Note: Descriptions are shown in the official language in which they were submitted.
2 1 84354
PATENT
UMD 1.0 025 (RWJ-92~20CIP)
,
CELL TYPE SPECI~IC GENE TRANSFER
USING RETROVIRAL VECTORS CONTAINING
ANTIBODY ENVELOPE FUSION PROTEINS
AND WII~-TYPE ENVELOPE FUSION PROTEINS
BACKGRO[ ND OF Tll~ INVENTION
This application is a ~ ."-in-part of pending application serial
no. 07/979,619, filed 20 November 1992.
Field of the Invention
This invention relates to retroviral vector particles having target cell
specificity. The retroviral vector particles comprise a retroviral vector having a
chimeric envelope protein consisting of an antigen binding site of an antibody or
another peptide fused to the envelope protein of the retroviral vector. The antigen
binding site or the other peptide replaces or disrupts the natural viral receptor
binding site. The resulting chimeric envelope is referred to as the ~targeting
envelope". This invention relates to retroviral vectors that contain not only the
targeting envelope but also wild-type envelope protein. The presence of wild-type
envelope in addition to the targeting envelope acts as a helper molecule by
supplying a fully funclional membrane fusion domain which may be impaired in
targeting envelopes. Tbijs helper function enables and/or enhances infection of cells
that do not contain a re~eptor for the wild-type envelope but do contain a receptor
for the binding of the t~rgeting molecule. This invention also relates to a method
for preparing the retroviral particles and for using the retroviral vectors to introduce
genes into vertebrate ce~ls.
22 1 ~435~
Descriptioll of tbe Ba~
.
The disclosures referred to herein to illustrate the l,~k~l. 1 of the
5 invention and to provide additional detail with respect to its practice are
i.l~,ulL ' herein by l~ference. For ~,u..~. , the disclosures are referenced
in the following text and '~ grouped in the appended ~ l.y.
Retroviral ~ectors are the most efficient tools to introduce genes into
10 vertebrate cells. Clinical . .l~,;,,,.,,,~c have been conducted to use retrovirus vectors
to cure a genetic disease in humans (adenosine deaminase (ADA) deficiency).
Besides correcting inborn errors of metabolism, gene therapy is also being tested in
c]inical trials to cure cancer and various other diseases (Science 1992, Vol. 258, pp.
744-746).
Retroviral vectors are basically retroviral particles that contain a
genome in which all viral protein coding sequences have been replaced with the
gene(s) of interest. As a result, such viluses cannot further replicate after one
round of infection. Rctroviral vector particles are produced by helrer cells
20 (Figure l). Such helper cells are cell lines that contain plasmid constructs which
express all retroviral proteins necessary for replication. After i & of the
vector genome into such helper cells, the vector genome is .. ~ t~ .i into virusparticles (due the presence of specific Pn~rC~ tinn sequences). Virus particles are
released from the helper cell carrying a genome containing only the gene(s) of
25 interest (Figure l). In the last decade, several retroviral vector systems, derived
from chicken or murine retroviruses, have been developed for the expression of
various genes (for reviews see Temin, l98~; Gilboa, 1990).
Retrovir~l, vectors have several limitations. Besides the limited
3 o genome size that can be Pn~rsi~l~t~A into viral particles, the most limiting factor
for the application of retroviral vectors is the restricted host range of the vector
particle. Some retroviruses can only infect cells of one species (ecotropic
I~UViiU~45) or even ollly one cell-type of one species (e.g., HrV). Other
1~;I1UViII~ have a veIy broad host range and can infect many different types of
3 5 tissues of many differen~ species (~ pllullul~ic retroviruses).
The initial s~ep of retroviral infection is the binding of the viral
envelope (erlv) ~lyWL~loleill to specific cell membrane receptors, the nature ofwhich is unknown for m~st retroviruses. However, the interaction of the viral env
q. 3 21 84354
protein with the cell sLlrface receptor is very specific and determines cell-type
specificity of a particular virus (Weiss et al, 1985). The envelope protein of all
known ICitl~Jvilu~i. is made up of two associated peptides, (e.g., gp70 and p20(E)
in SNV). These peptides are derived by proteolytic cleavage from the same
5 precursor (gPR9Oenv) encoded by the retrovilal env gene. One peptide p20(E),
also termed TM, anchors the protein in the membrane of the virus ar~d, as shown
with HIV, mediates the fusion of the virus and cell .,~ ~".- -~ The second
peptide gp70, also termed SU, mediates the bindirlg of the virus to its receptor and,
therefore, determines the host range (Weiss et al., 1985; Varmus and Brown,
1989).
