIAN INFLUENZA VIRUSES
s This Example describes the development of fowlpox
virus recombinants expressing the hemagglutinin genes of
three serotypes of avian influenza virus.
Cells and Viruses. Plasmids containing cDNA clones
of the H4, H5 and H7 hemagglutinin genes were obtained
1o from Dr. Robert Webster, St. Jude Children's Research
Hospital, Memphis, Tennessee. The strain of FPV
designated FP-1 has been described previously (Taylor et
al., 1988a, b). It is a vaccine strain useful in
vaccination of day old chickens. The parental virus
15 strain Duvette was obtained in France as a fowlpox scab
from a chicken. The virus was attenuated by
approximately 50 serial passages in chicken embryonated
eggs followed by 25 passages on chick embryo fibroblast
(CEF) cells. This virus was obtained in September 1980
2o by Rhone Merieux, Lyon, France, and a master viral seed
established. The virus was received by Virogenetics in
September 1989, where it was subjected to four successive
plaque purifications. One plaque isolate was further
amplified in primary CEF cells and a stock virus,
2s designated as TROVAC, was established. The stock virus
used in the in vitro recombination test to produce
TROVAC-AIH5 (vFP89) and TROVAC-AIH4 (vFP92) had been
further amplified though 8 passages in primary CEF cells.
The stock virus used to produce TROVAC-AIH7 (vFP100) had
3o been further amplified through 12 passages in primary CEF
cells.
Construction of Fowlpox Insertion Plasmid at F8
Locus. Plasmid pRW731.15 contains a 10 kbp PvuII-PvuII
fragment cloned from TROVAC genomic DNA. The nucleotide
3s sequence was determined on both strands for a 3659 by
PvuII-EcoRV fragment. This sequence is shown in FIG. 11
(SEQ ID N0:77). The limits of an open reading frame
designated in this laboratory as F8 were determined
within this sequence. The open reading frame is
_ WO 94/16716 ~ ~ ~ ,~ PCT/US94100888
105
initiated at position 495 and terminates at position w
1887. A deletion was made from position 779 to position
1926, as described below. '~..r
Plasmid pRW761 is a sub-clone of pRW731.15
containing a 2430 by EcoRV-EcoRV fragment. Plasmid
pRW761 was completely digested with XbaI and partially
digested with SSnI. A 3700 by XbaI-SSpI band was
isolated and ligated with the annealed double-stranded
oligonucleotides JCA017 (SEQ ID N0:37) and JCA018 (SEQ ID
l0 N0:38) .
JCA017 (SEO ID N0:37) 5' CTAGACACTTTATGTTTTTTAATATCCGGTCTT
AAAAGCTTCCCGGGGATCCTTATACGGGGAATAAT 3'
JCA018 (SEO ID N0:38) 5' ATTATTCCCCGTATAAGGATCCCCCGGGAA
GCTTTTAAGACCGGATATTAAAAAACATAAAGTGT 3'
The plasmid resulting from this ligation was
designated pJCA002. Plasmid pJCA004 contains a non-
pertinent gene linked to the vaccinia virus H6 promoter
in plasmid pJCA002. The sequence of the vaccinia virus
H6 promoter has been previously described (Taylor et al.,
1988a, b; Guo et al. 1989; Perkus et al., 1989). Plasmid
pJCA004 was digested with EcoRV and BamHI which deletes
the non-pertinent gene and a portion of the 3' end of the
H6 promoter. Annealed oligonucleotides RW178 (SEQ ID
N0:48) and RW179 (SEQ ID N0:49) were cut with EcoRV and
BamHI and inserted between the EcoRV and BamHI sites of
JCA004 to form pRW846.
RW178 (SEO ID N0:48): 5' TCATTATCGCGATATCCGTGTTAACTAGCTA
GCTAATTTTTATTCCCGGGATCCTTATCA 3'
RW179 (SEC? ID N0:49): 5' GTATAAGGATCCCGGGAATAAAAATTAGCT
3o AGCTAGTTAACACGGATATCGCGATAATGA 3'
Plasmid pRW846 therefore contains the H6 promoter 5' of
EcoRV in the de-ORFed F8 locus. The HincII site 3' of
the H6 promoter in pRW846 is followed by translation stop
codons, a transcriptional stop sequence recognized by
vaccinia virus early promoters (Yuen et al., 1987) and a
SmaI site.
WO 94116716 ~ PCT/US94I00888
1o6
Construction of Fowlt~ox Insertion Plasmid at F7
Locus. The original F7 non-de-ORFed insertion plasmid,
pRW731.13, contained a 5.5 kb FP genomic PvuII fragment
in the PvuII site of pUC9. The insertion site was a
unique HincII site within these sequences. The
nucleotide sequence shown in FIG. 12 (SEQ ID N0:78) was
determined for a 2356 by region encompassing the unique
HincII site. Analysis of this sequence revealed that the
unique HincII site (FIG. 12, underlined) was situated
1o within an ORF encoding a polypeptide of 90 amino acids.
The ORF begins with an ATG at position 1531 and
terminates at position 898 (positions marked by arrows in
FIG . 12 ) .
The arms for the de-ORFed insertion plasmid were
derived by PCR using pRW731.13 as template. A 596 by
arm (designated as HB) corresponding to the region
upstream from the ORF was amplified with oligonucleotides
F73PH2 (SEQ ID N0:50) (5'-GACAATCTAAGTCCTATATTAGAC-3')
and F73PB (SEQ ID N0:51) (5'-GGATTTTTAGGTAGACAC-3'). A
270 by arm (designated as EH) corresponding to the region
downstream from the ORF was amplified using
oligonucleotides F75PE (SEQ ID N0:52) (5'-
TCATCGTCTTCATCATCG-3') and F73PH1 (SEQ ID N0:53) (5'-
GTCTTAAACTTATTGTAAGGGTATACCTG-3').
Fragment EH was digested with EcoRV to generate a
126 by fragment. The EcoRV site is at the 3'-end and the
5'-end was formed, by PCR, to contain the 3' end of a
HincII site. This fragment was inserted into pBS-SK
(Stratagene, La Jolla, CA) digested with HincII to form
3o plasmid pF7Dl. The sequence was confirmed by
dideoxynucleotide sequence analysis. The plasmid pF7D1
was linearized with ApaI, blunt-ended using T4 DNA
polymerase, and ligated to the 596 by HB fragment. The
resultant plasmid was designated as pF7D2. The entire
sequence and orientation were confirmed by nucleotide
sequence analysis.
The plasmid pF7D2 was digested with EcoRV and BglII
WO 94/16716 21 ~ 3 ~ 3 ~ ~T~S94/00888
107
to generate a 600 by fragment. This fragment was
inserted into pBS-SK that was digested with ApaI, blunt-
ended with T4 DNA polymerase, and subsequently digested
with BamHI. The resultant plasmid was designated as
pF7D3. This plasmid contains an HB arm of 404 by and a
EH arm of 126 bp.
The plasmid pF7D3 was linearized with XhoI and
blunt-ended with the Klenow fragment of the E. coli DNA
polymerase in the presence of 2mM dNTPs. This linearized
to plasmid was ligated with annealed oligonucleotides F7MCSB
(SEQ ID N0:54) (5'-
AACGATTAGTTAGTTACTAAAAGCTTGCTGCAGCCCGGGTTTTTTATTAGTTTAGTT
AGTC-3') and F7MCSA (SEQ ID N0:55) (5'-
GACTAACTAACTAATAAAAAA
CCCGGGCTGCAGCAAGCTTTTTGTAACTAACTAATCGTT-3'). This was
performed to insert a multiple cloning region containing
the restriction sites for HindIII, PstI and SmaI between
the EH and HB arms. The resultant plasmid was designated
as pF7D0.
2o Construction of Insertion Plasmid for the H4
Hemaaalutinin at the F8 Locus. A cDNA copy encoding the
avian influenza H4 derived from A/Ty/Min/833/80 was
obtained from Dr. R. Webster in plasmid pTM4H833. The
plasmid was digested with HindIII and NruI and blunt-
ended using the Klenow fragment of DNA polymerase in the
presence of dNTPs. The blunt-ended 2.5 kbp HindIII-NruI
fragment containing the H4 coding region was inserted
into the HincII site of pIBI25 (International
Biotechnologies, Inc., New Haven, CT). The resulting
3o plasmid pRW828 was partially cut with BanII, the linear
product isolated and recut with HindIII. Plasmid pRW828
now with a 100 by HindIII-BanII deletion was used as a
vector for the synthetic oligonucleotides RW152 (SEQ ID
N0:56) and RW153 (SEQ ID N0:57). These oligonucleotides
represent the 3' portion of the H6 promoter from the
EcoRV site and align the ATG of the promoter with the ATG
of the H4 cDNA.
WO 94/16716 ~ . . PCTIUS94/00888
108
RW152 (SEO ID N0:56): 5' GCACGGAACAAAGCTTATCGCGATATCCGTTA
AGTTTGTATCGTAATGCTATCAATCACGATTCTGTTCC
TGCTCATAGCAGAGGGCTCATCTCAGAAT3'
RW153 (SEQ ID N0:57): 5' ATTCTGAGATGAGCCCTCTGCTATGAGCAGGA
ACAGAATCGTGATTGATAGCATTACGATACAAACTTA
ACGGATATCGCGATAAGCTTTGTTCCGTGC 3'
The oligonucleotides were annealed, cut with BanII and
HindIII and inserted into the HindIII-BanII deleted
pRW828 vector described above. The resulting plasmid
to pRW844 was cut with EcoRV and DraI and the 1.7 kbp
fragment containing the 3' H6 promoted H4 coding sequence
was inserted between the EcoRV and HincII sites of pRW846
(described previously) forming plasmid pRW848. Plasmid
pRW848 therefore contains the H4 coding sequence linked
to the vaccinia virus H6 promoter in the de-ORFed F8
locus of fowlpox virus.
Construction of Insertion Plasmid for H5
Hemactglutinin at the F8 Locus. A cDNA clone of avian
influenza H5 derived from A/Turkey/Ireland/1378/83 was
2o received in plasmid pTH29 from Dr. R. Webster. Synthetic
oligonucleotides RW10 (SEQ ID N0:58) through RW13 (SEQ ID
NO: G1) were designed to overlap the translation
initiation codon of the previously described vaccinia
virus H6 promoter with the ATG of the H5 gene. The
2s sequence continues through the 5' SalI site of the H5
gene and begins again at the 3' H5 DraI site containing
the H5 stop codon.
RW10 (SEQ ID N0:58): 5' GAAAAATTTAAAGTCGACCTGTTTTGTTGAGT
TGTTTGCGTGGTAACCAATGCAAATCTGGTC
3o ACT 3'
RW11 (SEO ID N0:59): 5' TCTAGCAAGACTGACTATTGCAAAAAGAAGCA
CTATTTCCTCCATTACGATACAAACTTAACG
GAT 3'
RW12 (SEQ ID N0:60): 5' ATCCGTTAAGTTTGTATCGTAATGGAGGAAA
35 TAGTGCTTCTTTTTGCAATAGTCAGTCTTGCTAGAAGT
GACCAGATTTGCATTGGT 3'
WO 94/16716 215 3 3 3 G PCTIUS94I00888
109
to
RW13 (SEO ID N0:61): 5' TACCACGCAAACAACTCAACAAAACAGGTCG ~.
ACTTTAAATTTTTCTGCA 3'
The oligonucleotides were annealed at 95°C for three~v
minutes followed by slow cooling at room temperature.
This results in the following double strand structure
with the indicated ends.
EcoRV _Pstl
J RW12 ~ RW13 I
RW11 ( RW10
Cloning of oligonucleotides between the EcoRV and
PstI sites of pRW742B resulted in pRW744. Plasmid
pRW742B contains the vaccinia virus H6 promoter linked to
a non-pertinent gene inserted at the HincII site of
pRW731.15 described previously. Digestion with PstI and
EcoRV eliminates the non-pertinent gene and the 3'-end of
2o the H6 promoter. Plasmid pRW744 now contains the 3'
portion of the H6 promoter overlapping the ATG of avian
influenza H5. The plasmid also contains the H5 sequence
through the 5' SalI site and the 3' sequence from the H5
stop codon (containing a DraI site). Use of the DraI
2s site removes the H5 3' non-coding end. The
oligonucleotides add a transcription termination signal
recognized by early vaccinia virus RNA polymerase (Yuen
et al., 1987). To complete the H6 promoted H5 construct,
the H5 coding region was isolated as a 1.6 kpb SalI-DraI
3o fragment from pTH29. Plasmid pRW744 was partially
digested with DraI, the linear fragment isolated, recut
with SalI and the plasmid now with eight bases deleted
between SalI and DraI was used as a vector for the 1.6
kpb pTH29 SalI and DraI fragment. The resulting plasmid
3s pRW759 was cut with EcoRV and DraI. The 1.7 kbp PRW759
EcoRV-DraI fragment containing the 3' H6 promoter and the
H5 gene was inserted between the EcoRV and HincII sites
of pRW846 (previously described). The resulting plasmid
pRW849 contains the HG promoted avian influenza virus H5
WO 94116716 ; ~ PCTIUS94I00888
ilo
C~ gene in the de-ORFed F8 locus.
Construction of Insertion Vector for H7
Hema9glutinin at the F7 Locus. Plasmid pCVH71 containing
the H7 hemagglutinin from A/CK/VIC/1/85 was received from
s Dr. R. Webster. An EcoRI-BamHI fragment containing the
H7 gene was blunt-ended with the Klenow fragment of DNA
polymerase and inserted into the HincII site of pIBI25 as
PRW827. Synthetic oligonucleotides RW165 (SEQ ID N0:62)
and RW166 (SEQ ID N0:63) were annealed, cut with HincII
io and stvI and inserted between the EcoRV and StvI sites of
pRW827 to generate pRW845.
RW165 (SEQ ID N0:62): 5' GTACAGGTCGACAAGCTTCCCGGGTATCGCG
ATATCCGTTAAGTTTGTATCGTAATGAATACTCAAATT
CTAATACTCACTCTTGTGGCAGCCATTCACACAAATG
i 5 CAGACAAAATCTGCCTTGGACATCAT 3'
RW166 (SEO ID N0:63): 5' ATGATGTCCAAGGCAGATTTTGTCTGCATTTG
TGTGAATGGCTGCCACAAGAGTGAGTATTAGAATTTG
AGTATTCATTACGATACAAACTTAACGGATATCGCGA
TACCCGGGAAGCTTGTCGACCTGTAC3'
2o Oligonucleotides RW165 (SEQ ID N0:62) and RW166 (SEQ
ID N0:63) link the 3' portion of the H6 promoter to the
H7 gene. The 3' non-coding end of the H7 gene was
removed by isolating the linear product of an A~~aLI
digestion of pRW845, recutting it with EcoRI, isolating
25 the largest fragment and annealing with synthetic
oligonucleotides RW227 (SEQ ID N0:64) and RW228 (SEQ ID
N0:65). The resulting plasmid was pRW854.
RW227 (SEO ID N0:64): 5' ATAACATGCGGTGCACCATTTGTATAT
AAGTTAACGAATTCCAAGTCAAGC 3'
3o RW228 (SEO ID N0:65): 5' GCTTGACTTGGAATTCGTTAACTTATA
TACAAATGGTGCACCGCATGTTAT 3'
The stop codon of H7 in PRW854 is followed by an HpaI
site. The intermediate H6 promoted H7 construct in the
de-ORFed F7 locus (described below) was generated by
35 moving the pRW854 EcoRV-H~aI fragment into pRW858 which
had been cut with EcoRV and blunt-ended at its PstI site.
WO 94/16716 215 3 3 3 6 ~~594100888
111
Plasmid pRW858 (described below) contains the H6 promoter.
in an F7 de-ORFed insertion plasmid.
The plasmid pRW858 was constructed by insertion of
an 850 by SmaI/HpaI fragment, containing the H6 promoter
linked to a non-pertinent gene, into the SmaI site of
pF7D0 described previously. The non-pertinent sequences
were excised by digestion of pRW858 with EcoRV (site 24
by upstream of the 3'-end of the H6 promoter) and PstI.
The 3.5 kb resultant fragment was isolated and blunt-
to ended using the Klenow fragment of the E. coli DNA
polymerase in the presence of 2mM dNTPs. This blunt-
ended fragment was ligated to a 1700 by EcoRV/HpaI
fragment derived from pRW854 (described previously).
This EcoRV/H~aI fragment contains the entire AIV HA (H7)
gene juxtaposed 3' to the 3'-most 24 by of the W H6
promoter. The resultant plasmid was designated pRW861.
The 12G by EH arm (defined previously) was
lengthened in pRW861 to increase the recombination
frequency with genomic TROVAC DNA. To accomplish this, a
575 by AccI/SnaBI fragment was derived from pRW 731.13
(defined previously). The fragment was isolated and
inserted between the AccI and NaeI sites of pRW861. The
resultant plasmid, containing an EH arm of 725 by and a
HB arm of 404 by flanking the AIV H7 gene, was designated
2s as pRW869. Plasmid pRW869 therefore consists of the H7
coding sequence linked at its 5' end to the vaccinia
virus H6 promoter. The left flanking arm consists of 404
by of TROVAC sequence and the right flanking arm of 725
by of TROVAC sequence which directs insertion to the de-
3o ORFed F7 locus.
Development of TROVAC-Avian Influenza Virus
Recombinants. Insertion plasmids containing the avian
influenza virus HA coding sequences were individually
transfected into TROVAC infected primary CEF cells by
35 using the calcium phosphate precipitation method
previously described (Panicali et al., 1982; Piccini et
al., 1987). Positive plaques were selected on the basis
WO 94/16716
' , PCTIUS94100888
112
~
~'3 of hybridization to HA specific radiolabelled probes and
subjected to sequential rounds of plaque purification
until a pure population was achieved. One representative
plaque was then amplified to produce a stock virus.
s Plasmid pRW849 was used in an in vitro recombination test
to produce recombinant TROVAC-AIHS (vFP89) expressing the
H5 hemagglutinin. Plasmid pRW848 was used to produce
recombinant TROVAC-AIH4 (vFP92) expressing the H4
hemagglutinin. Plasmid pRW869 was used to produce
1o recombinant TROVAC-AIH7 (vFP100) expressing the H7
hemagglutinin.
Immunofluorescence. In influenza virus infected
cells, the HA molecule is synthesized and glycosylated
as
a precursor molecule at the rough endoplasmic reticulum.
i5 During passage to the plasma membrane it undergoes
extensive post-translational modification culminating in
proteolytic cleavage into the disulphide linked HA1 and
HA2 subunits and insertion into the host cell membrane
where it is subsequently incorporated into mature viral
2o envelopes. To determine whether the HA molecules
produced in cells infected with the TROVAC-AIV
recombinant viruses were expressed on the cell surface,
immunofluorescence studies were performed. Indirect
immunofluorescence was performed as described (Taylor et
2s al., 1990). Surface expression of the H5 hemagglutinin
in TROVAC-AIHS, H4 hemagglutinin in TROVAC-AIH4 and H7
hemagglutinin in TROVAC-AIH7 was confirmed by indirect
immunofluorescence. Expression of the H5 hemagglutinin
was detected using a pool of monoclonal antibodies
3o specific for the HSHA. Expression of the H4HA was
analyzed using a goat monospecific anti-H4 serum.
Expression of the H7HA was analyzed using a H7 specific
monoclonal antibody preparation.
Immunoprecipitation. It has been determined that
35 the sequence at and around the cleavage site of the
hemagglutinin molecule plays an important role in
determining viral virulence since cleavage of the
WO 94/16716 215 3 3 3 ~ PCT~S94/00888
11~
hemagglutinin polypeptide is necessary for virus
particles to be infectious. The hemagglutinin proteins
of the virulent H5 and H7 viruses possess more than one
basic amino acid at the carboxy terminus of HA1. It is
s thought that this allows cellular proteases which
recognize a series of basic amino acids to cleave the
hemagglutinin and allow the infectious virus to spread
both in vitro and in vivo. The hemagglutinin molecules
of H4 avirulent strains are not cleaved in tissue culture
1o unless exogenous trypsin is added.
In order to determine that the hemagglutinin
molecules expressed by the TROVAC recombinants were
authentically processed, immunoprecipitation experiments
were performed as described (Taylor et al., 1990) using
1s the specific reagents described above.
Immunoprecipitation analysis of the H5 hemagglutinin
expressed by TROVAC-AIHS (vFP89) showed that the
glycoprotein is evident as the two cleavage products HA1
and HA2 with approximate molecular weights of 44 and 23
2o kDa, respectively. No such proteins were precipitated
from uninfected cells or cells infected with parental
TROVAC. Similarly immunoprecipitation analysis of the
hemagglutinin expressed by TROVAC-AIH7 (vFP100) showed
specific precipitation of the HA2 cleavage product. The
2s HA1 cleavage product was not recognized. No proteins
were specifically precipitated from uninfected CEF cells
or TROVAC infected CEF cells. In contrast,
immunoprecipitation analysis of the expression product of
TROVAC-AIH4 (vFP92) showed expression of only the
3o precursor protein HAo. This is in agreement with the
lack of cleavage of the hemagglutinins of avirulent
subtypes in tissue culture. No H4 specific proteins were
detected in uninfected CEF cells or cells infected with
TROVAC. Generation of recombinant virus by
35 recombination, in situ hybridization of nitrocellulose
filters and screening for B-galactosidase activity are as
previously described (Panicali et al., 1982; Perkus et
WO 94116716 PCT/US94/00888
ii4
al., 1989).
Example 14 - GENERATION OF NYVAC- AND ALVAC-BASED
RECOMBINANT CONTAINING THE GENE ENCODING
IiUMAN TUMOR NECROSIS FACTOR - a (TNF-a )
TNF-a is a cytokine produced by CTLs. It is one of
the products of these cells that is responsible for
killing tumor cells during an immune response. It has
previously been shown that the injection of recombinant
1o TNF could mediate the necrosis and regression of a
variety of established murine cancers (Asher et al.,
1987). The exact mechanisms for this anti-tumor activity
remain unclear, although TNF apparently affects the
vascular supply of tumors (Asher et al., 1987). Both the
secreted and membrane-bound forms of TNF-a may be
critical for its anti-tumor activities (Kriegler et al.,
1987 ) .
Plasmid pE4, containing the human necrosis factor -a
gene was extracted from E. coli transformed with this
2o plasmid. The pE4 transformed E. coli were obtained from
ATCC (ATCC #CLN-39894). PCR fragment PCR-TNF4 (755 bp)
was generated using pE4 as template and oligonucleotides
TNF3 (SEQ ID N0:66); 5'-
ATCATCTCGCGATATCCGTTAAGTTTGTATCGTAATGAGCACTGAAAGCATGATC-
3') containing the 3'-most region of the vaccinia H6
promoter (from the NruI site to the end; Perkus et al.,
1989) and the first 21 by of the TNF-a coding sequence,
and oligonucleotide TNF2 (SEQ ID N0:67) (5'-
ATCATCTCTAGAATAAAAATCACAGGGCAATGATCCC-3'), containing the
last 15 by of the TNF-a coding sequence, a vaccinia early
transcription termination signal (TSNT; Yuen and Moss,
198G), and an XbaI restriction site. A complete
NruI/XbaI digestion was performed and the resultant 735
by fragment was isolated and inserted into the 4.8 kb
NruI/XbaI fragment obtained by the digestion of the
generic insertion plasmid pVQH6C5LSP. The resultant
plasmid was designated pMAW048. The nucleotide sequence
of the entire H6-TNF-a expression cassette was confirmed
as described by Goebel et al. (1990).
WO 94/16716 ~ ~ PCT/US94100888
lls
Plasmid pVQH6C5LSP was derived in the following
manner:
A C5 insertion vector containing 1535 by upstream of
C5, polylinker containing KpnI, SmaI, XbaI, and NotI
s sites, and 404 by of canarypox DNA (31 by of C5 coding
sequence and 373 by of downstream sequence) was derived
in the following manner. A genomic library of canarypox
DNA was constructed in the cosmid vector pVK102 (Knauf et
al., 1982) probed with pRW764.5 and a clone containing a
io 29 kb insert identified (pHCOSl). A 3.3 kb ClaI fragment
from pHCOSl containing the C5 region was identified.
