Note: Descriptions are shown in the official language in which they were submitted.
W094~72 ~1 64297 PCT~S94/06177
Description
MENGOVIRUS AS A VECTOR FOR EXPRESSION OF FOREIGN POLYPEPTIDES
CROSS REFERENCE TO RELATED APPLICATIONS
This application is a continuation-in-part application
of United States application Serial No. 08/090,53l, filed
June 3, 1993. The entire disclosure of this application is
relied upon and expressly incorporated by reference herein.
BACKGROUND OF THE INVENTION
This invention relates to mengoviruses modified to
contain a nucleic acid encoding one or more foreign
polypeptides for immunological and non-immunological
purposes. Modified mengoviruses of this invention can be
recombinant viruses and/or chimaeric viruses.
Mengovirus is a picornavirus belonging to the genus
cardiovirus. While the natural host for mengovirus is the
mouse, with infection resulting in acute murine menin-
goencephalitis, mengovirus has a wide host range. In
addition to the mouse, mengovirus is also able to infect
various animal species including pigs, elephants, and pri-
mates including humans.
The picornaviruses are a family of pathogenic viruses.
Examples of picornaviruses include rhinovirus responsible for
the common cold, poliovirus, foot and mouth disease virus
(FMDV), Coxsackie viruses, hepatitis A virus, and murine
cardioviruses including mengovirus and encephalomyocarditis
virus.
Picornaviruses have a non-enveloped capsid containing a
small positive sense RNA genome. The capsids of all
picornaviruses are composed of a 60 subunit protein shell
having 5:3:2 icosahedral symmetry with each subunit
containing four nonidentical polypeptide chains (VPl, VP2,
VP3, and VP4). The shell encapsulates a single copy of the
positive sense RNA genome. The three dimensional structure
of mengovirus has been determined to atomic resolution by
y~ ~ 2 ~ 6 4 2 9 ~
W094/2g472 -4 ~ J ' PCT~S94/06177
-- 2
X-ray crystallography. Luo et al., Science 235:182-191
(1987).
The viral genome of mengovirus is a positive stranded
RNA molecule of about 7,800 nucleotides in length. The
genome is polyadenylated at its 3' end and covalently linked
to a small viral polypeptide VPg at its 5' end. The
mengoviral genome has been cloned in the form of a
complementary DNA (cDNA) molecule. The genome includes a
single open reading frame encoding a viral polyprotein.
The viral proteins are located within the polyprotein in
the order L-P1-P2-P3 from the N to the C terminal end of the
polyprotein. The polyprotein is processed by a series of
cleavage events to give rise to all structural and non-
structural proteins. The details of this processing are
reviewed by Ann C. Palmenberg, Proteolytic Processinq of
Picornaviral Pol~Protein 44 Ann. Rev. Microbiol. 603 (1990),
which is incorporated herein by reference. L designates a
leader polypeptide that is present in cardio and
aphthoviruses. P1 is a precursor to the structural proteins
VP1, VP2, VP3, and VP4, which are also identified as lD, lB,
lC, and lA, respectively. P2 and P3 are precursors to the
non-structural viral proteins required for the replication of
the viral RNA and the processing of the polyprotein.
The viral RNA is infectious. That is, upon its
introduction into permissive cells it is able to initiate a
complete viral multiplication cycle regenerating infectious
virus. RNA transcripts synthesized in vitro by an RNA
polymerase from the full-length viral cDNA were also sho~n to
be infectious. See Duke et al., J. Virol. 63:1822 (19~9).
The murine cardioviruses, such as mengovirus and
encephalomyocarditis virus, and aphthoviruses can be
distinguished from other positive strand RNA viruses by the
presence of long homopolymeric poly(C) tracts within their 5'
noncoding sequences. Although the length, generally 60-350
bases, and sequence discontinuities, e.g. uridine residues,
that sometimes disrupt the homopolymeric sequence have served
to characterize natural viral isolates, the exact biologica~
W094l29472 2 1 6 ~ 2 9 7 ;~ PCT~Sg4~06177
function of the poly(C) region is not clear. cDNA-mediated
truncation of the mengovirus poly(C) tract attenuates the
pathogenicity of this virus in mice. See Duke et al., Nature
343:474 (1990).
An attenuated strain of mengovirus, vM16, has been
described by Duke et al., Attenuation of Mengovirus through
Genetic Engineering of the 5' Non-coding Poly(C) Tract,
Nature 343:474 (1990), which is incorporated herein by
reference, and by Duke and Palmenberg, Cloning and Synthesis
of Infectious Cardiovirus RNAs Containing Short, Discrete
Poly(C) Tracts, J. Virol. 63:1822 (1989), which is also
incorporated herein by reference. This attenuated strain
contains a deletion in the poly(C) tract of the 5I non-coding
region of its genome. This attenuated strain protects mice
from a challenge with virulent mengovirus and
encephalomyocarditis virus (EMCV).
The advent of recombinant DNA technology has permitted
the development of live recombinant vaccines.
There exists a need in the art for suitable vectors by
which polypeptides and/or epitopes or antigens of human or
animal pathogens can be incorporated resulting in modified
live viruses that can be used in vaccines.
SUMMARY OF THE INVENTION
This invention helps satisfy the needs in the art by
providing, inter alia, a viable modified attenuated
mengovirus where a structural or non-structural protein of
the mengovirus comprises a heterologous amino acid sequence,
a fusion protein of the viable modified mengovirus, a
permissive cell infected with the viable modified mengovirus,
a recombinant nucleic acid (RNA or DNA) comprising the full-
length sequence of the modified mengovirus, a vaccine, and a
method of inducing an immune response.
This invention relates, inter alia, to a viable modified
mengovirus wherein the modified mengovirus is an attenuated
strain and comprises a heterologous nucleotide sequence. An
embodiment of this invention relates to a viable modified
mengovirus where modified mengovirus is an attenuated strain
W094/29472 2 ~ 6 4 2 9 7 PCT~S94/06177
and comprises a heterologous nucleotide sequence coding for a
heterologous peptide or protein. In a further embodiment,
the viable modified mengovirus is an attenuated strain having
a mutation or a deletion in the poly (C) tract of the 5
non-coding region of the genome of the mengovirus.
In particular, an embodiment of this invention relates
to a viable recombinant mengovirus where the recombinant
mengovirus is an attenuated strain having a deletion in the
poly(C) tract of the 5' non-coding region of the mengovirus
genome, and where the leader polypeptide of the recombinant
mengovirus is full-length and comprises a heterologous amino
acid sequence. In one specific embodiment of this invention
the recombinant mengovirus contains amino acids 299-466 of
gpl20 of the MN isolate of HIV-I inserted after amino acid 6
of the leader polypeptide.
Another embodiment of this invention relates to a fusion
protein comprising a full-length leader polypeptide of an
attenuated mengovirus strain into which a heterologous amino
acid sequence is inserted.
In a further embodiment, this invention relates to
permissive cells infected with a recombinant mengovirus of
this invention. In specific embodiments the permissive cells
are HeLa, VERO, BHK21, and P815 cells.
An additional embodiment of this invention relates to a
recombinant nucleic acid molecule (RNA or DNA) comprising a
mengovirus nucleic acid sequence and a heterologous nucleic
acid sequence. Preferably, the heterologous sequence is
inserted within the mengovirus sequence encoding the full-
length leader polypeptide. More preferably, the recombinant
nucleic acid molecule comprises the full-length attenuated
mengovirus sequence and the heterologous sequence inserted
within the full-length leader polypeptide sequence.
In yet another embodiment, this invention relates to a
viral genome of a recombinant mengovirus of this invention.
Another embodiment of this invention relates to vaccines
comprising a recombinant mengovirus of this invention. In
wo 94/29472 ~ l 6 ~ 2 9 7 PCTtUS94/06l77
specific embodiments the vaccines comprise the recombinant
mengovirus in admixture with a pharmaceutically acceptabJe
carrier.
An additional embodiment of this invention relates to a
method of inducing an immune response comprising
administering a recombinant mengovirus of the invention via a
parenteral or oral route to an organism such as a human or
animal, in which an immune response is to be induced. The
invention also concerns immunogenic compositions. Such
compositions comprise the recombinant mengovirus in admixture
with a pharmaceutically acceptable carrier.
A further embodiment of this invention relates to a
viable recombinant mengovirus of this invention further
comprising protease cleavages sites between a heterologous
amino acid sequence and the leader polypeptide. In a
specific embodiment of this invention, the protease cleavage
site is a protease 3C cleavage site.
In yet another embodiment, this invention relates to a
permissive cell infected with a viable recombinant mengovirus
of this invention, where the permissive cell expresses a
heterologous amino acid sequence in native form.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 is a schematic depiction of the organization of
the mengovirus genome.
Figure 2 is a plasmid map of pM16 depicting several
restriction sites, the location of the T7 promoter (arrow),
and the sequences derived from pBluescribe M13(+) (designated
as pBS, thin line) and the cDNA sequences derived from
mengovirus (heavy line).
Figure 3 is a plasmid map of pO5156S.
Figure 4 is a plasmid map of pMRA-l. The heavy line
refers to DNA sequences from mengovirus. The thin line
refers to sequences from pBluescribe M13(+). The arrow
refers to the T7 promoter. Various restriction sites are
identified. The nucleotide numbering system refers to the
position of nucleotides in the recombinant plasmid.
w094/29472 ~ 5 ~ ; 2 1 6 4 2 9 7 PCT~S94/06177
.
Figure 5 is a plasmid map of pMRA-2. The heavy line
refers to DNA sequences derived from mengovirus. The thin
line refers to sequences from pBluescribe M13(+). The arrow
refers to the T7 promoter. The stippled line refers to the
sequence of Ggpl20-VCN. Various restriction sites are
identified. The nucleotide numbering system refers to the
position of nucleotides in the recombinant plasmid.
Figure 6 is a plasmid map of pMRA-3. The heavy line
refers to DNA sequences derived from mengovirus. The thin
line refers to sequences from pBluescribe M13(+). The arrow
refers to the T7 promoter. The stippled line refers to the
sequence of ~gpl20-VCN. Various restriction sites are
identified. The nucleotide numbering system refers to the
position of nucleotides in the recombinant plasmid.
Figure 7 is a diagram of the vMLN450 gene organization
and the sequence of the recombinant L protein. Amino acids
(aa) derived from mengovirus are written in plain letters,
while amino acids derived from HIV gpl20 are written in bold
letters. Amino acids derived from linkers are underlined.
