Note: Descriptions are shown in the official language in which they were submitted.
WO 94/28140 ~ 2 2 Q PCT/AU94/00265
TRANSGENIC FLOWERING PLANTS
The present invention relates generally to transgenic flowering plants. More particularly~
5 the present invention is directed to transgenic rose, carnation and chrysanthemum plants
genetically modified to enable ~ression of flavonoid 3',5'-hydroxylase thereby
permitting the manipulation of intermediates in the flavonoid pathway.
The flower industry strives to develop new and different varieties of flowering plants,
10 with improved characteristics ranging from disease and pathogen resi~t~nce to altered
inflorescence. Although classical breeding techniques have been used with some success,
this approach has been limited by the constraints of a particular species' gene pool. It is
rare, for example, for a single species to have a full spectrum of coloured varieties.
Accordingly, substantial effort has been directed towards alle~ ,tillg to generate transgenic
15 plants exhibiting the desired characteristics. The development of blue varieties of the
major cutflower species rose, carnation and chrys~nthemum, for example, would offer a
significant o~ulLullily in both the cutflower and orn~ment~l markets.
Flower colour is predomin~ntly due to two types of pigment: flavonoids and carotenoids.
20 Flavonoids contribute to a range of colours from yellow to red to blue. Carotenoids
impart an orange or yellow tinge and are commonly the only pigment in yellow or orange
flowers. The flavonoid molecules which make the major contribution to flower colour
are the anthocyanins which are glycosylated derivatives of cyanidin, delphini(lin,
petunidin, peonidin, malvidin and pelargonidin, and are localised in the vacuole. The
25 dirr~le.ll anthocyanins can produce marked dir~lellces in colour. Flower colour is also
influenced by co-pi~ment~tior with colourless flavonoids, metal complexation,
glycosylation, acylation, methylation and vacuolar pH (Forkm~nn, 1991).
.
The biosynthetic pathway for the flavonoid pi ment~ ~lc;illarhl referred to as the
30 "flavonoid palhw~y") is well established and is shown in Figure 1 (Ebel and Hahlbrock,
1988; Hahlbrock and Grisebach, 1979; Wiering and de Vl~min~, 1984; Schram et al.,
1984; Stafford, 1990). The first committe~l step in the pathway involves the con-ien~tion
WO 94/28140 ,~ PCT/AU94/0026~
of three molecules of malonyl-CoA with one molecule of p-cournaroyl-CoA. This
reaction is catalysed by the enzyme chalcone synthase (CHS). The product of thisreaction, 2',4,4',6'-tetrahydroxychalcone, is norrnally rapidly isomerized to produce
naringenin by the enzyme chalcone flavanone isomerase (CHI). Naringenin is
5 subsequently hydroxylated at the 3 position of the central ring by flavanone 3-hydroxylase
(F3H) to produce dihydrokat;ll~fcrol (DHK).
The B-ring of dihydrokaempferol can be hydroxylated at either the 3', or both the 3' and
5' positions, to produce dihydroquercetin (DHQ) and dihydromyricetin (DHM),
10 respectively. Two key enzymes involved in this pathway are flavonoid 3'-hydroxylase
and flavonoid 3',5'-hydroxylase. The flavonoid 3'-hydroxylase acts on DHK to produce
DHQ and on naringenin to produce eriodictyol. The flavonoid 3',5'-hydroxylase
(hereinafter referred to as 3',5'-hydroxylase) is a broad ~ecl~ l enzyme catalyzing
hydroxylation of naringenin and DHK in the 3' and 5' positions and of eriodictyol and
15 DHQ in the 5' position (Stotz and Fo.k~ -, 1982), in both instances producing
pentahydroxyflavanone and DHM, l~e~ilively. The pattern of hydroxylation of the B-
ring of anthocyanins plays a key role in ~l~l~....il~;..~ petal colour.
Because of the aforesaid gene pool consllaill~, many of the major cutflower species lack
20 the 3',5'-hydroxylase and consequently cannot display the range of colours that would
othervvise be possible. This is particularly the case for roses, carnations and
cLys~ heml-m~, which constitute amajor plopo.Lion ofthe world-wide cutflower market.
There is a need, therefore, to modify plants and in particular roses, carnations and
cl~ h~mllm~, to g~ne.d~e transgenic plants which are capable of producing the 3',5'-
25 hydroxylase thereby providing a means of mocl.ll~ting DHK metabolism, as well as themetabolism of other Su~ dk;s such as DHQ, naringenin and eriodictyol. Such
modulation influences the hydroxylation pattern of the anthocyanins and allows the
production of anthocyanins derived from delphini~in, thereby modifying petal colour and
allowing a single species to express a broader spectrum of flower colours. There is a
30 particular need to generate l~ sgcl ic plants w_ich produce high levels of anthocyanins
derived from d~lphinidin. In accordance with the present invention, gene constructs are
generated and used to make transgenic plants which express high levels of delphinidin
PCT/AIJ 9 4 / 0 0 2 6 5
950703~q~ 2 RECE11/ED O 4 JUL 1995
and/or its derivatives relative to non-transgenic plants of the same species. It has been
clet~rrnin.?cl in accordance with the present invention that genetic constructs which
comprise a promoter from a gene encoding a flavonoid pdlhwdy enzyme operably linked
S to a flavonoid 3',5'-hydroxylase are capable of directing ~ e3~ion of high levels of
delphinin-derived anthocyanins. The production of these high levels of delphiniclin and
related molecules is particularly useful in developing a range of plants exhibiting altered
infloresce,lce ~.o~llies.
10 Accordingly, one aspect ofthe present invention collle~ lates a lla lsgenic plant selected
from rose, carnation and cllly~lh~mllrn or progeny or flowering parts thereof wherein
said plant carries a genetic construct colllp.;sillg a promoter from a gene encoding an
enzyme of the flavonoid ~dLhwdy operably linked to a gene encoding a flavonoid 3',5'-
hydroxylase wherein said Ll~sgel~ic plant produces higher levels of anthocyanins derived
15 from delphinidin relative to non-l.dnsgel~ic plants of the same species.
Preferably, the flavonoid 3',5'-hy~xylase is of petunia, v~lbella, dell)hillu.." grape, iris,
freesia, hydrangea, cyclamen, potato, pansy, egg plant, ~ h~l5 or c~ p~.~ul~ origin.
20 Most preferably, the flavonoid 3',5'-hydloxylase is of petunia origin.
The gene construct of the present invention compri~s a nucleic acid molecule encoding
a s~u~ ,lce ~n~o-lin~ 3',5'-Ly~oxylase and where n~ces~. y comprises additional genetic
se~u~l~ces such as promoter and t~....;.~lo, se.lu~"~ces which allow i;~ s;~ion of the
25 molecule in the ll~sge"ic plant. When the gene construct is DNA it may be cDNA
or genomic DNA. P~ ably, the DNA is in the form of a binary vector compri~ing
a ~him~erjc gene construct which is capable of being hlle~dled into a plant genome to
produce the ~ ic plant ofthe present invention. The ~h;.,.~ jc gene construct
carries a plant promoter from a gene encoding an e,~yll,c of the flavonoid pdl~wdy. A
30 pl~ f~ d promoter is from the gene encoding ch~lcone ~y~ ase (CHS) and is
~MENDED SHEEl
~EA~AU
P~T/AU 9 4 / O 0 2 6 5
950703,q:\opes\ejh,00265.clm,4 R E C E 1 V E D 3 4 ~ U l 1995
~3220
referred to herein as the "CHS promoter". The CHS promoter is particularly plcr~llcd
since it directs the high level tA~iession of genetic sequences operably linked down
stream thereof. The most ~l~fe.l~ d binary vectors are pCGP484, pCGP485, pCGP6535 and pCGP1458.