Sequence analysis of the ClaI fragment was used to extend
the sequence in FIG. 8 (SEQ ID N0:68) from nucleotides 1-
1372.
15 The C5 insertion vector was constructed as follows.
The 1535 by upstream sequence was generated by PCR
amplification using oligonucleotides C5A (SEQ ID N0:69)
(5'-ATCATCGAATTCTGAATGTTAAATGTTATACTTG-3') and C5B (SEQ
ID N0:75) (5'-GGGGGTACCTTTGAGAGTACCACTTCAG-3') and
2o purified genomic canarypox DNA as template. This
fragment was digested with EcoRI (within oligo C5A) and
cloned into EcoRI/SmaI digested pUCB generating pCSLAB.
The 404 by arm was generated by PCR amplification using
oligonucleotides C5C (SEQ ID N0:71)
25 (5'-GGGTCTAGAGCGGCCGCTTATAAAGATCTAAAATGCATAATTTC-3') and
C5DA (SEQ ID N0:72)
(5'-ATCATCCTGCAGGTATTCTAAACTAGGAATAGATG-3'). This
fragment was digested with PstI (within oligo CSDA) and
cloned into SmaI/PstI digested pCSLAB generating pCSL.
so pCSL was digested within the polylinker with Asp718
and NotI, treated with alkaline phosphatase and ligated
to kinased and annealed oligonucleotides CP26 (SEQ ID
N0:73)
(5'-GTACGTGACTAATTAGCTATAAAAAGGATCCGGTACCCTCGAGTCTAGAATCG
3s ATCCCGGGTTTTTATGACTAGTTAATCAC-3') and CP27 (SEQ ID N0:74)
(5'-GGCCGTGATTAACTAGTCATAAAAACCCGGGATCGATTCTAGACTCGAGGGTA
CCGGATCCTTTTTATAGCTAATTAGTCAC-3') (containing a disabled
WO 94/16716 PCTIUS94/00888
116
Asp718 site, translation stop codons in six reading
frames, vaccinia early transcription termination signal
(Yuen and Moss, 1987), BamHI, KpnI, XhoI, XbaI, ClaI, and
SmaI restriction sites, vaccinia early transcription
s termination signal, translation stop codons in six
reading frames, and a disabled NotI site) generating
plasmid pCSLSP.
The early/late H6 vaccinia virus promoter (Perkus et
al., 1989) was derived by PCR from a plasmid containing
to the promoter using oligonucleotides CP30 (SEQ ID N0:75)
(5'-TCGGGATCCGGGTTAATTAATTAGTCATCAGGCAGGGCG-3') and CP31
(SEQ ID N0:76)
(5'-TAGCTCGAGGGTACCTACGATACAAACTTAACGGATATCG-3'). The
PCR product was digested with BamHI and XhoI (sites
is created at the 5' and 3' termini by the PCR) and ligated
to similarly digested pCSLSP generating pVQH6C5LSP.
Plasmid pMAW048 was used in in vitro recombination
assays with ALVAC (CPpp) as rescue virus to yield
recombinant virus vCP245. Insertion with this plasmid
2o replaces the two copies of the C5 open reading frame with
the human TNF-a expression cassette. Fig. 15 presents
the nucleotide sequence of the H6/TNF-a sequence and
flanking regions within vCP245 (SEQ ID N0:79). The H6
promoter starts at position 74. The TNF-a start codon is
25 at position 201, and the TNF-a stop codon is at position
902. Positions 1 through 73 and positions 903 through
965 flank the H6/TNF-a expression cassette.
PCR fragment PCR-TNFH6 (156 bp) was amplified from
plasmid pBSH6 using oligonucleotides H65PH (SEQ ID N0:80)
30 (5'-ATCATCAAGCTTGATTCTTTATTCTATAC-3') containing a
HindIII site in the initial 21 by of the H6 promoter
region and TNFH6 (SEQ ID N0:81) (5'-
CATGCTTTCAGTGCTCATTACGATACAAACTTAACGG-3') containing the
3'-most 19 nucleotides of the H6 promoter and the 5'-most
35 18 nucleotides of the TNF coding sequence.
Plasmid pBSH6 was generated in the following manner.
The vaccinia H6 promoter through the EcoRV site was
WO 94/16716 215, 3 3 s PCTIUS94/00888
117
derived from a plasmid containing the synthetic H6
promoter (Perkus et al., 1989) using PCR and primers
H6PCR2 (SEQ ID N0:82) (5'-TTAACGGATATCGCGATAATG-3') and
H6PCR1 (SEQ ID N0:83) (5'-
ACTACTAAGCTTCTTTATTCTATACTTAAAAAGTG-3') creating a 5'
HindIII site. This 122 by PCR-derived fragment was
digested with HindIII and EcoRV followed by ligation to
similarly digested pBS-SK+ (Stratagene, La Jolla, CA)
generating plasmid pBSH6. The insert was confirmed by
io nucleotide sequence analysis.
PCR fragment PCR-TNF (721 bp) was amplified from
plasmid pE4 using oligonucleotides TNF1 (SEQ ID N0:84)
(5'-ATGAGCACTGAAAGCATG-3') containing the initial 18
nucleotides of the TNF-a coding sequence and TNF2 (SEQ ID
NO:G7). The PCR fragment, PCR-TNF fusion (859 bp), was
generated using PCR-TNFH6 and PCR-TNF as templates and
oligonucleotides H65PH (SEQ ID N0:80) and TNF2 (SEQ ID
N0:67) as primers. PCR-TNF fusion was digested with
HindIII and XbaI and the resultant 841 by fragment was
2o inserted into pBS-SK+ (Stratagene, La Jolla, CA) digested
with HindIII and XbaI. The resultant plasmid was
designated pMAW047 and the H6-TNF cassette was confirmed
by nucleotide sequence analysis as described previously
(Goebel et al., 1990).
The 841 by HindIII/XbaI fragment containing the H6-
TNF-a expression cassette was isolated from pMAW047,
blunt-ended using the Klenow fragment of the E. coli DNA
polymerase in the presence of 2mM dNTPs, and inserted
into the vaccinia insertion plasmid pSD541. The
3o resultant plasmid was designated pMAW049.
Plasmid pSD541 was derived in the following manner.
Flanking arms for the ATI region were generated by PCR
using subclones of the Copenhagen HindIII A region 'as
WO 94/16716 ~ PCTIUS94100888
ms
template. Oligonucleotides MPSYN267 (SEQ ID N0:85) (5'-
GGGCTCAAGCTTGCGGCCGCTCATTAGACAAGCGAATGAGGGAC:-3') and
MPSYN268 (SEQ ID N0:86) (5'-
AGATCTCCCGGGCTCGAGTAATTAATTAATTTTTATTACACCAGAAAAGACGGCTTG
AGATC-3') were used to derive the 420 by vaccinia arm to
the right of the ATI deletion. Synthetic
oligonucleotides MPSYN269 (SEQ ID N0:87) (5'-
TAATTACTCGAGCCCGGGAGATCTAATTTAATTTAATTTATATAACTCATTTTTTGA
ATATACT-3') and MPSYN270 (SEQ ID N0:88) (5'-
1o TATCTCGAATTCCCGCGGCTTTAAATGGACGGAACTCTTTTCCCC-3') were
used to derive the 420 by vaccinia arm to the left of the
deletion. The left and right arms were fused together by
PCR and are separated by a polylinker region specifying
restriction sites for BalII, SmaI, and XhoI. The PCR-
generated fragment was digested with HindIII and EcoRI to
yield sticky ends, and ligated into pUC8 digested with
HindIII and EcoRI to generate pSD541.
The plasmid pMAW047 was used in in vitro
recombination assays (Piccini et al., 1987) with NYVAC
(vP866; Tartaglia et al., 1992) as the rescue virus.
Recombination with this plasmid replaces the ATI open
reading frame with the H6-TNF-a expression cassette. The
NYVAC recombinant virus containing the H6-TNF-a cassette
was designated vP1200. Fig. 16 presents the nucleotide
sequence of the H6/TNF-a expression cassette incorporated
into the NYVAC recombinant, vP1200, and flanking NYVAC
sequences (SEQ ID N0:89). The H6 promoter starts at
position 59. The TNF-a start codon is at position 185,
and the TNF-a stop codon is at position 884. Positions 1
3o through 58 and positions 885 through 947 flank the
H6/TNF-a expression cassette.
WO 94/16716 J PCT/US94/00888
119
Table 21. Expression of Human TNF-a by vP1200 and vCP245
Sample Description TNF-a (ng/ml)
vP1196 NYVAC-CMVgB+pp65 0
vP1200 NYVAC-TNF-a >240
CPpp ALVAC 0
vCP245 ALVAC-TNF-a 59
to Expression of TNF-a by vP1200 (NYVAC-TNF-a) and vCP245
(ALVAC-TNF-cz) was measured by ELISA assay, using a
commercially available kit (Genzyme Diagnostics,
Cambridge, MA, cat.#1915-O1). Samples were prepared by
infection of Vero cells (NYVAC recombinants) or primary
is chick embryo fibroblasts (ALVAC) with recombinant or
parent virus. The cells were harvested when CPE was
complete and the infected cell lysates were used for the
ELISA assay, after sonication and clarification by
centrifugation at 500 xg for l0 min. one control,
2o vP1196, which expresses two cytomegalovirus proteins, gB
and pp65, was prepared in the same manner as the TNF-a
recombinants. The other control, ALVAC parent, was a
partially purified virus stock. All samples contained
approximately 10~ PFU/ml of virus. The results, shown in
2s Table 21, indicate that both vP1200 and vCP245 are
expressing human TNF-a. Expression of such levels in
vivo can be therapeutic.
Example 15 - NYVAC AND ALVAC-BASED D53 RECOMBINANT
VIRUSES
The nuclear phosphoprotein, p53, is found in normal
cells at very low steady state levels. Expression of p53
is tightly regulated throughout the cell cycle and may be
involved in controlling cell proliferation. The
3s molecular mechanisms by which p53 exerts its tumor
suppressor activity remain unknown, although p53 appears
to exist in two conformational states. One form is
unique to wildtype p53 and is associated with the ability
WO 94116716 PCTIUS94100888
120
to block cell cycle progression while the second form is
associated with the ability to promote cell proliferation
and is common to wildtype and mutant forms (reviewed by
Ulrich et al., 1992). p53 is the gene most frequently
found to be mutated in a wide variety of human tumors
(reviewed by Hollstein et al., 1991).
Probably the most studied cancer associated with p53
mutation is breast cancer. It is known that p53 mutation
results in the overexpression of the p53 gene product in
to primary breast cancer patients (Davidoff et al., 1991).
The basis for p53 overexpression was found to result from
a post-transcriptional mechanism, since p53-specific mRNA
levels were similar in tumors with high and low level
protein expression. Further, the p53 mRNA from
overexpressing tumors were found to contain missense
mutations in highly conserved regions of the gene. These
mutations were subsequently found to give rise to more
stable p53 protein forms which form complexes with heat
shock protein 70 (HSP-70). Since HSP-70 proteins have
2o been implicated in antigen processing, not only may the
humoral response to p53 observed in a subset of breast
cancer patients have resulted from unique
processing/presentation modes for complexes, such an
association may also elicit cellular anti-p53 protein
responses (Davidoff et al., 1992). Such anti-p53
cellular immune responses may be more germane to the
eventual immunotherapy of such cancers.
Generation of Poxvirus-based Recombinant Viruses
Expressing Wildtype and Mutant Forms of the Human p53
Gene Product
Three plasmids, p53wtXbaISP6/T3, p53-217XbaI, and
p53-238XbaI containing wildtype human p53 gene sequences,
and two mutant forms of p53, respectively, were obtained
from Dr. Jeffrey Marks (Duke University). The p53-
217XbaI contains a p53 gene encoding a p53 product
lacking codon 217 while p53-238XbaI encodes a p53 gene
product with an cysteine to arginine substitution at
WO 94/16716 ~ ~ ~ PCT/US94100888
121
amino acid 238. The sequence of the wildtype p53 cDNA
and the deduced amino acid sequence was described
previously (Lamb and Crawford, 1986; FIG. 3;.
All three p53 genes were individually juxtaposed 3' r~
to the modified vaccinia virus H6 promoter described by
Perkus et al., 1989. These manipulations wEare performed
in the following manner. A 227 by PCR-derived fragment
was generated using oligonucleotides MM002 (SEQ ID N0:90)
(5'-GATCTGACTGCGGCTCCTCCATTACGATACAAACTTAACGG-3') and
l0 RW425 (SEQ ID N0:91) (5'-
GTGGGTAAGGGAATTCGGATCCCCGGGTTAATTAATTAGTGATAC-3') and
plasmid pRW825 as template. PCR using these
oligonucleotides amplifies the vaccinia H6 promoter
sequences from pRW825 such that the 3' end of the
is promoter is precisely linked to the 5'-most region of the
p53 coding sequence. Plasmid pRW825 contains the
vaccinia virus H6 promoter (Perkus et al., 1989) linked
to a nonpertinent gene.
PCR was also used to generate a 480 by and 250 by
2o fragment from p53wtXbaISP6/T3. The 480 by fragment was
derived with oligonucleotides MM003 (SEQ ID N0:92) (5'-
GTTTGTATCGTAATGGAGGAGCCGCAGTCAGATC-3') and MM008 (SEQ ID
N0:93) (5'-
CATTACGATACAAACTTAACGGATATCGCGACGCGTTCACACAGGGCAGGTCTTGGC
25 -3'). This fragment contains the 3' portion of the
vaccinia virus H6 promoter sequences and the 5' portion
of the p53 coding sequences through the SctrAI site. The
250 by fragment was derived by amplification with
oligonucleotides MM005 (SEQ ID N0:94) (5'-
3o TACTACCTCGAGCCCGGGATAAAAAACGCGTTCAGTCTGAGTCAGGCCC-3') and
MM007 (SEQ ID N0:95) (5'-
GTGTGAACGCGTCGCGATATCCGTTAAGTTTGTATCGTAATGCAGCTGCGTGGGCGT
GAGCGCTTC-3'). This PCR fragment contains the 3' end of
the p53 coding sequences beginning at the StuI
35 restriction site. The 480 by and 250 by PCR fragments
were generated such that the 5' end of the MM005/MM007-
derived (SEQ ID N0:94/95) fragment overlaps the 3'~end of
WO 94/16716 , ~~, , ' PCTIUS94I00888
122
the MM003/MM008-derived (SEQ ID N0:92/93) fragment.
The 227 bp, 480 bp, and 250 by PCR-derived fragments
were pooled and fused by PCR using oligonucleotides MM006
(SEQ ID N0:96) (5'-ATCATCGGATCCCCCGGGTTCTTTATTCTATAC-3')
and MM005 (SEQ ID N0:94). The 783 by fused PCR product
contains the H6 promoter juxtaposed 5' to the 5' portion
of the p53 coding sequence (through the SarAI restriction
site) followed by the end of the p53 coding sequence
beginning at the StuI site. Following the end of the p53
to coding sequence, a TSNT sequence motif providing early
vaccinia transcription termination (Yuen and Moss, 1986)
and a unique XhoI site were added. It should be noted
that the final H6-p53 PCR fusion product (783 bp) does
not contain the p53 coding sequences between the SarAI
and StuI restriction sites.
The 783 by fusion was digested with BamHI (5' end)
and XhoI (3' end) and inserted into plasmid pSD550 to
yield plasmid pMM105. Plasmid pSD550 enables the
insertion of foreign genes into the vaccinia I4L locus by
2o replacing the I4L coding sequence. This plasmid was
derived from pSD548 (Tartaglia et al., 1992) by first
digesting this plasmid with BalII and SmaI. This
digested plasmid was then ligated to annealed
oligonucleotides 539A (SEQ ID N0:97) (5'-
AGAAAAATCAGTTAGCTAAGATCTCCCGGGCTCGAGGGTACCGGATCCTGATTAGTT
AATTTTTGT-3') and 539B (SEQ ID N0:98) (5'-
GATCACAAAAATTAACTAATCAGGATCCGGTACCCTCGAGCCCGGGAGATCTTAGCT
AACTGATTTTTCT-3) to generate pSD550.
Plasmids containing intact p53 gene (wildtype or
3o mutant forms) juxtaposed 3' to the H6 promoter were
generated by first digesting pMM105 with ScrrAI and StuI.
A 795 by SctrAI/StuI fragment was isolated from
p53wtXbaISP6/T3 and p53-238XbaI, while a 792 by fragment
was isolated from p53-217XbaI. These fragments were
individually ligated to the SarAI/StuI digested pMM105
plasmid to yield pMM106, pMM108, and pMM107,
respectively.
WO 94/16716 ~ ~ PCTIUS94/00888
123
Plasmids pMM106, pMM107, and pMM108 were used in
standard in vitro recombination experiments (Piccini et
al., 1987) with NYVAC (vP866; Tartaglia et al., 1992) as
the rescue virus to generate recombinant viruses vP1101,
vP1096, and vP1098, respectively. Fig. 17 presents the
nucleotide sequence of the wildtype p53 expression
cassette and flanking regions within vP1101 (SEQ ID
N0:99). The H6 promoter starts at position 145. The p53
start codon is at position 269, and the p53 stop codon is
1o at position 1450. Positions 1 through 144 and positions
1451 through 1512 flank the H6/p53 expression cassette.
The sequences within vP1096 and vP1098 are identical
except vP1096 contains a 3 base deletion from nucleotide
920 to 922 while vP1101 contains a point mutation at
nucleotide 980 (T or C).
Both immunofluorescence and immunoprecipitation
assays were performed using a p53-specific monoclonal
antibody (pAB1801, Oncogene Science provided by Dr. ,7.
Marks) to demonstrate expression of p53 in vP1101, vP1098
2o and vP1096 infected Vero cells. These assays were
performed as described previously (Taylor et al., 1990).
Immunofluorescence assay demonstrated p53-specific
fluorescent staining of cells infected with vP1101,
vP1096, or vP1098. The p53 antigen was located in both
the nucleus and cytoplasm of the infected cells. The
nuclear staining, however, was more intense in vP1101
infected cells. These results are similar to those
reported by Ronen et al. (1992) using replication-
competent vaccinia to express wildtype and mutant forms
of p53. No p53-specific fluorescent staining was
observed in Vero cells infected with the parental NYVAC
virus, vP866.
ALVAC (CPpp) p53 insertion plasmids were engineered
by excising the p53 expression cassettes from pMM106,
pMM107, and pMM108 by digestion with BamHI and XhoI and
inserting them individually into BamHI/XhoI digested
pNVQCSLSP-7. The 1320 by BamHI/XhoI fragment containing
WO 94/16?16 ~ PCTIUS94100888
124
the H6-p53 expression cassette from pMM106 and pMM108 was
inserted into pNVQCSLSP-7 to yield pMM110 and pMM112,
Ze' respectively, while the 1317 by BamHI/XhoI fragment
derived from pMM107 and inserted into pNVQCSLSP-7 yielded
s pMMlll.
The plasmid pNVQCSLSP-7 was derived in the following
manner. pCSLSP (defined in Example 1) was digested with
BamHI and ligated to annealed oligonucleotides CP32 (SEQ
ID NO:100) (5'-
l0 CATCTTAATTAATTAGTCATCAGGCAGGGCGAGAACGAAGACTATCTGCTCGTTAAT
TAATTAGGTCGACG-3') and CP33 (SEQ ID NO:101) (5'-
CATCCGTCGACCTAATTAATTAACGACGACATAGTCTCGTTCTCGCCTGCCTGATGA
CTAATTAATTAA-3') to generate pVQC5LSP6. pVQC5LSP6 was
digested with EcoRI, treated with alkaline phosphatase
15 and ligated to self-annealed kinased oligonucleotide CP29
(SEQ ID N0:102) (5'-AATTGCGGCCGC-3'), digested with NotI
and linear was purified followed by self-ligation. This
procedure introduced a NotI site to pVQC5LSP6, generating
pNVQCSLSP-7.
2o Insertion plasmids pMM110, pMMlll, and pMM112 were
used in standard in vitro recombination experiments
(Piccini et al., 198?) with ALVAC (CPpp) as the rescue
virus to yield vCP207, vCPl93 and vCP191, respectively.
Confirmation of expression of the p53 gene product was
25 accomplished by immunoprecipitation assays performed as
described above. Fig. 18 presents the nucleotide
sequence of the H6/p53 (wildtype) expression cassette and
flanking regions from vCP207 (SEQ ID N0:103). The H6
promoter starts at position 109. The p53 start codon is
3o at position 233, and the p53 stop codon is at position
1414. Positions 1 through 232 and positions 1415 through
1483 flank the H6/p53 expression cassette. The
nucleotide sequence is identical to that within vCPi93
and vCP191 except vCP193 contains a 3 nucleotide deletion
35 from nucleotide 973 to 975 while vCP191 contains a point
mutation at nucleotide 94 to (T to C).
A listing of the NYVAC- and ALVAC- based p53
WO 94/16716 ~ PCTIUS94/00888
125
recombinant viruses is provided in Table 22.
TABLE 22. NYVAC and ALVAC-based p53 recombinant viruses
Recombinant Virus Parent Virus Gene Insert
vP1101 NYVAC w.t.53
vP1096 NYVAC
p53 (-as 217)
vP1098 NYVAC p53 (aa238; C to
R)
vCP207 ALVAC w.t. 53
vCP193 ALVAC p53 (-as 217)
to vCP191 ALVAC
p53 (aa 238; C to
R)
Example 16 - UTILITY OF NYVAC- AND ALVAC-BASED
RECOMBINANT VIRUSES CONTAINING THE MAGE-1
GENE
Human melanoma-associated antigen MZ2-E is encoded
by the MAGE-1 gene (Reviewed by van der Bruggen and Van
der Eynde, 1992). MAGE-1 is expressed in primary
melanoma tumor cells, melanoma-derived cell lines, and
2o certain tumors of non-melanoma origins but not in normal
cells except in testis (Coulie et al., 1993). Of
interest from an immunological perspective, CTLs from
melanoma-bearing patients that are of the HLA-A1 MHC
haplotype are known to recognize a nonapeptide from the
MZ2-E gene product (Traveseri et al., 1992). Therefore,
definition of such an antigen provides a mechanism for
targeted immunotherapy for HLA-typed (HLA-A1) melanoma
patients.
Generation of NYVAC- and ALVAC-based Recombinant Viruses
Containing the MAGE-1 Gene
PCR fragment PCR-H6 (162 bp) was synthesized using
pBSH6 (described in Example 14) as template and
oligonucleotides H65PH (SEQ ID N0:80) and M1-4 (SEQ ID
- N0:104) (5'-CAGACTCCTCTGCTCAAGAGACATTACGATACAAACTTAACG-
3') which contains the last 18 by of the H6 promoter and
the initial 24 nucleotides of the MAGE-1 gene. A second
PCR fragment (PCR-M1) was amplified from plasmid
pTZI8RMAGE1 using oligonucleotides M1-1 (SEQ ID N0:105)
,,
WO 94/16716 ~ ~ ' PCT/US94/00888
126
(5'-ATGTCTCTTGAGCAGAGGAGTCTG-3' and M1-2 (SEQ ID N0:106)
(5'-CAGGCCATCATAGGAGAGACC-3'). The resultant PCR
fragment represents the initial 546 by of the MAGE-1
coding sequence.
Plasmid pTZI8RMAGE-1 contains a cDNA clone of the
MAGE-1 gene. This gene encodes the MZE-2 human melanoma
rejection antigen. This plasmid was provided by Dr.
Lloyd Old (Memorial Sloan-Kettering, NY, NY) who obtained
the plasmid originally from Dr. Thierry Boon (Ludwig
to Inst. for Cancer Research, Brussels, Belgium).
PCR fusion product, PCR-H6M1 was generated using
PCR-H6 and PCR-M1 as templates and oligonucleotides H65PH
(SEQ ID N0:80) and M1-2 (SEQ ID N0:106) as primers. A
complete HindIII/BalII digestion of PCR-H6M1 was
performed and the resultant 556 by was purified for
subsequent cloning steps.