Figure 8 depicts the results of a plaque assay. Fig. 8a
is the plaque phenotype of vM16 and Fig. 8b is the plaque
phenotype of vMLN450 stained after 72 hours.
Figure 9 depicts Reverse Transcription PCR (RT-PCR)
results. RT-PCR was performed with oligonucleotide pairs M-
VDW-1/3'VCN for lanes a-e and with oligonucleotide pairs M-
VDW-l/M-1094 for lanes g-k. The templates used for the
reactions were a) vMLN450 RNA, b) vM16 RNA, c) negative
control, d) pM16, e) pMRA-3, g) vMLN450 RNA, h) vM16 RNA,
i) negative control, j) pM16, and k) pMRA-3. Lane f)
contains bacteriophage lambda DNA cut with HindIII.
Figure 10 depicts the sequence of the ~gpl20-VCN region
at the DNA level (plus strand) and the oligonucleotides used
to sequence vMLN450 RNA derived PCR products. The boxed
sequence is restriction site NcoI.
Figure 11 is a 12% SDS-PAGE gel of cytoplasmic extracts
of a) mock infected HeLa cells, c) vM16 infected HeLa cel~s,
e) vMLN450 infected HeLa cells. Immunoprecipitations of
W094l29472 2 1 6 4 2 9 7 PCT~S94106177
-- 7
cytoplasmic extracts using MAb50.1 are shown in lane b) for
mock infected cells, lane d) for vM16 infected cells, and
lane f) vMLN450 infected cells.
Figure 12A depicts the results of an ELISA assay for
sera obtained from mice infected with vMLN450, vM16, and a
virus free control using gpl60 MN-LAI as an antigen.
Figure 12B depicts the results of an ELISA assay for
sera obtained from Balb/c mice infected with vMLN450, vM16,
and a virus free control using gpl60 LAI as an antigen. Irhe
reactivity of Balb/c sera 2 weeks after a first immunization
(filled bars) and 2 weeks after a second immunization
(stippled bars) with gpl60 LAI are shown. Titers are given
as reciprocal values of serum dilution giving an O.D. at 490
nm of 1.
Figure 12C depicts the results of an ELISA assay for
sera obtained from CBA mice infected with vMLN450, vM16, and
a virus free control using gpl60 LAI as an antigen. The
reactivity of CBA sera 2 weeks after a first immunization
(filled bars) and 2 weeks after a second immunization
(stippled bars) with gpl60 LAI are shown. Titers are given
as reciprocal values of serum dilution giving an O.D. at 490
nm of 1.
Figure 12D depicts the results of an ELISA assay for
sera obtained from Cynomolgus monkeys infected with vMLN45(),
vM16, and a virus free control using gpl60 LAI as an antigen.
The reactivity of Cynomolgus monkey preimmune sera (filled
bars) and sera 4 weeks after immunization (stippled bars)
with gpl60 LAI is shown. Titers are given as reciprocal
values of serum dilution giving an O.D. at 490 nm of 1.
Figure 13 is a diagram of the mengovirus polyprotein
showing a protease 3C cleavage site at the L-VP4 junction.
Figure 14 is a diagram of the polyprotein of the
recombinant mengovirus vMQG-1 showing the amino acid sequence
of the ~gpl20-QG-L junction for vMQG-l and vM16.
Figure 15 is a flow diagram of the procedure used to
construct pMRA-5.
W094/29472 ~- t~ t~ ~ 2 1 6 4 2 9 7 PCT~S94/06177
Figure 16 depicts the nucleic acid sequence of pM16.
The viral sequences are indicated with Us, i.e. as an RNA
sequence, and the plasmid sequences are indicated with Ts,
i.e. as a DNA sequence. pM16 is a DNA plasmid.
Figure 17 depicts the nucleic acid sequence of pM16-1.
The first base of this sequence is the first viral base. The
viral sequences are indicated by Us, i.e. as an RNA sequence,
and the plasmid sequences are indicated by Ts, i.e. as a DN~
sequence. pM16-1 is a DNA plasmid.
Figure 18 is a comparison of the sequence of pM16 and
pM16-1.
Figure 19 depicts the construction of pMLN450. The cDNA
sequence encoding amino acids 299 to 445 of HIV-IMN gpl20 was
inserted between amino acids 5 and 6 of the L polypeptide in
pM16 cDNA at the beginning of the viral polyprotein open
reading frame (A). The sequence of the resulting fusion
protein, ~gpl20-L is shown in (B). Leader amino acids are
represented in normal type and gpl20 amino acids in bold
characters. Additional residues encoded by the DNA linkers
are underlined.
Figure 20 depicts the plaque phenotype of vM16 (A) and
vMLN450 (B) viruses. Parental and recombinant viral plaques
formed on HeLa cell monolayers were stained after 72 h
incubation at 37C. Each well has a diameter of 3.5 cm.
Figure 21 depicts the expression of ~gpl20-L in vMLN450
infected cells. Mock (lanes A, B), vM16 (lanes C, D) and
vMLN450 (lanes E, F) infected HeLa cells were labelled with
35S-methionine. Cytoplasmic extracts were prepared at 7 h
postinfection and analyzed by 12% SDS-PAGE as described
previously (12). Some samples (lanes B, D, F) were
immunoprecipitated (13) with MAb 50.1 at 2~g/ml before
loading on the gel. The migration of Mengovirus marker
proteins is indicated.
Figure 22 depicts the Construction of pLCMG4. Figure
22a is a portion of the protein sequence and corresponding
DNA sequence or pMCS. Figure 22b is a portion of the protein
sequence and corresponding DNA sequence of pLCMG4. The
W094/29472 2 t 6 4 2 9 7 PCT~S94106177
g
sequence of the Leader peptide region at the beginning of the
Open Reading Frame is displayed. Restriction sites are
indicated. The cDNA sequence coding for the LCMN NP sequence
(boxed sequence) was inserted between the sites SnaBl and
Nhel of the plasmid pMCS. Underlined sequences result from
DNA linkers.
Figure 23 depicts the plaque phenotype of vMl6 and
vLCMG4 virus resulting from transfection of HeLa cells.
Cells were grown in 3.5cm wells and coloured after 48 hours.
Figure 24 depicts a double-stranded oligonucleotide
containing restriction sites XhoI, SnaBI, and NheI.
Figure 25 depicts the protein sequence and cDNA sequence
of the L-coding region of pMl6. The position of the XhoI
site is indicated.
Figure 26 depicts the L-coding region of PMCS. The new
restriction sites are indicated. Non-mengovirus amino acids
resulting from DNA linkers are boxed.
Figure 27 depicts cytoplasmic extracts and
radioimmunoprecipitations. Lane l is a
radioimmunoprecipitation of vMG-24 infected cytoplasmic
extracts with monoclonal antibody RV2-22C5. Lane 2 is a
cytoplasmic extract of vMG-5-24 infected cells. Lane 3 is a
radioimmunoprecipitation (mAb RV2-22C5) of vMl6 infected
cells. Lane 4 is a cytoplasmic extract of vMl6 infected
cells. Lane 5 is a radioimmunoprecipitation (mAb RV2-22C5)
of mock infected cells. Lane 6 is a cytoplasmic extract of
mock infected cells.
DETAILED DESCRIPTION OF THE INVENTION
In order that the invention described and claimed herein
may be more fully understood, the following detailed
description of embodiments of this invention is provided.
Within this description various terms of art are
employed. These terms are generally used in their ordinary
and well recognized sense. Various terms that are employed
throughout this description are defined infra.
As used herein, the term "recombinant virus" refers to a
genetically modified virus. A recombinant virus can comprise
WO 94n~72 ~ fS 2 1 6 42 9 7 PCT~S94/06177
-- 10 --
protein or nucleic acid from at least one other organism.
Thus, a recombinant virus can refer to a virus expressing a
non-structural heterologous polypeptide as well as viruses
comprising a heterologous polypeptide as a structural
element. Moreover, a recombinant virus can be a chimaeric
virus.
As used herein, the term "attenuated strain" refers to a
strain with reduced disease-producing ability and/or
pathogenicity.
As used herein, the term "genome" refers to the nucleic
acid comprising all the genes of a species. The nucleic acid
making up the genome may be RNA or DNA depending on the
nature of the species. For example, the genome of
picornaviruses or other RNA viruses is made up of RNA, while
the human genome is made up of DNA.
As used herein, the term "heterologous'~ refers to a
substance not naturally found in a given species. For
example, the term "heterologous amino acid sequence" when
used with reference to a specific virus refers to an amino
acid sequence not found in that virus, e.g., the proteins of
that virus.
As used herein, the term ~nucleotide or nucleic acid
sequence'~ refers to a linear series of nucleotides connected
by covalent bonds between the 3' and 5' carbons of adjacent
nucleotides. A nucleotide or nucleic acid sequence may be an
RNA sequence or a DNA sequence.
As used herein, the term '~amino acid sequence" refers to
a linear series of amino acids connected by covalent bonds.
As used herein, the term "fusion protein" refers to a
protein comprising at least two amino acid sequences, where
one of the amino acid sequences is not normally found
together in nature with the other amino acid sequence(s).
For example, a mengovirus fusion protein can comprise a
mengovirus amino acid sequence covalently linked to a
heterologous amino acid sequence.
As used herein, the term ~epitope~ refers to a
configuration of amino acids in a protein, where the
WO ~72 ~ 21~-42~ PCT~S94/06177
-- 11 --
configuration of amino acids is associated with an immune
response. For example, an epitope can be defined by an
antigenic motif that is recognized by an antibody and that
can induce an immune response. An epitope may be, but is not
limited to, a linear sequence of amino acids.
As used herein, the term "permissive cell~ refers to ~l
cell that can be productively infected with a virus. Thus, a
permissive cell to mengovirus, is a cell that can be infected
by mengovirus.
As used herein, the term "recombinant nucleic acid
molecule" refers to a hybrid nucleotide sequence (RNA or DNA)
comprising at least two nucleotide sequences placed together
by in vitro manipulation or a clone thereof.
As used herein, the term "cDNA~ refers to complementary
DNA. In the case of organisms whose genome is comprised of
DNA, the cDNA is complementary to mRNA or a fragment thereof.
In the case of organisms whose genome is comprised of ~NA,
the cDNA is complementary to the genome of the organism or a
fragment thereof.
As used herein, the term "polypeptide" refers to a
linear series of amino acids connected one to the other by
peptide bonds. The term "polypeptide~ includes but is not
limited to proteins.