. ..
Data obt~ined with several I~Lluvilu~s indicate that the retroviral
envelope protein forms trimers or tetramers. The fûrmation of trimers appears tobe mediated by the TM peptide (reviewed in Hunter,E. et al., 1990). Targeting
5 envelopes retain TM in order to (i) maintain a membrane fusion function and (iu)
maintain ~liæ~ However, since X-ray pictures are not available, it is
unclear whether or to what degree the construction of targeting-molecules impaired
the structure of the membiane fusion domain.
2û
BRIEF DEscRliYrloN OF TliE FiGURES
Figure I is a diagram illustrating helper cells expressing retroviral
25 proteins. A) Helper c~lls are made by the Lld,l~r~liùl~ of plasmids expressing all
retroviral proteins ne~essary to form infectious virus particles. B) Afier
ll~ul~f~liull of the retr~viral vector, the vector RNA genome is ~ 1 into
core structures. C) Helper cells that contain a plasmid express a modified envelope
gene.
Figure 2 is a diagram illustrating plasmids expressing mutant
envelope genes of spleen necrosis virus (SNV).
Figure 3 ~hows the sequence of the single chain antibody gene (scFv)
3 5 ag~unst the hapten DNP.
Figure 4 is a diagram illustrating helper cells expressing targeting
envelopes plus wild-type~ enYelopes. Such helper cells are made by the tr~ncf~ction
of pla mids expressing the u~ dillg proteins A) A helper cell expressing all
i~
.1 2 ~ 84354
-4 -
retroviral proteins necessary to forrn (a) retroviral core proteins and (b) targeting
envelope. B) Helper cells that contain targeting plus wild-type envelope are made
by t.~ r~~ plasmids expressing genes encoding such proteins. After
~r~n~fPrtirn of the retr~viral vector that has the gene of interest, tbe retroviral
5 vector RNA genome is . ~ into retroviral vector particles displaying the
envelope.
Figure S is a diagram of a eucaryotic gene expression vector
constructed. The gene expression vector was derived from a similar vector
10 described recently (Sheily,W. et al., 1993).
Figure 6 is a diagram illustrating plasmids expressing spleen necrosis
virus, SNV, core structlure proteins, wild-type envelope proteins, and various
targeting envelope proteins.
SUMMARY OF TIIE INVENTION
The present invention pertains to a retroviral vector particle having
defined target cell specificity mediated by the nature of the targeting envelopewhich can be a chimeric protein consisting of an antigen binding site of an antibody
or another peptide that binds to a specific cell surface structure (e g., the receptor
binding domain of another virus) fused to carboxy terminal parts of the retroviral~
envelope protein. The targeting envelope mediates the first step of retroviral
infection which is the binding of ehe virus to a specific cell-surface receptor. The
present invention also perti~ins to retroviral particles that contain a wild-type
envelope in addition to the targeting envelope. The presence of the wild-type
envelope serves to act ias a helper molecule to improve or ~ f ~ .~ a functional3 o membrane fusion domain. Using target cells that do not contain a receptor for the
wild-tyrJe envelope (e g., SNV is not infectious for human cells), the wild-typeenvelope is only involved in the second step of retroviral infection, which is the
efficient fusion of the viial and the cellular mPmhr~nPs The present invention also
pertains to the co~ liu-- of retroviral vector particles containing a wild-type
envelope in addition to aj targeting envelope which can ~ for the loss of
infectivity observed with retroviral particles that contain targeting envelopes alone.
In one enlhoAimPnt the present invention pertains to a retroviral
vector particle having target cell specificity which comprises a retroviral vector
5 2 ~ 84354
,
having a targeting peptde fused to the envelope protein of the retrQviral vector to
form a targeting envel~pe, wherein the targeting peptide replaces or disrupts the
natural viral receptor bit~.ding site and the targeting peptide is the antigen binding
site of an antibody, the .receptor binding peptide of another virus, or is a peptide
5 that specifically binds to a specific receptor of tbe target.
In another ,.I,~lj".. . ~, the present invention pertains to a cell type
specific method for u~ u~ genes intQ vertebrate cells using retroviral vectors
which comprises ~ g to the cells a retroviral vector particle baving target
cell specificity which cQmprises a retroviral vector having a targeting peptide fused
to the envelope proteirl of the retroviral Yector to form a targeting envelope,
wherein the targeting Feptide replaces or disrupts the natural viral receptor binding
site and the targeting pe.ptide is the antigen binding site of an antibody, the receptor
binding peptide of anot}ier virus, or is a peptide that specifically binds to a specific
receptor of the target.