By "nucleic acid molecule" as used herein is meant any contiguous series of nucleotide
bases ~eciryiLIg a sequence of amino acids in 3',5'-hydroxylase. The nucleic acid may
encode the full length enzyme or a functional dcliv~live thereof. By "dcl;v~livc;" is
10 meant any single or mllltiple amino acid sl-bstit~ltions, deletions, andlor additions relative
to the naturally-occllrring enzyme. In this regard, the nucleic acid includes the n~hlr~lly-
oCcllrrin~ nucleotide sequence encoding 3',5'-hydroxylase or may contain single or
multiple nucleotide ~lb~ lion~, deletions and/or ~lrlition~ to said naturally-occllrring
sequence. The terms "analogues" and "d~,l;v~livt;~" also extend to any functional
ch~mis~l equivalent of the 3',5'-hy~oAylase, the only ~c~ lL of the said nucleicacid molecule being that when used to produce a ll~sgenic plant in accor~lce with the
present invention said L~ sgel~ic plant exhibits one or more of the following plop~,~lies:
(i) production of 3',5'-l,ydl~Aylase-specific mRNA;
(ii) production of 3',5'-hy~Aylase protein;
(iii) production of ~lçlphinitlin and/or its d~liv~livcs, and/or
(iv) altered inflolescnce.
More particularly, said ~ sge,l,c plant exhibits one or more of the following pro~Llies:
ea3ed levels of 3',5'-Ly&`oAylase-specific mRNA above non-lla.lsgenic
endogenous levels;
(ii) increased production of 3',5'-Lyd~u~ylase protein;
(iii) elevated levels of production of ~lclrhinitlin and/or its d~,l;v~lives ahove non-
~ ge~ic endogenous levels; and/or
(iv) altered inflore3e~ce.
AMENDED SHEET
~E4~AU
WO 94/28140 PCT/AU94/00265
- 5 ~1~322~
The nucleic acid molecules used herein may exist alone or in combination with a vector
molecule and preferably an ex~rcs~ion-vector. Such vector molecules replicate and/or
express in eukaryotic and/or prokaryotic cells. Preferably, the vector molecules or parts
5 thereof are capable of integration into the plant genome. The nucleic acid molecule may
additionally contain a sequence useful in facilit~tin~ said integration and/or a promoter
sequence capable of directing expression of the nucleic acid molecule in a plant cell. The
nucleic acid molecule and promoter may be introduced into the cell by any nurnber of
means such as by electroporation, micro-projectile bombardment or Agrobacterium-
10 mediated transfer.
In accordance with the present invention, a nucleic acid molecule encoding 3',5'-
hydroxylase may be introduced into and r~ e~ed in a transgenic plant selected from the
list concictinp; of rose, carnation and ch~ hemum thereby providing a means to convert
15 DHK and/or other suitable substrates into anthocyanin derivatives of anthocyanidins such
as pet~lni~lin, malvidin and especially delphinidin. The production of these anthocyanins
may contribute to the production of a variety of shades of blue colour or blue-like colour
or may otherwise modify flower colour by diverting anthocyanin production away from
pelargonidin, cyanidin and peonidin and their derivatives and towards delphinidin and its
20 derivatives. Expression of the nucleic acid sequence in the plant may be constitutive,
inducible or developmental. The ~ ..ession "altered inflorescence" means any alteration
in flower colour relative to the naturally-occurring flower colour taking into account
norrnal variations belwr ell flowerings. Preferably, the altered inflorescence includes
production of various shades of blue, purple or pink colouration dir~lelll to those in the
25 non-~ sgenic plant.
The present invention also contemplates a method for producing a transgenic flowering
plant exhibiting elevated levels of production of delrhini-lin and/or its dc.iv~Liv~s above
non-L~ sg~ic endogenous levels, said method comprising introducing into a cell of a
30 plant selected from the list concictin~ of rose, c~rn~ti~ n and chrys~nthPmllm, a nucleic
acid molecule encoding a sequence encoding 3',5'-hydroxylase under conditions
pPrmitting the c;v~ ,lession of said nucleic acid molecule, regenerating a tr~ncgenic
WO 94/28140 PCT/AU94/00265
~ 32~ 6-
plant from the cell and growing said transgenic plant for a time and under conditions
sufficient to permit the e~res~ion of the nucleic acid molecule into the 3',5'-hydroxylase
enzyme. The present invention is also directed to a method for producing a transgenic
plant selected from rose, carnation and chrys~nthemllm, said method comprising
S introducing into said plant a gene construct co"~ a nucleic acid sequence encoding
a flavonoid 3',5'-hydroxylase characterised in that said transgenic plant produces higher
levels of anthocyanin derived from delphinidin relative to non-transgenic plants of the
same respective species.
10 In a preferred embodiment, the L~ sgellic flowering plant exhibits altered inflorescence
properties coincident with elevated levels of delphini~in production, and the altered
inflorescence includes the production of blue flowers or other bluish shades depending
on the physiological conditions of the recipient plant. In certain plant species it may be
preferable to select a "high pH line", such being defined as a variety having a higher than
15 average petal vacuolar pH. The origin of the recombinant 3',5'-hydroxylase or its mutants
and derivatives may include, petunia, verbena, delphinil-m, grape, iris, freesia, hydrangea,
cyclamen, potato, pansy, li~i~nthlle, c~lllp~ or eggplant.
Consequently, the present invention extends to a transgenic rose, carnation or
20 cllly.~ hPmllm plant col~ g all or part of a nucleic acid molecule representing 3',5'-
hydroxylase and/or any homologues or related forms thereof and in particular those
Ll~ sgenic plants which exhibit elevated 3',5'-hydroxylase-specific mRNA and/or elevated
production of delrhinidin derivatives and/or altered inflorescence plo~ ies. Thetransgenic plants, therefore, contain a stably-introduced nucleic acid molecule comprising
25 a nucleotide sequence encoding the 3',5'-hydroxylase enzyme. The invention also extends
to progeny from such transgenic plants and also to reproduction material therefor (e.g.
seeds). Such seeds, especially if coloured, will be useful inter alia as proprietary tags for
plants.
30 The present invention is further described by reference to the following non-limiting
Figures and Examples.
WO 94/28140 2 i ~ 3 2 2 0 PCT/AU94/00265
- 7 -
In the ~igures:
Figures l(A) and (B) are schematic le~.es~l,lalions of the biosynthesis pathway for the
flavonoid pigments. Enzymes involved in the first part of the pathway have been
indicated as follows: PAL = Phenyl~l~nine ~mmoni~-lyase; C4H = Cinn~m~te 4
5 hydroxylase; 4CL = 4-coumarate: CoA ligase; CHS = Chalcone synthase; CHI =
Chalcone flavanone isomerase; F3H = Flavanone 3-hydroxylase; DFR =
Dihydroflavonol-4-re~ t~e; UFGT = UDP-glucose: flavonoid-3-O-glucosyltransferase.
The later steps correspond to conversions that can occur in P. hybrida flowers and
include: 1 = addition of a rham~ose sugar to the glucosyl residue of cyanidin-3-glucoside
10 and delphinidin-3-glucoside; 2 = acylation and 5-O-glucosylation; 3 = 3' methylation;
4 = 5' methylation; 5 = 3'5' methylation.
Figure 2 is a diagrammatic rt;~lesenl~lion of the binary ex~lession vector pCGP812,
contruction of which is described in Example 3. Gent = the g~ ycin resi~t~nce gene;
15 LB = left border; RB = right border; nptII = the e~re~ion ~sette for neomycinphosphol~ r~ se II; GUS = the ,B-glucuronidase coding region. Chim^- ;c gene insert
is as indicated, and described in Example 3. Restriction enzyme sites are marked.