PCR fragment PCR-M3' (535 bp) was amplified from
pTZI8RMAGE-1 using oligonucleotides M1-3 (SEQ ID N0:107)
(5'-GTGGCTGATTTGGTTGGTTTTCTG-3') which contains 24
2o nucleotides complementary to the MAGE-1 gene at a region
approximately 200 by upstream of the M1-2 oligonucleotide
sequence and M1-5 (SEQ ID N0:108) (5'-
ATCATCTCTAGAAAAAAAATCACATAGCTGGTTTCAG-3') containing the
terminal 15 nucleotides of the MAGE-1 coding sequence, a
2s vaccinia early transcription termination signal (T5NT;
Yuen and Moss, 1986) and an XbaI restriction site. PCR-
M3' was digested with BQ1II and XbaI. The resultant 414
by fragment was isolated and co-inserted into
HindIII/XbaI digested pBS-SK(+) with the 556 by
3o HindIII/BalII digested PCR fragment PCR-H6M1. The
resultant plasmid containing the entire H6-MAGE-1
expression cassette was designated pMAW034. The H6-MAGE-
1 cassette was confirmed by nucleotide sequence analysis
as per Goebel et al., 1990).
3s The 864 by NruI/XbaI fragment from pMAW034 was
isolated and inserted into pVQH6C5LSP (described in
Example 14) that was digested in a similar fashion. The
WO 94116716
21 ~ 3 3 ~ 6 PCT/US94/00888
127
resultant plasmid was designated pMAW036. This plasmid
served as the insertion plasmid for replacing the two C5
ORFs in the ALVAC genome with the H6-MAGE-1 expression
cassette.
s Plasmid pMAW036 was used in standard in vitro
recombination experiments with ALVAC as the rescuing
virus. Recombinant virus were identified by an in situ
plaque hybridization assay using MAGE-1-specific
radiolabeled DNA probes. Recombinant plaques were plaque
1o purified and amplified. The resultant ALVAC-based
recombinant containing the MAGE-1 gene was designated
vCP235. Fig. 19 presents the nucleotide sequence of the
H6/MAGE-1 expression cassette and flanking region
contained within vCP235 (SEQ ID N0:109). The H6 promoter
15 starts at position 74. The MAGE-1 start codon is at
position 201, and the MAGE-1 stop codon is at position
1031. Positions 1 through 73 and positions 1032 through
1094 flank the H6/MAGE-1 expression cassette.
The NYVAC (vP866) insertion plasmid pMAW037 was
2o generated by initially digesting pMAW034 with NruI/BamHI.
The resultant 879 by fragment was isolated and inserted
into NruI/BamHI digested pSPHAH6. The resultant plasmid
was designated pMAW037.
Plasmid pSPHAH6 was generated in the following
25 manner. Plasmid pSD544 (containing vaccinia sequences
surrounding the site of the HA gene replaced with a
polylinker region and translation termination codons in
six reading frames) was digested with XhoI within the
polylinker, filled in with the Klenow fragment of DNA
3o polymerase I and treated with alkaline phosphatase.
SP126 (containing the vaccinia H6 promoter) was digested
with HindIII, treated with Klenow and the H6 promoter
isolated by digestion with SmaI. Ligation of the H6
promoter fragment to pSD544 generated SPHA-H6 which
35 contained the H6 promoter in the polylinker region (in
the direction of HA transcription).
Plasmid pMAW037 was used in standard in vitro
WO 94116716 . ' ' PCT/US94100888
128
tj recombination experiments (Piccini et al., :1987) with
NYVAC (vP866) as the rescue virus. Fig. 20 presents the
nucleotide sequence of the H6/MAGE-1 expres:~ion cassette
and flanking regions within pMAW037 (SEQ ID NO:110). The
H6 promoter starts at position 52. The MAGE-1 start
codon is at position 179, and the MAGE-1 step codon is at
position 1009. Positions 1 through 51 and ~~ositions 1010
through 1084 flank the H6/MAGE-1 expression cassette.
Examule 17 - GENERATION OF AN ALVAC- AND NYVAC-BASED
to CEA RECOMBINANT VIROSES
The CEA gene was provided in plasmid pGEM.CEA, which
contains the CEA coding sequence (2,109 nucleotides) as
well as 5' and 3' untranslated regions (Dr. J. Schlom,
NCI-NIH). The 5' end of the CEA construct was modified to
remove the 5' untranslated sequences and place the
vaccinia H6 promotor before the ATG initiation codon of
CEA. This was accomplished by PCR with the
oligonucleotide pair CEA1 (SEQ ID NO:111) (5'-
2o TATCGCGATATCCGTTAAGTTTGTATCGTAATGGAGTCTCCCTCG-3') and
CEA2 (SEQ ID N0:112) (5'-TGCTAGATCTTTATCTCTCGACCACTGTATG-
3') and plasmid pGEM.CEA as template. The resulting
fragment links the 3' 30 nucleotides of the H6 promotor
to the CEA initiation codon, extends 22 nucleotides past
2s the ApaI site at position 278 of the CEA coding sequence,
and terminates with a BalII site introduced by the PCR
primer CEA2 (SEQ ID N0:114). Prior to cloning, this
fragment was digested with EcoRV (site located within the
3' end of the H6 promotor) and BalII. The digested 5'
3o PCR fragment was then included in a 3-way ligation with
two fragments derived from plasmid pI4L.H6: an NcoI/BqlII
vector fragment and an NcoI/EcoRV fragment which
contained the 5' portion of the H6 promotor. The
resulting plasmid, designated pI4L.H6.CEA-5', contains '
3s the full length H6 promotor linked to a 5' CEA fragment
extending from the ATG codon through the ApaI site at
position 278.
The 3' end of CEA was modified to remove the 3'
WO 94116716 215 3 3 3 ~ ~T~S94100888
129
untranslated region of CEA and place a vaccinia early
transcription termination signal (TSNT) followed by a
series of restriction sites (XhoI, XbaI, SmaI, HindIII)
after the TAG termination codon. This was accomplished
by PCR with the oligonucleotide pair CEA3 (SEQ ID N0:113)
(5'-CTATGAGTGTGGAATCCAGAACG-3') and CEA4 (SEQ ID N0:114)
(5'-TCAGAAGCTTCCCGGGTCTAGACTCGAGATAAAAACTATATCAGAGCAACC-
3') and plasmid pGEM.CEA as template. The resulting
fragment extends from a position 32 nucleotides 5' of the
to CEA HindII site located at position 1203 through the 3'
end of the coding sequence. This fragment was cloned as
a HindII/HindIII fragment into a HindII/HindIII-digested
pGEM.CEA vector fragment. The resulting plasmid,
designated pGEM.CEA-3', contains the entire CEA gene as
found in pGEM.CEA with a 3' end modified to remove the 3'
untranslated region and replace it with a TSNT signal
followed by XhoI, XbaI, SmaI, and HindIII restriction
sites.
To generate an ALVAC C3 donor plasmid containing
2o CEA, a BamHI/ApaI fragment containing the H6 promotor
linked to the 5' end of CEA was obtained from
pI4L.H6.CEA-5', an ApaI/XhoI fragment containing the
remainder of the CEA coding sequence (plus TSNT) was
obtained from pGEM.CEA-3', and a BamHI/XhoI C3 vector
fragment was derived from plasmid p126.C3. After
subsequent 3-way ligation, the plasmid pH6.CEA.C3 was
obtained. This plasmid contains the full length H6/CEA
expression cassette inserted between left and right
flanking arms of ALVAC DNA which direct insertion to the
3o C3 sites on the ALVAC genome. Transcription of CEA is
oriented from right to left.
Plasmid p126.C3, an ALVAC C3 donor plasmid, was
derived as follows. This plasmid contains an insert
consisting of cDNA derived from the Plasmodium falciparum
SERA gene (Li et al., 1989; Bzik et al., 1989; Knapp et
al., 1989; NOTE: SERA is also known as SERP I and p126)
under the control of the entomopox virus 42K early
. . : . . y.,,
WO 94116716 PCTIUS94/00888
i3o
promotor.
A. Methodolog3r for generatina t~126. C3 .
1. Construction of P. falciparum FCR3 Strain Blood
Stage cDNA Library.
s Total RNA from human erythrocytes infected with P.
falciparum FCR3 strain was provided by Dr. P. Delplace
(INSERM-U42). Poly-A+ RNA was isolated from this sample
by use of oligo(dT) cellulose (Stratagene, La Jolla, CA.)
as described by Aviv and Leder (1972) and modified by
1o Kingston (1987). Briefly, total RNA was mixed with
oligo(dT) cellulose in Binding buffer (0.5M NaCl, O.O1M
Tris-Cl, pH 7.5) and incubated for 30 minutes at room
temperature. Poly-A+ RNA/oligo(dT) cellulose complexes
were pelleted by centrifugation and washed 3 times with
i5 Binding buffer. Purified poly-A+ RNA was eluted from the
oligo(dT) cellulose in Elution buffer (0.01M Tris-C1, pH
7.5). A second elution with DEPC-treated dH20 was
performed, the eluates were pooled, and the poly-A+ RNA
recovered by ethanol precipitation.
2o The purified poly-A+ RNA was used as a template for
the synthesis of first strand cDNA by reverse
transcriptase in a reaction primed with oligo(dT) (Watson
and Jackson, 1985; Klickstein and Neve, 1987). For this
reaction, l2ug poly-A+ RNA was incubated with 105 units
25 AMV reverse transcriptase (Life Sciences, Inc., St.
Petersburg, FL.) in 100mM Tris-C1 pH 8.3, 30mM KC1, 6mM
MgCl2, 25mM DTT, 80 units RNasin, 1mM each dNTP, and
24ug/ml oligo(dT)12-is as primer for 2 hours at 42°C.
After organic extractions, double stranded cDNA was
30 obtained by use of DNA polymerase I and RNase H with
first strand cDNA as template (Watson and Jackson, 1985:
Klickstein and Neve, 1987). The first strand cDNA was
incubated with 25 units DNA polymerase I and 1 unit RNase
H in 20mM Tris-C1 pH 6, 5mM MgCl2, lOmM (NH4)2S04, 100mM
35 KC1, 500ug/ml BSA, 25mM DTT, and O.lmM each dNTP at 12°C
for one hour followed by one hour at room temperature to
synthesize second strand cDNA. The double stranded cDNA
215333fi
WO 94/16716 PCTIUS94100888
131 " -
was recovered by organic extractions and ethanol
precipitation.
The double-stranded blood stage cDNA was then
sequentially treated with T4 DNA polymerase to create
s blunt ends and EcoRI methylase to protect internal EcoRI
sites. EcoRI linkers were then added followed by
digestion with EcoRI and size selection on a 5-25%
sucrose gradient. Fractions containing long cDNAs (1-10
Kb) were pooled and ligated into coRI cleaved Lambda
to ZAPII vector (Stratagene, La Jolla, CA.). The resulting
phage were packaged and used to infect the XL-1 Blue E.
coli strain (Stratagene). The phage were then harvested
from these cells and amplified by one additional cycle of
infection of XL-1 Blue to produce a high titer FCR3
is strain blood stage cDNA library.
2. Screen of cDNA Library for SERA cDNA Clones.
The FCR3 strain cDNA library was screened by plaque
hybridization with 32P end-labelled oligonucleotides
derived from published sequences of SERA to detect cDNA.
2o The cDNA library was plagued on lawns of XL-1 Blue
(Stratagene) in 150mm dishes at a density of 100,000
plaques per dish. Plaques were transferred to
nitrocellulose filters which were then soaked in 1.5M
NaCl/0.5M NaOH for 2 minutes, 1.5M NaCl/0.5M Tris-C1 pH 8
25 for 5 minutes, 0.2M Tris-C1 pH 7.5/2X SSC for one minute,
and baked for 2 hours in an 80°C vacuum oven. Filters
were prehybridized in 6X SSC, SX.Denhardts, 20mM NaH2P04,
500ug/ml salmon sperm DNA for two hours at 42°C.
Hybridizations were performed in 0.4% SDS, 6X SSC, 20mM
3o NaH2P04, 500ug/ml salmon sperm DNA for 18 hours at 42°C
after the addition 32P-labelled oligonucleotide. After
hybridization, filters were rinsed 3 times with 6X SSC,
0.1% SDS, washed for 10 minutes at room temperature, and
washed for 5 minutes at 58°C. Filters were then exposed
35 to X-ray film at -70°C.
Plaques hybridizing with the oligonucleotide probe
were cored from plates and resuspended in SM buffer
CA 02153336 2003-02-18
77396-19
I32
(100mM NaCl, 8mM MgS04, SOm~M Tris-C1 pH 7.5, 0.01%
gelatin) captaining 4% chloroform. Dilutions of such
phage stocks were used to infect XL-1 Blue, plaques were
transferred to nitrocellulose, and the filters were
hybridized with 3ZP-labelled oligonucleotides. Well
isolated positive plaques were selected and subjected to
two additional rounds of purif icatian as just described.
3. '0 0
positive Phaqe Clones.
I0 SERA cDNAs i,n t."~e pBluescript plasznid vector
(Stratagene) were obtained by an in vivo excision
protocol developed for use with the lambda ZAPIT vector
(Stratagene) . Br=efly, purified recombinant lambda phage
stocks were incubated with XL-1 glue cells and 8408
filamentous helper phage fo:r 1~ minutes a- 37°C. After
the addition of 2X Y'" media (1% NaCI, 1% yeast extract,
7..6% Bacto-tryptane), incubation was continued for 3
hours at 37°c~ fol:?owed by 20 minutes at 70°C. After'
centrifugation, f ilamentous phage particles containing
2o pBluescript phagemid (with cDNA insert) were recovered in
the supernatant. D.ilutions of the recovered f ilamentous
phage stock were mixed with XL-1 Blue and plated to
obtain colonies containing pBluescript plasmids with SERA
cDNA inserts.
z5 4. Generation of Malaria cDNA by PCR.
By use cf the polymerase chain reaction (PCR), the
5' portion of the ceding sequence of SERA was amplified
with specif is olic~cnucleotide primers and first strand
cDNA as template ~'Saiki et al. 1988, Frohman et al.
3o 1988) . SERA-specific first strand cflNA was synthesized
by reverse transcriptase using the reaction conditions
~. - o
described. above a-:d s~ec;_.c a~~.ccnuc_eo~les as pri.n rs.
. RNA was subsequen~.ly e'_~minated by treatment with RNase A
prior to PCR. The GeneAmp+LNA a~sp'_iFication kit (Per kin
i5 Elmer Cetus, Norwal:t, C"~.) was used for PC~. Brielv,
f it s t s trend cDNA i z SOnM KCB , lOmM Tr is-C 1 pH 3 . 3 , 1. 5:n1~
MgCl2, 0.01 % gel atin was mixed wit: 200uM each dNT?, luNl
*Trace-mark
CA 02153336 2003-02-18
'17386-:.~
133
of each primer, and 2.5 units Taq polymerase. Reactions
were processed in a Thermal Cycler (Perkin Elmer Cetus)
with 1 cycle of denaturation, annealing, and extension at
94°C for 2 minutes, 43°C for 3 minutes, and 72°C for 40
minutes; 40 cycles at 94°C for 1 minute, 43°C for 2
minutes, and 72°C for 4 minutes followed by a final
extension at 72°C for 20 minutes.
The inclusion of restriction sites in primers used
for PCR allowed the cloning of amplified SERA cDNA into
1o plasmid vectors. Clones cantaining cDNAs derived from
t~~ro independent PCRs were obtained for eac."1 SERA cDNA
that was amplified in order to contzol fcr Taq polymerase
errors.
B. Results.
1. Isolation clonincr and characterization of SERA
cDNA.
We have isolated overlapping cDNA clones spanning
the SERA coding sequence from the PCR3 strain of P.
2o falciparum. The p125.6 cDNA, Which extends from the
coRI site at position 1892 (numbering based on SERF I
gene of FCBR strain; Knapp eat al. , 1989) through the 3'
end of the coding sequence, was isolated from the blood
stage cDNA Lambda ~APLI cDNA library by hybridization to
a SERA-specific o.Ligonucleotide JAT2 (SEQ ID N0:115) (5'-
GTCTCAGAACGTGTTCATGT-3'), which a derived from the 3'
end of th a SERA coding sequence (Bzik et al., 1989; Knapp
et al., 1989). Clones derived from the 5' end of the
SERA coding sequence were obtained by PCR wish primers
JAT15 (SEQ ID N0:116) (5'-CACGGATCCATGAAGTCATATATTTCCTT-
3' ) and JAT16 (SEQ ID NO:11'') (5'-
- GTGAAGCTTAATCCATAATCTTC.~AT.'~:,TT-3 ' ) and SERA f it s t sgrand
cDNA templa to (obtained with oligonucleotide primer JAT1%
( SEQ ID fC : 1:.8 ) ( 7' _~.~T J~.=~GC~."~'='TATACAT?~1CAGA.~TA.~CA-3' ; ~~
and were cloned i:~t;~ pUCl9 (New England Biolabs, BPv~art~~.=~,
N.L~..). These 1923 by cDNAs e:xten~ from the initiation
colon to a point 3'... by 3' o~ the internal EcoR~ site
( pos i tic:: l c 3 2 ) . C::e such c~i3? , F=2 5 . 8 , was found by DI~n
*Trade-mar'.~c
WO 94/16716 '~, ; ~ ~ ' PCTIUS94100888
134
sequence analysis to contain a Taq polymerase error at
nucleotide 1357. This error, an A to G substitution,
resides within the 315 by KpnI/NdeI restriction fragment.
A second SERA 5' cDNA, p126.9, has no mutations within
s this KpnI/NdeI fragment. An unmutated 5' SERA cDNA was
generated by replacing the 315 by Kpn_I/NdeI fragment in
p126.8 with the analogous fragment from p126.9 to
generate p126.14. Full length SERA cDNA was generated by
ligating the p126.14 5' cDNA as an XmaI/EcoRI fragment
to into a partial EcoRI/XmaI digested p126.6 vector fragment
to generate p126.15.
The complete nucleotide sequence of the p126.15 SERA
cDNA insert was determined and is shown in Figures 21A
and 21B (SEQ ID N0:119) along with the predicted amino
15 acid sequence (SEQ ID N0:120). This cDNA contains a 2955
by open reading frame encoding 984 amino acids that is
identical to the SERA allele II gene in the FCR3 strain
and the FCBR SERP I gene (Li et al., 1989, Knapp et al.,
1989 ) .
2o The SERA cDNA was isolated from p126.15 as a 3 Kb
XmaI/EcoRV fragment and the XmaI end ligated into an
XmaI/BglII digested pCOPCS-5H vector fragment. DNA
polymerase I Klenow fragment was used to fill in the
pCOPCS-5H BalII site which was subsequently ligated to
2s the EcoRV end to generate p126.16. In this plasmid, SERA
is under the control of the early/late vaccinia H6
promotor.
2. Modification of SERA cDNA.
The 3' end of the SERA cDNA was modified to place a
3o vaccinia early transcription termination signal (T5NT;
Yuen and Moss, 1987) and a series of restriction sites
(XhoI, SmaI, SacI) immediately after the TAA termination
codon. This was accomplished by PCR with
oligonucleotides JAT51 (SEQ ID N0:121) (5'-
35 TAGAATCTGCAGGAACTTCAA-3'), JAT52 (SEQ ID N0:122) (5'-
CTACACGAGCTCCCGGGCTCGAGATAAAAATTATACATAACAGAAATAACATTC-
3'), and plasmid p126.16 as template. The resulting 300
WO 94116716 PCT/US94100888
135
by amplified fragment was cloned as a PstI/SacI fragment
into p126.16 digested with PstI and SacI to generate
p126.17.
The 5' end of the SERA cDNA in p126.17 was modified
to place several restriction sites (HindIII, SmaI, BamHI)
and the 42K entomopox promotor before the ATG initiation
codon. This was accomplished by PCR with
oligonucleotides JAT53 (SEQ ID N0:123) (5'-
CTAGAGAAGCTTCCCGGGATCCTCAAAATTGAAAATATATAATTACAATATAAAATG
l0 AAGTCATATATTTCCTTGT-3'), JAT54 (SEQ ID N0:124) (5'-
ACTTCCGGGTTGACTTGCT-3'), and plasmid p126.16 as template.
The resulting 250 by amplified fragment was cloned as a
HindIII/HindII fragment into p126.17 digested with
HindIII and HindII to generate p126.18. This plasmid
contains a cassette consisting of the SERA cDNA
controlled by the 42K entomopox promotor, with a vaccinia
early transcription termination signal, and flanked by
restriction sites at the 5' (HindIII, SmaI, BamHI) and 3'
(XhoI, SmaI, SacI) ends.
2o The 42K promotor/SERA cassette was isolated from
p126.18 as a BamHI/XhoI fragment and cloned into a
BamHI/XhoI digested pSD553 vector fragment. The
resulting plasmid is designated p126.ATI.
3. Generation of p126.C3.
2s The 42K/SERA expression cassette was isolated from
p126.ATI as a BamHI/XhoI fragment and cloned into a
BamHI/XhoI-digested VQCP3L vector fragment. The
resulting plasmid, designated p126.C3, is an ALVAC C3
donor plasmid.
30 4. Derivation of pSD553.
- The pSD553 vaccinia donor plasmid was used for the
generation of p126.ATI. It contains the vaccinia K1L
host range gene (Gillard et al., 1986) within flanking
Copenhagen vaccinia arms, replacing the ATI region (orfs
35 A25L, A26L; Goebel et al., 1990a,b). pSD553 was
constructed as follows.
Left and right vaccinia flanking arms were
WO 94116716 PCTIUS94100888
136
constructed by PCR using pSD414, a pUCB-based clone of
vaccinia SalI B (Goebel et al., 1990a,b) as template.
~t~ The left arm was synthesized using synthetic
deoxyoligonucleotides MPSYN267 (SEQ ID N0:85) (5'-
GGGCTGAAGCTTGCTGGCCGCTCATTAGACAAGCGAATGAGGGAC-3') and
MPSYN268 (SEQ ID N0:86) (5'-AGA TCT CCC GGG CTC GAG TAA
TTA ATT AAT TTT TAT TAC ACC AGA AAA GAC GGC TTG AGA TC-
3') as primers. The right arm was synthesized using
synthetic deoxyoligonucleotides MPSYN269 (SEQ ID N0:87)
(5'-TAA TTA CTC GAG CCC GGG AGA TCT AAT TTA ATT TAA TTT
ATA TAA CTC ATT TTT TGA ATA TAC T-3') and MPSYN270 (SEQ
ID N0:88) (5'-TAT CTC GAA TTC CCG CGG CTT TAA ATG GAC GGA
ACT CTT TTC CCC-3') as primers. The two PCR-derived DNA
fragments containing the left and right arms were
combined in a further PCR reaction. The resulting
product was cut with EcoRI/HindIII and a 0.9kb fragment
isolated. The 0.9kb fragment was ligated with pUC8 cut
with EcoRI/HindIII, resulting in plasmid pSD541. The
polylinker region located at the vaccinia deletion locus
2o was expanded as follows. pSD541 was cut with BalII/XhoI
and ligated with annealed complementary synthetic
deoxyoligonucleotides MPSYN333 (SEQ ID N0:125) (5'-GAT
CTT TTG TTA ACA AAA ACT AAT CAG CTA TCG CGA ATC GAT TCC
CGG GGG ATC CGG TAC CC-3')/MPSYN334 (SEQ ID N0:126) (5'-
TCG AGG GTA CCG GAT CCC CCG GGA ATC GAT TCG CGA TAG CTG
ATT AGT TTT TGT TAA CAA AA-3') generating plasmid pSD552.
The K1L host range gene was isolated as a !kb
BQ1II(partial)/HpaI fragment from plasmid pSD452 (Perkus
et al., 1990). pSD552 was cut with BalII/HpaI and
ligated with the K1L containing fragment, generating
pSD553.
5. Derivation of VQCP3L.
The VQCP3L ALVAC donor plasmid was used for the
generation of p126.C3 and was constructed as follows.