In yet another ~ b~iil"~,lll, the present invention pertains to a
method for preparing a retroviral vector parlicle having target cell specificity which
comprises a retroviral vector having a targeting peptide fused to the envelope
2 0 protein of the retroviral vector to form a targeting envelope, wherein the targeting
peptide replaces or disrupts the natural viral receptor binding site and the targeting
peptide is the antigen binding site of an antibody, the receptor binding peptide of
another virus, or is a peptide that specifically binds to a specific receptor of the
target, which comprise.~, the steps of:
(a) proviling a targeting peptide;
(b) repla~ ing part of the envelope gene coding for the viral receptor
binding site with the tar~eting peptide to form a chimeric envelope gene;
(c) cloni-.lg the chimeric envelope gene in a eucaryotic gene
expression vector; and l .
3 0 (d) ~ rP~ the chimeric envelope expression plasmid, a
retroviral core protein lixpression plasmid, and a selectable marker gene expression
plasmids into eucaryotic cells.
,
21 84354
~I - 6 -
~i
DEIrhlLED DESCRIPrlON OF T}iE INVENTiON
;.
Targeting Envelope
This inv~ntion relates to retroviral vector particles having target cell
specificity. The retro~/iral vector particles comprise a retroviral vector having a
chimeric envelope prot in consisting of an antigen binding site of an antibody or
another peptide fused to the envelope protein of the retroviral vector. The antigen
lo binding site or the oth~,r peptide replaces or disrupts the natural viral receptor
binding site. The reslilting chimeric envelope is referred to as the ~targeting
envelope~. This inverltion relates to retroviral vectors that contain not only the
targeting envelope but .,lso wild-type envelope protein. The presence of wild-type
envelope in addition lo the targeting envelope acts as a helper molecule by
supplying a fully functional membrane fusion domain which may be impaired in
targeting envelopes. This helper function enables and/or enhances infection of cells
that do not contain a receptor for the wild-type envelope but do contain a receptor
for the binding of the targeting molecule. This invention also relates to a method
for preparing the retro~ iral particles and for using the retroviral vectors to introduce
2 o genes into vertebrate cells.
To alter the host range of a vector particle, retroviral vector particles
may be cu~LIuc~d tha~ ~contain modified envelope proteins that recognize only a
cell surface structure ( eceptor) specific for the target cell of interest. Proteins
known to recognize sp~cific structures of proteins are antibody molecules. Hence,
to make a retroviral v~ctor particle specific for a cell-type of interest, the viral
receptor binding peptide may be replaced with an antigen binding site of an
antibody molecule. To test whether vector particles containing such antigen binding
sites are competent for infection, model systems were developed using an antigenbinding peptide of an aqtibody against the hapten ~ u~ lol (DNP) fused to
envelope gene of spleer necrosis virus (SNV).
Tqe us~ of the anti-hapten (anti-DNP) antibody has many
advantages. (1) The interaction of this antigen with the antibody is well
~ rl ;,- A (Davies and Metzger, 19~3). (2) The hapten is easily available. (3)
A large variety of cells ~which cannot be infected with wild-type vector particles)
can be conjugated with this hapten. DNP conjugated cells bind antibodies directed
against this hapten. l~;~s, the hapten may mimic the (abundant) presence of a
receptor for the chimerir Yector particle. (4) Anti-hapten antibodies are frequently
21 84354
. - 7 -
in~r~qli7~i by the cell ~ii Thus, in the case, the construction of chimeric envelope
proteins will destroy ~he membrqqne fusion dom~in of TM, this property may
li ~ for this losis of function. (5) An in vi~ro binding assay can be easily
established to test for virus particle formation and binding of such viruses to DNP.
~
Wild-l~pe Envelope
This invention relates to retroviral particles having a target cell
specificity. The retro~i~l vector particles comprise a retroviral vector having a
10 targeting envelope which mediates the birlding of the retroviral vector particle to a
cell surface receptor of the target cell:^ This binding is v~ry specific and deterrnines
the host range and celJ~type specificity. The particles also have a wild type
envelope. Using target c;ells that do not cont,in a viable receptor for the wild type
envelope, the function of the wild-type envelope is only to supply a fully functional
15 membr. ne fusion doma.n. This invention also relates to the method for preparing
the retroviral vector particles and a method for using the retroviral vectors tointroduce genes into vertebrate cells.