Figure 3 is a diagr~mm~tic replcsc.-t;~l ion of the binary expression vector pCGP485,
20 contruction of which is described in Example 4. Gent ~ the gentamycin resistance
gene; LB ~ left border; RB - right border; nptII = the expression c~csette for
neomycin phosphotransferase II. ~',him^ ic gene insert is as int~ic~te~l, and described
in Example 4. Restriction enzyme sites are marked.
25 Figure 4 is a diagr~....,.-l ;c represe~ ion of the binary expression vector pCGP628,
contruction of which is described in Example 5. Gent - the gentamycin recict~ncegene; LB left border; RB ~ right border; nptII - the expression c~csette for
neomycin phosphotransferase II. ('.him- ;c gene insert is as in~ ted, and described
in Example 5. Restriction C.lZyll.C sites are marked.
WO 94/28140 PCT/AU94/00265
-- 8 --
2~32~ '
Figure 5 is a diagr~mm~tic represent~ti~-n of the binary expression vector pCGP653,
contruction of which is described in Example 6. Gent - the gentamycin resistancegene; LB ; left border; RB right border; nptII = the expression cassette for
5 neomycin phosphotransferase II. ('.him~ric gene insert is as in~ic~te~, and described
in Example 6. Restriction enzyme sites are marked.
Figure 6 is a diagramm~tic represent~tion of the binary ~ ssion vector pCGP484,
contruction of which is described in Example 7. Gent = the expression cassette for
10 the gentamycin resistance gene; LB ~ left border; RB - right border; nptII =
neomycin phosphotransferase II. Chim~ric gene insert is as indicated, and described
in Example 7. Restriction enzyme sites are marked.
Figure 7 is a diagr~mm~tic reprPsent~tion of the binary expression vector pCGP1458,
l5 contruction of which is described in Example 8. nptI = the neomycin
phosphotransferase I re~i~t~nce gene;; LB ~ left border; RB right border; nptII
~ the expression cassette for neomycin phosphotransferase II. ('him~eric gene insert
is as inliic~te~l~ and described in Example 8. Restriction enzyme sites are marked.
20 Figure 8 shows a photograph of an autoradiographic represent~ti~n of a Southern
hybridization of Royalty callus tissue transformed with pCGP628. Genomic DNA
was digested with EcoRI and probed with the 720bp EcoRV internal fragment of
Hfl cDNA. Negative controls (N) are Royalty callus tissue transformed with pCGP
293. The postive control (H~ contains lOpg of the Hfl fr~gment. The arrows in~lic~te
25 the 2kb EcoRI fragment expected in transformed plants.
Figure 9 shows a photograph of an autoradiographic repr.os.ont~tion of a Southern
hybridization of Chrys~nth~omllm cv. Blue Ridge plants, transformed with pCGP484.
Genomic DNA was digested with XbaI, which releases a 2.3kb Hfl-PLTP fragm~nt,
30 and probed with a 1.8kb ~E2I/BspE~ fragment released from pCGP602, cont~ining the
Hfl cDNA. Negd~ive control (N) is genomic DNA isolated from non-transformed
Blue Ridge plants. The postive control ~P) is plasmid DNA of pCGP485 digested with
WO 94l28140 ~ 6 32 2 ~ PCT/AU94,00265
~ g
XbaI. The arrow indicates the 2.3kb product expected in transformed plants.
EXAMPLE 1
Materials
5 Eriodictyol and dihydroquercetin were obtained from Carl Roth KG and naringenin
was obtained from Sigma. Dihydromyricetin was chemically synthesized from
myricetin (Extra Synthese, France) by the method of Velc~uy~e et al. (1985). [3Hl-
naringenin (5.7 Ci/mmole) and [3Hl~ihydroquercetin (12.4 Ci/mmole) were obtained
from Amersham. All enzymes were obtained from commercial sources and used10 according to the manufacturer' s recommen~l~tions.
The Escherichi~ coli strain used was:
DH5a ~E44, ~ZYA-~EgF)U169, ~801acZ~\M15, hsdR17 (rk-, mk+),
recA1, endA1, g~LA96, thi-1, relA1, deoR. (~n~han, 1983 and BRL,
1986).
The disarmedAgrobactenum tumefaaens strains AGL0 (Lazo et al., 1991) and LBA4404(~loekema et al., 1983) were obtained from Dr R Ludwig, Department of Biology,
Univ~ y of California, Santa Cruz, USA and Calgene, Inc. CA, USA, respectively.
The armed Agrobacterium tumefaciens strain ICMP 8317 was obtained from Dr Richard
Gardner, Centre for Gene Technology, Department of C'.elltll tr and Molecular Biology,
Univ~ y of A~lrkl~n-i New 7~al~n~1
25 The cloning vector pBluescript was obtained from Strat~gene
Plants were grown in speri~liced growth rooms with a 14 hr day length at a lightintencity of 10,000 lux minimllm and a t~l.p~ld~ure of 22 to 26.
WO 94/28140 PCT/AU94/00265
2~3~2~ - 10-
EXAMPLE 2
Construction of pCGP 90
Plasmid pCGP90 was constructed by cloning the cDNA insert from pCGP602
5 (International Patent Application PCT/AU92/00334; Publication Number WO
93/01290) in a sense orientation behind the Mac promoter (Comai et al., 1990) ofpCGP293.
The binary- expression vector pCGP293 was derived from the Ti binary vector
10 pCGN1559 ~McBride and Summerfelt, 1990). Plasmid pCGN1559 was digested with
KpnI and the overh~nging 3~ ends were removed with T4 DNA polymerase according
to standard protocols (Sambrook et al.,1989). The vector was then further digested
with XbaI and the rec~llting 5~ overhang was repaired using the Klenow fragment of
DNA polymerase I. The vector was then re-ligated to give pCGP67. A 1.97 kb PstI
15 fragment cont~ining the Mac promoter, mas terminator and various cloning sites
(Comai et al., 1990) was isolated from pCGP40 and inserted into the Pstl site ofpCGP67 to give pCGP293.
Plasmid pCGP40 was constructed by removing the GUS gene aefferson et al., 1987)
20 as a BamHI-SacI fragment from pCGN7334 and replacing it with the BamHl-SacI
fragment from pBluescribe M13 that in~ cles the multicloning site. Plasmid
pCGN7334 (obtained from Calgene, Inc. CA, USA), was constructed by inserting thefragment cont~ining the rhim~ric Mac-GUS-mas gene into the XhoI site of
pCGN7329 (Comai et al., 1990).
2~
The BamHI-KpnI fragment cont~ining the above-mentioned cDNA insert was then
isolated from pCGP602 and ligated with a BamHI/KpnI fragment of pCGP293.
Correct insertion of the insert in pCGP90 was established by restriction analysis of
DNA isolated from gen~a lly~ ;n recict~nt transformants.
WO 94/28140 ll PCT/AU94/00265
~ 21~322~
EXAMPLE 3
Construction of pCGP 812
The binary expression vector pCGP812 was derived from the Ti binary vector
S pCGN1558 ~McBride and Summerfelt, 1990). A 5.2 kb XhoI fragment cont~ining thechimaeric mas-35S-GUS-ocs gene was isolated from pKIWI 101 (Jannsen and Gardner,1989) and sub-cloned into the XhoI site of pBluescript KS to give pCGP82. The 5.2
kb fragment was then re-isolated by HindIII/~I digestion and sub-cloned into theHindIII/KpnI sites of pCGN1558 to give pCGP83.
Plasmid pCGP83 was restricted with KpnI and the overhanging 3~ ends were removedwith T4 DNA polymerase according to standard protocols (Sambrook et al.,1989). ASmaI-BamHI adaptor (Pharmacia) was then ligated to the flushed ~I sites to give
~ "sticky" ends. A 3.8 kb ~g II fragment con~ining the ~him~Pric Mac-Hfl-mas
15 gene from pCGP807 (described below) was ligated with the BamHI "sticky" ends of
pCGP83 to yield pCGP812 ~igure 2).