Insertion plasmid VQCP3L was derived as follows. An
8.5kb canarypox BalII fragment was cloned in the BamHI
site of pBS-SK plasmid vector to form pWWS. Nucleotide
WO 94/16716 PCTIUS94100888
215333
137
sequence analysis of a 7351 by subgenomic fragment from
ALVAC containing the C3 insertion site is presented in
Figs. 14A to 14C (SEQ ID N0:127). The C3 ORF is located
between nucleotides 1458 to 2897. In order to construct
a donor plasmid for insertion of foreign genes into the
C3 locus with the complete excision of the C3 open
reading frame, PCR primers were used to amplify the 5'
and 3' sequences relative to C3. Primers for the 5'
sequence were RG277 (SEQ ID N0:128) (5'-
1o CAGTTGGTACCACTGGTATTTTATTTCAG-3') and RG278 (SEQ ID
N0:129) (5'-
TATCTGAATTCCTGCAGCCCGGGTTTTTATAGCTAATTAGTCAAATGTGAGTTAATA
TTAG-3'). Primers for the 3' sequences were RG279 (SEQ
ID N0:130)
(5'TCGCTGAATTCGATATCAAGCTTATCGATTTTTATGACTAGTTAATCAAATAAA
AAGCATACAAGC-3') and RG280 (SEQ ID N0:131) (5'-
TTATCGAGCTCTGTAACATCAGTATCTAAC-3'). The primers were
designed to include a multiple cloning site flanked by
vaccinia transcriptional and translational termination
2o signals. Also included at the 5'-end and 3'-end of the
left arm and right arm were appropriate restriction sites
(Asp718 and EcoRI for left arm and EcoRI and SacI for
right arm) which enabled the two arms to ligate into
Asp718/SacI digested pBS-SK plasmid vector. The
2s resultant plasmid was designated as pC3I. A 908 by
fragment of canarypox DNA, immediately upstream of the C3
locus was obtained by digestion of plasmid pWWS with NsiI
and SSpI. A 604 by fragment of canarypox and DNA was
derived by PCR using plasmid pWW5 as template and
30 oligonucleotides CP16 (SEQ ID N0:132) (5'-
TCCGGTACCGCGGCCGCAGATATTTGTTAGCTTCTGC-3') and CP17 (SEQ
ID N0:133) (5'-TCGCTCGAGTAGGATACCTACCTACTACCTACG-3').
The 604 by fragment was digested with Asp718 and XhoI
(sites present at the 5' ends of oligonucleotides CP16
35 and CP17, respectively) and cloned into A~718-XhoI
digested and alkaline phosphatase treated IBI25
(International Biotechnologies, Inc., New Haven, CT)
WO 94/16716 PCT/US94/00888
i3s
generating plasmid SPC3LA. SPC3LA was digested within
IBI25 with EcoRV and within canarypox DNA with NsiI, and
~t ligated to the 908 by NsiI-SSpI fragment generating
SPCPLAX which contains 1444 by of canarypox DNA upstream
s of the C3 locus. A 2178 by BqlII-S,tvI fragment of
canarypox DNA was isolated from plasmids pXX4 (which
contains a 6.5 kb NsiI fragment of canarypox DNA cloned
into the PstI site of pBS-SK. A 279 by fragment of
canarypox DNA was isolated by PCR using plasmid pXX4 as
1o template and oligonucleotides CP19 (SEQ ID N0:134) (5'-
TCGCTCGAGCTTTCTTGACAATAACATAG-3') and CP20 (SEQ ID
N0:135) (5'-TAGGAGCTCTTTATACTACTGGGTTACAAC-3'). The 279
by fragment was digested with XhoI and SacI (sites
present at the 5' ends of oligonucleotides CP19 and CP20,
15 respectively) and cloned into SacI-XhoI digested and
alkaline phosphatase treated IBI25 generating plasmid
SPC3RA. To add additional unique sites to the
polylinker, pC3I was digested within the polylinker
region with EcoRI and ClaI, treated with alkaline
2o phosphatase and ligated to kinased and annealed
oligonucleotides CP12 (SEQ ID N0:136) (5'-
AATTCCTCGAGGGATCC-3') and CP13 (SEQ ID N0:137) (5'-
CGGGATCCCTCGAGG-3') (containing an EcoRI sticky end, XhoI
site, BamHI site and a sticky end compatible with ClaI)
25 generating plasmid SPCP3S. SPCP3S was digested within
the canarypox sequences downstream of the C3 locus with
SCI and SacI (pBS-SK) and ligated to a 261 by BalII-SacI
fragment from SPC3RA and the 2178 by BalII-SCI fragment
from pXX4 generating plasmid CPRAL containing 2572 by of
3o canarypox DNA downstream of the C3 locus. SPCP3S was
digested within the canarypox sequences upstream of the
C3 locus with ASp718 (in pBS-SK) and AccI and ligated to
a 1436 by AS~718-AccI fragment from SPCPLAX generating
plasmid CPLAL containing 1457 by of canarypox DNA
35 upstream of the C3 locus. The derived plasmid was
designated as SPCP3L. VQCP3L was derived from pSPCP3L by
digestion with XmaI, phosphatase treating the linearized
215333fi
WO 94/16716 PCTIUS94/00888
139
plasmid, and ligation to annealed, kinased
oligonucleotides CP23 (SEQ ID N0:138) (5'-
CCGGTTAATTAATTAGTTATTAGACAAGGTGAAAACGAAACTATTTGTAGCTTAATT y
AATTAGGTCACC-3') and CP24 (SEQ ID N0:139) (5'-
CCGGGGTCGACCTAATTAATTAAGCTACAAATAGTTTCGTTTTCACCTTGTCTAATA
ACTAATTAATTAA-3').
DNA sequence analysis of pH6.CEA.C3 revealed a one
nucleotide deletion (T) at position 1203 of the CEA
coding sequence (eliminating a HindII site) which
occurred during a previous cloning step. This deletion
was corrected by replacing a 1047 nucleotide MscI
fragment (extending from position 501 to 1548) from
pH6.CEA.C3 with the analogous, unmutated MscI fragment
from pGEM.CEA. The resulting plasmid was designated
pHG.CEA.C3.2.
CEA has been inserted into ALVAC by recombination
between NotI-linearized pH6.CEA.C3.2 donor plasmid and
ALVAC rescuing virus. Recombinants containing CEA have
been identified by plaque hybridization with a DNA probe
2o derived from the CEA coding sequence (an NruI/XhoI
fragment containing the full length CEA coding sequence).
A NruI/XhoI fragment containing the 3' end of the H6
promotor linked to the full length CEA coding sequence
was isolated from pH6.CEA.C3.2. This fragment was
ligated to an NruI/XhoI-digested pSPHA.H6 vector
fragment, which was derived from the pSD544 HA donor
plasmid by the insertion of a fragment containing the H6
promotor. The resulting plasmid was designated
pH6.CEA.HA and contains the CEA coding sequence linked to
3o the regenerated H6 promotor. The pH6.CEA.HA donor
plasmid directs insertion of the H6/CEA expression
cassette to the HA site of NYVAC. Transcription of CEA
is oriented from left to right.
Plasmid pSD544 was derived as follows. pSD456 is a
subclone of Copenhagen vaccinia DNA containing the HA
gene (ASGR; Goebel et al., 1990a,b) and surrounding
regions. pSD456 was used as template in polymerase chain
WO 94116716 PCTlUS94100888
140
reactions for synthesis of left and right vaccinia arms
flanking the A56R ORF. The left arm was synthesized
using synthetic oligodeoxynucleotides MPSYN279 (SEQ ID
N0:140) (5' CCCCCCGAATTCGTCGACGATTGTTCATGATGGCAAGAT 3')
and MPSYN280 (SEQ ID N0:141) (5'-
CCCGGGGGATCCCTCGAGGGTACCAAGCTTAATTAATTAAATATTAGTATAAAAAGT
GATTTATTTTT -3') as primers. The right arm was
synthesized using MPSYN281 (SEQ ID N0:142) (5'-
AAGCTTGGTACCCTCGAGGGATCCCCCGGGTAGCTAGCTAATTTTTCTTTTACGTAT
1o TATATATGTAATAAACGTTC -3') and MPSYN312 (SEQ ID N0:143)
(5'- TTTTTTCTGCAGGTAAGTATTTTTAAAACTTCTAACACC -3') as
primers. Gel-purified PCR fragments for the left and
right arms were combined in a further PCR reaction. The
resulting product was cut with EcoRI/HindIII. The
is resulting 0.9 kb fragment was gel-purified and ligated
into pUC8 cut with EcoRI/HindIII, resulting in plasmid
pSD544. Figures 22 and 23 present the nucleotide
sequences of the H6/CEA expression cassettes and flanking
regions in plasmids pH6.CEA.C3.2 and pH6.CEA.HA,
2o respectively (SEQ ID N0:144/145, respectively). In Fig.
22, the HG promoter begins at position 57. The CEA start
codon begins at position 181 and the stop codon ends at
position 2289. Positions 1 through 58 and 2290 through
2434 flank the H6/CEA expression cassette. In Fig. 23,
25 the H6 promotor begins at position 60. The CEA start
codon begins at position 184 and the stop codon ends at
position 2292. Positions 1 through 59 and 2293 through
2349 flank the H6/CEA expression cassette.
Example 18 - MURINE IL-2 INTO ALVAC AND NYVAC
3o Insertion of murine IL-2 into ALVAC. Plasmid pmut-1
(ATCC No. 37553) contains the murine IL-2 gene from
American Type Culture Collection, Rockville, MD. The IL-
2 gene was placed under the control of the vaccinia H6
promoter (Perkus et al., 1989) and the IL-2 3' noncoding
35 end was removed in the following manner.
Template pRW825, containing the H6 promoter and a
nonpertinent gene, was used in a polymerase chain
WO 94/16716 2 I 5 3 3 3 G ~T~S94/00888
141
reaction (PCR) with primers MM104 (SEQ ID N0:146)
5'ATCATCGGATCCCTGCAGCCCGGGTTAATTAATTAGTGATAC 3' and MM105
(SEQ ID N0:147) 5'
GAGCTGCATGCTGTACATTACGATACAAACTTAACGGA 3'. The 5' end of
MM104 contains BamHI, PstI and SmaI sites followed by a
sequence which primes from the H6 promoter 5' end toward
the 3' end. The 5' end of MM105 overlaps the IL-2 5' end
and MM105 primes from the H6 promoter 3' end toward the
5' end. The resultant 228 base pair PCR derived fragment
to contains the H6 promoted 5' most base pairs of IL-2.
Template plasmid pmut-1 was used in a second PCR
with primers MM106 (SEQ ID N0:148) 5'
CGTTAAGTTTGTATCGTAATGTACAGCATGCAGCTG 3' and MM107 (SEQ ID
N0:149) 5' GAGGAGGAATTCCCCGGGTTATTGAGGGCTTGTTGAGA 3'.
The 5' end of MM106 overlaps the 3' end of the H6
promoter and primes from the IL-2 5' end toward the 3'
end. The 5' end of MM107 contains EcoRI and SmaI sites
followed by a sequence which primes from the IL-2 3' end
toward the 5' end. The resultant 546 base pair PCR
2o derived fragment was pooled with the above 228 base pair
PCR product and primed with MM104 and MM107. The
resultant 739 base pair PCR derived fragment, containing
the H6 promoted IL-2 gene, was digested with BamHI and
EcoRI, generating a 725 base pair fragment, for insertion
between the BamHI and EcoRI sites of pBS-SK (Stratagene,
LaJolla, California), yielding pMM151.
The 755 base pair pMM151 BamHI-XhoI fragment
containing the H6 promoted IL-2 gene was inserted between
the BamHI and XhoI sites of the C3 vector pCP3LSA-2. The
3o resultant plasmid pMM153, contains the H6 promoted IL-2
gene in the C3 locus.
The nucleotide sequence of murine IL-2 from the
translation initiation codon through the stop codon is
given in Figure 24 (SEQ ID N0:150).
C3 vector plasmid pCP3LSA-2 was derived in the
following manner. Plasmid SPCP3L (Example 17) was
digested with NsiI and NotI and a 6433 by fragment
WO 94116716 ' PCT/US94/00888
Cp _
142
isolated and ligated to annealed oligonucleotides CP34
(SEQ ID N0:151) 5' GGCCGCGTCGACATGCA 3' and CP35 (SEQ ID
N0:152) 5' TGTCGACGC 3', generating plasmid pCP3LSA-2.
Recombination between donor plasmid pMM153 and ALVAC
rescuing virus generated recombinant virus vCP275, which
contains the vaccinia H6 promoted murine IL-2 gene in the
C3 locus.
Insertion of murine IL-2 into NYVAC. Plasmid
pMM151, defined above, was digested with BamHI/XhoI and a
755 base pair fragment containing the H6 promoted IL-2
gene was isolated. This BamHI/XhoI fragment was inserted
between the BamHI and XhoI sites of the NYVAC TK vector
pSD542. The resultant plasmid pMM154, contains the H6
promoted IL-2 gene in the TK locus.
is Plasmid pSD542 was derived in the following manner.
To modify the polylinker region, TK vector plasmid pSD513
(Example 7) was cut with PstI/BamHI and ligated with
annealed synthetic oligonucleotides MPSYN288 (SEQ ID
N0:153) 5' GGTCGACGGATCCT 3' and MPSYN289 (SEQ ID N0:154)
5' GATCAGGATCCGTCGACCTGCA 3', resulting in plasmid
pSD542.
Recombination between donor plasmid pMM154 and NYVAC
rescuing virus generated recombinant virus vP1239, which
contains the HG promoted murine IL-2 gene in the TK
locus .
Expression of murine IL-2 in ALVAC and NYVAC based
recombinants. ELISA assay. The level of expression of
murine IL-2 produced by ALVAC and NYVAC based
recombinants vCP275 and vP1239 was quantitated using an
3o ELISA kit from Genzyme Corporation, Cambridge, MA.
(InterTest-2XTM Mouse IL-2 ELISA Kit, Genzyme Corporation,
Code # 2122-O1). Duplicate dishes containing confluent
monolayers of mouse L-929 cells (2 x 106 cells/dish) were
infected with recombinant virus vCP275 or vP1239
expressing murine IL-2 or infected with ALVAC or NYVAC
parental virus. Following overnight incubation at 37°C,
supernatants were harvested and assayed for expression of
WO 94116716 21 ~ 3 3 3 6 ~T~S94100888
143 "
murine IL-2 using the InterTest-2XTM Mouse IL-2 ELISA Kit
as specified by the manufacturer (Genzyme Corporation,
Cambridge, MA). The InterTest-2XTM Mouse IL-2 ELISA Kit
is a solid-phase enzyme-immunoassay employing the
multiple antibody sandwich principle. ELISA plates were
read at 490 nm. Background from ALVAC or NYVAC samples
was subtracted, and values from duplicate dishes were
averaged. The quantity of murine IL-2 secreted is
expressed as pg/ml, which is equivalent to pg/106 cells
(Table 23).
Table 23
Recombinant virus Murine IL-2 secreted
vCP275 160 pg/ml
vP1239 371 pg/ml
Example 19 - HUMAN IL-2 INTO ALVAC AND NYVAC
2o Insertion of Human IL-2 into ALVAC. Plasmid pTCGF-
11 (ATCC No. 39673) contains the human IL-2 gene from
American Type Culture Collection, Rockville, MD. The IL-
2 gene was placed under the control of the vaccinia H6
promoter (Perkus et al., 1989), two codons were
2s corrected, and the IL-2 3' noncoding end was removed in
the following manner.
Template plasmid pRW825, containing the H6 promoter
and a nonpertinent gene, was used in a polymerase chain
reaction (PCR) with primers MM104 (SEQ ID N0:146)
3o 5' ATCATCGGATCCCTGCAGCCCGGGTTAATTAATTAGTGATAC 3' and
MM109 (SEQ ID N0:155) 5'
GAGTTGCATCCTGTACATTACGATACAAACTTAACGGA 3'. The 5' end of
MM104 contains BamHI, Pstl and SmaI sites followed by a
sequence which primes from the vaccinia H6 promoter 5'
3s end toward the 3' end. The 5' end of MM109 overlaps the
IL-2 5' end, and MM105 primes from the H6 promoter 3' end
toward the 5' end. The resultant 230 base pair PCR
derived fragment contains the H6 promoted 5' most base
pairs of IL-2.
4o Template plasmid pTCGF-11 was used in a PCR with
WO 94/16716 ' PCT/US94100888
144
primers MM108 (SEQ ID N0:156) 5'
C1j CGTTAAGTTTGTATCGTAATGTACAGGATGCAACTC 3' and MM112 (SEQ ID
N0:157) 5'
TTGTAGCTGTGTTTTCTTTGTAGAACTTGAAGTAGGTGCACTGTTTGTGACAAGTGC
AAGACTTAGTGCAATGCAAGAC 3'. The 5' end of MM108 overlaps
the 3' end of the H6 promoter and primes from the IL-2 5'
end toward the 3' end. MM112 primes from position 100,
in the human IL-2 sequence (Figure 25), toward the 5'
end. The resultant 118 base pair fragment contains the
3' most base pairs of the H6 promoter and 5' 100 by of
the IL-2 gene.
Plasmid pTCGF-11 from American Type Culture
Collection was sequenced, and the sequence was compared
with the published sequence (Clark, et al., 1984). Two
mutations resulting in amino acid changes were
discovered. Oligonucleotide primers MM111 (SEQ ID
N0:158) 5'
TTCTACAAAGAAAACACAGCTACAACTGGAGCATTTACTTCTGGATTTACAGATGAT
TTTGAATGGAATTAATAATTAC 3' and MM112 were used to correct
2o these two base changes in pTCGF-11.
The corrected nucleotide sequence of human IL-2 from
the translation initiation codon through the stop codon
is given in Figure 25 (SEQ ID N0:159).
Except for a silent G to T change in pTCGF-11 at
position 114, the sequence in Figure 25 is the same as
the IL-2 sequence described in Clark, et al., 1984. The
T at position 41 in the sequence in Figure 25 is C in
pTCGF-11, and the codon change is from leu to pro. The T
at position 134 in the sequence in Figure 25 is C in
3o pTCGF-11, and the codon change is from leu to ser. The
predicted amino acid sequences of other human, bovine,
murine, ovine, and porcine IL-2 isolates were compared
with the sequence in Clark, et al., 1984; the codons at
positions 41 and 134 are both conserved as leu.
Template pTCGF-11 was used in a PCR with primers
MM110 (SEQ ID N0:160) 5'
GAGGAGGAATTCCCCGGGTCAAGTCAGTGTTGAGATGA 3' and MM111. The
WO 94116716 ~ ~ PCTIUS94100888
145
5' end of MM110 contains EcoRI and SmaI sites followed ~y
a sequence which primes from the IL-2 3' end toward the':
5' end. MM111 primes from position 75 toward the IL-2 3'"
end. The resultant 400 base pair PCR derived fragment
s was pooled with the above 230 and 118 base pair PCR
products and primed with MM104 and MM110. The resultant
680 base pair PCR derived fragment, containing the
vaccinia H6 promoted IL-2 gene, was digested with BamHI
and EcoRI and inserted between the BamHI and EcoRI sites
to of pBS-SK (Stratagene, LaJolla, California), yielding
pRW956.
Plasmid pRW956 was digested with BamHI/XhoI and a
700 by fragment containing the H6 promoted IL-2 gene was
isolated. This fragment was inserted between the BamHI
15 and XhoI sites of the C3 vector plasmid pCP3LSA-2
(Example 18). The resultant plasmid, pRW958, contains
the H6 promoted IL-2 gene in the C3 locus.
Recombination between donor plasmid pRW958 and ALVAC
rescuing virus generated recombinant virus vCP277, which
20 contains the H6 promoted human IL-2 gene in the C3 locus.
Insertion of Human IL-2 into NYVAC. Plasmid pRW956,
defined above, was digested with BamHI/XhoI and a 700
base pair fragment was isolated. This fragment,
containing the vaccinia H6 promoted human IL-2 gene, was
25 inserted between the BamHI and XhoI sites of the NYVAC TK
vector plasmid pSD542 (Example 18). The resultant
plasmid, pRW957, contains the H6 promoted human IL-2 gene
in the TK locus.
Recombination between donor plasmid pRW957 and NYVAC
3o rescuing virus generated recombinant virus vP1241, which
contains the H6 promoted human IL-2 gene in the TK locus.
Expression of human IL-2 in ALVAC and NYVAC based
recombinants. ELISA assay. The level of expression of
human IL-2 produced by ALVAC and NYVAC based recombinants
35 vCP277 and vP1241 was quantitated using a Human
Interleukin-2 ELISA kit from Collaborative Biomedical
Products, Inc., Becton Dickinson, Bedford, MA. (IL-ISA 2TM
WO 94/16716 . PCT/US94100888
146
Cat. No. 30020). Duplicate dishes containing confluent
monolayers of human HeLa cells (2 x 106 cells/dish) were
infected with recombinant virus vCP277 or vP1241
expressing human IL-2 or infected with ALVAC or NYVAC
s parental virus. Following overnight incubation at 37°C,
supernatants were harvested and assayed for expression of
human IL-2 using the IL-ISA 2TM Human Interleukin-2 ELISA
kit as specified by the manufacturer (Collaborative
Biomedical Products, Inc., Becton Dickinson, Bedford,
1o MA). The IL-ISA 2TM Kit is a solid-phase enzyme-
immunoassay employing the multiple antibody sandwich
principle. ELISA plates were read at 490 nm. Background
from ALVAC or NYVAC samples was subtracted, and values
from duplicate dishes were averaged. The IL-ISA 2TM
is KitIL-2 quantitates human IL-2 in Biological Response
Modifiers Program (BRMP) units (Gerrard et al., 1993).
The quantity of human IL-2 secreted is expressed as BRMP
u/ml, which is equivalent to BRMP u/106 cells (Table 24).
Table 24
Recombinant virus Human IL-2 secreted
vCP277 850 BRMP U/ml
vP1241 953 BRMP U/ml
Example 20 - MURINE IFNy INTO ALVAC AND NYVAC
Insertion of Murine IFNY into ALVAC. Plasmid pmsl0
was obtained from ATCC (#63170). Plasmid pmsl0 contains
cDNA encompassing the entire mouse IFNY coding sequence
3o with flanking region cloned into the PstI site of pBR322.
Plasmid pMPI3H contains the vaccinia I3L promoter
(Perkus et al., 1985; Schmitt and Stunnenberg, 1988) in
pUC8. Plasmid pMPI3H is designed for cleavage at a H~~aI
site within the promoter and at a site in the downstream
3s polylinker region to allow for downstream addition of the
3' end of the I3L promoter linked to a foreign gene.
Linkaae of murine IFNv cxene with I3L promoter;
Construction of pMPI3mIF. Murine IFNy coding sequences
with linkage to I3L promoter were synthesized by PCR
WO 94116716 215 3 3 3 6 PCT~S94100888
147
using oligonucleotides MPSYN607 (SEQ ID N0:161) 5' ~ ,
TAATCATGAACGCTACACACTGC 3' and MPSYN608 (SEQ ID N0:162)
5' CCCGGATCCCTGCAGTTATTGGGACAATCTCTT 3' as primers, and
plasmid pmsl0 as template. The PCR product was cut with
BamHI and a 510 by fragment was isolated and ligated with
vector plasmid pMPI3H cut with HpaI/BamHI. Following
sequence verification, the resulting plasmid was
designated pMPI3mIF.
Insertion of I3L/murine IFNY cassette into the C3
locus; construction of pMPC3I3mIF. Plasmid pMPI3mIF was
cut with HindIII and blunt ended with Klenow fragment of
E. coli polymerase. The DNA was then cut with BamHI and
a 0.6 kb fragment containing the I3L/murine IFNy cassette
was isolated. This fragment was ligated with vector
plasmid pVQC3LSA-3 cut with SmaI/BamHI, resulting in
insertion plasmid pMPC3I3mIF.
Nucleotide sequence of the I3L/murine IFNy
expression cassette is given in Figure 26 (SEQ ID
N0:163). The start codon for the murine IFNy gene is at
2o position 101, and the stop codon is at position 596.