Retroviral vectors derived from spleen necrosis virus containing
2 o wild-type envelope alolle cannot infect human or hamster cells. In these infectivity
studies, retroviral parti~ies harvested from DSN cells were used (Dougherty,J.P.and T~min,~ M. 1989) to infect human HeLa and Col-l, as well as hamster
CHTG (ret. l) cells (T,ables I and 2). DSN cells are standard retroviral packaging
oells containing a plasr,nid expressing the retroviral core proteins and another25 plasmid expressing wild-type envelope (Dougherty,J.P. and T~min,~ M, 1989).
t
To intrc,- uce genes into such cells using SNV retroviral vector
particles, two different a~proaches were made using different targeting envelopes in
with and without additional wild-type envelope.
1. Targeting of human cancer cells (HeLa and Col-l) with SNV
retroviral vectors. The antigen binding site of an antibody directed against thehapten DNP was used However, the antigen binding site used in the targeting
envelope was derived from an antibody (termed B6.2, Bird,R.E. et al., 1988 and
35 Colcher,D. et al., 1990) directed against a cell-surface protein expressed on various
human cancers (e.g. HeLa and Col-l cells, Bird,R.E. et al., 1988 and Colcher,D.
et al., 1990). The gene constructs (Figure 6) for the expression of the targeting
envelope are similar b~ that described above. In particular, in two constructs
(Figure 6, pTC24 and ;~TC25), the antibody moiety was fused to exactly the same
21 84354
l - 8 -
i~ , .,
position of the SNV e l-~elope gene as the ianti-DNP a~body described below (formore details, see below:,,Material and Methods). To test, whether the addition of a
fully functional membrarLe fusion domain (prc,vided by wild-type envelope) wouldincrease the efficiency c,f infection, helper cells expressing retroviral core proteins,
5 wild-type envelope, and the targeting e ope were developed (Figure 4). Virus
was harvested from such helper cells aDd s~ubjected to infectivity studies.
2. Tar~eting CHTG oells that express a receptor for ecotropic
murine leukemia viruD~. To test whether~retrovi~al paIticles derived from SNV
displaying targeting molecules other than antigen binding sites of an antibody are
infectious, targeting envelopes were co~istructed that contained the receptor binding
peptide of another viruD (murine Ieukemia virus) fused to the envelope of SNV.
Infectivity of virus particles displaying such targeting envelopes with and without
wild-type envelope waS tested.
. .
Examples
TargetiDg Envelope
Materials and Methods
:`
Construction of Antibody-Envelope Fusion Genes
The gene;coding for the envelope protein of spleen necrosis virus
(SNV) does not contain suitable restriction enzyme sites to enable the construction
of antibody-envelope fusion genes. Thus, point mutations were introduced (by site
directed, ~,. ~- . ~) ill ~he SNV env gene at different locations to create restriction
enzyme 1~7~ iUI~ sites. For this purpose, the SNV env gene (Hindm-SacI
3 0 fragment) was subcloned into pSelect (a vector specifically designed for site
directed ",~ estriction sites for enzymes that create blunt ends were
introduced in such a way that the restriction enzymes cut between two codons.
Following c~,rlD;,l~"lly this strategy, all mutants can be used to create deletions,
insertions, and fusion~ in any ~o~ lio~l without altering the reading frame.
Further, restriction eLlzyme sitff were nestcd between regions coding for
r.~ opl~,b;c and hydrol~hilic domauns. It was hypothesized that the deletion of a
certain domain(s) would not interfere with the proper folding of the following
domain. This hypothffis is based on the finding that many proteins in evolution
arose by exon shuffling of functional domains.
` 2184354
g
.
Some mut~nt envelopes that have been made are shown in Figure 2.
pSNV-env-mC (Figure 2a? cont~ins a new restriction enzyme site located between al~.yJlu~llubic and a hydrcphilic peptide domain. In this mutant, the change in the
s nueleotide sequence does not alter the amino acid scquence. Thus, pSNV-env-mC
can be considered as a positive controL- ~ pSNV~nv-mD contains a new restrictionenzyme site within the cl.~ avage site of ~e çnvelope precursor. The introduction of
the mutation also alter~d the amino acid sequence destroying the common motive
found in all cleavage sites of all l~llu~.lu~ ' ~ , ' ' Thus, it was expectcd
10 that the resulting envel~ e precursor would not be cleaved, and, therefore, would
not to give rise to infec~ious virus particles.' 'Mut'ated env genes were inserted into
pHB3, a eucaryotic gene expression vector (Figure 2).