As used herein, the term "expression'~ refers to the
process of producing a polypeptide from a structural gene.
As used herein, the term "polyprotein~ refers to a
covalently linked linear series of amino acids comprising
more than one protein. In some cases, proteins constituting
a polyprotein can be released by endoproteolytic cleavage by
a specific protease.
The genomic organization of mengovirus is shown in
Figure 1. This figure depicts mapping of the viral
polypeptides to the genome as well as various intermediates
in the processing of the polyprotein to mature components of
the virus.
The poly(C) region is also identified in Figure 1. As
described by Duke et al., supra, and Duke and Palmenberg,
2~ 64297
W094~72 PCT~S94/06177
- 12 -
suPra, deletions in this region are associated with an
attenuated phenotype. Consequently, plasmids containing cDNP
of the genome of mengovirus with mutations, e.g.,
substitutions and deletions, in the poly(C) region can be
used as the source of mengovirus DNA for the construction of
various embodiments of this invention relating to recombinant
mengoviruses exhibiting an attenuated phenotype.
In preferred embodiments of this invention, a suitable
source of mengovirus nucleic acid is plasmid pM16. pM16 has
been deposited at the Collection Nationale de Cultures de
Micro-organismes (C.N.C.M.) in Paris, France on June 2, 199~
under accession number I-1313. A partial plasmid map of pM1 t`
is shown in Figure 2 and the sequence of pM16 is shown in
Figure 16. This plasmid encodes a mutated poly(C) tract of
C13UC10, but otherwise comprises a DNA sequence corresponding
to the full-length genome of mengovirus inserted between the
EcoRI and BamHI restriction sites of the double-stranded
replicative form vector pBluescribe M13(+). Consequently,
this plasmid contains the mengovirus cDNA downstream from the
T7 promoter.
In other embodiments of this invention, a suitable
source of mengovirus nucleic acid is pM16-1. pM16-1 has also
been deposited at the C.N.C.M. on June 2, 1993 under
accession number I-1312. The sequence of pM16-1 is shown in
Figure 17.
In other embodiments of this invention other plasmids
may be used as a source of mengovirus nucleic acid. For
example, pM18, encoding a C8 poly(C) tract, or pM19, encoding
a C12 poly(C) tract or a plasmid containing a complete
deletion of the poly(C) tract can be used. If an attenuatec3
phenotype is not required pMWt, encoding the wild type
poly(C) tract C50UC10, can be used. As each of these
plasmids contains DNA complementary to the mengovirus geno~e
outside the poly(C) tract, one plasmid can be constructed
from another mengovirus plasmid (or wild type mengovirus DNA)
by various in vitro manipulations. One possibility is the
replacement of the EcoRV - AvrI I restriction fragment
wo ~n~ ~ 21 6 4~7 PCT~S94/06177
- 13 -
containing the poly(C) tract from one plasmid with the ap-
propriate ~coRV - AvrI~ fragment of the plasmid to be
constructed.
Once a vector encoding an attenuated mengovirus genome
in DNA form has been obtained, a heterologous nucleotide
sequence encoding an amino acid sequence to be expressed by
the recombinant mengovirus can be inserted within the coding
region of the mengovirus genome. In specific embodiments of
this invention the nucleic acid sequence codes for a
heterologous antigen or epitope.
The site at which the heterologous nucleotide sequence
is inserted can be at a restriction site. In specific
embodiments of this invention, the site is at the NcoI
restriction site encompassing nucleotide 729 of the
mengovirus genome.
When the heterologous nucleotide sequence is inserted at
a restriction site, the mengovirus DNA vector is restricted
with the appropriate enzyme to cleave the DNA vector. The
heterologous DNA sequence is then ligated to the restricted
mengovirus vector to produce a recombinant DNA molecule
comprising the mengovirus genome -- now including the
heterologous nucleotide sequence.
When the heterologous nucleotide sequence is not
inserted at a restriction site, one of ordinary skill in the
art can select a restriction fragment of the DNA vector
comprising the insertion site. A synthetic DNA fragment can
then be synthesized that corresponds to the selected
restriction fragment but additionally includes the
heterologous nucleotide sequence inserted at the desired
site. The synthetic DNA fragment can then be inserted in
place of the selected restriction fragment in the DNA vector
to generate a recombinant DNA molecule comprising a
recombinant mengovirus genome cDNA.
The heterologous nucleotide sequence can be prepared in
a variety of ways. For example, the sequence may be obtained
by specifically cleaving cDNA encoding the heterologous
polypeptide to be expressed by the recombinant mengovirus.
wo ~n~n ~ ~. X~ .S ~ ~ 1 6 4 2 9 7 PCT~Sg4/06177
- 14 _
For example, this may be accomplished using appropriate
restriction enzymes. Alternatively, the heterologous
nucleotide sequence can be chemically synthesized using
methods well known in the art.
Recombinant mengoviruses and proteins or expression
products thereof that comprise a desired heterologous
polypeptide, e.g., an antigen or epitope, can be obtained by
generating an RNA transcript from the recombinant DNA
molecule comprising a heterologous nucleotide sequence
inserted into the recombinant mengovirus genome. For
example, in the case of pM16 and pM16-l an RNA transcript can
be produced in vitro using T7 RNA polymerase. Alternative
promoters and corresponding polymerases can be substituted.
Aliquots of the transcription mixture can be used to
transfect permissive cells. For example, the DEAE Dextran,
calcium phosphate, poly-ornithin, electroporation, and
synthetic transfection agents can be used to transfect
mammalian cells such as HeLa, VERO, BHK21, and P815. The
production of progeny viruses can be monitored by microscopy,
and the viruses can be released by well known methods of
cellular disruption, for example, freezing and thawing.
In specific embodiments of this invention, the
heterologous polypeptide is inserted within the leader
polypeptide (L). It was determined that insertion of the
foreign epitope at 6 amino acids from the N terminus of the
mengovirus polyprotein does not render L non-functional and
thus does not interfere with the multiplication of the virus
either in vitro or in vivo.
Other insertion sites may be chosen within the viral
genome for insertion at positions where the insert does not
interfere with functions that are important for the viral
life cycle. If there are no restriction sites at a suitable
insertion site they can be introduced, e.g. by site directed
mutagenesis. Thus in principle, all restriction sites and
other locations within the genome can be envisaged for
insertion with the exception of well defined functional
areas, e.g. the catalytic triad of 3C. Preferred sites
wo 94ng472 - 2 1 6 4 2 9 7 PCT~S94/06177
- 15 -
include non-structural regions of the genome, e.g., P2, P3
and/or regions corresponding to the N- or the C- terminus of
viral proteins.
In order to produce a fusion protein comprising L and a
foreign polypeptide, such as an antigen or epitope, the
foreign nucleotide sequence is inserted into the mengoviru.~
cDNA within the L polypeptide coding sequence in such a way
as to conserve reading frame. The recombinant virus can then
express the foreign sequences as part of the viral
polyprotein. The polyprotein is processed, inter alia, to
the form of a fusion protein comprising the L polypeptide
with the heterologous polypeptide inserted therein. The
fusion protein can then be obtained from the cytoplasm of
infected cells.-
In terms of this invention the heterologous DNA sequenceinserted into a mengovirus vector can encode any amino acid
sequence. In certain embodiments of this invention the amino
acid sequence comprises a heterologous epitope. In these
embodiments, the heterologous amino acid sequence can
comprise several foreign epitopes or a single foreign
epitope, or it can define an epitope together with other
amino acids, e.g. mengovirus amino acids. In other embodi-
ments, the amino acid sequence can consist essentially of a
heterologous epitope. By way of example, amino acid se-
quences of various embodiments of this invention are listed
in Table I.
W O 94~9472 _ , 2 1 6 42 9 7 PCT~US94/06177
- 16 -
Table I
PAT~OGEN PROTEIN SUBDOMAIN AMINO ACIDS
l/Hepatitis B Virus Sl 90-110
2/ Streptococcus type 24 M 12 N terminal
spec. type 5 M aa
type 6 M
type 19 M
3/ Influenza virus NSl 1-81
HA2 65-222
4/ Plasmodium 93kd blood
falciparium sta~e protein
5/ Schistosoma Immunodominant
mansoni Calcium binding
Proteins (CaBP's)
6/ Hepatitis C C 1-22, 51-70
Virus El 248-268,
297-315
7/ Borrelia OSP A
bur~doferi
8/ HTLV-l Env 190-199
9/ Chlamydia spec. MOMP variable domain
(Outer membrane IV
protein)
10/ HIV-I, HIV-2, glycoprotein, e.g. V3 loop 299-446
SIV ~P120 tPND)
ll/TGEV S Sl
In embodiments of this invention the heterologous DNA
sequence to be inserted is generally in the range of about
700-1,100 bases. Sequences given in Table I are examples of
heterologous sequences for the construction of recombinant
mengovirus of the invention. Recombinant mengoviruses
containing heterologous sequences of species not given in the
Table can be constructed as indicated herein. In cases where
the heterologous sequence is too large to be expressed in
mengovirus a set of recombinant mengoviruses each expressing
a part of the given protein can be constructed.
The heterologous DNA sequence of this invention can
encode more than one polypeptide. The DNA sequences encoding
the polypeptides can be directly linked to each other or they
can be separated by a joining sequence. In specific
21~64297
W094~9472 ~ ~ PCT~S94/06177
- 17 -
embodiments, these joining sequences can encode a cleavage
site.
- In embodiments of this invention the L polypeptide of
the recombinant virus comprises a segment of gpl20 of HIV-I.
In specific embodiments, the L polypeptide comprises amino
acids 299-446 of gpl20 of the MN strain of HIV-I. In more
specific embodiments, amino acids 299-446 of gpl20 of the MN
strain of HIV-I are inserted after amino acid 6 of the L
polypeptide. This HIV sequence comprises sequences coding
for the V3 loop, which constitutes the principal neutral-
ization determ;n~nt (PND) and sequences downstream involved
in binding of the gpl20 molecule to the CD4 receptor. The
resulting recombinant mengovirus expresses an HIV-I gpl20 -
mengovirus L fusion protein that was recognized by HIV-I
specific antibodies and induced anti HIV-I antibodies in
animals.
The HIV-I gpl20 - mengovirus L fusion protein also
induced a gpl20 - specific cytotoxic immune response in
animals.