Plasmid pVQC3LSA-3 was derived in the following
manner. ALVAC C3 locus insertion plasmid VQCP3L (Example
17) was digested with NsiI and NotI and a 6503 by
fragment isolated and ligated to annealed
oligonucleotides CP34 (SEQ ID N0:151) 5'
GGCCGCGTCGACATGCA 3' and CP35 (SEQ ID N0:152) 5'
TGTCGACGC 3', generating plasmid VQCP3LSA-3. (Note:
Plasmid VQCP3LSA-3 is identical to plasmids VQCP3LSA-5
and VQCP3LSA, used in subsequent examples; see, e.a.,
3o Examples 24, 25, 26.)
Recombination between donor plasmid pMPC3I3mIF and
ALVAC rescuing virus generated recombinant virus vCP271,
which contains the I3L promoted murine IFNy gene in the
C3 locus.
Insertion of Murine IFNy into NYVAC. Insertion of
I3L/murine IFNy cassette into TK locus; construction of
pMPTKI3mIF. Plasmid pMPI3mIF, defined above, was cut
WO 94/16716 ~ PCTIUS94/00888
i4s
with HindIII and blunt ended with Klenow fragment of E.
coli polymerase. The DNA was then cut with BamHI and a
0.6 kb fragment containing the I3L/murine IFNy cassette
was isolated. This fragment was ligated with NYVAC TK
vector plasmid pSD542 (Example 18) cut with SmaI/BamHI,
resulting in insertion plasmid pMPTKI3mIF.
Recombination between donor plasmid pMPTKI3mIF and
NYVAC rescuing virus generated recombinant virus vP1237,
which contains the I3L promoted murine IFNY gene in the
TK locus.
Expression of murine IFNv in ALVAC and NYVAC based
recombinants. ELISA assay. The level of expression of
murine IFNy produced by ALVAC and NYVAC based
recombinants vCP271 and vP1237 was quantitated using an
ELISA kit from Genzyme Corporation, Cambridge, MA.
(InterTest-y Kit, Genzyme Corporation, cat # 1557-00).
Duplicate dishes containing confluent monolayers of mouse
L-929 cells (2 x 106 cells/dish) were infected with
recombinant virus vCP271 or vP1237 expressing murine IFN~y
or infected with ALVAC or NYVAC parental virus.
Following overnight incubation at 37°C, supernatants were
harvested and assayed for expression of murine IFNy using
the InterTest-'y Kit as specified by the manufacturer
(Genzyme Corporation, Cambridge, MA). The InterTest-y
Kit is a solid-phase enzyme-immunoassay employing the
multiple antibody sandwich principle. ELISA plates were
read at 490 nm. Background from ALVAC or NYVAC samples
was subtracted, and values from duplicate dishes were
averaged. The quantity of murine IFNY secreted is
3o expressed as nanograms/ml, which is equivalent to ng/106
cells (Table 25).
Table 25
Recombinant virus Murine IFNv secreted
vCP271 972 ng/ml
vP1237 3359 ng/ml
WO 94116716 2 I 5 3 3 3 6 ~T~S94/00888
149
Biolocrical assay. The biological activity of murine~.,
IFNY expressed by ALVAC and NYVAC based recombinants was
quantitated using a standardized IFNy bio-assay (Vogel et
al., 1991). This assay quantitates IFN activity by
titrating its ability to protect L-929 cells from VSV
(vesicular stomatitis virus)-induced cytopathic effect
(CPE) .
Confluent monolayers of mouse L-929 cells (2 x 106
cells/dish) were mock-infected or infected with NYVAC,
1o vP1237, ALVAC, or vCP271 at an moi of 5. Dishes were
inoculated in duplicate. Following the 1 hour adsorption
period, 1 ml of fresh medium was added to each dish and
they were incubated overnight at 37°C. The supernatants
from both dishes were pooled, filtered through a 0.22 ~,m
1s filter and tested for IFN activity as detailed below.
Two-fold serial dilutions of supernatants were tested,
beginning at undiluted for mock infected, NYVAC, and
ALVAC infected dishes, or 1:100 and 1:1000 for vCP271 and
vP1237 infected dishes.
2o In the IFN-y bio-assay, 50 ~.1 medium was added to
all wells of a 96-well plate, followed by 50 ~1 of a
serial dilution of a stock of commercial murine IFN-y
(Genzyme Corporation, MG-IFN, lot # B3649) or culture
supernatant as described above. Next, 50 ~.1 of L-929
2s cells (3 x 104 cells) were added to each well, and plates
were placed at 37°C overnight. After 24 hours, cells
were infected with 100 ~,1 VSV (moi of 0.1). Plates were
incubated at 37°C overnight. After 24 hours, CPE was
assessed. The well which gave the same CPE as VSV in the
3o absence of interferon was defined as having 1 unit/ml
interferon. This method coincided well with the
interferon standard.
The interferon concentration in the supernatants is
determined as the reciprocal of the dilution which gives
3s similar CPE to the standard at 1 unit/ml interferon. For
mock-infected, NYVAC and ALVAC infected cells, less than
20 units/ml interferon is produced. For vP1237, 14,000
WO 94116716 PCT/US94/00888
i5o
units/ml IFN-y is produced, and for vCP271, 3,600
units/ml IFN-y is produced. vP1237 produced four-fold
greater levels of IFN-y than vCP271, confirming results
seen above by the ELISA assay. The lack of protection
s conferred by supernatants from mock-infected or parental
virus-infected cells shows that the protective activity
in supernatants from vP1237- and vCP271-infected cells is
IFN-y. This was confirmed by a neutralization assay
which showed that antisera to IFN-y (Genzyme Corporation
1o monoclonal hamster anti-murine IFN-y, 1222-00, lot
#B3847) but not antisera to murine IFN-a/Q (Lee
Biomolecular Research, INC., San Diego, CA, No. 25301,
lot. #89011) or murine IFN-(~ (Lee Biomolecular Research,
Inc., No. 25101, lot. #87065) was capable of neutralizing
i5 the protective activity produced by these recombinants.
Example 21 - HUMAN IFNy INTO ALVAC AND NYVAC
Insertion of Human IFNv into ALVAC. Plasmid p52 was
obtained from ATCC (No. 65949). Plasmid p52 contains
cDNA encoding the carboxy terminal 2/3 of the human IFNy
2o coding sequence with untranslated 3' region cloned into
the PstI site of pBR322.
Linkage of human IFNy gene with I3L promoter;
Construction of pMPI3hIF.
(A) The missing region of the human IFNy gene was
25 synthesized using long, overlapping PCR primers, MPSYN615
(SEQ ID N0:164) 5'
TAATCATGAAATATACAAGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTT
CTCTTGGCTGTTACTGCCAGGACCCATATGTAAAAGAAGC 3' and MPSYN616
(SEQ ID N0:165) 5'
3o TTCTTCAAAATGCCTAAGAAAAGAGTTCCATTATCCGCTACATCTGAATGACCTGCA
TTAAAATATTTCTTAAGGTTTTCTGCTTCTTTTACATATGGGTCCTGGC 3' with
no extraneous template. The end of MPSYN615 is designed
for cloning into the HpaI site of pMPI3H (Example 20).
There are 25 by of overlap between MPSYN615/MPSYN616. A
35 179 by PCR product was isolated.
(B) The remainder of human IFNy gene was synthesized
using PCR primers MPSYN617 (SEQ ID N0:166)
2 I 5 3 3 3 6 PCTIUS94/00888
WO 94/16716
151
5' TCTTTTCTTAGGCATTTTGAAGAATTGGAAAGAGGAGAGTGACAG 3' and
MPSYN618 (SEQ ID N0:167) 5'
CCCGGATCCCTGCAGTTACTGGGATGCTCTTCGA 3' with plasmid p52 as
template. MPSYN617 has 25 by overlap with missing
region; MPSYN618 is designed for cloning into the
downstream BamHI site of pMPl3H. A ca. 350 by PCR
fragment was isolated.
(A+B) Combination PCR was performed using isolated
fragments from (A) and (B), above, and external primers
1o MPSYN615 and MPSYN618. The PCR product was digested with
BamHI, and a ca. 510 by fragment was isolated. This
fragment was cloned into pMPI3H cut with HpaI/BamHI.
Following sequence confirmation, the resulting
plasmid was designated pMPI3hIF. pMPI3hIF contains the
human IFNy gene under the control of the I3L promoter.
Insertion of I3L/human IFNy cassette into C3 locus;
construction of pMPC3I3hIF. Plasmid pMPI3hIF was cut
with HindIII and blunt ended with Klenow fragment of E.
coli polymerase. The DNA was then cut with BamHI and a
0.6 kb fragment containing the I3L/human IFNy cassette
was isolated. This fragment was ligated with ALVAC C3
vector plasmid pVQC3LSA-3 (Example 20) cut with
SmaI/BamHI, resulting in ALVAC insertion plasmid
pMPC3I3hIF.
Nucleotide sequence of the I3L/human IFNy
expression cassette is given in Figure 27 (SEQ ID
N0:168). The start codon for the human IFNy gene is at
position 101, and the stop codon is at position 599.
Recombination between donor plasmid pMPC3I3hIF
3o and ALVAC rescuing virus generated recombinant virus
vCP278, which contains the I3L promoted human IFNy gene
in the C3 locus.
Insertion of Human IFNy into NYVAC. Insertion of
I3L/human IFNV cassette into TK locus; construction of
pMPTKI3hIF. Plasmid pMPI3hIF, described above, was cut
with HindIII and blunt ended with Klenow fragment of E.
coli polymerase. The DNA was then cut with BamHI and a
WO 94!16716 PCT/US94100888
152
0.6 kb fragment containing the I3L/human IFNy cassette
was isolated. This fragment was ligated with NYVAC TK
vector plasmid pSD542 (Example 18) cut with SmaI/BamHI,
resulting in NYVAC insertion plasmid pMPTKI3hIF.
Recombination between donor plasmid pMPTKI3hIF
and NYVAC rescuing virus generated recombinant virus
vP1244, which contains the vaccinia I3L promoted human
IFNy gene in the TK locus.
Expression of human IFNy in ALVAC and NYVAC based
to recombinants
ELISA assay
The level of expression of human IFNy produced by
ALVAC and NYVAC based recombinants vCP278 and vP1244 was
quantitated using a human Interferon y ELISA kit from
Genzyme Corporation, Cambridge, MA. (InterTest-yTM Kit,
Genzyme Corporation, cat # 1556-00). Duplicate dishes
containing confluent monolayers of human HeLa cells (2 x
106 cells/dish) were infected with recombinant virus
vCP278 or vP1244 expressing human IFNy or infected with
2o ALVAC or NYVAC parental virus. Following overnight
incubation at 37 C, supernatants were harvested and
assayed for expression of human IFNy using the InterTest-
y Kit as specified by the manufacturer (Genzyme
Corporation, Cambridge, MA). The InterTest-y Kit is a
solid-phase enzyme-immunoassay employing the multiple
antibody sandwich principle. ELISA plates were read at
490 nm. Background from ALVAC or NYVAC samples was
subtracted, and values from duplicate dishes were
averaged. The quantity of human IFNy secreted is
3o expressed as nanograms/ml, which is equivalent to ng/106
cells (Table 26).
Table 26
Recombinant virus Human IFNy secreted
vCP278 9 ng/ml
vP1244 l5 ng/ml
WO 94116716 PCTIUS94/00888
21 ~3~36
153
Example 22 - Murine IL-2 plus IFNv into ALVAC and NYVAC
Insertion of Murine IFNv into C6 locus of ALVAC;
addition to ALVAC-murine IL-2 recombinant virus.
Derivation of C6 insertion vector. ALVAC C6 insertion
vector pC6L was derived as follows. A 3.0 kb canarypox
HindIII fragment containing the entire C6 ORF was cloned
into the HindIII site of pBS-SK (Stratagene) to form
plasmid pC6HIII3kb. Nucleotide sequence of the canarypox
insert in pC6HIII3kb is presented in Figure 28 (SEQ ID
1o N0:169). In Figure 28, the C6 ORF is located between
nucleotides 377 to 2254.
Extension of canarypox sequence to the right of
pC6HIII3kb was obtained by sequence analysis of
overlapping canarypox clones. In order to construct a
i5 donor plasmid for insertion of foreign genes into the C6
locus with the complete excision of the C6 open reading
frame, flanking 5' and 3' arms were synthesized by using
PCR primers and genomic canarypox DNA as template. The
380 by 5' flanking arm was synthesized using primers C6A1
20 (SEQ ID N0:170) 5'
ATCATCGAGCTCGCGGCCGCCTATCAAAAGTCTTAATGAGTT 3' and C6B1
(SEQ ID N0:171) 5'
GAATTCCTCGAGCTGCAGCCCGGGTTTTTATAGCTAATTAGTCATTTTTTCGTAAGT
AAGTATTTTTATTTAA 3'. The 1155 by 3' flanking arm was
25 synthesized using primers C6C1 (SEQ ID N0:172) 5'
CCCGGGCTGCAGCTCGAGGAATTCTTTTTATTGATTAACTAGTCAAATGAGTATATA
TAATTGAAAAAGTAA 3' and C6D1 (SEQ ID N0:173) 5'
GATGATGGTACCTTCATAAATACAAGTTTGATTAAACTTAAGTTG 3'. Left
and right flanking arms synthesized above were combined
3o by PCR reaction using primers C6A1 and C6D1, generating a
full length product of 1613bp. This PCR product was cut
near the ends with SacI/Kt~nI and cloned into pBS-SK cut
with SacI/Kt~nI, generating C6 insertion plasmid pC6L.
pC6L contains, in the C6 deletion locus, a multicloning
35 region flanked by translational stop codons and TSNT
transcriptional terminators (Yuen and Moss, 1986). The
sequence of pC6L is presented in Figure 29 (SEQ ID
WO 94/16716 . : PCTIUS94/00888
154
N0:174). In Figure 29, the multicloning region is
located between nucleotide 407 and nucleotide 428.
Annealed synthetic oligonucleotides VQC (SEQ ID
N0:175) 5'
TTAATCAGGATCCTTAATTAATTAGTTATTAGACAAGGTGAAACGAAACTATTTGTA
GCTTAATTAATTAGCTGCAGCCCGGG 3' and VQN (SEQ ID N0:176) 5'
CCCGGGCTGCAGCTAATTAATTAAGCTACAAATAGTTTCGTTTTCACCTTGTCTAAT
AACTAATTAATTAAGGATCCTGATTAA 3' were ligated into pBS-SK
resulting in an intermediate plasmid. Plasmid pMM117
to contains a SmaI/EcoRI polylinker fragment from this
intermediate plasmid replacing the SmaI/EcoRI polylinker
of pC6L.
Plasmid pMP42GPT contains the Escherichia coli
xanthine-guanine phosphoribosyl transferase gene (Ecogpt
is gene) (Pratt and Subramani, 1983) under the control of an
entomopox promoter (EPV 42kDa). The 31 by EPV 42kDa
promoter sequence (SEQ ID N0:177) used in pMP42GPT is 5'
CAAAATTGAAAATATATAATTACAATATAAA 3'.
Insertion of 42kDa/Ecogpt cassette into C6 locus;
2o Construction of pMP117Qpt-B. Plasmid pMP42GPT was cut
with EcoRI and a 0.7kb fragment containing the
42kDa/Ecogpt expression cassette was isolated. This
fragment was inserted into vector plasmid pMM117 cut with
EcoRI in both orientations, generating pMP117gpt-A and
2s pMP117gpt-B.
Insertion of I3L/murine IFNy cassette into C6 locus;
construction of pMPC6mIFQpt. Plasmid pMPI3mIF (Example
20) was cut with HindIII and blunt ended with Klenow
fragment of E. coli polymerase. The DNA was then cut
3o with PstI (partial digest) and a 0.6 kb fragment
containing the I3L/murine IFNy cassette was isolated.
Vector plasmid pMP117gpt-B was cut with SmaI (partial
digest) and full length linear DNA was isolated. This
was cut with PstI and the largest fragment was isolated.
35 Vector and insert fragments were ligated, resulting in
insertion plasmid pMPC6mIFgpt. In addition to the
I3L/murine IFNy expression cassette, plasmid pMPC6mIFgpt
WO 94116716 21 ~ 3 ~ 3 6 pCT~S94/00888
155 ,
contains the 42kDa/Ecogpt expression cassette to allow
for selection of recombinants through the use of --~°
mycophenolic acid (Boyle and Coupar, 1988; Falkner and
Moss, 1988).
Recombination was accomplished between donor plasmid
pMPC6mIFgpt and rescuing virus vCP275 (Example 18).
Recombinant virus are plaque purified. The resultant
ALVAC based recombinant virus contains the vaccinia I3L
promoted murine IFNY gene, as well as the EPV 42kDa
1o promoted Ecogpt gene, both in the C6 locus and the
vaccinia H6 promoted murine IL-2 gene in the C3 locus.
Insertion of Murine IFNy and Murine IL-2 into NYVAC.
Insertion of I3L~ murine IFNy cassette into TK locus;
construction of pMPTKm2IF. Plasmid pMPI3mIF (Example 20)
was cut with HindIII and blunt ended with Klenow fragment
of E. coli polymerase. The DNA was then cut with BamHI
and a 0.6 kb fragment containing the I3L/murine IFNy
cassette was isolated. This fragment was ligated with
vector plasmid pMM154 (Example 18) cut with SmaI/BamHI,
2o resulting in insertion plasmid pMPTKm2IF.
Recombination between donor plasmid pMPTKm2IF
and NYVAC rescuing virus generated recombinant virus
vP1243, which contains the vaccinia I3L promoted murine
IFNy gene and the vaccinia H6 promoted murine IL-2 gene,
both in the TK locus.
Expression of murine IL-2 in ALVAC and NYVAC based
recombinants: comparison with recombinants coexpressing
murine IL-2 and murine IFNY. ELISA assay. The level of
3o expression of murine IL-2 produced by ALVAC based
recombinants vCP275 and vCP288, and NYVAC based
recombinants vP1239 and vP1243 was quantitated using a
Murine Interleukin-2 ELISA kit from Collaborative
Biomedical Products, Inc., Becton Dickinson, Bedford, MA.
(Mouse IL-2 ELISA kit Cat. No. 30032). Duplicate dishes
containing confluent monolayers of murine L929 cells (2 x
106 cells/dish) were infected with recombinant virus
WO 94/16716 ~ . , PCT/US94100888
156
vCP275 or vP1239 expressing murine IL-2, recombinant
virus vCP288 or vP1243 coexpressing murine :CL-2 and
murine IFNy, or infected with ALVAC or NYVAC parental
virus. Following overnight incubation at 37 C,
supernatants were harvested and assayed for expression of
murine IL-2 using the mouse Interleukin-2 EhISA kit as
specified by the manufacturer (Collaborative Biomedical
Products, Inc., Becton Dickinson, Bedford, MA). The mouse
Interleukin-2 ELISA kit is a solid-phase enzyme-
lo immunoassay employing the multiple antibody sandwich
principle. ELISA plates were read at 490 nm. Background
from ALVAC or NYVAC samples was subtracted, and values
from duplicate dishes were averaged. The mouse
Interleukin-2 ELISA kit quantitates murine IL-2 in
Biological Response Modifiers Program (BRMP) units
(Gerrard et al., 1993). The quantity of murine IL-2
secreted is expressed as BRMP u/ml, which is equivalent
to BRMP u/106 cells (Table 27).
2o Table 27
Recombinant virus Cytokines expressed Murine IL-2 secreted
vCP275 mIL-2 1838 BRMP u/ml
vCP288 mIL-2 + mIFNy 2124 BRMP u/ml
vP1239 mIL-2 5030 BRMP u/ml
vP1243 mIL-2 + mIFNy 4353 BRMP u/ml
From the results reported in Table 27, it is evident that
co-expression of murine IFNy does not affect the level of
3o murine IL-2 expression by ALVAC or NYVAC-based
recombinants. Also, the level of murine IL-2 expression
under the conditions of this assay is approximately twice .
as high for NYVAC based recombinants as it is for ALVAC
based recombinants, in agreement with the results
presented in Table 23, which were based on a different
murine IL-2 ELISA assay (Intertest-2XTM, Genzyme
Corporation, Cambridge, MA).
WO 94116716 ~ PCTIUS94/00888
157 "
Example 23 - HUMAN IL-2 PLU8 IFNy INTO ALVAC AND NYVAC
Insertion of Human IFNY into C6 locus of ALVAC;
addition to ALVAC-Human IL-2 recombinant virus.
Insertion of I3LJhuman IFNY cassette into C6 locus;
construction of pMPC6I3hIF. Plasmid pMPI3hIF (Example
21) was cut with HindIII and blunt ended with Klenow
fragment of E. cvli polymerase. The DNA was then cut
with BamHI and a 0.6 kb fragment containing the I3L/human
IFNy cassette was isolated. ALVAC C6 vector plasmid
to pMM117 (Example 22) was cut with BamHI (partial)/SmaI and
the largest fragment was isolated. These fragments were
ligated, resulting in insertion plasmid pMPC6I3hIF.
Recombination was accomplished between donor
plasmid pMPC6I3hIF and rescuing virus vCP277 (Example
19). Recombinants are plaque purified. The resultant
ALVAC based recombinant virus contains the vaccinia I3L
promoted human IFNy gene in the C6 locus and the vaccinia
H6 promoted human IL-2 gene in the C3 locus
(vCP277+IFNy).
2o Insertion of Human IFNv and IL-2 into NYVAC.
Insertion of H6/human IL-2 cassette into the TK locus;
construction of pMPTK2hIF. Plasmid pMPTKI3hIF (Example
21) was cut with PstI and phosphatased with Shrimp
alkaline phosphatase. Plasmid pRW858 (Example 19) was
cut with PstI and a 700 by fragment isolated.
Phosphatased vector and insertion fragment were ligated,
resulting in plasmid pMPTK2hIF. In pMPTK2hIF, the two
human cytokine gene cassettes are both contained within
the NYVAC TK insertion site, oriented in a tail-to-tail
orientation. The human IFNY gene is under the control of
the vaccinia I3L promoter, and the human IL-2 gene is
under the control of the vaccinia H6 promoter.
Recombination was accomplished between donor
plasmid pMPTKh2IF and NYVAC rescuing virus. Recombinants
are plaque purified. The resultant NYVAC based
recombinant virus contains the vaccinia I3L promoted
human IFNy gene and the vaccinia H6 promoted human IL-2
WO 94116716 . . ~' , . .. PCTIUS94100888
158
gene, both in the TK locus (NYVAC+IFNY+IL-2).
E
l
24 -
N
IN
O ALVAC AND NYV
C
I
-
xamp
e
MURI
E
L
4
T
A
Murine IL-4 into ALVAC. Plasmid p2A-E3, containing
the murine IL-4 gene, (m IL-4) was obtained from the
American Type Culture Collection (ATCC No. 37561). The
murine IL-4 gene was placed under the control of the
vaccinia E3L promoter by PCR as described below.
The vaccinia E3L promoter, a strong early
promoter, is located immediately upstream from the
1o vaccinia E3L open reading frame (Goebel et al., 1990).
Nucleotide sequence of the E3L/murine IL-4
expression cassette is presented in Figure 30 (SEQ ID
N0:178). In Figure 30, the start codon of the murine IL-
4 gene is at nucleotide position 68, and the stop codon
is at nucleotide position 488.
The mIL-4 gene was amplified by PCR with
oligonucleotide primers MIL45 (SEQ ID N0:179) 5'
CTCACCCGGGTACCGAATTCGAATAAAAAAATGATAAAGTAGGTTCAGTTTTATTGC
TGGTTGTGTTAGTTCTCTCTAAAAATGGGTCTCAACCCCCAG 3' and MIL43
(SEQ ID N0:180) 5'
TTAGGGATCCAGATCTCGAGATAAAAACTACGAGTAATCCATTTGCATGATGCTC
3' and plasmid p2A-E3 (ATCC) as template. The resulting
fragment contained the mIL-4 gene linked to the vaccinia
E3L promotor and flanked by XmaI/KpnI/EcoRI and
XhoI/BqlII/BamHI sites at the 5' and 3' ends,
respectively. The amplified E3L/mIL-4 fragment was
digested with XmaI/BamHI and ligated to an XmaI/BamHI-
digested pVQCP3LSA-5 vector fragment. Plasmid pVQCP3LSA-
5 (same as VQCP3LSA-3, Example 20) is an ALVAC C3 locus
3o insertion plasmid. The resulting C3 donor plasmid was
designated pC3.MIL4.2. An expression cassette consisting
of the E. coli gpt gene linked to the entomopox 42kDa
promoter was isolated as a SmaI fragment from plasmid
pMP42GPT (Example 22), then cloned into a SmaI-digested
pC3.MIL4.2 vector fragment. The resulting plasmid was
designated pC3MIL4.gpt.