The genes coding for the heavy and the light chain of an antibody
15 against DNP have bee~l kindly provided by Dr. Ogawa (Scripps Clinic, La Jolla,
Ca). The genes were sequenced and published (Riley et al.,l986). Using PCR
tcchnology as described (Whitlow and Filpula, 1990), a single chain antibody gene
was wn~tluc~d includil;g the signal peptide against DNP. The PCR product was
cloned into the SmaI site of rRl~ C~-irt DNA sc-quencing confirmed the successful
2 0 ~ of the two ene segments coding for the variable regions of the antigen
binding peptide. The complete sequence of the anti-DNP scFv gene is given in
Figure 3. A SacII ~oc~lted in the polylinker of pBluescript) to SmaI ~ocated in the
3' PCR primer) fragme~ was inserted into eucaryotic expression vectors replacingamino terminal parts of tlle envelope gene as follows: in pTC4, the SacII (located
25 upstream of the ATG co10n of the env gene) to SmaI fragment of env was replaced
with the scFv gene; in pTC5 the SaclI to the Mscl fragment of env was replaced
with the scFv gene (Fip,ure 2C and 2D, respectively). After cloning, the antibody-
envelope junctions wer~ sequenced to verify the ",~; " ~ . of the corrcct reading
frame of the chimeric g~ne.
~ In Yitro Binding Assays
The in vi~rQ binding assays we}e performed in the following manner.
DNP was conjugated to!~SA (DNP-BSA was used to raise the initial antibodies
3 5 from which the scFv ' ~enes have been derived). DNP-BSA was coupled to
activated Sepharose following the protocol r~comml-n4~d by the supplier (Sigma).An Elisa assay with a.anti-DNP antibody (kindly provided by Dr. S.Pestka)
confirmed the successful coupling reaction. IOOml of tissue culture s.~
medium was incubated with 50ml of DNP-~SA-Sepharose for 30 minutes at 37C.
21 84354
- 10-
After incubation, the ~ë~pharose particles were pelleted by u r~, in a
Qualitron .~ .r 'lil`~lg,: for 30 seconds. The pellets were rirlsed once with PBS.
The PBS was }emoved and reverse i ,ILiUII assays were perforlned by adding
the reaction to the seph~rose pellet. The reverse tr~-cr~irti~n assay was done using
stdndard ~)lU~JUll.d, .ncorporation of 32PdTTP into cDNA was ~ by
TCA ~c~ Jildtiu.. as d~cribed (Schleif ar~d Wensink, 1981).
" Test for Infectivi~y
of Particles Containing A ~ clo~ Fusion Proteins
The envelope expression plasrnids shown in Figure2 were
transfected into D17 cells (a dog u~twalluullld cell-line) in ~ f ~;l with
pBRl and pJD214HY ~igure 2), plasmids expressing the retroviral core proteins,
and containing a retioviral vector for the expression of the lly~
5 ~' ,' ' '` gene; respectively (see also Figure 1). Cells were selected for
lly~lullly~;.l resistance.. After selection for ~ IUIIIY~ resistance, virus was
harvested from confluer.~t cell cultures and infectivity assays were rerformed (see
below). Infected target,cells were selected for hygromycin resistance (D17 cellswere incubated with nr.edium containing 60mg/ml hygromycin, CEIO cells with
medium containing 250'rng/ml hygromycin). Hygromycin resistant cell colonies
indicate infectious virus particles.
Infectivity assays were performed on D17 and CHO cells with and
without conjugated DI~. DNP was conjugated to cells as follows: Cells were
incubated with 500 .~1 of a solution containing 1.4 mg/ml DNBS (2,4,-
D;.li~ul,~ sulfonic acid, 2-hydrate, purchased from Kodak) in sodium
cocodylate buffer (0.25M) for 3 to 5 minutes at room t L ' r,. The
U'J..;. ,, " reaction was stopped by adding 5 ml of medium to the cells.
,:[
Infection;~of non-conjugated cells were performed in the presence of
50 mM polybrene usin~ standard protocols. In the case of DNP conjugated cells,
i~fection was performeG without po~ybrene.