The plasmid pCGP807 was constructed by lig~ting the 1.8 kb BamHI-KpnI fragment
cont~ining the above-mentioned Hfl cDNA insert from pCGP602 with BamH[-KpnI
20 ends of pCGP40.
EXAMPLE 4
Construction of pCGP 485
The binary vector pCGP485 was derived from the Ti binary vector pCGN1547
25 (McBride and Summerfelt, 1990). A ~-him^~ ;c gene was constructed concicting of (i)
the promoter sequence from a CHS gene of snapdragon; (ii) the coding region of the
above-mentioned cDNA insert from pCGP602 from petunia, and (iii) a petunia
phospholipid transferase protein ~PLTP) terminator sequence. The CHS promoter
consists of a 1.2 kb gene fragment 5' of the site of translation initiation (Sommer and
30 Saedler, 1986). The petunia cDNA insert consists of a 1.6 kb BclI/FspI fragment from
the cDNA clone of pCGP602 (lnternational Patent Application PCT/AU92/00334;
Publication Number WO 93/01290). The PLTP terminator sequence consists of a 0.7
WO 94/28140 PCT/AU94/00265
21Ç~322~ - 12-
kb SmaI/XhoI fragment from pCGP13/~ l~am (Holton, 1992), which in~ des a 150 bp
untranclate~ region of the transcribed region of the PLTP gene. The fhim~eric
CHS/cDNA insert/PLTP gene was cloned into the PstI site of pCGN1547 to create
pCGP485.
EXAMPLE 5
Construction of pCGP 628
Plasmid pCGP176 ~lnternational Patent Application PCT/AU92/00334; Publication
Number WO 93/01290) was digested with EcoRI and SpeI. The digested DNA was
10 filled in with Klenow fragment according to standard protocols (Sambrook et al.,1989),
and self-ligated. The plasmid thereby obtained wac ~cignated pCGP627. An
XbaI/~I digest of pCGP627 yielded a 1.8 kb fragment which was ligated with a 14.5
kb fragment obtained by XbaI/KpnI digestion of pCGP293. The plasmid thus createdwas decignated pCGP628.
EXAMPLE 6
Construction of pCGP 653
Plasmid pCGP293 (described above in Example 2) was digested with XbaI and the
r~slllting 5' overhang was filled in using Klenow fragment according to standard20 protocols (Sambrook et al.,l989). It was then digested with HindIII. During this
procedure, the Mac promoter (Comai et al., 1990) was delete-l A 0.8 kb petunia CHS-
A promoter from pCGP669 (described below) was ligated into this backbone as a
blunt-ended EcoRI/HindIII fragm~nt This plasmid product was ~ecignated pCGP672.
25 An XbaI/Asp718 digestion of pCGP807 (described in Example 3, above) yielded a 1.8
kb fràgment cont~ining the Hfl cDNA, which wac ligated with a 16.2 kb XbaVAsp718Laglllcn~ from pCGP672. The plasmid thus created wac ~iecignate~ pCGP653.
A promoter fragment of the CHS-A gene was amplified by PCR, using the
30 oligonucleotides CHSA-782 and CHSA+34 as primers (see sequenoes below) and
Petunia Irybrid~ V30 genomic DNA as template. The PCR product was cloned into
ddT-tailed pBluescript (Holton and Graham, 1991) and the orient~tion of the gene
wO 94/28140 2 ~ 6 3 2 2 o PCT/AUg4/00265
- 13 -
fragment verified by restriction enzyme mapping. The plasmid thus created was
~lesignaterl pCGP669. The oligonucleotide primers were designed to the publishedsequence of the petunia CHS-A promoter ~Koes, 1988).
CHSA-782
5' GTTTTCCAAATCTTGACGTG 3'
CHSA + 34
5' ACGTGACAAGTGTAAGTATC 3'
EXAMPLE 7
Construction of pCGP 484
Construction of pCGP484 was icl~ntic~l to that for pCGP485, outlined above in
Example 4, except that pCGP484 contains the 3.5 kb PstI fragment (cont~ining the~him~ric gene CHS-Hfl-PLTP) in the opposite orientation.
EXAMPLE 8
Construction of pCGP 1458
The plasmid pCGP1458 was contructed using the 10 kb binary vector pBIN19 (13evan,
1984) as the backbone. Plasrnid pBIN19 was digested with EcoRI and the resulting 5'
20 overhang was filled in using Klenow fr~gment according to standard protocols
(Sarnbrook et al.,1989). Plasmid pCGP485 was digested with PstI to remove the
~him^~ric CHS/cDNA insert/PLTP gene as a 3.5 kb fr~gment The 3' overhang
resulting from PstI digestion was removed with T4 DNA polymerase and this fragment
was then ligated into the filled in EcoRI site of the plasmid pBIN19.
EXAMPLE 9
Transformation of E. coli and A. t~m~aae7zs
Transformation of the Escher~chia coli strain DH50-cells with one or other of the
vectors pCGP812, pCGP90, pCGP485, pCGP628, pCGP653, pCGP484 or pCGP1458
30 was performed according to standard procedures (Sambrook et al., 1989) or Inoue et
al., (1990)-
WO 94/28140 PCT/AU94/00265
æ20 -14- ~
The plasmid pCGP812, pCGP90, pCGP485, pCGP628, pCGP653, pCGP484 or
pCGP1458 was introduced into the appropriate Agrobactenum tumefaae7ts strain by
adding 5 ~g of plasmid DNA to 100 ~L of competent Agroba*enum tumefaaens cells
prepared by inoclllqting a 50 mL MG/L (Garfinkel and Nester, 1980) culture and
5 growing for 16 h with shqking at 28. The cells were then pelleted and resuspended in
0.5 mL of 85% (v/v) 100 mM CaCl2/15% (v/v) glycerol. The DNA-Agrobactenum
mixture was frozen by incubation in liquid N2 for 2 min and then allowed to thawby incubation at 37 for 5 min. The DNA/bacterial mixture was then placed on ice for
a further 10 min. The cells were then mixed with 1 mL of MG/L media and
10 incubated with shqking for 16 h at 28. Cells of A. tumefaaens carrying eitherpCGP812, pCGP90, pCGP485, pCGP628, pCGP653 or pCGP484 were s.olecte~l on
MG/L agar plates contlining 100 ~Llg/mL gentamycin. Cells of A. tumefaaens carrying
pCGP1458 were sel~cte~l on MG/L agar plates contqining 100,ug/mL kanamycin. The
presence of the plasmid was confirmed by Southern analysis of DNA isolated from the
15 gentamycin-recictqnt transformants.
EXAMPLE 10
Transformation of Dianthus
a. Plant Material
20 Dtanthus caryophyllus, (cv. Crowley Sim, Red Sim, Laguna) c~ttings were obtained
from Van Wyk and Son Flower Supply, Victoria, Australia. The outer leaves were
removed and the cllttingc were steriliæd briefly in 70% (v/v) ethanol followed by
1.25% (w/v) sodium hypochlorite (with Tween 20) for 6 minutes and rinsed three
times with sterile water. All the visible leaves and axillary buds were removed under
25 the ~iicsecting microscope before co-cultivation.
b. Co-cultivation of A~-l ~ ".~"~ and Diantbus Tissue
Ag;robactenum tum~factens strain AGL0 (Lazo et al., 1991), cQrlt-ining any one of the
binary vectors pCGP90, pCGP812, pCGP485 or pCGP653, was mqintqine(l at 4 on
30 MG/L (Garfinkel and Nester, 1980) agar plates with 100 mg/L gentamycin. A single
colony was grown overnight in liquid MG/L broth and diluted to 5 x 108 cells/mL
next day before inoculation. Dtctnthus tissue was co~ultivated with Agrobactertum
21 ~2~ ~
WO 94/28140 PCT/AU94/00265
- 15 -
on Murashige and Skoog' s (1962) medium ~MS) supplem~nte~ with 3% sucrose (w/v),5 mg/L a-naphthalene acetic acid (NAA), 20 ~M acetosyringone and 0.8% Difco Bacto
Agar (pH 5.7).