Recombination was accomplished between donor
WO 94116716 21 ~ 3 3 3 fi PCTIUS94/00888
159 '.. .
plasmid pC3MIL4.gpt and ALVAC rescuing virus using the
mycophenolic acid selection system (Example 22).
Recombinant virus are plaque purified. The resultant
recombinant virus contains the murine IL-4 gene under the
control of the vaccinia E3L promoter, as well as the
Ecogpt gene under the control of the EPV 42kDa promoter,
both at the C3 locus of ALVAC.
Murine IL-4 into NYVAC. The mIL-4 gene was
amplified by PCR with primers MIL45 (SEQ ID N0:179) and
1o MIL43 (SEQ ID N0:180) and plasmid p2A-E3 (ATCC) as
template. The resulting fragment contained the mIL-4
gene linked to the vaccinia E3L promotor and flanked by
XmaI/KpnI/EcoRI and XhoI/BqlII/BamHI sites at the 5' and
3' ends, respectively. The amplified E3L/mIL-4 fragment
was digested with XmaI/BamHI. NYVAC TK insertion plasmid
pSD542 (Example 18) was digested with XmaI/BamHI and
ligated to the XmaI/BamHI-digested PCR fragment. The
resulting TK donor plasmid was designated pTK-mIL4.
Recombination between donor plasmid pTK-mIL4
2o and NYVAC rescuing virus generated recombinant virus
vP1248 which contains the vaccinia E3L promoted murine
IL-4 gene in the TK locus.
Example 25 - HUMAN IL-4 INTO ALVAC AND NYVAC
Human IL-4 into ALVAC. Plasmid pcD-hIL-4,
containing the human IL-4 gene, was obtained from the
American Type Culture Collection (ATCC No. 57593).
PCR fragment PCRhIL4-I was synthesized using plasmid
pcD-hIL-4 as template DNA and synthetic oligonucleotides
E3LIL4-C (SEQ ID N0:181) 5'
3o GCTGGTTGTGTTAGTTCTCTCTAAAAATGGGTCTCACCTCCCAACTG 3' and
E3LIL4-D (SEQ ID N0:182) 5'
ATCATCTCTAGAATAAAAATCAGCTCGAACACTTTGAATATTTCTCTCTCATG 3'
as primers.
Oligonucleotides E3LIL4-A (SEQ ID N0:183) 5'
ATCATCAAGCTTGAATAAAAAAATGATAAAGTAGGTTCAGTTTTATTGCTGGTTGTG
TTAGTTCTCTCTAAAA 3' and E3LIL4-B (SEQ ID N0:184) 5'
TTTTAGAGAGAACTAACACAACCAGCAATAAAACTGAACCTACTTTATCATTTTTTT
WO 94!16716 PCTIUS94100888
160
ATTC 3' were annealed to generate Fragment II containing
the vaccinia E3L promoter sequence (Example 24).
A second fusion PCR product (PCRhIL4-II) was
~t obtained using PCR fragment PCRhIL4-I and Fragment II
s (annealed oligos) as DNA template and E3LIL4-D and
E3LIL4-E (SEQ ID N0:185)
5' ATCATCAAGCTTGAATAAAAAAATGATAAAGTAGGTTCAG 3' as
oligonucleotide primers. A complete HindIII/XbaI digest
of PCRhIL4-II yielded an 536 by fragment which was
1o subsequently isolated. A complete HindIII/XbaI digest of
pBS-SK+ (Stratagene) was performed and the 2.9 kb
fragment isolated. The isolated fragments were ligated,
resulting in plasmid pBShIL4.
Figure 31 (SEQ ID N0:186) presents the nucleotide
is sequence of the expression cassette consisting of the E3L
promoted human IL-4 gene. The start codon for the human
IL-4 gene is at nucleotide position 62, and the stop
codon is at nucleotide position 521.
A complete XbaI digest of plasmid pBShIL4 was
2o performed. Ends were filled in using Klenow fragment of
E. coli polymerase. This linearized plasmid was then
digested with XhoI and the 536 by fragment, containing
the E3L promoter and human IL4 gene, was isolated. C3
insertion vector plasmid VQCP3LSA (same as pVQCP3LSA-3,
2s Example 20) was completely digested with XhoI/SmaI and
the 6.5 kb fragment isolated. The isolated fragments
were ligated, resulting in insertion plasmid pC3hIL4.
Recombination between donor plasmid pC3hIL4 and
ALVAC rescuing virus generated recombinant virus vCP290,
3o which contains the vaccinia E3L promoted human IL-4 gene
in the C3 locus.
Human IL-4 into NYVAC. Plasmid pBShIL4 (discussed
above) contains the E3L/human IL-4 expression cassette in
pBS-SK. A complete XbaI digest of plasmid pBShIL4 was
35 performed. Ends were filled in using Klenow fragment of
E. coli polymerase. This linearized plasmid was then
digested with XhoI and the 536 by fragment, containing
WO 94/16716 PCTIUS94/00888
2153336
161
the E3L promoter and human IL-4 gene, was isolated.
NYVAC TK insertion vector plasmid pSD542 (Example 18) was
completely digested with XhoI/SmaI and the 3.9 kb
fragment isolated. The isolated fragments were ligated,
resulting in insertion plasmid pTKhIL4.
Recombination between donor plasmid pTKhIL4 and
NYVAC rescuing virus generated recombinant virus vP1250,
which contains the vaccinia E3L promoted human IL-4 gene
in the TK locus.
1o Example 26 - HUMAN GMCSF IN ALVAC AND NYVAC
Human GMCSF into ALVAC. Plasmid GMCSF, containing
the gene encoding the human granulocyte-macrophage
colony-stimulating factor (hGMCSF), was obtained from the
American Type Culture Collection (ATCC No. 39754).
is PCR fragment GMCSF-I was synthesized using plasmid
GMCSF as template DNA and E3LGMC-A (SEQ ID N0:187)
5' GCTGGTTGTGTTAGTTCTCTCTAAAAATGTGGCTGCAGAGCCTGCTG 3' and
E3LGMC-B (SEQ ID N0:188)
5' ATCATCCTCGAGATAAAAATCACTCCTGGACTGGCTCCCAGCAGTCAAAGGGG
20 3' as oligonucleotide primers.
Synthetic oligonucleotides E3LSMA-B (SEQ ID N0:189)
5'
ATCATCCCCGGGGAATAAAAAAATGATAAAGTAGGTTCAGTTTTATTGCTGGTTGTG
TTAGTTCTCTCTAAAA 3' and E3LIL4-B (SEQ ID N0:184; Example
2s 25) were annealed to generate fragment GMCSF-P containing
the vaccinia E3L promoter sequence.
A fusion PCR product (GMCSF-II) was obtained using
fragments GMCSF-I and GMCSF-P as DNA templates and
E3LSMA-A (SEQ ID N0:190) 5'
3o ATCATCCCCGGGGAATAAAAAAATGATAAAGTAGGTTCAG3' and E3LGMC-B
as oligonucleotide primers. A complete XhoI/SmaI digest
of GMCSF-II yielded a 0.5 kb fragment which was
subsequently isolated. A complete XhoI/SmaI digest of
pBS-SK+ was performed and the 2.9 kb fragment isolated.
3s The isolated fragments were ligated, resulting in plasmid
pBSGMCSF, which contains the vaccinia E3L/hGMCSF
expression cassette.
WO 94!16716 PCT/US94/00888
162
Nucleotide sequence of the vaccinia E3L/hGMCSF
expression cassette is given in Figure 32 (SEQ ID
''f N0:191). In Figure 32, the start codon for hGMCSF is at
nucleotide position 62, the stop codon is at nucleotide
position 494.
A complete XhoI/SmaI digest of pBSGMCSF (above) was
performed and the 0.5 kb fragment, containing the
vaccinia E3L promoter and hGMCSF gene, was isolated.
ALVAC C3 insertion plasmid VQCP3LSA (Example 20) was
1o completely digested with XhoI/SmaI and the 6.5 kb
fragment isolated. The isolated fragments were ligated,
resulting in plasmid pC3hGMCSF.
Recombination between donor plasmid pC3hGMCSF and
ALVAC rescuing virus generated recombinant virus vCP285,
which contains the vaccinia E3L promoted human GMCSF gene
in the C3 locus.
Human GMCSF into NYVAC. A complete XhoI/SmaI digest
of pBSGMCSF was performed and the 0.5 kb fragment,
containing the vaccinia E3L promoter and hGMCSF gene, was
2o isolated. pSD542 (Example 18) was completely digested
with XhoI/SmaI and the 3.9 kb fragment isolated. The
isolated fragments were ligated, resulting in plasmid
pTKhGMCSF.
Recombination between donor plasmid pTKhGMCSF and
NYVAC rescuing virus generated recombinant virus vP1246,
which contains the vaccinia E3L promoted human GMCSF gene
in the TK locus.
Expression of human GMCSF in ALVAC and NYVAC based
recombinants. ELISA assav. The level of expression of
3o human GMCSF produced by ALVAC and NYVAC based
recombinants vCP285 and vP1246 was quantitated using an
ELISA kit from Genzyme Corporation, Cambridge, MA.
(Factor-Test Human GM-CSF ELISA Kit, Genzyme Corporation,
product code GM-TE.) Duplicate dishes containing
confluent monolayers of human HeLa cells (2 x 106
cells/dish) were infected with recombinant virus vCP285
or vP1246 expressing human GMCSF or infected with ALVAC
WO 94/16716 21 ~ 3 3 3 ~G ~T~S94100888
163
or NYVAC parental virus. Following overnight incubation
at 37°C, supernatants were harvested and assayed for
expression of human GMCSF using the Factor-Test Human GM-
CSF ELISA kit as specified by the manufacturer (Genzyme
Corporation, Cambridge, MA). The Factor-Test Human GM-
CSF ELISA Kit is a solid-phase enzyme-immunoassay
employing the multiple antibody sandwich principle.
ELISA plates were read at 490 nm. Background from ALVAC
or NYVAC samples was subtracted, and values from
to duplicate dishes were averaged. The quantity of human
GMCSF secreted is expressed as picograms(pg)/ml, which is
equivalent to pg/106 cells (Table 28).
Table 28
is Recombinant virus Human GMCSF secreted
vCP285 2413 pg/ml
vP1246 4216 pg/ml
Example 27 - HUMAN IL-12 IN ALVAC AND NYVAC
Derivation of DNA encoding the two subunits of the
human IL-12 ctene. First strand cDNA synthesis was
performed on total RNA isolated from human EBV
transformed cell line GJBCL stimulated 24 hrs. with 100nM
Phorbol 12,13-Dibutyrate. Oligonucleotide primers used
for PCR amplification of the genes encoding the p35 and
p40 subunits (below) were based on the published human
IL-12 sequence (Gubler et al., 1991).
3o The p40 subunit of the human IL-12 gene (hIL12p40)
was obtained as PCR fragment PCR J60 using first strand
cDNA from cell line GJBCL as template and
oligonucleotides JP202 (SEQ ID N0:192) 5'
CATCATATCGATGGTACCTCAAAATTGAAAATATATAATTACAATATAAAATGTGTC
ACCAGCAGTTGG 3' and JP189 (SEQ ID N0:193) 5'
TACTACGAGCTCTCAGATAGAAATTATATCTTTTTGGG 3' as primers.
PCR J60 was cut with SacI/ClaI and a 1.0 kb fragment was
isolated and ligated with pBSSK+ (Stratagene), cut with
SacI/ClaI, generating plasmid PBSHIL12p40II. In plasmid
4o PBSHIL12p40II, hIL12p40 is under the control of the
WO 94/16716 PCTIUS94/00888
164
entomopox 42kDa promoter (Example 22).
The sequence of the EPV 42kDa/human IL-12 P40
expression cassette is presented in Figure 33 (SEQ ID
N0:194). In Figure 33, the initiation codon for the
s human IL-12 P40 subunit is at nucleotide position 32, the
stop codon is at nucleotide position 1017.
The p35 subunit of the human IL-12 gene (hIL12p35)
was obtained as PCR fragment PCR J59 using first strand
cDNA from cell line GJBCL as template as oligonucleotides
l0 JP186 (SEQ ID N0:195) 5'
CATCATGGTACCTCAAAATTGAAAATATATAATTACAATATAAAATGTGTCCAGCGC
GCAGCC 3' and JP201 (SEQ ID N0:196) 5'
TACTACATCGATTTAGGAAGCATTCAGATAG 3' as primers. PCR J59
was cut with Asp718/Clal and a 0.7 kb fragment was
1s isolated and ligated with pBSSK+ (Stratagene), generating
plasmid PG2. The hIL12p35 gene was put under the control
of the vaccinia E3L promoter (Example 24) by a PCR
reaction using plasmid PG2 as template and
oligonucleotides JP218 (SEQ ID N0:197) 5'
20 CATCATGGTACCGAATAAAAAAATGATAAAGTAGGTTCAGTTTTATTGCTGGTTGTG
TTAGTTCTCTCTAAAAATGTGTCCAGCGCGCAGCC 3' and JP220 (SEQ ID
N0:198) 5' CATCATATCGATTTAGGAAGCATTCAGATAGCTCGTCAC 3' as
primers. PCR J62 was cut with Asp718/ClaI and a 0.7 kb
fragment was isolated and ligated with pBSSK+
2s (Stratagene), generating plasmid PBSHIL12p35II.
The sequence of the vaccinia E3L/human IL-12 P35
expression cassette is presented in Figure 34 (SEQ ID
N0:199). In Figure 34, the initiation codon for the
human IL-12 P35 subunit is at nucleotide position 62, the
3o stop codon is at nucleotide position 719.
A cassette containing poxvirus-promoted genes for
both subunits of human IL-12 was assembled in pBSSK+ by
ligating a 0.7kb As~718/ClaI fragment from PBSHIL12p35II
and a l.Okb Asp718/SacI fragment from PBSHIL12p40II into
3s pBSSK+ cut with SacI/ClaI. The resulting plasmid was
designated PBSHIL12. In PBSHIL12 the EPV 42kDa/hIL12p40
cassette and the vaccinia E3L/hIL12p35 cassette are
I
WO 94!16716 2 1 5 3 3 3 fi p~~S94100888
165
oriented in a head-to-head orientation relative to each
other.
Human IL-12 into ALVAC. The combination cassette
containing poxvirus-promoted genes for both subunits of
human IL-12 was excised as a l.7kb SacI/ClaI fragment
from plasmid PBSHIL12. The fragment was blunt-ended by
treatment with the Klenow fragment of E. coli polymerase,
and cloned into ALVAC C6 vector plasmid pC6L (Example 22)
cut with SmaI. The resulting plasmid was designated
l0 pC6HIL12.
Recombination was performed between donor plasmid
pC6HIL12 and ALVAC rescuing virus. Recombinant virus are
plaque purified. The resultant recombinant virus (ALVAC
+ IL-12) contains both of the human IL-12 genes in the C6
locus of ALVAC.
Human IL-12 into NYVAC. The combination cassette
containing poxvirus-promoted genes for both subunits of
human IL-12 was excised as a l.7kb SacI/ClaI fragment
from plasmid PBSHIL12. The fragment was blunt-ended by
2o treatment with the Klenow fragment of E. coli polymerase,
and cloned into NYVAC TK vector plasmid pSD542 (Example
18) cut with SmaI. The resulting plasmid was designated
pTKHIL12.
Recombination was performed between donor plasmid
pTKHIL12 and NYVAC rescuing virus. Recombinant virus are
plaque purified. The resultant recombinant virus (NYVAC
+ IL-12) contains both of the human IL-12 genes in the TK
locus of NYVAC.
Example 28 - MURINE B7 IN ALVAC AND NYVAC
3o Murine B7 into ALVAC. Preparation of cDNA for
murine B7. Macrophages from a naive Balb/c mouse spleen
were stimulated in vitro with Concanavalin A and LPS.
Total RNA from these cells was used as a template for
first-strand cDNA synthesis by reverse transcription
using oligo dT as a primer. An aliquot of first strand
cDNA preparation was used for the specific murine B7 cDNA
amplification by PCR using the primers LF32 (SEQ ID
WO 94116716 ' ' PCTIUS94100888
166
N0:200) 5'
TATCTGGAATTCTATCGCGATATCCGTTAAGTTTGTATCGTAATGGCTTGCAATTGT
CAG 3' and LF33 (SEQ ID N0:201) 5'
ATCGTAAGCTTACTAAAGGAAGACGGTCTG 3'. The specific primers
LF32 and LF33 were derived from the published sequence of
murine B7 (Freeman and al., 1991). Nucleotides 5' to the
ATG in LF32 correspond to part of the vaccinia H6
promoter (Perkus et al., 1989). The amplified 951
nucleotide cDNA fragment containing the murine B7 gene
1o was digested by EcoRI and HindIII and subsequently cloned
into the corresponding sites of the plasmid pBSSK+
(Statagene). The resulting plasmid, pLFl, was digested
with NruI and XhoI, and a 949 by fragment containing part
of the vaccinia H6 promoter and the entire murine B7 gene
was isolated.
Plasmid pMPC616E6 contains a non relevant gene
under the control of the vaccinia H6 promoter in the
ALVAC C6 insertion locus. Plasmid pMPC616E6 was digested
with NruI and XhoI, and the 4,403 by NruI-XhoI fragment
2o containing the bulk of the H6 promoter in the ALVAC C6
insertion locus was isolated. This vector fragment was
ligated with the NruI/XhoI fragment from pLFi. The
resulting plasmid was named pLF4.
Nucleotide sequence of the murine B7 gene is
given in Figure 35 (SEQ ID N0:202). In Figure 35, the
start codon for the murine B7 gene is at nucleotide 1 and
the stop codon is at nucleotide 919.
Recombination between donor plasmid pLF4 and
ALVAC rescuing virus generated recombinant virus vCP268,
3o which contains the vaccinia H6 promoted murine B7 gene in
the C6 locus.
Murine B7 into NYVAC. Plasmid pSIVl2 contains
a nonrelevant gene under the control of the vaccinia H6
promoter in the NYVAC I4L insertion locus. Plasmid
pSIVl2 was digested with NruI and XhoI, and the 3,557 by
NruI-XhoI fragment containing the bulk of the H6 promoter
in the NYVAC I4L insertion locus was isolated. This
21333
WO 94/16716 PCTlUS94/00888
167 . .~
fragment was ligated to annealed synthetic ~'
oligonucleotides LF57 (SEQ ID N0:203) 5'
CGACATTTGGATTTCAAGCTTCTACG 3' and LF58 (SEQ ID N0:204) 5'
GATCCGTAGAAGCTTGAAATCCAAATGTCG 3' which contain an
internal HindIII site. The resulting plasmid, pLF2, was
digested with NruI and HindIII, and a 3,659bp vector
fragment was isolated. Plasmid pLFl (above) was digested
with NruI and HindIII, and a 951 by NruI-HindIII fragment
containing part of the vaccinia H6 promoter and the
to entire murine B7 gene was isolated. These two fragments
were ligated, generating plasmid pLF3.
Plasmid pLF3 corresponds to an I4L NYVAC donor
plasmid containing the entire murine B7 coding sequence
under the control of the vaccinia H6 promoter.
is Recombination between donor plasmid pLF3 and NYVAC
rescuing virus generated recombinant virus vP1230, which
contains the vaccinia H6 promoted murine B7 gene in the
I4L locus.
Surface expression of B7 on murine tumor cells
2o infected with ALVAC and NYVAC-based recombinants
expressing murine B7. K1735 mouse melanoma cells and CC-
36 mouse colon carcinoma cells were infected with 10 pfu
per cell of NYVAC-B7 (vP1230), ALVAC-B7 (vCP268), or
NYVAC or ALVAC parental virus for 1 hour, washed free of
2s unadsorbed virus by centrifugation, and incubated at
37°C. B16 mouse melanoma cells were treated similarly
except that the cells were infected with 5 pfu of virus
per cell. After a 1 hr (K1735) or overnight (CC-36;B16)
incubation, the cells were washed in PBS by
3o centrifugation and resuspended in 1.0 ml of PBS. To each
cell preparation, 0.005 ml of 1:5 diluted Fc Block
(Pharmingen, San Diego, CA, cat. 01241A; purified anti-
mouse Fcy II receptor) and 0.1 ml of 1:100 diluted FITC-
rat anti-mouse B7 monoclonal antibody (Pharmingen, cat.
35 01944D) was added. The cells were incubated for 30
minutes at 4°C, washed twice in cold PBS by
centrifugation and analyzed for cell-associated FITC
TWO 94116716 . ' PCTIUS94100888
d' __
i6a
fluorescence by flow cytometry (Becton-Dickinson
FACScan).
Although K1735 cells infected with NYVAC-B7
(vP1230) or ALVAC-B7 (vCP268) for 1 hour showed only
slightly higher fluorescence than control uninfected or
NYVAC or ALVAC infected cells, B7 expression in
recombinant infected CC-36 and B16 cells was remarkable
(Figure 36). As demonstrated by the uninfected control
cells, none of the three cell lines endogenously
io expresses murine 87. Clearly, infection of established
murine tumor cell lines with NYVAC-B7 (vP1230) or ALVAC-
B7 (vCP2G8), but not the vectors NYVAC or ALVAC, results
in high levels of expression of the murine T-lymphocyte
co-activator molecule, BB-1/B7.
Example 29 - HUMAN B7 IN NYVAC
Preparation of cDNA for human B7.
Macrophages from human peripheral blood were
stimulated in vitro with Concanavalin A and LPS. Total
RNA from these cells was used as a template for first
2o strand cDNA synthesis by reverse transcription using
oligo dT as a primer. An aliquot of first strand DNA
preparation was used for specific human B7 cDNA
amplification by PCR using the primers LF62 (SEQ ID
N0:205) 5' ATCGTAAGCTTATTATACAGGGCGTACACTTTC 3' and
LF6lbis (SEQ ID N0:206) 5'
TATCTGGAATTCTATCGCGATATCCGTTAAGTTTGTATCGTAATGGGCCACACACGG
AGG 3'.
The specific primers LF62 and LF6lbis were derived
from the published sequence of human B7 (Freeman and al.,
1989). Nucleotides 5' to the ATG in LF6lbis correspond
to part of the vaccinia H6 promoter (Perkus et al.,
1989). The amplified 997 nucleotide cDNA fragment
containing the murine B7 gene was digested by EcoRI and
HindIII and subsequently cloned into the corresponding
sites of the plasmid pBSSK+ (Stratagene). This plasmid
was designated pLF6.
The sequence for the human B7 gene is presented in
WO 94/16716 215 3 3 3 ~ ~T~S94I00888
169
Figure 37 (SEQ ID N0:207). In Figure 37, the start codon
for the human B7 gene is at nucleotide position 1 and the
stop codon is at nucleotide position 865.
Insertion of Human B7 into NYVAC.
Plasmid pLF3 (Example 28) was digested with NruI and
HindIII and a 3652 by vector fragment containing the bulk
of the H6 promoter in the NYVAC I4L insertion locus was
isolated. Plasmid pLF6 (above) was digested with NruI
and HindIII, and a 897 by fragment containing part of the
to vaccinia H6 promoter and the entire human B7 gene was
isolated. These two fragments were ligated, generating
plasmid pLF7.
Plasmid pLF7 corresponds to an I4L NYVAC donor
plasmid containing the entire human B7 coding sequence
under the control of the vaccinia H6 promoter.
Recombination between donor plasmid pLF7 and NYVAC
rescuing virus generated recombinant virus vP1245, which
contains the vaccinia H6 promoted human B7 gene in the
I4L locus.
2o Expression of human B7. FACScan.