In terms of antigenicity, an L fusion protein comprising
a foreign epitope can retain the ability to induce and bind
antibodies directed to the native protein sequence. Hence,
the strategy could be applied to any foreign protein that
exhibits antigenic properties of interest. Consequently, in
cases of single well-defined and short epitopes, the
construction of recombinant mengoviruses, containing these
epitopes in a larger protein, is the strategy of choice.
Recombinant viruses of this invention have been sho~l to
induce antibodies in mice and cynomolgus monkeys that bind to
the protein and/or neutralize the pathogen from which the
foreign sequences are derived. Therefore, the induction of
an immune response in other animal species susceptible to
mengovirus, such as humans, is predicted based on the ln
vitro and in vivo results obtained. Thus, a protective
immune response may be elicited by recombinant viruses of
this invention. For example, a recombinant virus expressing
sequences of the G protein of rabies can be engineered in
r~
wos4n~n ~ ~ 2 1 64297 PCT~S94/061~
accordance with this invention for use as a vaccine in
animals, including mice. Similarly, a recombinant virus ex-
pressing sequences from the glycoprotein of HTLV-l could b~ -
obtained for use in macaques, other primates, or humans.
The antigenicity and immunogenicity of proteins
comprising foreign epitopes expressed by the recombinant
mengoviruses can be improved in various ways: the size of
the heterologous nucleotide sequence encoding the foreign
epitope can be increased to express larger segments of the
foreign antigen (or the whole antigen) up to a m~X; ~um size
of about 350 amino acids, the foreign antigen can be
expressed in native form rather than as a fusion protein, and
selective targeting of the foreign antigen to appropriate
cell compartments can be achieved to allow post-translational
modifications, such as glycosylation, that can be important
for the antigenicity and/or immunogenicity of the fusion
protein.
In embodiments of this invention, the recombinant
mengovirus can express multiple sequences of one protein. In
addition, the recombinant mengovirus can comprise multiple
sequences from different proteins. Thus, this invention
makes it possible to immunize or induce an immune response
against multiple pathogens at the same time.
In certain embodiments of this invention a heterologous
polypeptide can be expressed in native form by including
protease cleavage sites between the amino acid sequence of
the heterologous polypeptide and the mengovirus sequences.
In preferred embodiments of this invention mengovirus
protease 3C cleavage site is used. The endogenous mengovirus
protease 3C is responsible for most cleavages of the
mengovirus polyprotein. For example protease 3C mediates th~
cleavage between the L-peptide and VP4(lA) by specifically
cleaving precursor protein L-Pl-2A at a Q-G amino acid
linkage yielding free L-peptide and Pl-2A.
Figure l3 is a depiction of the mengovirus genome with
this protease 3C cleavage site indicated. The amino acid
sequence in Figure 13 is a sufficient substrate for cleavage
wog4n~72 ` /` 2 1 6 4 2 9 7 PCT~Sg4/06l77
._ -- 19 --
by protease 3C. See Parks et al., J. Virol. 63: 1054 (198Y)
the entire disclosure of which is incorporated herein by
reference. In embodiments of this invention, a DNA sequence
coding for the protease 3C cleavage site can be included at
each end of the heterologous DNA sequence to be inserted. In
addition, the sequence Asn-Pro-Gly-Pro, which is the cleavage
site between viral protein 2A and 2B can be used. There is
evidence that the cleavage between 2A and 2B occurs by
scission of the glycine proline bond through an autocatalytic
mechanism. When such a heterologous DNA sequence is used t~
construct a recombinant mengovirus, the resulting
heterologous polypeptide can be released from the mengovirus
polypeptides by autocatalytic cleavage during infection.
The heterologous polypeptide can be targeted to specific
cell compartments. For example, the incorporation of a
nuclear localization sequence, such as that of the SV40 T
antigen, should target the protein to the nucleus. By
contrast, a signal sequence, such as that of
~-2-microglobulin should target the polypeptide to the
endoplasmic reticulum to permit post-translational modifica-
tions, e.g. glycosylation, and secretion into the medium.
Moreover, a sequence such as the transmembrane sequence of
gp41 of HIV-I can be used as an anchoring sequence to all~w
the polypeptide to be inserted into the cell membrane.
In further embodiments two or more different proteins
may be coexpressed in the same cell by coinfecting the target
cell with two or more recombinant viruses. This can permit
various intermolecular interactions in the coinfected target
cell.
The recombinant mengovirus of the invention can be used
as a vaccine or as part of an immunogenic composition. The
subjects to be vaccinated include man, primates, non-human
primates, mammals, mice, or any other animal that can be
infected by mengovirus. In embodiments of this invention the
recombinant mengovirus is present in the vaccine or
immunogenic composition in admixture with a pharmaceutically
acceptable carrier. Examples of suitable carriers include
wo 94n~72 2 1 6 4 2 9 7 PCT~S94/06177
- 20 -
any buffer that supports virus stability and is accepta~le
for use in animals or humans. For a live vaccine an adjuvan~
is not necessary. In other embodiments of this invention a
vaccine or immunogenic composition comprises a mengovirus
fusion protein of this invention in admixture with a pharma-
ceutically acceptable carrier, wherein the fusion protein
comprises a heterologous amino acid sequence comprising an
antigen.
The following properties of mengovirus make it
particularly attractive as a live vaccine or an immunogen
with wide potential.
1. The vM16 strain and other attenuated strains
described herein are not likely to easily revert to virulence
as their attenuation results from a deletion. It may be
possible to use a genetically engineered mengovirus strain
with the entire poly(C) tract deleted in the context of this
invention.
2. The wide host range of mengovirus permits its use as
a vaccine or immunogen in many different animal species for a
wide variety of pathogens of medical or veterinary
importance, e.g. HAV, HIV, HTLV, Rabies, FMDV, coronaviruses
such as bovine, herpes virus, measles, mumps, and Respiratory
Syncitial Virus (RSV).
3. The use of mengovirus in a vaccine in the form of a
live virus able to replicate in an organism after either
parenteral or oral administration should permit the induction
of both a humoral immune response and a cellular immune
response, in particular a cytotoxic T-cell response.
4. The ability of mengovirus to multiply in the
intestine after oral immunization should permit the inducti~n
of both a systemic general immune response and a local
mucosal response. This is particularly relevant in the case
of pathogens such as HIV, HPV HTLV, TGEV or rotaviruses.
The recombinant viruses of this invention can be used in
a variety of non-immunological ways. For example, the
recombinant virus can be used as a cloning or expression
vector in order to produce large amounts of a desired nucleic
2 1 64297 `
wo s4ns472 - ~ . PCT/US94/06177
- 21 -
acid or protein, e.g. in tissue culture. A heterologous
protein expressed in cells infected with a recombinant
- mengovirus can be purified in large quantity from the
infected cells.
In addition, the recombinant viruses of the invention
could be used to deliver specific inhibitors of various
pathogens or of cellular functions responsible for disease to
various cellular or subcellular locations.
The following examples are given by way of illustra~ion
to facilitate a better understanding of the invention and are
not intended to limit the invention. It should be further
understood that the detailed description while indicating
preferred embodiments of the invention, is given by way of
illustration only, since various changes and modifications
within the spirit and scope of the invention will become
apparent to those skilled in the art from the detailed
description.
Examples
MATERIALS AND METHODS
Construction of vMLN450.
All DNA manipulations were performed according to
standard procedures (7). Subclone pMRAl was generated by
deletion of the 5.8kb Sph I - Sph I fragment (plasmid base
1928-7775) from plasmid pM16, which contains the vM16
Mengovirus cDNA downstream of the T7 promoter (5). HIV-IMN
gpl20 specific DNA was amplified by PCR from plasmid pTG5156
(Transgene SA, Strasbourg), kindly provided by M. P. Kieny,
using oligonucleotides 5' VCN
(ATATGTTGACCATGGAACAAATTAATTGTACAAGACCC) and 3'VCN
(TAATCCATGGCGGTCAACGTGGGTGCTACTCCTAATGG). The PCR fragment
was first cloned into pMRA1 at the Nco I site (viral base
729) resulting in plasmid pMRA2. Full-length cDNA was
re-established by transfer of the 5.8kb fragment of pM16 ir.to
the SpA I site of pMRA2, resulting in plasmid pMRA3. Correct
~s ~ ` 2 1 64297
wog4n~72 ~; ' PCT~S94/06177
- 22 -
orientation of cloned sequences was determined by PCR and
plasmids were amplified in E. coli DH5~ (Promega).
Infectious RNA transcripts derived from pMRA3 were
prepared using T7 RNA polymerase and transfected into HeL~
cells as described (5), resulting in recombinant Mengovirus
vMLN450. Stocks of vM16 and vMLN450 were produced by passage
on HeLa cells, titrated as described (8), and analyzed by
RT-PCR for the presence of the inserted HIV-I sequence using
Mengovirus-specific oligonucleotides, 5'194-
(TAGGCCGCGGAATAAGGCCGGTGTGC) and 3'1094-
(GGAGCATGTTCGAGAAAGCATTGAC).
Immunizations and ELISA tests.
Ten week old BALB/c mice were immunized twice
intraperitoneally with 106pfu (plaque forming units) of
vMLN450 or 106pfu of vM16 in PBS on days 0 and 56. Control
animals received PBS alone. Adult cynomolgus monkeys were
immunized intramuscularly with 106pfu of vMLN450 or vM16 in
PBS. ELISA plates (Nunc Maxisorb) were coated with 50ng per
well of purified recombinant gpl60LAI or gpl60MN-LAI
(Transgene), incubated with serial dilutions of sera,
followed by horseradish peroxidase conjugated sheep anti
mouse-IgG (H+L) antibody (Diagnostics Pasteur) or rabbit anti
monkey-IgG (H+L) antibody (Nordic). ELAVIA tests (Diagnostics
Pasteur) were carried out following the manufacturer's
protocol. HIV-IMN neutralization assays were performed as
described (9) using 3.5x105 MT4 cells. Syncytia formation
was monitored between days 6 and 10.
ExamPle 1
Construction of PMRA-3
In order to facilitate cloning in the NcoI site 729 of
the Mengovirus cDNA, a deletion clone of pM16 was constructed
by elimination of the 5.8 kb SphI ( 1928) - SphI ( 7775)
fragment, which contains two NcoI sites. The resulting
clone, designated pMRA-1 (Figure 4), contains a ùnique NcoI
site at position 729.
W094~72 ~ ` ~ 2 1 ~4 2 9 7 PCT~S94106177
- 23 -
A 478 bp HIV-I-MN speci,ic DNA fragment was generated
using Polymerase Chain Reaction (PCR) from plasmid p05156S
with the following oligonucleotides:
5~VCN: ATATGTTGACCATGGAACAAATTAATTGTACAAGACCC
3~VCN: TAATCCATGGCGGTCAACGTGGGTGCTACTCCTAATGG.