S c. Recovery of Transgenic Dian~us Plants
Co-cultivated tissue was transferred to MS medium supplem.ontec~ with 1 mg/L
benzylaminopurine (BAP), 0.1 mg/L NAA, 150 mg/L kanamycin, 500 mg/L ticarcillin
and 0.8% Difco Bacto Agar (selection medium). After three weeks, explants were
transferred to fresh selection m~ lm and care was taken at this stage to remove
10 axillary shoots from stem explants. After ~8 weeks on selection medium healthy
advelltlLious shoots were transferred to hormone free MS medium cont~ining 3%
sucrose, 150 mg/L kanamycin, 500 mg/L ticarcillin, 0.8% Difco Bacto Agar. At this
stage GUS histo~hemic~l assay (Jefferson, 1987) and/or NPT II dot-blot assay
(McDonnell et al., 1987) was used to identify transgenic shoots. Transgenic shoots
were transferred to MS m~illm supplemente-l with 3% sucrose, 500 mg/L ticarcillin
and 0.4% (w/v) Gelrite Gellan Gum (Schweizerhall) for root induction. All cukures
were m~int~ined under a 16 hour photoperiod (120 /~E cool white fluorescent light) at
23i 2. When plants were rooted and reached 4-6 cm tall they were ~c~lim~ticecl under
mist. A mix cont~ining a high ratio of perlite (75% or greater) soaked in hydroponic
mix ~Kandreck and Black, 1984) was used for ac~limlti~n, which typically lasts 4-5
weeks. Plants were ~crlim~ticec~ at 23C under a 14 hour photoperiod (200,uE
mercury halide light).
EXAMPLE 11
Transformation of Ros~ hybrida
1. Rosa ~brida cv Royalty
Plant tissues of the rose cultivar Royalty were transformed according to the method
riicrlose~ in PCT 91/04412, having publication number WO92/00371.
2. Ros~ ~ybri~ cv Kardinal
a. Plant Material
Kardinal shoots were obtained from Van Wyk and Son Flower Supply, Victoria,
WO 94/28140 ~.a32~ - 16 - PCTIAU94/00265
Australia. Leaves were removed and the remaining shoots (5-6 cm) were sterilized in
1.25 % (w/v) sodium hypochlorite (with Tween 20) for 5 minutes followed by threerinses with sterile water. Isolated shoot tips were soaked in sterile water for 1 hour
and precultured for 2 days on MS medium cont~ining 3% sucrose, 0.1 mg/L BAP, 0.15 mg/L kinetin, 0.2 mg/L Gibberellic acid, 0.5% (w/v) polyvinyl pyrrolidone and 0.25%
Gelrite Gellan Gum, before co-cultivation.
b. Co-cultivation of Agrob~k"~J~ and Rosa shoot Tissue
Agrobac~enum tumefaaens strains ICMP 8317 (~anssen and Gardner 1989) and AGL0,
10 cont~ining the binary vector pCGP812, was m~intain~rl at 4C on MG/L agar plates
with 100 mg/L gentamycin. A single colony from each Agrobacterium strain was
grown overnight in liquid MG/L broth. A final concentration of 5 x 108 cells/mL
was prepared the next day by dilution in liquid MG/L. Before inoculation, the two
Agrobacter~um cultures were mixed in a ratio of 10:1 (AGL0/pCGP812:
15 8317/pCGP812). A longit~l~1inal cut was made through the shoot tip and an aliquot
of 2 ,ul of the mixed Ag;robactenum cultures was placed as a drop on the shoot tip.
The shoot tips were co-cultivated for 5 days on the same mPclillm used for preculture.
Agrobactenum tumefaaens strain AGL0, cont~ining the binary vector pCGP1458, was
20 maint~ine~l at 4C on MG/L agar plates with 100 mg/L kanamycin. A single colony
from each Agrobactenum strain was grown overnight in liquid MG/L broth. A final
conce~ d~ion of 5 x 108 cells/mL was prepared the next day by dilution in liquidMG/L.
25 c. Rec~,v~.y of Transgenic Rosa Plants
After co-cultivation, the shoot tips were transferred to selection mP~ m Shoot tips
were transferred to fresh selection mP~ m every 3-4 weeks. Galls obsel ved on the
shoot tips were excised when they reached ~8 mm in ~ mpter. Isolated galls were
transferred to MS .. P~;.. cont~ining 3% sucrose, 25 mg/L kanamycin, 250 mg/L
30 cefotaxime and 0.25% Gelrite Gellan Gum for shoot formation. Shoots regenerated
from gall tissue were isolated and transferred to selection mPfiillm GUS hictorhemic~l
assay and callus assay were used to identify tr~ncgPnic shoots. Transgenic shoots were
wo 94/281~0 2 1 5 3 ~ 2 ~ PCT/AUg4/00265
- 17 -
transferred to MS medium con~aining 3% sucrose, 200 mg/L cefotaxime and 0.25%
Gelrite Gellan Gum for root induction. All cultures were m~int~ined under 16 hour
photoperiod (60 ~E cool white fluorescent light) at 23 i 2. When the root system was
well developed and the shoot reached 5-7 cm in length the transgenic rose plants were
5 transferred to autoclaved Debco 514110/2 potting mix in 8 cm tubes. After 2-3 weeks
plants were replanted into 15 cm pots using the same potting mix and m~in~ined at
23 under a 14 hour photoperiod (300,uE mercury halide light). After 1-2 weeks potted
plants were moved to glasshouse ~I)ay/Night temperature: 25-28/14) and grown to
flowering.
EXAMPLE 12
Transformation of C~nys~"~h~",u", monfolis m
a. Plant Material
Chr~santhemum monfolium (cv. Blue Ridge, Pennine Chorus) ~lttingc were obtained
15 from F & I Baguley Flower and Plant Growers, Victoria, Australia. Leaves wereremoved from the c~7ttingc, which were then sterilized briefly in 70% (v/v) ethanol
followed by 1.25% (w/v) sodium hypochlorite (with Tween 20) for 3 minutes and
rinsed three times with sterile water. Internodal stem sections were used for co-
cultivation.
b. Co-cultivation of Agroh~k"~", and Cb~ "~",u>" Tissue
Agrobactenum tumefaaens strain LBA4404 (Hoekema et al., 1983), cont~ining any one
of the binary vectors pCGP90, pCGP484, pCGP485 or pCGP628, was grown on
MG/L agar plates cont~ining 50 mg/L rifampicin and 10 mg/L gentamycin. A single
25 colony from each Agrobactenum was grown overnight in the same liquid mP~ m
These liquid cultures were made 10% with glycerol and 1 mL aliquots transferred to
the freezer (-80). A 100-200~1 aliquot of each frozen Agrobactenum was grown
overnight in liquid MG/L cont ining 50 mg/L rifampicin and 10 mg/L gentamycin.
A final conce~r~ion of 5 x 10 cells/mL was prepared the next day by dilution in
30 liquid MS cont~ining 3% (w/v) sucrose. Stem sections were co-cultivated, with Agrobactenum cont~ining any one of LBA4404/pCGP90, LBA4404/pCGP484,
LBA4404/pCGP485 or LBA4404/pCGP628, on co-cultivation mP~ m for 4 days.