Human HeLa cells were infected with recombinant
virus vP1245 expressing human B7 or with NYVAC parental
virus. A monoclonal antibody specific for human B7
(Anti-BB1(B7), Cat. No. 550024, Becton Dickinson Advanced
Cellular Biology, San Jose, CA), was used to detect
expression of human B7 on the surface of infected cells
by flow cytometry (Becton-Dickinson FACScan) as described
in Example 28. B7 was detected on the surface of cells
infected with recombinant virus vP1245. B7 was not
3o detected on the surface of uninfected cells or cells
infected with NYVAC parental virus.
Immuno~recipitation. NYVAC based recombinant virus
vP1245 was assayed for expression of the human B7 gene
using immunoprecipitation. Recombinant or parental virus
3s were inoculated onto preformed monolayers of tissue
culture cells in the presence of radiolabelled 35S-
methionine and treated as previously described (Taylor et
WO 94/16716 PCT/US94/00888
17o
al., 1990). Immunoprecipitation reactions were
performed using a monoclonal antibody specific for human
B7 (Anti-BB1(B7), Cat. No. 550024, Becton Dickinson
Advanced Cellular Biolo
gy, San Jose, CA). A protein of
s between approximately 44 and 54 kDa was precipitated from
~t cells infected with recombinant virus vP1245, in
agreement with Freeman et al. (1989). The protein was
not immunoprecipitated from uninfected cells or cells
infected with NYVAC parental virus.
1o Example 30 - CO-INSERTION OF MURINE IFNy AND MURINE 87
INTO ALVAC AND NYVAC
Co-Insertion of Murine IFNy and Murine B7 into
ALVAC. Recombination was accomplished between donor
15 plasmid pLF4 (Example 28) and rescuing virus vCP271
(Example 20). Recombinant virus are plaque purified.
The resultant ALVAC based recombinant virus (ALVAC + IFNy
+ B7) contains the vaccinia I3L promoted murine IFNy gene
in the C3 locus and the vaccinia H6 promoted murine B7
2o gene in the C6 locus.
Co-Insertion of Murine IFNY and Murine B7 into
NYVAC. Recombination was accomplished between donor
plasmid pMPTKmIF (Example 20) and rescuing virus vP1230
(Example 28). Recombinant virus are plaque purified.
25 The resultant NYVAC based recombinant virus
(NYVAC+IFNy+B7) contains the vaccinia I3L promoted murine
IFN~y gene in the TK locus and the vaccinia H6 promoted
murine B7 gene in the I4L locus.
Example 31 - INSERTION OF WILDTYPE AND MUTANT FORMS OF
30 MURINE P53 INTO ALVAC
The gene for the nuclear phosphoprotein p53 is the
gene most frequently found to be mutated in a wide
variety of human tumors (reviewed in Hollstein et al.,
3s 1991). NYVAC and ALVAC-based p53 recombinant virus. are
described in Example 15.
Insertion of wildtype Murine p_53 into ALVAC.
Plasmid p11-4 containing murine wild-type p53 was
received from Arnold Levine (Princeton University,
WO 94/16716 ~ ~ PCTIUS94I00888
W
Princeton, New Jersey). The p53 sequence is described in
Pennica et al., (1984). The murine wild-type p53 gene
was placed under the control of the vaccinia H6 promoter
and the p53 3' non coding end was removed with PCR-
derived fragments.
A fragment containing the H6 promoted 5' end of the
p53 gene fused to the 3' end of the p53 gene was
generated by several PCRs as described below.
PCR I: Plasmid pRW825, containing the H6 promoter
1o and a nonpertinent gene, was used as template with
oligonucleotides MM080 (SEQ ID N0:208) 5'
ATTATTATTGGATCCTTAATTAATTAGTGATACGC 3' and MM081 (SEQ ID
N0:209) 5'
CTCCTCCATGGCAGTCATTACGATACAAACTTAAC 3' producing a 228bp
fragment containing the H6 promoter and the 5'-most base
pairs of the murine p53 gene. MM080 anneals to the 5'
end of the H6 promoter and primes toward the 3' end.
MM081 anneals to the 3' end of the H6 promoter and primes
toward the 5' end.
2o PCR II: Plasmid p11-4 was used as template with
oligonucleotides MM082 (SEQ ID N0:210) 5'
CGTTAAGTTTGTATCGTAATGACTGCCATGGAGGAGTC 3' and MM083 (SEQ
ID N0:211) 5'
TAGTAGTAGTAGTAGCTTCTGGAGGAAGTAGTTTCC 3' to generate a
129bp fragment with the 3'-end of the H6 promoter, the 5'
end of the p53 gene followed by l5bp which overlaps PCR
fragment PCRIII (described below). MM082 contains the 3'
end of the H6 promoter and primes from the 5' end of the
murine p53 gene. MM083 anneals to position 97 (Figure
38) of the murine p53 gene and primes toward the 5' end.
PCRIII: Plasmid p11-4 was used as template with
oligonucleotides MM084 (SEQ ID N0:212) 5'
CAGAAGCTACTACTACTACTACCCACCTGCACAAGCGCC 3' and MM085 (SEQ
ID N0:213) 5'
AACTACTGTCCCGGGATAAAAATCAGTCTGAGTCAGGCCCCAC 3' to
generate a 301bp fragment. The 301bp PCR-derived
fragment contains the 3' end of the p53 gene, and the 5'
WO 94/16716 PCT/US94I00888
172
end overlaps the 3' end of the PCRII product. MM084 (SEQ
ID N0:212) primes from position 916 of the murine p53
gene toward the 3' end. MM085 (SEQ ID N0:213) primes
from position 1173 toward the p53 gene 5' end. The three
s PCR products were pooled and primed with MM080 and MM085. '
The resultant 588bp fragment contains a BamHI site
followed by the H6 promoted 5' end of the p53 gene fused
to the p53 gene 3' end followed by a SmaI site; the 5'
end of the p53 gene ends at the XhoI site at position 37,
to and the 3' end starts at the SacII site at position 990
(Figure 38). The 588bp PCR-derived fragment was digested
with BamHI and SmaI generating a 565bp fragment which was
inserted into BamHI/SmaI digested pNC5LSP5 (described
below). The resultant plasmid, designated pMM136, was
15 digested with KspI and XhoI to remove a 149bp fragment,
and the 953bp KS~I/XhoI fragment from p11-4 was inserted.
The resultant plasmid, pMM148, contains the H6 promoted
wild-type murine p53 in the ALVAC C5 insertion locus.
The construction of pNC5LSP5 is as follows. A C5
2o insertion vector plasmid pCSLSP (Example 14) was digested
with EcoRI, treated with alkaline phosphatase and ligated
to self-annealed oligonucleotide CP29 (SEQ ID N0:102) 5'
AATTGCGGCCGC 3', then digested with NotI and linear
purified followed by self-ligation. This procedure
25 introduced a NotI site to pCSLSP, generating pNC5LSP5.
The nucleotide sequence of the wildtype murine p53
gene is presented in Figure 38 (SEQ ID N0:214). The
start codon is at position 1 and the stop codon is at
position 1171.
3o Recombination between donor plasmid pMM148 and
ALVAC rescuing virus generated recombinant virus vCP263.
vCP263 contains the wild type murine p53 gene under the
control of the vaccinia H6 promoter in the C5 locus.
Insertion of a mutant form of Murine p53 into ALVAC.
35 Plasmid pSVK215 containing a mutant form of the murine
p53 gene was received from Arnold Levine (Princeton
University, Princeton, New Jersey). The mutation in
WO 94116716 3 ~ PCTIUS94100888
173
pSVKH215 changes the sequence GTAC of the murine p53
coding sequence (Figure 38) nt positions 643 through 646 ...
to CCAAGCTTGG. The insertion between nt positions 643
and 646 changes the predicted amino acid coding sequence
s from val-pro to pro-ser-leu-ala; and the insertion
replaces a K~nI site with a HindIII site. The
construction of pSVKH215 is described in Tan et al.,
(1986).
Plasmid pMM136 (described above) contains the
to vaccinia H6 promoted 5' end of the p53 gene fused to the
3' end of the p53 gene in an ALVAC C5 locus insertion
plasmid. pMM136 was digested with KspI and XhoI to
remove 149bp, and the 960bp KspI/XhoI fragment containing
the mutation described above from pSVKH215 was inserted.
1s The resultant plasmid, pMM149, contains the H6 promoted
murine mutant p53 gene in the C5 locus.
Recombination between donor plasmid pMM149 and
ALVAC rescuing virus generated recombinant virus vCP267.
vCP267 contains the mutant form of the murine p53 gene
2o under the control of the vaccinia H6 promoter in the C5
locus.
Example 32 - INSERTION OF MUTANT FORMS OF HUMAN P53
INTO AhVAC AND NYVAC
25 Mutant forms of Human o53 into ALVAC.
Figure 18 (Example 15) presented the sequence of the
vaccinia H6 promoted human wild type p53 gene cassette in
an ALVAC-based recombinant, vCP207. In this example, to
facilitate description of the mutant forms of the human
3o p53 gene being described, Figure 39 (SEQ ID N0:215)
presents only the coding sequence for the human wild type
p53 gene. The start codon is at position 1 and the stop
codon is at position 1180.
Plasmid Cx22A, containing a mutant form of the human
3s p53 gene, was received from Arnold Levine (Princeton
University, Princeton, New Jersey). Relative to the wild
type p53 sequence presented in Figure 39, the G at
nucleotide position 524 is substituted with an A,
WO 94116716 ~ ' ' ~ PCT/US94100888
changing the arg amino acid at codon 175 of the wild type
Zc' protein to a his amino acid in Cx22A.
Plasmid pMM110 (Example 15, Figure 18) contains the
vaccinia H6 promoted wildtype human p53 gene in the ALVAC
C5 insertion site. The human p53 gene contains two PflmI
sites. p53 coding sequences upstream from the first
PflmI site and downstream from the second PflmI site are
the same in pMM110 as in Cx22A. pMM110 was digested with
PflmI to remove the 853 central base pairs of the p53
1o gene. The 853bp PflmI fragment from Cx22A containing the
base change at position 524 was inserted. The resultant
plasmid, pMM143, contains the H6 promoted mutant p53
gene.
Recombination between donor plasmid pMM143 and ALVAC
rescuing virus generated recombinant virus,vCP270.
vCP270 contains the mutant form of the human p53 gene
under the control of the vaccinia H6 promoter in the C5
locus.
Plasmid pR4-2 containing a mutant form of the human
2o p53 gene was received from Arnold Levine (Princeton
University, Princeton, New Jersey). Relative to the wild
type p53 sequence presented in Figure 39, the G at
nucleotide position 818 is substituted by an A, changing
the arg codon at amino acid position 273 to a his codon
in pR4-2.
Plasmid pMM110 (Example 15, Figure 18) contains the
vaccinia H6 promoted human wildtype p53 gene in the ALVAC
C5 insertion site. p53 coding sequences upstream from
the first PflmI site and p53 coding sequences downstream
3o from the second PflmI site are the same in pMM110 as in
pR4-2. pMM110 was digested with PflmI to remove the 853
central base pairs of the p53 gene. The 853bp PflmI
fragment from pR4-2 containing the base change at -
nucleotide position 818 was inserted. The resultant
plasmid, pMM144, contains the H6 promoted mutant form of
the human p53 gene in the C5 insertion locus.
Recombination between donor plasmid pMM144 and ALVAC
WO 94/16716 215 3 3 3 ~ PCT/US94/00888
175
rescuing virus generated recombinant virus vCP269.
vCP269 contains the mutant form of the human p53 gene
under the control of the vaccinia H6 promoter in the C5
locus.
Mutant forms of Human p53 into NYVAC.
Plasmid Cx22A, described above, contains a mutant
form of the human p53 gene, in which the G at nucleotide
position 524 (Figure 39) is substituted by an A, changing
the arg codon at amino acid position 175 to a his codon
1o in Cx22A.
Plasmid pMM106 (Example 15) contains the vaccinia H6
promoted wild-type human p53 gene in the NYVAC I4L
insertion locus. p53 coding sequences upstream from the
first PflmI site and p53 coding sequences downstream from
the second PflmI site are the same in pMM106 as in Cx22A.
pMM106 was digested with PflmI to remove the 853 central
base pairs of the p53 gene. The 853bp PflmI fragment
from Cx22A containing the base change at position 524 was
inserted. The resultant plasmid, pMM140, contains the H6
2o promoted mutant p53 gene.
Recombination between donor plasmid pMM140 and NYVAC
rescuing virus generated recombinant virus vP1234.
vP1234 contains the mutant form of the human p53 gene
under the control of the vaccinia H6 promoter in the I4L
locus .
Plasmid pR4-2, described above, contains a mutant
form of the human p53 gene, in which the G at nucleotide
position 818 (Figure 39) is substituted by an A, changing
the arg codon at amino acid position 273 to a his codon
3o in pR4-2.
pMM106 (Example 15) contains the H6 promoted wild-
type human p53 gene in the I4L locus. p53 coding
sequences upstream from the first PflmI site and p53
coding sequences downstream from the second PflmI site
are the same in pMM106 as in pR4-2. pMM106 was digested
with PflmI to remove the 853 central base pairs of the
p53 gene. The 853bp PflmI fragment from pR4-2 containing
r
WO 94116716 PCT/US94100888
i76
C~ the base change at position 818 was inserted. The
resultant plasmid, pMM141, contains the H6 promoted
mutant p53 gene.
Recombination between donor plasmid pMM141 and NYVAC
s rescuing virus generated recombinant virus vP1233.
vP1233 contains the mutant form of the human p53 gene
under the control of the vaccinia H6 promoter in the I4L
locus.
A listing of the wildtype and mutant forms of murine
1o p53 and the mutant forms of human p53 present in ALVAC
and NYVAC recombinants described in Examples 31 and 32 is
provided in Table 29.
Table 29
15 Recombinant Virus Parent Virus Species Gene Insert
vCP263 ALVAC murine w.t. p53
vCP267 ALVAC murine p53 (+3 aa)
vCP270 ALVAC human p53 (aa 175; R to H)
vCP269 ALVAC human p53 (aa 273; R to H)
2 s vP1234 NYVAC human p53 (aa 175; R to H)
vP1233 NYVAC human
p53 (aa 273; R to H)
3o Immunoprecipitation.
ALVAC and NYVAC based recombinants vP1101, vP1096,
vP1098, vCP207, vCP193, vCP191 (all described in Example
15; Table 22, as well as ALVAC and NYVAC based
recombinants vCP270, vCP269, vP1233, vP1234 described in
35 this Example, Table 29), contain wild type or mutant
forms of the human p53 gene. All of these recombinant
virus were assayed for expression of the human p53 gene
using immunoprecipitation.
Recombinant or parental virus were inoculated onto
4o preformed monolayers of tissue culture cells in the
presence of radiolabelled 35S-methionine and treated as
previously described (Taylor et al., 1990).
2153336
WO 94/16716 PCTIUS94I00888
177
Immunoprecipitation reactions were performed using a
human p53 specific monoclonal antibody 1801. A protein
of between 47 and 53 kDa was precipitated foom cells
infected with any of the recombinant viruses, vP1101,
vP1096, vP1098, vCP207, vCP193, vCP191, vCP270, vCP269,
vP1233, or vP1234, but not from uninfected dwells or cells
infected with parental ALVAC or NYVAC virus.
Based upon the properties of the poxvirus vector
systems, NYVAC, ALVAC and TROVAC cited above, such
1o vectors expressing either wildtype or mutant forms of p53
provide valuable reagents to determine whether endogenous
CTL activities can be detected in patient effector
populations (TILs, PBMC, or lymph node cells); and,
valuable vehicles for the stimulation or the augmenting
of such activities; for instance, augmenting such
activities by in vitro or ex vivo stimulation with these
recombinant viruses. Further, the highly attenuated
properties of both NYVAC and ALVAC allow the recombinants
of the invention to be used for interventive
2o immunotherapeutic modalities discussed above, e.g., in
vivo interventive immunotherapy
Example 33 - ERH-H-2 INTO COPAR
Plasmid ErbB2SphIstop was obtained from Jeffrey
Marks (Duke University Center). ErbB2SphIstop contains a
3.8 kb human erb-B-2 cDNA insert cloned in pUCl9. The
insert extends from nt 150 through nt 3956 (Yamamoto et
al., 1986) and contains the entire erb-B-2 coding
sequence. In ErbB2SphIstop, the St~hI site at nt 2038 was
mutagenized by the addition of an XbaI linker, creating
3o an in frame stop codon. The remaining, truncated, ORF
thus specifies an extracellular, secretable form of the
erb-B-2 gene product, mimicking the translation product
of the 2.3 kb mRNA. Plasmid ErbB2SphIstop was digested
with XhoI and the 3.8 kb erb-B-2 fragment was isolated.
This isolated fragment was ligated with COPAK vector
plasmid pSD555 cut with XhoI, resulting in plasmid
pMM113.
WO 94116716 PCT/US94/00888
17s
Plasmid pSD555 was derived as follows. Plasmid
pSD553 (Example 17) is a vaccinia deletion/insertion
plasmid of the COPAK series. It contains the vaccinia
K1L host range gene (Gillard et al., 1986) within
flanking Copenhagen vaccinia arms, replacing the ATI
region (orfs A25L, A26L; Goebel et al., 1990).
Plasmid pSD553 was cut with NruI and ligated with a
SmaI/NruI fragment containing the synthetic vaccinia H6
promoter element (Perkus et al., 1989) upstream from the
1o NruI site located at -26 relative to the translation
initiation codon. The resulting plasmid, pMP553H6,
contains the vaccinia H6 promoter element located
downstream from the K1L gene within the A26L insertion
locus.
To complete the vaccinia H6 promoter and add a
multicloning region for the insertion of foreign DNA,
plasmid pMP553H6 was cut with NruI/BamHl and ligated with
annealed synthetic oligonucleotides MPSYN349 (SEQ ID
N0:216) 5'
2o CGATATCCGTTAAGTTTGTATCGTAATGGAGCTCCTGCAGCCCGGGG 3' and
MPSYN350 (SEQ ID N0:217) 5'
GATCCCCCGGGCTGCAGGAGCTCCATTACGATACAAACTTAACGGATATCG 3'.
The resulting plasmid, pSD555, contains the entire H6
promoter region followed by a multicloning region.
Recombination between donor plasmid pMM113 and NYVAC
rescuing virus generated recombinant virus vP1100.
vP1100 contains the erb-B-2 gene under the control of the
vaccinia H6 promoter in the I4L locus, along with the
vaccinia K1L host range gene.
3o Immunoprecit~itation. Preformed monolayers of Vero
cells were inoculated at 10 pfu per cell with parental
NYVAC virus and recombinant virus vP1100 in the presence
of radiolabelled 35S-methionine and treated as previously
described (Taylor et al., 1990). Immunoprecipitation
reactions were performed using a human erb-B-2 specific
monoclonal antibody TA1-1C. A protein of approximately
97 kDa was precipitated from cells infected with vP1100,
WO 94116716 ~ ~ PCTIUS94/00888
179
but not from uninfected cells or cells infected with
parental NYVAC virus.
Having thus described in detail preferred
embodiments of the present invention, it is to be
s understood that the invention defined by the appended
claims is not to be limited to particular details set
forth in the above description as many apparent
variations thereof are possible without departing from
the spirit or scope of the present invention.
WO 94/16716 PCT/US94100888
180
REFERENCES
1. Almoguera, C., Shibata, D., Forrester, K., Martin,
J., Arnheim, N., Peracho, M., Cell 53, 549-554
(1988).
2. Altenburger, W., C-P. Suter and J. Altenburger,
Archives Virol. 105, 15-27 (1989).
3. Asher, A.L., Mule, J.J., Reichert, C.M., et al., J.
Immunol. 138, 963-974 (1987).
4. Avery, R.J., and Niven. J., Infect. and Immun. 26,
795-801 (1979).
5. Aviv, H., and Leder, P., Proc. Natl. Acad. Sci. USA
69, 1408-1412 (1972).
6. Behbehani, A.M., Microbiological Reviews 47, 455-509
(1983).
7. Bergoin, M., and Dales, S., In Comparative Virology,
eds. K. Maramorosch and E. Kurstak, (Academic Press,
NY) pp. 169-205 (1971).
8. Bernards, R., Destree, A., McKenzie, S., Cordon, E.,
Weinberg, R.A., and Panicali, D., PNAS USA 84, 6854-
6858 (1987).
9. Bertholet, C., Drillien, R., and Wittek, R., Proc.
Natl. Acad. Sci. USA 82, 2096-2100 (1985).
10. Boursnell, M.E.G., P.F. Green, J.I.A. Campbell, A.
Deuter, R.W. Peters, F.M. Tomley, A.C.R. Samson,
P.T. Emmerson, and Binns, M.M., Veterinary
Microbiology 23, 305-316 (1990b).
11. Boursnell, M.E.G., P.F. Green, A.C.R. Samson, J.I.A.
Campbell, A. Deuter, R.W. Peters, N.S. Millar, P.T.
4o Emmerson, and Binns, M.M., Virology 178, 297-300.
(1990c).
12. Boursnell, M.E.G., Green, P.F., Campbell, J.I.A.,
Deuter, A., Peters., R.W., Tomley, F.M., Samson,
A.C.R., Chambers, P., Emmerson, P.T., and Binns,
M.M., J. Gen. Virol. 71, 621-628 (1990a).
13. Boyle, D.B.; Coupar, B.E.H., Gene 65, 123-128
(1988).
14. Brunda, M.J., L. Luistro, R.R. Warrier, R.B. Wright,
B.R. Hubbard, M. Murphy, S.F. Wolf and M.K. Gately,
J. Exp. Med. 178, 1223-1230 (1993).
15. Buller, R.M.L., G.L. Smith, Cremer, K., Notkins,
A.L., and Moss, B., Nature 317, 813-815 (1985).
WO 94/16716 21 ~ 3 3 3 fi PCT~S94/00888
181
16. Buller, R.M.L., Chakrabarti, S., Cooper, J.A.,
Twardzik, D.R., and Moss, B., J.Virol. 62, 866-874
(1988).
17. Bzik, D., Li, W., Horii, T., and Inselburg, J.,
Molec. Biochem. Parasitol. 30, 279-288 (1988).
18. Cadoz, M., A. Strady, B. Meignier, J. Taylor, J.
Tartaglia, E. Paoletti and S. Plotkin, The Lancet,
339, 1429 (1992).
19. Cassel, W.A., D.R. Murray and H.S. Phillips Cancer
52, 856-860 (1983).
20. Chambers, P., N.S. Millar, and P.T. Emmerson, J.
Gen. Virol. 67, 2685-2694 (1986).
21. Chen, L., S. Ashe, W.A. Brady, I. Hellstrom, K.E.
Hellstrom, J.A. Ledbetter, P. McGowan and P.S.
2o Linsley, Cell 71, 1093-1102 (1992).
22. Child, S.J., Palumbo, G.J., Buller, R.M.L., and
Hruby, D.E. Virology 174, 625-629 (1990).
23. Clark, S. Arya, S., Wong-Staal, F., Matsumoto-
Mobayashi, M., Kay, R., KaUfman, R., Brown, E.,
Shoemaker, C., Copeland, T., Oroszland, S., Smith,
K., Sarngadharan, M, Lindner, S., and Gallo, R.
PNAS 81, 2543-2547 (1984).
24. Clewell, D.B., J. Bacteriol 110, 667-676 (1972).
25. Clewell, D.B. and D.R. Helinski, Proc. Natl. Acad.
Sci. USA 62, 1159-1166 (1969).
26. Colinas, R.J., R.C. Condit and E. Paoletti, Virus
Research 18, 49-70 (1990).
27. Cooney E.L., Corrier A.C., Greenberg P.D., et al.,
Lancet 337, 567-572 (1991).
28. Coulie, P., Weynants, P., Muller, C., Lehmann, F.,
Herman, J., Baurain, J.-F., and Boon, T. In Specific
Immunotherapy of Cancer with Vaccines, eds. Bystryn,
J.-L., Ferrone, S., and Livingston, P. New York
Academy of Science, New York. pp. 113-119 (1993).