Plasmid pO5156S is depicted in Figure 3 and was obtained from
Transgene S.A., Strasbourg, France. pO5156S is described in
patent application WO92/19742. The MN sequence of the genome
has been published by Gurgo et al., 1988. Virology 164: 531-
536 (1988), which is incorporated herein by reference.
The amplified sequence, ~gpl20-VCN, corresponds to
amino acids 299 to 446 of the glycoprotein 120 of HIV-I-MN.
~gpl20-VCN was generated with oligonucleotides 5'VCN and
3'VCN at a concentration of about 100 mM on 5 ng of template,
pO5156S with the PFU Polymerase obtained from Stratagene
using a PFU amplification buffer also obtained from
Stratagene and standard thermocycling conditions.
The ~gpl20-VCN fragment was then cloned into NcoI site
729 of pMRA-l to yield pMRA-2. pMRA-2 is depicted in Figure
5. The correct orientation and length of the ~gpl20-VCN
insert in pMRA-2 was confirmed by PCR, using the
oligonucleotides M-1094, S'VCN and 3'VCN. The
oligonucleotide sequence of M-1094 is:
M-1094: GGAGGCATGTTCGAGAAAGCATTGAC.
Correct clones gave an 800 bp PCR fragment with M-1094 and
5'VCN and no amplified DNA with M-1094 and 3'VCN, whereas
clones containing ~gpl20-VCN in the incorrect orientation
gave the opposite results.
The full-length cDNA was reconstituted by cloning the
5 . 8 kb SphI ( 1928) - SphI ( 7775 ) fragment from pM16 back into
pMRA-2, which resulted in the plasmid pMRA-3. pMRA-3 is
depicted in Figure 6. This plasmid contains 459 additional
bp inserted in frame in the L-peptide coding region of the
mengovirus cDNA, and codes for the 25.8 kD fusion protein
LN450 (Figure 7 ) .
The correct orientation of the 5.8 kb SphI ( 1928) -
SphI (7775) fragment of pM16 in pMRA-3 was confirmed by a
wog4n~72 ~ t`t;; 2 1 6 4 2 9 7 PCT~S94/06177
- 24 -
double restriction digest with BamHI tBoehringer Mannheim)
and HindIII (Boehringer Mannheim). This double restriction
digest of a plasmid in the correct orientation results in two
DNA fragments of 30 and 11356 bases. Whereas, the incorrect
clones exhibit two DNA fragments of 5821 and 5565 bases in
length.
Example 2
Growth characteristics of vMLN450
Infectious RNA transcripts of vMLN450 and vM16 cDNA were
produced in vitro by incubating T7 RNA Polymerase (Pharmacia)
with Ba~II digested plasmids pM16 and pMRA-3 in an
appropriate buffer. Aliquots of this transcription mixture
were adjusted to 1 mg/ml DEAE Dextran and subsequently
transfected into HeLa cells by incubating the solution on
monolayer cells for 30 minutes, as described by Sylvie van
der Werf et al., Synthesis of Infectious Poliovirus RNA by
Purified T7 RNA Polymerase, Proc. Natl. Acad. Sci. (USA)
83:2330 (1986), the entire disclosure of which is incorpo-
rated herein by reference.
Transfection of RNA derived from plasmid pMRA-3 into
HeLa cells resulted in production of the virus vMLN450. The
production of progeny virus was monitored by microscopy.
Stock virus was grown by infection of a confluent monolayer
of HeLa cells at a multiplicity of infection (MOI) of 1.
Virus was harvested after complete cpe (cytopathic effect).
Intracellular virus was released by freezing and thawing
cells three times and pelleting cellular debris and nuclei b~
centrifugation. Complete cpe was observed after 72 hours,
compared to 48 hours when cells were transfected with pM16
RNA. vMLN450 grows to high titers, albeit approximately 3 to
4 times lower than vM16.
The plaque phenotype of the recombinant viruses was
tested. Virus stock solutions were diluted in Dulbecco's
Modified Eagle Medium (DMEM) without Fetal Calf Serum (FCS)
and used to infect a confluent monolayer of HeLa cells.
After 30 minutes incubation, cells were covered with DMEM
W0 ~n~472 Zl 642 9 7 PCT~Sg4/06l77
_ 25 -
containing 0.9% soft agar. The cells were then incubated for
72 hours at 37C and intact cells were stained with 0.2%
crystal violet solution.
The plaque phenotype of the recombinant viruses
harvested from culture supernatant gives medium-size plaques
with an average diameter of approximately 65% that of wil~-
type-virus plaques (Figure 8).
Example 3
Genetic stabilitY of vMLN450
The transfection supernatant containing vMLN450 was
passaged three times on HeLa cells, and the viral RNA was
extracted. Viral RNA from passage 3 of the recombinant virus
vMLN450 was analyzed by RT-PCR (Reverse Transcription PCR),
using the oligonucleotides 5'VCN, 3'VCN, M-1094 and M-VDW-1.
The sequence of oligonucleotide M-VDW-l is:
TAGGCCGCGGAATAAGGCCGGTGTGC.
Sequence analysis was performed on RT-PCR products by a
PCR sequencing method derived from the Sanger dideoxy
sequencing method described by Adams and Blakesley, Focus
13:56-57 (1991) and Adams and Blakesley, Focus 14:31-33
(1992). PCR fragments were extracted from low-melting point
agarose gels and approximately 200 ng of DNA was added to
each of four reaction mixtures, each containing different
concentrations of dNTP's and ddNTP's and 4 pmol of 32P-end
labelled primer. The reaction was started by adding TAQ
Polymerase (Amersham) and incubating for 20 rounds of am-
plification at standard thermocycling conditions. The
sequencing reaction was analyzed by polyacrylamide gel
electrophoresis (PAGE) under standard conditions.
Analyses with oligonucleotide pairs M-VDW-l / M-1094 and
5'VCN / M-1094 demonstrated that specific DNA fragments, 138
bp and 932 bp respectively, could be amplified from vMLN450
RNA. There was no apparent difference in size between these
DNA fragments and DNA fragments generated from plasmid pMRA-
WO ~n~472 -~y ~ .~t~ 2 1 6 4 2 9 7 PCT~S94/06177
- 26 -
3. The results of these experiments are shown in Figure 9.
No wild-type-size fragments, indicating a reversion to
vM16 like viruses, could be detected. The 1382 bp fragment
was partially sequenced to further exclude non-specificity.
A partial sequence obtained for vMLN450 is depicted as an
underlined sequence in Figure 10 and shows no difference from
that of the original insert.
Example 4
Expression of LN450 in HeLa cells
In order to analyze expression of the fusion protein
LN450, HeLa cells in monolayer were infected with vMLN450 at
a MOI of 10 and labelled with 35S methionine from 5 1/2 to 7
1/2 hours post infection, essentially as described by Lee and
Wimmer, Virology 166: 405 (1988) which is incorporated herein
by reference. At 7 hours post infection, cells were lysed
with NP40 and cytoplasmic extracts were prepared as described
by Harber et al., Journal of Virology 65: 326 (-l991) which is
incorporated herein by reference. The 35S methionine
labelled proteins were then analyzed by SDS polyacrylamide
gel electrophoresis (SDS-PAGE). Gel electrophoresis and
autoradiography were carried out according to standard
conditions.
HeLa cells were infected with vMLN450 and vMl6
respectively and viral proteins were labelled with 35S-
methionine. Cytoplasmic extracts were prepared at 7 1/2
hours post infection and aliquots analyzed subsequently by
SDS-PAGE. vMLN450 infected cells show the presence of a
single additional protein with an apparent molecular weight
of 26 kDa (Figure ll, e), which is absent in vM16 or mock
infected cells (Figure 11, a, c). The molecular weight of
this protein corresponds to the expected size for LN450.
Example 5
Antiqenicity
Antigenic properties of LN450 were assayed by im-
munoprecipitation using monoclonal antibody 50.1 (obtained
from Repligen). Aliquots of S methionine labelled vMLN450
infected cell lysate were incubated with l~g of MAb 50.1 f~r
W094~72 -- 2 ! 6.4 2 9 7 PCT~S94/06177
- 27 -
1 hour at 4C, then an equal volume of a protein A-Sepharose
suspension was added and the mixture was incubated for l
hour. The protein A-sepharose complexes were pelleted,
washed three times and analyzed by SDS-PAGE followed by
autoradiography.
Cellular extracts of vMLN450, vM16 and mock infected
HeLa cells were immunoprecipitated with the monoclonal
antibody 50.1 (MAb 50.1). This antibody recognizes the V3
loop of ihe MN strain of HIV-I, the principal neutraliæillq
determinant of HIV-I-MN. The data shown in Figure 11, b), d)
and f) demonstrate that only the 26 kDa protein that is
produced in vMLN450 infected cells, can be immunoprecipitated
with MAb 50.1, confirming the identity of the 26 kd protein
as LN450.
ExamPle 6
ImmunoqenicitY
In one experiment, ten week old Balb/c or CBA mice wer~
immunized intraperitoneally with lO pfu of vMLN450 (4
animals for Balb/c and 5 animals for CBA) or 106 pfu of M16
(4 animals for Balb/c and 2 animals for CBA) in PBS. Three
animals (Balb/c) or 2 animals (CBA) received PBS as a virus
free control. Animals were boosted 8 weeks after the initial
immunization with an equal dose of virus. Blood samples were
taken 14 days after ~ nization and sera were prepared.
Cynomolgus monkeys (Macaca fascicularis) were immunized
intramuscularly with approximately 4 x 10 pfu of vMLN450 (3
animals) or vM16 (1 animal) in PBS. Blood samples were taken
28 days after immunization and sera were prepared.
ELISA plates (Nunc Maxisorb) were coated with 100 ~1
per well of recombinant gpl60 MN-LAI or gpl60 LAI (500 ng/ml
in PBS). gpl60 MN-LAI is a fusion protein containing the
gpl20 moiety from the MN viral strain, and gp41 from the IIIB
(LAI) strain. The plates were washed, and incubated with
serial dilutions of mouse or monkey sera. After incubation
for 2 hours at 37C, plates were washed and a monoclonal
antibody (antimouse IgG (H+L) (Diagnostics Pasteur) or
antimonkey IgG (H+L) (Nordic Immunology)) conjugated to
wo ~o 14~ ` ~ ` ; ` ' ~ 2 ~ 6 4 2 9 7 ~CT~S94/~177
horseradish peroxidase was added and incubated for 1 hour at
37C. After a final wash the test was developed by addin~ an
OPD (670 ~g/ml), H2O2 (0.042%) solution. The reaction was
stopped by addition of 4N H2SO4 and the O.D. was read at 490
nm in a Dynatech ELISA plate reader.