WO 94128140 2 ~ 6 3 ~ 2 ~ PCT/AU94/00265
- 18 -
c. Recovery of Transgenic C~ysG."~J~"um Plants
After co-cultivation, the stem sections were transferred to selection medium. After 34
weeks, regenerating explants were transferred to fresh m~linm Adventitious shoots
which survived the kanamycin selection were isolated and transferred to MS medium
5 containing kanamycin and cefotaxime for shoot elongation and root induction. All
cultures were maintained under a 16 hour photoperiod (80 ~E cool white fluorescent
light) at 23 :t 2C. Leaf samples were collected from plants which rooted on
kanamycin and Southern blot analysis was used to identify tr~ncgenic plants. When
transgenic chrys~nthemllm plants reached 4-5 cm in length they were transferred to
10 autoclaved Debco 51410/2 potting mix in 8 cm tubes. After 2 weeks plants werereplanted into 15 cm pots using the sarne potting mix and m~int~inecl at 23C under
a 14 hour photoperiod (300 ~E mercury halide light). After 2 weeks potted plantswere moved to glasshouse tDay/Night temperature: 25-28C/14C) and grown to
flowering.
EXAMPLE 13
Southern Analysis
a. Isolation of Genornic DNA from Dian~bus
DNA was isolated from tissue essenti~lly as described by Dellaporta et al., (1983). The
20 DNA pl~ald~ions were further purified by CsCl buoyant density cell~r;rugation (Sambrook et al., 1989).
b. Isolation of Genomic DNA from C~"~h.",u",
DNA was isolated from leaf tissue using an extraction buffer cont~ining 4.5 M
2~ g~ni~inillm thiocyanate, 50 mM EDTA pH 8.0, 25 rnM sodium citrate pH 7.0,
0.1 M 2-mercaptoethanol, 2% (v/v) lauryl sarcosine. The plant tissue was ground to
a fine powder in liquid N2 following which extraction buffer was added (5 mL/g of
tissue) and the solution mixed on a rotating wheel for 16 h. The mixture was then
phenol: chloroform: isoamylalcohol (50:49:1) extracted twice and the genomic DNA30 precipitated by adding three volumes of ethanol and cent-;ruging for 15 min at
10,000 rpm.
WO 94/28140 2 I 6 ~ ~ ~ O PCTIAU94/00265
~1~ 19-
c. Isolation of Genomic DNA from Ros~
DNA was extracted by grinding tissue in the presence of liquid N2 in a mortar and
pestle and adding lml of extraction buffer (0.14 M sorbitol, 0.22 M Tris-HCl [pH8.0],
5 0.022 M EDTA, 0.8 M NaCl, 0.8% (w/v) CTAB, 1%N-laurylsarcosine) heated at 65C.
Chloroform (200,u1) was added and the mixture incubated at 65C for 15 min.
Following cen~.;rugation, the supernatant was phenol-chloroform extracted and then
added to an equal volume of isopropanol, inverting to mix. This mixture was
ce~ ;fuged and the pellet washed with 95% ethanol, re-centrifuged and washed with
10 70% ethanol. The pellet was vacuum-dried and resuspended in 30,u1 TE buffer (pH
8.0).
d. Southern Blots
The genomic DNA (10 ~g) was digested for 16 hours with 60 units of EcoRI and
15 electrophoresed through a 0.7% (w/v) agarose gel in a running buKer of TAE (40 mM
Tris-acet~te, 50 mM EDTA). The DNA was then denatured in ~lPn~hlring solution
(1.5 M NaCl/0.5 M NaOH) for 1 to 1.5 hours, neutralized in 0.5 M Tris-HCl (pH
7.5)/ 1.5 M NaCl for 2 to 3 hours and the DNA was then transferred to a Hybond N(Amersham) filter in 20 x SSC.
Southern analysis of putative transgenic D~anthus, Rosa and Ch~ysanthemum plantsobtained after selection on kanamycin confirmed the integration of the appropriate
~him~ric gene into the genome.
EXAMPLE 14
Northern Analysis
a. Dian~s and (~ny~"~",u", RNA
Total RNA was isolated from tissue that had been frozen in liquid N2 and ground to
a fine powder using a mortar and pestle. An extraction buffer of 4 M guanidiniumisothiocyanate, 50 mM Tris-HCl (pH 8.0), 20 mM EDTA, 0.1% (v/v) Sarkosyl, was
added to the tissue and the mixture was homogenized for 1 minute using a polytron
at m~imllm speed. The suspension was filtered through Miracloth (Calbiochem) and
WO 94/28140 PCT/AU94/00265
~ G?~2~ 20-
ce~ ;fuged in a JA20 rotor for 10 min~ltes at 10,000 rpm. The supernatant was
collected and made to 0.2 g/ mL CsCl (w/v). Samples were then layered over a 10 mL
cushion of 5.7 M CsCl, 50 mM EDTA (pH 7.0) in 38.5 mL Quick-seal centrifuge tubes
(Berkm~n) and centr;ruged at 42,000 rpm for 12-16 hours at 23 in a Ti-70 rotor. Pellets
5 were resuspended in TE/SDS (10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.1% (w/v)
SDS) and extracted with phenol:chloroform:isoamyl alcohol (25:24:1) saturated in 10
mM EDTA (pH 7.5). Following ethanol precipitation the RNA pellets were
resuspended in TE/SDS.
10 RNA samples were electrophoresed through 2.2 M formaldehyde/1.2% (w/v) agarose
gels using running buffer cont~ining 40 mM morpholinopropanesulphonic acid (pH
7.0), 5 mM sodium acetate, 0.1 mM EDTA (pH 8.0). The RNA was transferred to
Hybond-N filters (Amersham) as described by the m~nllf~tllrer and probed with 32p
labelled cDNA fragment (108 cpm/,ug, 2 x 106 cpm/mL). Prehybric~i7~tion (1 h at
15 42C) and hybridization (16 h at 42C) was carried out in 50% (v/v) form~mi-le, 1 M
NaCl, 1% (w/v) SDS, 10% (w/v) dextran sulphate. Degraded salmon sperm DNA (100
,ug/mL) was added with the 32P-labelled probe for the hybridization step.
Filters were washed in 2 x SSC/ 1% (w/v) SDS at 65C for 1 to 2 hours and then 0.2
20 x SSC/ 1% (w/v) SDS at 65C for 0.5 to 1 hour. Filters were exposed to Kodak XAR
film with an intencifying screen at -70 for 48 hours.
Northern analysis of Dianthus cv. Red Sim transformed with plasmid pCGP90
in~ te~l that eight of thirteen plants were positive.
b. Rosa R;NA
Total RNA was extracted from petals (buds and of flowers 5 days post-harvest)
according to the method of M~nning, 1991.
WO 94/28140 21 ~3~ o PCT/AU94/00265
-- 21 --
EXAMPLE 15
32P-Labelling of DNA Probes
DNA fr~gmçnts (50 to 100 ng) were radioactively labelled with 50 ~Ci of [a-32P]-- S dCTP using an oligolabelling kit (Bresatec). Unincorporated [a-32P]-dCTP was
removed by chromatography on a Sephadex G-50 (Fine) column.
EXAMPLE 16
Anthocyanidin Analysis
10 Prior to HPLC analysis the anthocyanin molecules present in petal extracts were acid
hydrolysed to remove glycosyl moieties from the anthocyanidin core. The
hydroxylation pattern on the B ring of the anthocyanin pigm~nts was determined by
HPLC analysis of the anthocyanidin core molecule. The HPLC system used in this
analysis was a Hewlett-Packard 1050 equipped with a multiwavelength detector
15 (MWD). Reversed phase chromatographic separations were performed on a Spherisorb
S5 ODS2 cartridge column, 250 mm x 4 mm ID.
a. Extraction of anthocyanins and flavonoids
Flower pigm~nts were extracted from petal sçgmçnts (ca. 50 mg) with 5 ml of
20 m~th~nol cont~ining 1% (v/v) of aqueous 6M hydrochloric acid. Extracts were diluted
with water (1-9) and filtered (Millex HV, 0.45,u) prior to injection into the HPLC
system.
b. Hydrolysis of anthocyanins
25 Crude mPth~nolic extracts (100 ~L) obtained in a. above were evaporated to dryness
in Pierce Reacti-Vials using a stream of dry nitrogen at room temperature. The
residues were dissolved in 200~L 2M HCl, vials were capped and then heated at 100C
for 30 minutes. Hydrolysis mixtures were diluted with water (1:9) and filtered (Millex
HV, 0.45~) prior to HPLC analysis.