29. Davidoff, A.M., Kerns, B.J.M., Iglehart, J.D.,
Marks, J.R., Cancer Res. 51, 2605-2610 (1991).
30. Davidoff, A.M., J.D. Iglehart, and J.R. Marks, PNAS
USA 89, 3439-3442 (1992).
31. Dreyfuss, G., Adam, S.A., and Choi, Y.D., Mol.. Cell.
Biol. 4, 415-423 (1984).
CA 02153336 2003-02-18
77396-19
I&Z
32. Drillien, R», F. Koehren and A. Kirn, Virology ill,
488-499 ( 1981) .
33. Edbauer, C.,, R. Weinberg, J. Taylor, A. Rey-
Senelonge, J.F. Bouquet, P. Desmettre, and E.
Paoletti, Virology 1.79, 901-904 (1990).
34. Engelke, D.R., Hoener, P.A., and Collins, F.S.,
Proc. Natl. Acad. Sci. OSA 85, 544-548 (1988).
35. Espion, D., S. de Henau, C. Letellier, C.-D. Wemers,
R. Brasseur, J.F. Young, M. Gross, M. Rosen3~erg, G.
Meulemans and A. Bunny, Arch. Virol. 95, 79-95
1987 ) .
3G. Estin, C.D., Stevensan, U.S., Plowman, G.D., Hu, S.-
L., Sridhar, P., Hellstrom, Z., Brown, J.P.,
Hells ty bm, K. °. , PNAS '~35,~ 85 , 1052-1 050 ( 1 988 ) .
37. Etinger H.M. , Altenburger W. , 'Jaccine 9, 470-4'72
(:.991) .
30
38. Falkner, F.G.; Moss, B., J. Virol. 62, 1849-1854
( 1988 ) .
39. Fendly, B.M., Kotts, C., Vetterlein, D», Lewis,,
G_D.. Winget, M., Carver. M.E., Watson, S.R., Sarup,
J., Saks, S., Ollrich, A., Shepard, H.M., J. Biol.
Resp. Mod. 9, 449-455 (1990)_
40. Fenner, F., Virology 5, 502-529 (I958).
41. Fishbein, G.E., McClay, E., Berd, D., and M.J.
Mastrangelo, Vaccine Res. l, 1~~-123, 1992.
42. Flexner, C., Hugen, A., and Moss, .., Nature 330,
259-262 (1987).
43. Freeman, G.J'., G.S. Gray, C.D. Gimmi, D.B. Lombard,
4o L.-J. Zhou, M. White, J.D. Fingeroth, J.G. Gribben
and L.M. Nadler, J. Exp. Med., 174, 625-631 (1991).
44. Freeman, G.J., A.S. Freedman, J.M. Segil, G. Lee,
J.F. Whitman and L.M. Nadler, J. Immunol. 143, 2714-
22 (1989).
45. Fries et al., 32nd Interscience Conference on
Antimicrobial agents and Che~no~herap~, Anaheim, CA
(October 1992).
4 G . Frohmaa , M . , Dush, M.. , a~d Ma= 'in , G . , Pr oc . Na ..1 .
Acac.. Sci. USA. 85, 899~-9002 ('_983).
47 . Fuj i'Har a et al , , Eur. J . Zmmu,nol . 14 , 17 i-175
(19s4) .
WO 94/16716 215 3 3 3 6 pCT/US94/00888
183
48. Funahashi, S., T. Sato and H. Shida, J. Gen. Virol.
69, 35-47 (1988).
49. Garten, W., Kohama, T., and H-D. Klenk. J. Gen.
Virol. 51, 207-211 (1980).
50. Gerrard, T.L., R. Thorpe, S. Jeffcoate and C.
Reynolds, Biologicals 21, 77-79 (1993).
l0 51. Ghendon, Y.Z., and Chernos, V.I., Acta Virol. 8,
359-368 (1964).
52. Gillard, S., Spehner, D., Drillien, R., and Kirn,
A., Proc. Natl. Acad. Sci. USA 83, 5573-5577 (1986).
53. Goebel, S.J., Johnson, G.P., Perkus, M.E., Davis,
S.W., Winslow, J.P., Paoletti, E., Virology 179,
247-266 (1990).
54. Goebel, S.J., G.P. Johnson, M.E. Perkus, S.W. Davis,
J.P. Winslow and E. Paoletti, Virology 179, 517-563
(1990b).
55. Goldstein, D.J. and S.K. Weller, Virology 166, 41-51
(1988).
56. Greenberg, P.D., Adv. Immunol. 49, 281-355 (1991).
57. Gubler, U., A.O. Chua, D.S. Schoenhaut, C.D. Dwyer,
3o W. McComas, R. Motyka, M. Nabavi, A.G. Wolitzky,
P.M. Quinn, P.C. Familletti and M.K. Gately, Proc.
Natl. Acad. Sci. USA 88, 4143-4147 (1991).
58. Guo, P., Goebel, S., Davis, S., Perkus, M.E.,
Languet, B., Desmettre, P., Allen, G., and Paoletti,
E., J. Virol. 63, 4189-4198 (1989).
59. Hareuveni et al., Proc. Natl. Acad. Sci. USA 87,
9498-9502 (1990).
60. Hareuveni et al., Vaccine 9(5), 618-626 (1991).
61. Hollstein, M., Sidransky, D., Vogelstein, B.,
Harris, C.C., Science 253, 49-53 (1991).
62. Hollstein, M., D. Sidransky, B. Vogelstein, C.C.
- Harris, Science 253, 49-53 (1991).
63. Homma, M., and M. Ohuchi, J. Virol. 12, 1457-1465
S0 ( 1973 ) .
64. Hruby, D.E. and L.A. Ball, J. Virol. 43, 403-409
(1982).
65. Hruby, D.E., R.A. Maki, D.B. Miller and L.A. Ball,
Proc. Natl. Acad. Sci. USA 80, 3411-3415 (1983).
WO 94/16?16 , ' PCTIUS94100888
184
66. Hu, S.-L., Plowman, G.D., Sridhar, P., Stevenson,
U.S., Brown, J.P., Estin, C.D., J. Virol. 62, 176-
180 (1988).
67. Ichihashi, Y. and Dales, S., Virology 46, 533-543
(1971).
68. Itamura, S., H. Iinuma, H. Shida, Y. Morikawa, K.
Nerome and A. Oya, J. Gen. Virol. 71, 2859-2865 _
l0 (1990) .
69. Jacobson, J.G., D.A. Leib, D.J. Goldstein, C.L.
Bogard, P.A. Schaffer, S.K. Weller and D.M. Coen,
Virology 173, 276-283 (1989).
70. Jamieson, A.T., G.A. Gentry and J.H. Subak-Sharpe,
J. Gen. Virol. 29, 465-480 (1974).
71. Kantor, J., K. Irvine, S. Abrams, P. Snot', R. Olsen,
2o J. Greiner, H. Kaufman, D. Eggensperger, and J.
Schlom. Cancer Res 52, 24 (1992).
72. Karupiah, G., R. V. Blanden, and I. A. Ramshaw, J.
Exp. Med. 172, 1495-1503 (1990).
73. Karupiah, G., A.J. Ramshaw, I.A. Ramshaw, and R.V.
Blanden, Scand. J. Immunol. 36, 99-105 (1992).
74. Kato, S., M. Takahashi, S. Kameyama and J. Kamahora,
3o Biken's 2, 353-363 (1959).
75. Kaufman, H., Schlom, J., Kantor, J., Int. J. Cancer
48, 900-907 (1991).
76. Kieny, M. P., Lathe, R., Drillien, R., Spehner, D.,
Skory, S., Schmitt, D., Wiktor, T., Koprowski, H.,
and Lecocq, J. P., Nature (London) 312, 163-166
(1984) .
77. Kingston, R., Preparation of poly (A)+ RNA. Current
Protocols in Molecular Biology. Ausubel, F., Brent,
R., Kingston, R., Moore, D., Seidman, J., Smith, J.,
and Struhl, K., eds. p 4.5.1. John Wiley and Sons,
N.Y. (1987).
78. Kleitmann W., Schottle A., Kleitmann B., et al., In
Cell Culture Rabies Vaccines and Their Protective
Effect in Man., ed. Kuwert/Wiktor/Koprowski,
(International Green Cross - Geneva) pp. 330-337
(1981) .
WO 94116716 215 3 3 3 6 ~T~S94/00888
185
79. Klickstein, L., and Neve, R., Preparation of insert
DNA from messenger RNA, Current Protocols in
Molecular Biology. Ausubel, F., Brent, R., Kingston,
R., Moore, D., Seidman, J., Smith, J., and Struhl,
K., eds. pp 5.5.1-5.5.10. John Wiley and Sons, N.Y.
(1987).
80. Knapp, B., Hundt, E., Nau, U., and Kupper, H.,
Molecular cloning, genomic structure, and
localization in a blood stage antigen of Plasmodium
falciparum characterized by a serine stretch. Molec.
Biochem. Parasitol. 32, 73-84 (1989).
81. Knauf, V.C. and Nester, E.W., Plasmid 8, 45-54
( 1982 ) .
82. Kohonen-Corish, M.R.J., N.J.C. King, C.E. Woodhams
and I.A. Ramshaw, Eur. J. Immunol. 20, 157-161
(1990).
83. Kotwal, G.J., A.W. Hugin and B. Moss, Virology 171,
579-587 (1989a).
84. Kotwal, G.J. and B. Moss, J. Virol. 63, 600-606
(1989b).
85. Kotwal, G.J., S.N. Isaacs, R. McKenzie, M.M.
Frank and B. Moss, Science 250, 827-830 (1990).
86. Kotwal, G.J. and Moss, B., Nature (Lond.) 335, 176-
178 (1988).
87. Kriegler, M., Perez, C., DeFay, K., et al., Cell 53,
45-53 (1988).
88. Kuwert E.K., Barsenbach C., Werner J., et al., In
Cell Culture Rabies Vaccines and Their Protection
Effect in Man, eds. Kuwert/Wiktor/Koprowski
(International Green Cross - Geneva) pp. 160-167
(1981) .
89. Lai, A. C.-K, and B. G.-T. Pogo, Virus Res. 12, 239-
250 (1989).
90. Lamb, P. and Crawford, L., Mol. Cell. Biol. 6, 1379-
1385 (1986).
91. Lathe, R.S., Kieny, M.P., Gerlinger, P., Clertant,
P., Guizani, I., Cuzin, F. P. and Chambon. Nature
326, 878-880 (1987).
92. Le, L., R. Brasseur, C. Wemers, G. Meulemans, and A.
Burny, Virus Genes 1, 333-350 (1988).
93. Li, W., Bzik, D., Horii, T., and Inselburg, J.,
Molec. Biochem. Parasitol. 33, 13-26 (1989).
WO 94116716 PCT/US94100888
186
C~
94. Lindenmann, J. and P.A. Klein, J. Exp. Med. 126, 93-
108 (1967).
95. Lindenmann J., Biochim. Biophys. Acta. 355, 49-75
(1974).
96. Lopez, A.F., M.J. Elliott, J. Woodcock and M. A.
Vadas, Immunology Today 13, 495-500 (1992).
97. Mandecki, W., Proc. Natl. Acad. Sci. USA 83, 7177-
7182 (1986).
98. Maniatis, T., Fritsch, E.F., and Sambrook, J. In
Molecular cloning: a laboratory manual, (Cold -Spring
Harbor Laboratory, Cold Spring Harbor, NY) (1982).
99. Matthews, R.E.F., Intervirology 17, 42-44 (1982b).
100. McGinnes, L.W., and T.G. Morrison, Virus Research 5,
343-356 (1986).
101. Merz, D.C., A. Scheid, and P. Choppin, J. Exper.
Med. 151, 275-288 (1980).
102. Morgan, A.J., M. Mackett, S. Finerty, J.R. Arrand,
F.T. Scullion and M.A. Epstein, J. Med. Virol. 25,
189-195 (1988).
103. Moss, B., E. Winters and J. A. Cooper, J. Virol. 40,
387-395 (1981).
104. Nagai, Y., H.D. Klenk, and R. Rott, Virology 72,
494-508 (1976).
105. Nagai, Y., T. Yoshida, M. Hamaguchi, H. Naruse, M.
Iinuma, K. Maeno, and T. Matsumoto, Microbiol.
Immunol. 24, 173-177 (1980).
106. Norrby, E., and Y. Gollmar, Infect. and Immun. 11,
231-239 (1975) .
107. Ogawa, R., N. Yanagida, S. Saeki, S. Saito, S.
Ohkawa, H. Gotoh, K. Kodama, K. Kamogawa, K.
Sawaguchi and Y. Iritani, Vaccine 8, 486-490 (1990).
108. Paez, E., S. Dallo and M. Esteban, Proc. Natl. Acad.
Sci. USA 82, 3365-3369 (1985). .
109. Palumbo, G.J., Pickup, D.J., Fredrickson, T.N.,
5o Mcintyre, L.J., and Buller, R.M.L., Virology 172,
262-273 (1989).
110. Panicali, D. and E. Paoletti, Proc. Natl. Acad. Sci.
USA 79, 4927-4931 (1982).
WO 94116716 215 3 3 3 G ~~594/00888
187
111. Panicali, D., Davis, S.W., Mercer, S.R., and ' ..
Paoletti, E., J. Virol. 37, 1000-1010 (1981).
112. Pardoll, D., Current Opinion in Immunology 4, 619- v
623 (1992). '..
113. Patel, D.D. and Pickup, D.J., EMBO 6, 3787-3794
(1987).
114. Patel, D.D., Ray, C.A., Drucker, R.P., and Pickup,
D.J., Proc. Natl. Acad. Sci. USA 85, 9431-9435
(1988).
115. Pennica, D., D.V. Goeddel, J.S. Hayflick, N.C.
Reich, C.W. Anderson and A.J. Levine, Virology 134,
477-482 (1984).
11G. Perkus, M.E., S.J. Goebel, S.W. Davis, G.P. Johnson,
E.K. Norton and E. Paoletti, Virology 180, 406-410
(1991).
117. Perkus, M.E., Goebel, S.J., Davis, S.W., Johnson,
G.P., Limbach, K., Norton, E.K., and Paoletti, E.,
Virology 179, 276-286 (1990).
118. Perkus, M.E., A. Piccini, B.R. Lipinskas and E.
Paoletti, Science 229, 981-984 (1985).
119. Perkus, M.E., Limbach, K., and Paoletti, E., J.
3o Virol. 63, 3829-3836 (1989).
120. Perkus, M. E., D. Panicali, S. Mercer and E.
Paoletti, Virology 152, 285-297 (1986).
121. Perkus M.E., Piccini A., Lipinskas B.R., et al.,
Science 229, 981-984 (1985).
122. Piccini, A., M.E. Perkus, and E. Paoletti, Methods
in Enzymology 153, 545-563 (1987).
123. Pickup, D.J., B.S. Ink, B.L. Parsons, W. Hu and W.K.
Joklik, Proc. Natl. Acad. Sci. USA 81, 6817-6821
(1984).
124. Pickup, D.J., B.S. Ink, W. Hu, C.A. Ray and W.K.
Joklik, Proc. Natl. Acad. Sci. USA 83, 7698-7702
(1986).
125. Pratt, D. and S. Subramani, Nucleic Acids Research
11, 8817-8823 (1983).
126. Ramshaw, I.A., J. Ruby and A. Ramsay, Tibtech 10,
424-426 (1992).
127. Reed, L.J. and Muench, H., Am. J. Hyg. 27, 493-497
(1938).
WO 94116716 ' ~ PCTIUS94/00888
lsa
128. Riddell, S.R., Watanabe, K.S., Goodrich, J.M., Li,
~~'3 C.R., Agha, M.E., Greenberg, P.D., Science 257, 238-
241 (1992).
129. Ronen, D., Teitz, Y., Goldfinger, N., Rotter, V.
Nucleic Acids Research 20, 3435-3441 (1992).
130. Rosenberg, S.A., J. of Clinical Oncology 10, 180-199
(1992).
131. Ruby, J., A. Ramsey, G. Darupiah, & I. Ramshaw,
Vaccine Res. 4, 347-356 (1992).
132. Saiki, R., Gelfand, D., Stoffel, S., Scharf, S.,
Higuchi, R., Horn, G., Mullis, K., and Erlich, H.,
Science 239, 487-491 (1988).
25
133. Sanger, F., Nickeln, S. Coulson, A.R., Proc. Natl.
Acad. Sci. 74, 5463-5467 (1977).
134. Schmidtt, J.F.C. and H.G. Stunnenberg, J. Virol. 62,
1889-1897 (1988).
135. Schwartz, R.H., Cell 71, 1065-1068 (1992).
136. Seligmann, E.B., In Laboratory Techniques in Rabies,
eds. M.M. Kaplan and H. Koprowski, (World Health
Organization, Geneva) pp. 279-285 (1973).
137. Shapira, S.K., Chou, J., Richaud, F.V. and
Casadaban, M.J., Gene 25, 71-82 (1983).
138. Shida, H., T. Tochikura, T. Sato, T. Konno, K.
Hirayoshi, M. Seki, Y. Ito, M. Hatanaka, Y. Hinuma,
M. Sugimoto, F. Takahashi-Nishimaki, T. Maruyama, K.
Miki, K. Suzuki, M. Morita, H. Sashiyama and M.
Hayami, EMBO 6, 3379-3384 (1987).
139. Shida, H., Hinuma, Y., Hatanaka, M., Morita, M.,
4o Kidokoro, M., Suzuki, K., Maruyzam, T., Takahashi-
Nishimaki, F., Sugimoto, M., Kitamura, R., Miyazawa,
T., and Hayami, M., J. Virol. 62, 4474-4480 (1988).
140. Shida, H., Virology 150, 451-462 (1986).
141. Shimizu, Y. H. Fujiwara, S. Ueda, N. Wakamiya, S.
Kato, T. Hamaoka, Eur. J. Immunol. 14, 839-843
(1984).
142. Shimizu, Y., K. Hasumi, K. Masubuchi & Y. Okudaira,
Cancer Immunol. Immunother. 27, 223-227 (1988).
143. Slabaugh, M., N. Roseman, R. Davis and C. Mathews,
J. Virol. 62, 519-527 (1988).
CA 02153336 2003-02-18
77396-19
1A9
IO
144. SZUith, J.S. , P.A. Yager and G.M. Baer, ,~ Laboratory
Techniques in Rabies, eds. M. M. Kaplan and H.
Koprowski (WHO Geneva) pp. 354-3S7 (1973).
145. Stanberry, L. R., S. Kit and M. G. Myers, J. Virol.
55, 322-328 (1985).
146. Tabor, S. and C. C. Richardson, Proc. Natl. Acad.
SCi. USA 89, 4?fi7-4771 (1987).
147. Tan, T., Wallis, J., Levine, A., Journal of Virology
59, 574-583 (1986).
i48. Tartaglia, J., Pincus, S., Paoletti, E., Critical
Reviews in Immunology 1.0 , 13-3 0 ( I990a ) .
149. Tartaglia, J., Perkus. M.E., Taylor, J., Norton,
E.K., Audonnet, J.-C.. Cox, W.I., Davis, S.W., Van
Der Hoeven, J., Meignier, e., Riviere, M., Languet,
8., Paolett.v, ..., Vir ology 188, 2I7-232 (1992) .
150. Tartaglia, J., J. Taylor, w.I. Cox, J.-C. Audannet,
M . E . Perkus , A . . Radaell:i , C. de Giuli. Morghen , B .
Meiqnier, M. Ri.viere, K. Weinhold & Paoletti, E. In
AIDS Researl~h Reviews, Vol. III: 36I-3'78, W. Koff,
F. along-Staaw ~ R. C. Kenedy, Eds. , VoI . 3 , Marcel
Dekker, Nv (1993a).
15I. Tartaglia, J. & Paoletti, E. ,~n_ Immunochemistry of
3o Viruses, II. The Basis for Serodiagnosis and
Vaccines. M.:i.V. van Regenmortel & A.R. Neurath,
Eds. 125-151. Elsevier Science Publishers, Amsterdam
( 1990b) .
152. Tartaglia, J., Jarret~, 0., Desmettre, P., Paoletti,
E. J. V:.rol . 67, 2370-2375 (1993b) .
153. Tartaglia, J., R. Get~ig ~ E. Paoletti. Encylooedia
of Virology (Vol. I), eds. Webster, R.G., and A.
4o Granoff, Academic P=ess Limited, London,1994.
154. Taylor, J., C. Trirnarchi, R. Weinberg, B. Languet,
E. Gui.llemi~, P. Desmettre and E. Paoletti, Vaccine
9, 19d-193 (' 1991b) ,
I55. Taylor, G., -. J. Scott, G. Wertz and A. Ball, J.
Ge n. V_=o; 7v , 125-.3C ( :.?9wa) .
. 156. Tavl or , J. , c.~bzuer , . , Re=r-Senel tinge, ... , Bc.:v;~uc~.s:,
5~ ,J. -. . ,. Nor to , ~. , G~:ebe'_, 5. , Des:net'r e, P. ,
Paoletti, ,_. , J . Vir;~l. 63, 1441-1 45D ( :990) .
15 i . Tavl or , J. , P . Weinbe=;, J. Tartaglia, C.
R=chaAcison, G. Alkhati5, D. Briedis, M. Apcel , ...
Norton. & E. Paoletti, Viro'_ogy 187, 321-323 (1972).
WO 94/16716 . PCTlUS94100888
190
158. Taylor, J., Weinberg, R., Kawaoka, Y., Webster,
R.G., and Paoletti, E., Vaccine 6, 504-508 (1988a).
159. Taylor, J., R. Weinberg, B. Lanquet, P. Desmettre,
and E. Paoletti, Vaccine 6, 497-503 (1988b).
160. Taylor, J., C. Trimarchi, R. Weinberg, B. Languet,
F. Guillemin, P. Desmettre & E. Paoletti, Vaccine 9,
190 (1991).
161. Toyoda, T., T. Sakaguchi, K. Imai, N. M. Inocencio,
B. Gotoh, M. Hamaguchi, and Y. Nagai, Virology 158,
242-247 (1987).
162. Traversari, C., van der Bruggen, P., Luescher, I.F.,
Lurquin, C., Chomez, P., van Pel, A., De Plaen, E.,
Amar-Costesec, A., Boon, T., J. Exp. Med. 176, 1453-
1457 (1992).
1G3. Trinchieri, G., Imm. Today 14, 335-338 (1993)
164. Ulrich, S.J., Anderson, C.W., Mercer, W.E., Appella,
E., J. Biol. Chem. 267, 15259-15262 (1992).
165. van der Bruggen, P. and Van der Eynde, B., Curr.
Topics in Immunology 4, 608-612 (1992).
166. van der Bruggen, P., Traversari, C., Chomez, P.,
Lurquin, C., De Plaen, E., Van de Eynde, B., Knuth,
A., Boon, T., Science 259, 1643-1647 (1991).
167. Vogel, S.N., R.M. Friedman, and M.M. Hogan, Current
Protocols in Immunology, 6.9.1-6.9.8 (1991).
168. Wallack, M.K., K.R. McNally, E. Leftheriotis, H.
Seigler, C. Balch, H. Wanebo, A. Bartolucci & J.A.
Bash, Cancer 57, 649-655 (1986).
169. Watson, C., and Jackson, J., In DNA Cloning, Volume
4o I: a practical approach, Glover, D.M., ed. pp 79-88
(IRL Press, Oxford) (1985).
170. Weir, J.P. and B. Moss, J. Virol. 46, 530-537
(1983).
171. Yamamoto, T., S. Ikawa, T. Akiyama, K. Semba, N.
Nomura, N. Miyajima, T. Saito and K. Toyoshima,
Nature 319, 230-234 (1986).
172. Yuen, L. and B. Moss, J. Virol. 60, 320-323 (1986).
173. Yuen, L., and Moss, B., Proc. Natl. Acad. Sci. USA
84, 6417-6421 (1987).
WO 94/16716 21 ~ 3 3 3 6 pCT~S94100888
191
174. Zhou, J., L. Crawford, L. McLean, X. Sun, M.
Stanley, N. Almond and G.L. Smith, J. Gen. Virol.
71, 2185-2190 (1990).