Serial 1 in 2 dilutions starting from a 1/100 dilution
of mouse sera were tested in a syncitia inhibition assay.
The diluted sera were added to a virus solution, containing
HIV-I-MN at the minimal concentration inducing syncitia
formation. The mixture was incubated for one hour and a
suspension of 3.5x105 MT4 cells were added. Cells were grown
in 48 well plates, diluted 1 in 4 at day 3, and syncitia
formation was monitored between day 6 and 10.
Balb/c mice, CBA mice, or cynomolgus monkeys were
immunized with either 106 pfu of vMLN450 in the case of mice
or 2 x 10 pfu of vMLN450 in the case of monkeys, 106pfu vM16
or a virus free control. The mice were bled two weeks after
immunization and 10 weeks after immunization (2 weeks after
boost). Sera were analyzed by ELISA, using recombinant gpl60
MN-LAI or gpl60 LAI as antigen. The monkeys were bled 4
weeks after immunization and were analyzed similarly. The
data shown in Figure 12 and Table 3 demonstrate that specific
anti HIV antibodies were only detected in sera from mice
infected with vMLN450.
Anti-HIV-I titers raised approximately 35 fold after the
animals were boosted with vMLN450 and remained at a high
level for at least 10 weeks after the second immunization.
Similar results were obtained using CBA mice.
When analyzed in a neutralization assay using MT4 cells
and HIV-I-MN (Table 2), two out of four Balb/c sera obtained
2 weeks after immunization inhibited virus induced syncitia
formation completely at dilutions of 1 in 100.
i_ ~
wo 94ng472 2 1 6 4 2 9i 7 PCT~S94/06177
`~ - 29 -
Table 2
- Neutralization Assay (Inhibition of synci.tia formation)
Animal # Immunizing Pre-immune Immune serum
(Balb/c mice) agent serum (2 wk)
Dilution Dilution
1 PBS <1/100 <1/100
6 vM16 <1/100 <1/100
8 vMLN450 <1/100 <1/100
9 vMLN450 <1/100 1/100
vMLN450 <1/100 <1/100
11 vMLN450 <1/100 1/100
HIV-I-specific antibody response in mice and monkeys.
wog4ng472 ~ PCT~S94/06177
Table 3
ELISA reactivity of mouse sera with HIV-I gpl60LAl
Da~s after immunization
Immunization 0 14 70 112
PBS(3)* <100 <100 <100 <100
vM16(4) <100 <100 <100 <100
vMLN450(4) <100 4677 169824 95499
Sera of Balb/c mice were prepared at the indicated time
point, pooled and tested as described in Materials and
Methods. Titers are given as reciprocal values of the
dilution giving an OD490nm of 1.
* Number of animals in the lot.
W09~2~72 ~ ~ 2 ~ 4 PCT~S94/06177
HIV-I neutralizing antibody titers were determined in a
syncytia formation inhibition assay using HIV-IMN (9).
- Neutralization titers ranged from 1:100 to 1:400 in the day
70 sera from vMLN450 immunized BALB/c mice, whereas values
for control sera were below 1:100. The V3 specific response
in the animals is currently being determined.
Comparable experiments were conducted using cynomolgus
monkeys. Animals were immunized with a single intramuscular
injection of 10 pfu of live vM16 or vMLN450. HIV-I-specific
antibodies were measured one month later by ELISA, using
either purified recombinant gpl60MN-LAI (Table 4) or a
commercial ELISA kit (ELAVIA) (data not shown). Both tests
demonstrated the presence of elevated gpl60 specific
antibodies in the vMLN450 immunized monkeys, whereas the vM16
immunized animal showed no reactivity.
Table 4
ELISA reactivity of monkey sera with HIV-I gpl60MN-LAl
MonkeY (Immunization)
Days 339B 46698 320A 5343A
after
immunization(vM16) (vMLN450) (vMLN450) (vMLN450)
0 <20 43 <20 45
28 23 933 141 2089
Titers are given as reciprocal values of the dilution giving
an OD49Onm of 1.
Example 7
Gpl20-specific cytotoxic immune respon~e.
In addition to B-cell and T-helper cell epitopes, the
V3-loop sequence of gpl20 of HIV-IMN has been shown to
wog4n~72 ; ~; ~ t ~'- 2 1 6 42 9 7 PCT~S94106177
~ 32 -
contain a MHC class I-restricted cytotoxic T-lymphocyte (CTL)
epitope that is recognized in mice in the context of the H-2d
haplotype (lO). We therefore searched for the presence of a
cytotoxic cellular immune response towards this epitope in
BALB/c mice immunized with vMLN450. Spleen cells from
immunized mice were stimulated in vitro with Pl8-MN peptide
and assayed for cytotoxic activity towards syngeneic target
cells (P815) that had been pulsed with peptide PI 8-MN,
comprising the V3 CTL-epitope sequence (lO). As shown in
Table 5, a clear HIV-IMN-specific cytotoxic activity could be
demonstrated at an effector to target ratio of 25:l in the
animals immunized with vMLN450 but not in those immunized
with the parental vMl6. This activity was MHC class
I-restricted. See Ref. ll.
W094/2~72~ ; 2 ;1` 6 4 2 9 7 PCT~S94/06177
- 33 -
Table 5
HIV-IMN V3 specific cytolysis
- Percent specific lysis
Immunization Control P18-MN pulsed
P815 cells P815 cells
vMl6 1 4
vMLN450 3 36
Spleen cells from vM16 or vMLN450 immunized BALB/c mice were
pooled and subsequently restimulated in vi tro as described in
Materials and Methods. Cytolytic activity was measured
against P815 cells pulsed or not with P18-MN peptide at an
effector:target ratio of 25:1.
The cytotoxicity assay was performed as follows: BALB/c
mice were immunized intraperitoneally on days 0 and 21 with
106 pfu of vM16 or vMLN450. Spleen cells from three mice per
lot were recovered 10 days later, pooled and restimulated in
vitro for 7 days with P18-MN peptide (10), then for 5 days
with P18-MN peptide in the presence of 5~ concanavalin A
supernatant-containing medium as a source of growth factor,
Cytolytic activity of stimulated splenocytes was determined
by a 5h5lCr-release assay. Target cells were peptide-pulsed
51Cr-labelled P815 tumor cells. Percentage of specific 51Cr
release was calculated as: [(experimental release -
spontaneous release)/(mAx;m~l release - spontaneous release)]
x 100. Spontaneous release was less than 20% of maximal
release obtained by incubation with 1% triton X-100.
ExamPle 8
Construction of vMOG-l
The HIV-I-MN gpl20 sequences used in this construction
were generated as described supra in the description of the
vMLN450 construction. However, the amino acid sequence was
wog4~n ~ fi~ ;; 2 1 6 4 2 9 7 PCT~S94/06177
- 34 _
altered as indicated in Figure 14 at the C-terminal end of
the HIV insert and the N-terminal end of the L-peptide.
The generation of recombinant mengovirus vMQG-l,
containing a heterologous truncated gpl20, or fragments
thereof, at the N-terminus of the L-peptide, and separated
from the latter by protease cleavage site(s) e.g., 3C, bears
the potential to augment expression and immunogenicity of the
gpl20 sequences, as compared to vMLN450. The fragments of
gpl20 are chosen to elicit an immune response in an animal.
In specific embodiments these fragments are composed of
peptides between 20 and 100 amino acids.
A flow diagram of the construction of pMRA-5, the cDNA
of vMQG-l, is depicted in Figure 15. The sequence of the
synthetic double-stranded oligonucleotide labelled LQGd/s in
Figure 15 is:
TGA AAC TCA GGG TAA CTC TAC TAC
ACT TTG AGT CCC ATT GAG ATG ATG GTA C
Briefly, the PCR amplified sequence ~gpl20-VCN was re-
stricted with HincII and NcoI and a 451 bp fragment was
isolated. This fragment was ligated to a synthetic double-
stranded oligonucleotide LQGd/s coding for the 3C cleavage
site. The resulting ligated fragment was restricted with
NcoI and inserted at the NcoI restriction site of pMRA-l.
The resulting plasmid was named pMRA-4. The 5.8 kb SphI
fragment of pM16 described supra is inserted in pMRA-4 at
SphI ( 1926) to restore the full-length mengovirus sequence,
and produce pMRA-5. pMRA-5 is transcribed in vitro and the
resulting RNA is used to infect HeLa cells to generate virus.
The insertion of 486 additional bases into the
mengovirus genome, in the case of vMQG-l, is unlikely to
interfere with the viability of the virus since the insertion
of 459 bases yielded a perfectly viable recombinant
mengovirus in the case of vMLN450. Along with the
introduction of the 3C cleavage site between the heterologous
amino acid sequence and the L-peptide a myristylation signal
has been retained at the N-terminus of L*, a mutant of
mengovirus L shown in Figure 14. Moreover, the change of th~
j
wo 94n~72 ~ 2 1 64297 PCT~S94/06177
- 35 -
N-terminal amino acid sequences in L is not expected to
interfere with the function of the L -peptide since the al-
teration only comprises the replacement of the first two
amino acids (MA) by the amino acid sequence GNS. A similar
deletion of the N-terminal amino acid and fusion with het-
erologous amino acids has been shown to have no dramatic
effect on virus viability in the case of vMLN450.
Expression of vMQG-1 proteins should yield the proteins
~gpl20-Q and L after proteolytic cleavage by protease 3C.
The difference between gpl20-Q and gpl20-VCN is at the C-
terminus of the protein:
vMQG-l . . . RWFETQ
vMLN450 . . . RWLTAMEQ.
The entire sequence of ~gpl20-Q is:
MATTMEQINC TRPNYNKRKR IHIGPGRAFY TTKNIIGTTR QAHCNISRAK
WNDTLRQIVS KLKEQFKNKT IVFNQSSGGD PEIVMHSFNC GGEFFYCNTS
PLFNSTWNGN NTWNNTTGSN NNITLQCKIK QIINMWQEVG KAMYAPPIEG
QIRWFETQ- (COOH).