WO 94/28140 PCT/AU94/00265
- 22 -
c. Chromatography
Separation of flower pigmPnts was effected via gradient elution using the following
system:
Solvent A: (triethylamine: conc. H3PO4: H2O) (3:2.5:1000)
Solvent B: acetonitrile
Gradient Conditions: 5% B to 40% B over 20 minutes
Flow Rate: 1 ml/min
Temperature: 35C
Detection: MWD with cim1lltqneous data acquisition at 280, 350 and 546nm.
The anthocyanidin peaks were ic~entifie~l by reference to known standards. An
alternative method for the analysis of anthocyanin molecules present in petal extracts
is to be found in Brugliera et al., 1994.
HPLC analysis is con~ cte~l to determine the presence of delphini~in, pelargonidin and
cyanidin pigm~ntc in samples of carnation, chrysqnthemllm and rose tissues having
been transformed with one or other of the plasmids pCGP90, pCGP485, pCGP484,
pCGP628, pCGP653 or pCGP1458. Representq-tive data of pCGP90, pCGP485 and
20 pCGP653 in transgenic carnation flowers are shown in Table 1.
WO 94/28140 21 ff 3 2 2 Q PCTIAU94/00265
- 23 -
TABLE 1
HPLC Analysis of pCGP90, pCGP485 and pCGP653 Transgenic Plowers
Sample % Delphinidin % Pelar onidin %C~
NON-TRANSGENIC CARNATION:
Cul~ivar: Red Sim 0 85.3 0.8
TR~NSGENIC CARNATION:
Red Sim + pCGP90
(i) Acc #* 1933 1.9 82.7 nd~
(ii) Acc # 2011 3.7 76.9 nd
Red Sim + pCGP485
l) Acc # 3654B 13.0 75.1 2.3
Red Sim + pCGP653
(i) Acc # 3660/2 18.1 71.4 3.2
(ii) Acc # 3655 35.6 49.1 7.5
* Acc # ~ plant accession number
*~ nd - not detected
EXAMPLE 17
Pr~alation of Plant Extracts for Assay of 3' ,5' -Hydroxylase Activity
Plant tissue was homogenised in a 10 times volume of ice.-cold extraction buffer (100
mM potassium phosphate (pH 7.5), 1 mM EDTA, 0.25 M sucrose, 0.25 M mannitol,
0.1% (w/v) BSA, 0.1 mg/mL PMSF, 20 mM 2-mercaptoethanol and 10 mg/mL
polydar AT). The homogenate was cc.lLliruged at 13,000 rpm in a JA20 rotor
~el1~".-~") for 10 min at 4C and an aliquot of the supernatant assayed for 3',5'-
hydroxylase activity.
WO 94/28140 PCT/AU94/00265
~ 3~2~ 24- - ~
3~ ,5~ -Hydroxylase Assay
3',5'-Hydrox,vlase enzyme activity was measured using a modified version of the
method described by Stotz and Forkrnann (1982). The assay reaction mixture typically
cont~inPrl 195 ~L of plant extract, 5~L of 50 mM NADPH in assay buffer (100 mM
potassium phosphate (pH8.0), 1 mM EDTA and 20 mM 2-mercaptoethanol), and 105
dpm [14C] naringenin in a final volume of 200 ~L. Following incubation at 23
overnight, the reaction mixture was extracted twice with 0.5 mL of ethyl~cet~te. The
ethyl acetate phase was dried under vacuum and then resuspended in 10 ~L of ethyl
acetate. The radio-labelled flavonoid molecules were then separated on cellulose thin
layer plates ~Merck Art 5577, Germany) using a chloroform: acetic acid: water (10:9:1,
v/v) solvent system. At the completion of the chromatography, the TLC plates were
air-dried and the reaction products localised by autoradiography and i~i~ntifiecl by
comparison to non-radioactive naringenin, eriodictyol, dihydroquercetin and
dihydromyricetin standards which were run alongside the reaction products and
vic~.~1i7Pd under W light.
EXA~PLE 18
Transformation of various cultivars
The ~him~ric genes cont~inecl in any one of the constructs pCGP90, pCGP812,
pCGP628, pCGP485, pCGP653, pCGP484 or pCGP1458 is introduced into plant
varieties of rose, carnation and ch~ h~mllm using Agrobactenum-m~ t~-l gene
transfer, as described in Examples 10, 11 and 12. Integration of the appropriate~hir--~ ;c gene into the plant genome is confirm~l by Southern analysis of plants
obtained after kanamycin selection and HPLC analysis is used to detect the presence
of anthocyanins as described in Example 16, above.
Plants s~lccescfully rendered transgenic and which are able to express the transgene in
accordance with the present invention, have signifie~nt levels of 3',5'-hydroxylase
enzyme activity in addition to 3' ~5/-hydr~ylated anthocyanins (seen in Example 16),
compared with non-~r~lsgel1ic controls which do not contain the gene n~c~ss~ry for
the production of 3' ,5' -hydlc)~Lylase activity.
WO 94/28140 21 ~ 3 2 2 ~ PCT/AU94/0026~
- 25 -
EXAMPLE 19
Carnation cv. Crowley Sim + pCGP 90
The plasmid pCGP90 was mtroduced into the carnation cultivar Crowley Sim using
Agrobactenum-mPrli~terl gene transfer, as described in Example 10. Integration of the
construct in the plant genome was confirmed by Southern analysis of plants obtained
after kanamycin selection. Nine plants were ~mined for the presence of the nptIIand Hfl genes and for the production of delphinidin. Eight of the nine plants analyzed
were positive for both nptII and Hfl but HPLC analysis was unable to detect any
evidence of delphini~lin production by these plants (see Table 2; "Kan" ~ kanamycin).
Table 2
# Acc# Kan Hfl Delphinidin
1930A + +
2 1942B + +
3 2008B - - -
4 2217A + +
2217B + +
6 2338A + +
7 2338B + +
8 2338C + +
9 2338D + +
EXAMPLE 20
Carnation cv. Laguna + pCGP 485
The plasmid pCGP485 was introduoed into the carnation cultivar Laguna using
Agrobactenum-mP~ tecl gene transfer, as described in Example 10. Integration of the
construct in the plant genome was confirmed by Southern analysis of plants obtained
after kanamycin selection. HPLC analysis of the anthocyanin molecules present inpetal extracts is carried out according to the procedure set out in Example 16, above,
to show ~he presence of 3' ,5'-hydroxylated anthocyanin del;va~ s. These 3' ,5'-hydroxylated anthocyanins are only produced as a result of the expression of the
WO 94/28140 PCT/AU94/0026~
p~ ~32~ 26 -
exogenous DNA sequence, ie: the Hfl cD~JA sequence, introduced via transformation
with the binar,v vector pCGP485.
EXAMPLE 21
Rose cv. Royalty + pCGP 485/pCGP 628
The plasmids pCGP485 and pCGP628 were introduced into the rose cultivar Royalty
usingAgrobactenum-m~fiiate~l gene transfer, as referred to in Example 11. Integration
of the construct in the plant genome was confirmed by Southern analysis of plants
obtained after kanamycin selection. HPLC analysis of the anthocyanin molecules
present in petal extracts is again carried out according to the procedure set out in
Example 16, above, to show the presence of 3' ,5'-hydroxylated anthocyanin
de.;v~ives. These 3' ,5' -hydroxylated anthoc,vanins are only produced as a result of
the expression of the exogenous DNA sequence, ie: the Hfl cDNA sequence,
introduced via transformation with either of the binary vectors pCGP485 or pCGP628.