The cellular localization of ~gpl20-Q is expected to be
cytoplasmic and independent of the L -peptide localization.
In addition, this strategy provides information that i5
applicable to the cloning of a signal sequence at the
N-terminus of the ~gpl20 sequence, or any other heterologous
insert, leading to the secretion of the foreign insert thus
likely to result in increased immunogenicity.
ExamPle 9
pM16-1 as Source of Menqovirus DNA
The previous Examples may also be carried out using
plasmid pM16-1 as a source of mengovirus nucleic acid.
pM16-1 contains a deletion of nucleotides 10,931 to 10,950 ir
the plasmid region resulting in an increase in the
infectivity of the transcript. The sequence of pM16-1 is
depicted in Figure 17 and a comparison of the sequence of
pM16 and pM16-1 is provided in Figure 18. pM16-1 or any
other version of mengovirus cDNA could be used for
construction of recombinant viruses like vMLN450.
wog4ng472 ~ ~st~ 2 1 6 4 2 9 7 PCT~Sg4/06177
- 36 -
Example 10
Protection of Mice from Lymphocytic Choriomeningitis
Infection Usinq Recombinant Menqovirus
The well-characterized immunodominant cytotoxic
T-lymphocyte (CTL) epitope from the lymphocytic
choriomeningitis virus (LCMV) nucleoprotein (NP) was used ac
a model. It has previously been shown that the introduction
of this epitope into Vaccinia virus allows the induction of
protective immunity against lethal LCMV infection in BALB/
c (H-2d) mice. J.C. Whitton et al., J. Virology 67:348-356
(1993). A Mengovirus chimaera, vLCMG4, was constructed that
expresses 14 amino acids (aa) of the LCMV NP including the 9
aa CTL epitope; ProGlnAlaSerGlyValTyrMetGly.
Materials and Methods
Construction and Production of vLCMG4
DNA manipulations, transcription, transfection, tissue
culture of HeLa cells, and production of Mengovirus were
carried out as described above.
CYtotoxicity assaYs
Primary cytotoxic activity against LCMV was checked in
livers from immunized animals essentially as described by
P. L. Gossens, H. JOUIN, and G. Milon, Dynamics of
Lymphocytes and Inflammatory Cells Recruited in Liver during
Murine Listenosis, J. Immunol ., 147, 3514-3520.
Each liver was homogenized in a potter glass grinder
containing 10ml HBSS + antibiotics, passed through a nylon
sieve and centrifuged for 10 min. at 4C at 150g. Each
pellet was resuspended in 45ml HBSS adjusted to 0.03% Trypsin
and 33~g/ml DNAse-l. Cells were incubated for 45 minutes at
37C under gentle shaking, before adjusting the mixture to
10% fetal calf serum (FCS). Cells were washed twice with
HBSS and the final pellet was resuspended in lml of complete
RPMI 1640 culture medium. (10% FCS, 1% L-Glutamine, 4x10 5M
fl-mercaptoethanol). Cells were counted and adjusted to the
appropriate concentration for the CTL assay. Non-infected or
LCMV infected J774 target cells were radiolabelled with
200~Ci of 51 Cr for lh at 37C, washed and distributed into
96 well plates at 105 cells/well and 100~1, containing
wog4n~72 2 1 6 4 2 9 7 PCT~S94tO6177
- 37 -
diluted effector cells. Plates were centrifuged at lOOg for
2 min. before a 4 h incubation at 37C. After another
centrifugation supernatants were collected and counted in a
gamma counter. Specific cytotoxicity was calculated
according to the following formula: experimental release -
spontaneous release/maximum release - spontaneous release,
where spontaneous release was determined in the absence o~
effector cells and 100% release in the presence of 1% triton.
Immunizations
8 week old female BALB/c mice obtained from Iffa-Credo
were immunized intraperitoneally with 0.2ml of either PBS or
different doses of either vM16, vLCMG4 or the Armstrong
strain of LCMV (LCMV-ARM, was obtained from Dr. Oldstone,
Scripps Research Institute, LaJolla, USA). LCMV-ARM has been
deposited at the American Type Culture Collection, 12301
Parklawn Drive, Rockville, MD 20852 under accession number
ATCC VR-134. Mice were challenged intracranially ten days
after immunization (p.i.) with 102-8 pfu of LCMV-ARM in 30~1
to test for the primary protective response and 43 or 45 days
p.i. to test for the memory response.
Results
Construction of vLCMG4 and qrowth characteristics
A double stranded synthetic oligonucleotide, coding for
the LCMV NP as 117 to 130, was inserted in frame between the
restriction sites SnaBl (747) and Nhel (754) of the
Mengovirus cDNA pMCS, yielding plasmid pLCMG4 (Fig. 1).
Plasmid DNA was sequenced through the mutated region. RNA
transcripts of pLCMG4 were transfected into HeLa cells givin~
rise to the recombinant virus vLCMG4. Virus from
transfection and infection supernatants showed the same
plaque phenotype as the parental vM16 or vMCS (Fig. 2).
After passage in HeLa cells vLCMG4 grows to high titers
comparable to vMl6 or vMCS.
WO ~n~72 ~ $~ ~1 6 4 2 9 7 PCT~Sg4/06l77
- 38 -
LCMV specific cytotoxicity
Whereas PBS and vM16 immunized animals show no lytic
activity towards syngeneic LCMV-infected J775 target cells,
LCMV and vLCMG4 immunized animals exhibit specific
cytotoxicity even at low effector/target ratios (Table 6).
Table 6
PBS LCMV vM16 vLCMG4
T~rgets 2X105 pf~ ip106 pfu ip 106 pfu ip
26* 13 6.5 50 25 12.5 16 8 36 18
J774 7** 6 5 3 3 4 3 4 0 0 0
J774
+ LCMN 17 16 7 84 81 75 0 1 74 78 77
* Effector/target ratio
** Percentage specific cytotoxicity
Vaccination of BALB/c mice aqainst LCMV challenqe
Sinqle dose immunization
Mice were immunized intraperitoneally with 106 pfu of
either vM16 or vLCMG4, 2 x 105 pfu of LCMV-ARM or tissue
culture medium as virus-free control. Animals were
challenged by intracranial injection of LCMV on day 10 or 4~.
as described in Materials and Methods and monitored daily.
All deaths occurred before day 10. No protection was
obtained for animals that had received vM16 or medium,
whereas complete protection was observed for LCMV and vLCMG4
immunized animals (Table 7).
W O 94n9472 ~ 2 1 6 4 297 PCT~US94/06177
_ - 39 -
Table 7
T i7~tion
-
vM16 vLCMG4 LCMN Medium
Day of lO 43 1043 lO 43 lO
challenge p.i.
Percent
Protection 0% 0% 100% lOOX lO0~ lO0~0%
(Number of (5) (4) (lO) (ll) (5) (5) (5
animals)
Dose dePendent Protection
In order to evaluate the minimal dose requirement for
effective vaccination with vLCMG4, different doses of vLCMG4
were used to immunize BALB/c mice. 100% protection could be
observed 10 days p.i. at a dose as low as 100 pfu, the
protection being still at 60% (2 dead out of 5) when animals
were immunized with 10 pfu. At 45 days p.i. protection
levels remained very high with single cases of death with 10,
103 and 104 pfu (Table 8).
wog4n~72 ,~ ti~ 2 1 6 4 2 9 7 PCT~S94/06177
- 40 -
Table 8
Ti 7.~ tion
Days vLCMG4 LCMV
p.i.
Dose (pfu) 10 1o2 103104 105 1o6 105.3
60~* lOOZ 100~ 100~ 100% 100% 100%
Protection
80% lOOZ 80% 80Z 100% 100% 100%
* Each lot contained 5 animals
Discussion and Conclusion
The results obtained for the Mengo-LCMV recombinant
- vLCMG4 confirm and extend the results obtained for the HIV
recombinant vMLN450:
1/ The 14 amino acid foreign sequence was inserted into the
Mengovirus genome without loss of viability. vLCMG4 grows to
high titers, comparable to vM16 and vMCS, and the plaque
phenotype is the same as for the parental virus.
2/ A specific immune response can be induced in vLCMG4
immunized animals against LCMV. Strong primary CTL activity
can be detected against LCMV infected target cells in livers
of immunized animals without secondary antigen stimulation of
- effector cells in vitro. In addition to the capacity of
Mengovirus to induce a humoral response against foreign
antigens, this result confirms the possibility to use
Mengovirus as a vector to induce cellular immune responses
against heterologous sequences.
3~ After immunization with vLCMG4 animals were protected
against a lethal dose challenge of LCMV.
DISCUSSION
ng472 --,i, PCT~S94/06177
- 41 -
Picornaviruses such as poliovirus, rhinovirus or
Mengovirus are attractive models for the development of
recombinant vaccines because their RNA genomes are expressed
exclusively in the cytoplasm of infected cells. We have
developed Mengovirus as a new viral vector. Mengovirus is
cardiovirus and shares the same serotype as
encephalomyocarditis virus (EMCV), Columbia SK, and
Maus-Elberfeld viruses (1,2). Mengovirus is able to
replicate in a wide range of animal species including
primates (3,4). Genetic engineering has shown that the
pathogenic potential of Mengovirus is controlled by a
homopolymeric poly(C) tract (C50~C10) within the 5
non-coding region of the genome (5,6). Truncation or deletion
of the poly(C) tract leads to stably attenuated Mengovirus
strains that can be propagated with ease in cell culture and
are highly resistant to reversion.
Like all picornaviruses, the Mengovirus genome encodes a
large polyprotein that is cleaved proteolytically into a
series of mature structural and non-structural proteins (2).
Unlike entero- and rhinoviruses, the P1 capsid region of
cardio- and aphthoviruses is preceded by a leader (L)
polypeptide. The Mengovirus L polypeptide is 67 amino acids
in length. Its functional relevance to the virus is unknow]l,
as it is not a protease like the L protein in aphthoviruse~.
Release of L from the polyprotein requires proteolysis by
viral protease 3C, an enzyme encoded downstream in the viral
genome. To determine whether attenuated Mengovirus could be
used as a viral vector and have potential to serve as live
recombinant vaccine, we engineered a segment encoding the
V3-C4 domains of HIV-IMN gpl20 into the region of the vM16
genome that encodes the L polypeptide. The resulting
recombinant virus expressed the gpl20-L fusion protein alonc~
with the normal Mengovirus proteins and elici~ed a stron~
humoral as well as cellular immune response to HIV-I in
immunized animals.