EXAMPLE 22
Rose cv. Kardinal + pCGP 1458
The plasmid pCGP1458 was introduced into the rose cultivar Kardinal using
Agrobactenum-mr-liatecl gene transfer, as described in Example 11. Integration of the
construct in the plant genome was confirmed by Southern analysis of plants obtained
after kanamycin selection. HPLC analysis of the anthocyanin molecules present inpetal extracts is again carried out according to the procedure set out in Example 16,
above, to show the presence of 3' ,5'-hydroxylated anthocyanin de.;va~ives. These
3' ,5' -hydroxylated anthocyanins are only produced as a result of the expression of the
exogenous DNA sequence, ie: the Hfl cDNA sequence, introduced via transformationwith the binary vector pCGP1458.
EXAl!tIPLE 23
CL,~ ,tllemum ~v. BlueRidge + pCGP 484/pCGP 485/pCGP 628
The plasrnids pCGP484, pCGP485 and pCGP628 were introduced into the
chrys~nth~mllm cultivar BlueRidge using Agrobactenum-m~o~ia~e~l gene transfer, as
described in Example 12. Integration of the construct in the plant genome was
WO 94/28140 21 6 3 ~ 2 0 PCT/AU94/00265
- 27 -
confirmed by Southern analysis of plants obtained after kanamycin selection. HPLC
analysis of the anthocyanin molecules present in petal extracts is again carried out
according to the procedure set out in Example 16, above, to sho~ the presence of3~ ,5~ -hydroxylated anthocyanin deliva~iv~s. These 3' ,5' -hydroxylated anthocyanins
are only produced as a result of the expression of the exogenous DNA sequence, ie: the
Hfl cDNA sequence, introduced via transformation with any one of the binary vectors
pCGP484, pCGP485 or pCGP628.
EXAMPLE 24
Altered Infloresc~-lce
The expression of the introduced flavonoid 3' ,5~-hydroxylase enzyme activity in the
transgenic plant is capable of having a marked effect on flower colour. Floral tissues
in transgenic plants may change from the pale pinks and reds of the non-transgenic
control plants to colours ranging from a darker pink/maroon to a blue/purple colour.
The colours may also be described in terms of numbers from the Royal Horticultural
Society' s Colour Chart. In general, the changes can be described as moving the colour
from the pale-to-mid pink hues of 60C/D - 65C/D, to the darker bluer/purpler hues
represPntPcl by many, but not all, of the colour squares between 70 and 85. It should
be remembered that other bio~hemic~l and physiological conditions will affect the
individual outcome and the citing of specific colours should not be interpreted as
defining the possible range.
In the case of the transgenic carnation flower, Accession Number 3655, produced using
the plasmid construct pCGP653 described above, an obvious bluing effect on the petals
was observed. The normally-orange-red colour of Red Sim carnation cultivars
(corresponding appro~im~tPly to 45A/B of the Royal Horticultural Society~ s Colour
Chart) had changed to a blue/purple hue.
WO 94/28140 PCT/AU94/00265
2~3~2~ - 28 -
Those skilled in the art will appreciate that the invention described herein is susceptible
to variations and modifications other than those sperific~lly described. It is to be
understood that the invention ~nclùdes all such variations and mo~lific~ti~ns. The
invention also includes all of the steps, features, compositions and compounds referred
to or indicated in this sperific~tion, individually or collectively, and any and all
combinations of any two or more of said steps or features.
WO 94/28140 ~ I ~ 3 2 2 ~ PCT/AU94/00265
- 29 -
RE~ERENCES:
Bethesda Research Laboratories. BRL pUC host: E. coli DH5aTM competent cells.
Bethesda Res. Lab. Focus 8(2): 9, 1986.
Bevan, M. Nucleic Acids Res. 12: 8711-8721, 1984.
Brugliera, F., Holton, T.A., Stevenson, T.W., Farcy, E., Lu, C-Y. and Cornish, E.C.
Plant J. 5(1): 81-92, 1994.
Comai, L., Moran, P. and Maslyar, D., Plant Molecular Biology 15: 373-381, 1990.
Dellaporta, S.J., Wood, J. and Hick, J.B. Plant Mol. Biol. Rep. 1: 19-21, 1983.
Ebel, J. and Hahlbrock, K. In 7'he Flavonoids: Advances in Research Since 1980.
Harborne, J.B. (Ed.), Aca~lemic Press, New York, USA, 641-679, 1988.
Forkm~nn, G. Plant Breeding 106: 1-26, 1991.
Garfinkel, D.J. and Nester, E.W. J. Bacteriol. 144: 732-743, 1980.
Hahlbrock, K. and Grice~h, H. Annu. Rev. Plant Physiol. 30: 105-130, 1979.
~anahan, D. J. Mol. Biol. 166: 557, 1983.
Holton, T.A. PhD Thesis, Unive~ y of Melbourne, Australia, 1992.
Holton, T.A. and Graharn, M.W. Nucleic Acids Res. 19: 1156, 1991.
Horsch, R.B., Fry, J.E., Hoffm~nn, N.L., Eichholz, D., Rogers, S.G. and Fraley, R.T.
Science 227: 1229-1231, 1985.
WO 94/28140 PCT/AU94/00265
~6~?~ - 30 -
Inoue, H., Nojima, H. and Okayama, H; Gene 96: 23-28, 1990.
J~nnce~, BJ.J. and Gardner, R.C. Plant Mol. Biol. 14: 61-72, 1989.
Jefferson, R.A., Kavanagh, T.A. and Bevan, M.W. ~MBO J. 6(13): 3901-3907, 1987.
Kandreck, K.A. and Black, N.D. Growing media for ornamental plants and turf p317,
NSW Univ~ ;Ly Press, Kencington, Australia, 1984.
Koes R.F. Genes involved in flavonoid b~osynthesis in Petunia hybrida: T~e chalcone
synthase multigene family. PhD Thesis, Vrije Universiteit, Amsterdam, The
Netherlands, 1988.
Lazo, G.R., Pascal, A.S. and Ludwig, R.A. Bio/technology 9: 963-967,1991.
McDonnell, R.E., Clarke R.D., Smith, L.A. and Hinchee, M.A. Plant Mol. Biol.Rep.
4: 380-386,1987
M~nning, K. Anal. Biochem. 195: 45-50,1991.
Sarnbrook, J., Fritsch, E.F. and M~ni~tic, T. Molecular Cloning: A Laboratory Manual
(2nd edition). Cold Spring Harbor Laboratory Press, USA, 1989.
Schram, A.W., Jonsson, L.M.V. and Rennink, G.J.H. "Bio~htqmictry of flavonoid
synthesis in Petunia hybrida." In: Petunia Sink, K.C. (Ed.), Springer-Verlag, Berlin,
Germany, pp 68-75, 1984.
Sommer, H. and Saedler, H. Mol. Gen. Genet. 202: 429-434,1986.
Stafford, H.A. Flavonoid Metabolism. CRC Press, Inc. Boca Raton, Florida, USA,
1990.
WO 94/28140 21 6 3 2 2 ~ PCT/AU94/00265
- 31 -
Stotz, G. and Forkm~nn, G. æ Natu~orsch 37c: 19-23, 1982.
Ve~ y~se, S.A.R., Delcour, J.A. and Dondeyne, P. J. Chromatography 324: 495-497,
1985.
Wiering, H. and De Vlaming, P. "Inheritance and Biorhemictry of Pigm~nts." In:
Petunia Sink, K.C. tEd.), Springer-Verlag, Berlin, Germany, pp 49-65,1984.