W094~9472 .~ r~ 2 t 6 4 2 9 7 PCT~S94/06177
- 42 -
We have demonstrated here that Mengovirus can be used as
a vector for the expression of immunogenic foreign protein
sequences. In this case, 147 amino acids from the HIV-IMN
gpl20 were fused in frame into the N-terminus of the L
polypeptide of the vM16 strain of Mengovirus. The
recombinant was viable, although showing somewhat smaller
plaque size and reduced virus yields as compared to vM16.
The vMLN450 virus could be stably passaged for at least four
cycles in cell culture with complete retention of the HIV-I
sequence.
It has been reported that the size of the poliovirus
genome can be increased by up to 17~ in recombinant
bicistronic constructions and still be encapsidated, albeit
with reduced viability. Poliovirus genomes 31% longer than
wild-type are not encapsidated (13). The virions of vMLN450
carry an HIV-I/Mengo recombinant RNA genome, but the viral
capsids are identical to those of parental Mengovirus. The
HIV-I sequence is replicated and expressed only during
infection, as is typical for other Mengo non-structural
proteins. The viral 3C cleavage site between the fusion
protein and P1 region is recognized and processed in a normal
manner. Polyprotein translation directed by the 5'
non-coding IRES (internal ribosome entry site) (1~-16) is
also normal, and initiated at the appropriate AUG of the
fusion-protein sequence. The ability of this IRES to direct
efficient translation of a wide variety of heterologous
protein sequences is already well established (13,17). We
have, for example, recently constructed a new Mengovirus
recombinant encoding part of the rabies virus G protein which
expresses a ~G-L fusion protein that can be immunopreci-
pitated by a rabies-specific antibody. We have also
engineered a vector cassette that will allow easy insertion
of almost any antigen-encoding cDNA segment into the L
protein region of an attenuated Mengovirus genome.
The cytoplasmic location of the infectious cycle of
picornaviruses and the fact that picornavirus genomic RNA
does not undergo reverse transcription are desirable features
wo~n~72 - - ~ i 2i 64297 PCT~S94/06177
_ - 43 -
for any viral expression vector to be used as a live
recombinant vaccine. The vMl6 system could potentially sho~
- broad applicability and safety in a wide variety of mammaliar.
hosts.
The gratifying and unexpected aspect reported in this
current study is that the immunogenic response to attenuated
Mengovirus clearly extends to heterologous antigens that are
carried and expressed by the virus during its limited
replication. The ~gpl20-L protein synthesized within cells,
retained natural antigenic properties and could be recognized
by a gpl20 V3-loop specific monoclonal antibody. Infection
of mice or monkeys with vMLN450, produced high titer
polyclonal sera that reacted with ~IV-I gpl60. The efficacy
of the response means that the fusion protein was efficiently
expressed in an immunologically relevant configuration.
Different modes of expression, such as those of non-fused and
glycosylated gpl20 segments, need now to be investigated in
order to determine the optimal antigen presentation to
achieve high HIV-specific neutralization titers. Given the~
wide host range of Mengovirus and the strong humoral response
tyPically elicited by its nonstructural proteins, it is
likely that vM16-based recombinants expressing appropriate
heterologous antigens will induce high titer protective
responses against various pathogens in many different animal
hosts.
Example 11
Construction of A Mengovirus cDNA, pMCS, Allowing
Facilitated Cloninq at The N-Terminus of The Leader Peptide
In embodiments of this invention, cloning of foreign
sequences into the Mengovirus genome at the NcoI 729 site
within the L coding region of the Mengovirus genome, involves
a two-step cloning procedure, as it was realized for the
construction of pMRA3/vMLN450. First a sequence is cloned
into the subclone pMRAl, then the orientation of the insert
is verified, since cloning into a single site allows
insertion in the proper as well as the inverse orientation.
WO ~72 t~ 2 1 6 4 2 9 7 PCT~S94/06177
- 44 -
In order to accelerate cloning of foreign sequences into
the leader peptide, we engineered a synthetic oligonucleotide
at the site of the NcoI site 729, which contains the
restriction sites for the enzymes XhoI, Sna BI and Nhe I.
These restriction sites do not occur in the Mengovirus cDNA,
and allow easy one step cloning into the Mengovirus cDNA.
Furthermore if different enzymes are chosen for each end of
the insert sequence, e.g., the 5' end of the insert carries
the Sna BI site and the 3' end the Nhe I site, the ligation/
insertion of the insert sequence into the Mengovirus genome
will be directed/forced and does not require screening for
orientation.
Generation of the cassette containing cDNA pMCS:
A double stranded oligonucleotide containing the
restriction sites XhoI, Sna BI and Nhe I (Figure 24) was
inserted at the NcoI site at position 729 of pMRAl, giving
pM~LFUSL. The 5.8 kb Sph I-Sph I fragment of pMl6 was
subsequently transferred into the Sph I site 1928 of
pM~LFUSL, resulting in plasmid pMCS (Figure 26). All DNA
manipulations have been carried out according to standard
procedures (ref ll, page 43).
The oligonucleotide linker sequence codes for non-Mengo
amino acids (Figure 26). RNA derived from pMCS and
transfected into permissive HeLa cells gives large size
plaques like the parental vMl6 RNA.
The utility of pMCS has been demonstrated by the
insertion of an LCMV epitope, allowing the generation of a
recombinant Mengovirus, vLCMG4, that is able to induce a
protective immune response in mice against lethal LCMV
infection.
W094~9472 2 1 6 4 2 9 7 PCT~S94/~177
_.
_ 45 -
Conclusion
The Mengovirus cDNA pMCS allows easy and orientation
directed/forced cloning of foreign sequences at the N-
terminus of the Mengovirus leader peptide. Viable
recombinant Mengoviruses can be generated from pMCS as
demonstrated by the construction of the Mengo LCMV
recombinant, vLCMG4.
ExamPle 12
Construction of A Recombinant Mengovirus
Encodinq For A Seqment of the Rabies Virus Glycoprotein.
A PCR fragment of 350 base pairs was generated from the
plasmid pRb56, See W. Tordo et al, Proc. Natl. Acad. Sci.
(USA) 83, 3914-3918 (1986), which includes the sequence for
the linear neutralizing epitope G5-24, B. Dietzschold et al.,
J. Virol. 64: 3804-3809 (1990), of the glycoprotein of the PV
isolate of Rabies virus. The amplified DNA carries at the 5'
end a XhoI site and at the 3' end a Sna BI site. The PCR
fragment and the pMCS plasmid were digested with restriction
enzymes XhoI and Sna BI, purified and ligated according to
standard procedures (ref 11, page 43). The resulting
plasmid, pMG5-24 was used to prepare RNA for transfection, a~
described above. The recombinant genome codes for a L-~G
fusion protein of an expected size of about 20 kDa.
Viable recombinant virus was obtained after
transfection of pMG5-24 RNA. Virus stocks were prepared and
used to infect HeLa cells in the presence of 35S methionine,
as described earlier.
vMG5-24 infected cells show the presence of an
additional protein of an apparent molecular weight of 22--
25 kDa, which is absent from vM16 or Mock infected cells
(Figure 27). In order to identify the identity of this
protein, the cytoplasmic extract was immunoprecipitated with
the Rabies G5-24 specific monoclonal antibody RV2-22C5, as
described earlier. See H. Burschoten et al., J. Gen. Virol.
70:291-298 (1989). The 22-25 kDa protein could be
immunoprecipitated from cytoplasmic extracts from vMG5-24
infected cells.
~ j 2 1 64297
WO ~ng472 ~ PCT~S94106177
- 46 -
These results demonstrate that an additional foreign
sequence can be expressed from a Mengovirus genome in an
antigenic manner.
, !
WO ~n~72 ~ 2 ~ 6 4 2 9 7 PCT~S94/06177
~_.
- 47 -
REFERENCES
1) Rueckert, R. (1991) In Fields (ed.), Virology 2lld ed.,
pp. 507-548.
2) Palmenberg, A.C. (1990) Ann. Rev. Microbiol. 44,
603-623.
3) Hubbard, G.B., Soike, K.F., Butler, T.M., Carey, K.D.,
Davis H., Butcher, W.I. & Gauntt, C.J. (1992) Lab. Anim.
Sci. 42, 233-239.
4) Helwig, F.C. & Schmidt, E.C.H. (1945) Science 102,
31-33.
5) Duke, G.M. & Palmenberg, A.C. (1989) J. Virol. 63,
1822-1826.
6) Duke, G.M., Osorio, J.E. & Palmenberg, A.C. (1990)
Nature (London) 343, 474-476.
7) Sambrook, J., Fritch, E.F., & Maniatis, T. (1989)
Molecular Cloning, A Laboratory Manual, Cold Spring Harbor
Press.
8) Emini, E.A., Jameson, B.A., Lewis, A.J., Larsen, G.R. &
Wimmer, E. (1982) J. Virol. 43, 997-1002.
9) Rey, F., Barre-Sanoussi, F., Schmidtmayerova, H., &
Chermann, J.C. (1987) J. of Virol. Meth. 16, 239-249.
10) Takahashi, H., Merli, S., Putney, S.D., Houghton. R.,
Moss, B., Germain, R.N.,& Berzofsky, J.A. (1989) Science 246,
118-120.
11) Harber, J.J., Bradley, J., Anderson, C.W., & Wimmer, E.
(1991) J. Virol. 65, 326-334.
12) Harlow, E. & Lane, D. (1988) Antibodies, A Laboratory
Manual, Cold Spring Harbor Press.
13) Alexander, L., Lu, H.H. & Wimmer, E. (1994) Proc Natl
Acad Sci USA 91, 1406-1410.
14) Parks, G.D., Duke, G.M., & Palmenberg, A.C. (1986)
J. Virol. 60, 376-384.
15) Jang, S.K., Krausslich, H.G., Nicklin, M.J., Duke, G.M ,
Palmenberg, A.C., & Wimmer, E. (1988) J. Virol. 62,
2636-2643.
16) Pelletier, J. & Sonnenberg, N., (1988) Nature (London)
334, 320-325.
W094/29472 2 ~ 6 4 2 9 7 PCT~S94/06177
- 48 -
17) Kaufman, R.J., Davies, M.V., Wasley, L.C., & Michnick,
D. (1991) Nuc. Acids Res. l9, 448S-4490.
Any publications, patents, and patent applications
mentioned, referred to, or cited in this specification are
expressly incorporated herein by reference to the same extent
as if such publication, patent, and patent application was
specifically and individually indicated to be incorporated by
reference.