.,
2 ~ 84354
Wild-Type Envelope
: Material and Methods
~ scA targeting vectors
To wnstil~t a targeting envelope wntaining the antigen binding site
of an antibody directe~ ag~unst a cell-surface protein expressed on several human
tumor cells, the cu~ v!~Jil.6 single chain antibody gene (termed B6.2, Bird,R.E.lo et al., 1988 and Colc~er,D. et al., 1990) made for expression in E.wli. wasmodified in the following way: PCR technology~was used to amplify the B6.2 scA
gene using the original E.coli. expression plasmid as template (Bird,R.E. et al.,
1988 and Colcher,D. et al., 1990). The primers used had the following sequence:
primer A: 5' GGAGCGCTGACGTCGTGATGACCCAGTC 3'
primerB: 5' CCTCGCG~TCCACCGCCGGAGACTGTGAGAGTGGTGC3'
/;
The PCR :~nplifir~tinn results in a fragment that does not wntain the bacterial
ompA signal sequence;and the stop codons present in the original B6.2 gene
(Bird,R.E. et al., 198~'and Colcher,D. et al., 1990). The PCR products were
cloned into the Smal sit~: of the pBluescript vector (Strata gene) and sequenced to
verify a wrrect reading~'frame. The plasmid was termed pTC9. The B6.2 gene
was isolated by digesting the pTC9 plasmid with Eco47III plus NruI. The
wll~..J~.6 restriction enzyme recognition sites have been introduced with the
25 primers used for PCR ~nnplifir~ti in The B6.2 gene (the Ew47m to NruI
fragment was cloned into pTC13, a gene expression vector (Figure 5). The
co~ Jih~g vector (~ermed pTC23) contains the ER transport signal sequence of
the SNV envelope prorei;n fused to the B6.2 gene to enable transport through the,...1np~ reticulun~ ' The cloning ~ the NruI site at the 3' end of
3 o the B6.2 gene. Carbox~ terminal parts of the SNV envelope gene were isolated and
fused to the B.2 gene ~ruI site) to give plasmids pTC24, pTC25, and pTG26
(Figure 6). Plasmids ~ C24 and pTC25 retain exactly the same portions of the
retroviral envelope as; lilasmids pTC4 and pTC5 which wntain the anti-DNP
antibody. In plasmid pTC26, the antibody is fused to wdon 168 of the SNV
3 5 envelope.
2184354
~ - 12 -
Cl~imeric SNV-MLV targeting envelope
Targeting envelopes containing the receptor binding peptide of
another virus were made as follows: the gene segment of ecotropic murine leukemia
5 virus (a HindIII-BalI fragment comprising almost the complete region coding for
the SU peptide, including its ~R transport signal sequence, Ott,D., and Rein,A.
1992) was isolated and inserted into the vectors pSNV-env-mC and pSNV-env-mD
(pSNV-env-mC and pSi~V-env-mD was described in Figure V replacing the amino
terminal parts of the S~ envelope gene. The resulting constructs are identical to
10 plasmids pTC4 and pTC5, respectively, except that the anti-DNP antibody peptide
(anti-DNP scA) is repl~_~d by the receptor binding peptide of ecoMLV (Figure 6,
pSNV-MLV-chiC and ~,SNV-MLV-chi-D, respectively).
.;!1
tal system
Briefly, holper cells were made as described above by l.,...~f~l;.c,
plasmids expressing retroviral gag-pol proteins, the retroviral targeting envelope,
and tbe wild-type envP'ope into D17 cells in co-tr?n~f~rtinn with a selectable
marker to obtain help~r cell lines containing targeting envelope only or helper cells
2o containing both targeing and wild-type envelope. Infectivity assays were
per~formed on a variety of different cell-lines which included D17 cells, CHTG-cells
expressing the ecotropi,, murine leukemia virus receptor (Albrittnn T. M et al.,1989) and human Hel~ and Col-l cells. Infectivity was determined with a
retroviral vector expr~ssing the bacterial beta-~ tn~ o gene as described
25 (Mikawa,T. et al.).
Results
Targeting Envelope
.' :
In vitro hinding assay. The in vifro binding assays showed that only
cells transfected with pS~V-env-mD produce viral vector particles that contain a35 chimeric envelope able to bind DNP (see also Table 1).
.,
Infectivitytstudies. The results of the infectivity ~,A~ ' ' are
in Table 1.; Vector particles containing wild-type envelope (pSNV-
env-mC) infected D17 cells with an efficiency of about 105 colony forming units
2 1 84354
13 -
per ml of tissue culture ~ medium. Such virus particles also infected Dl7
cells conjugated with D~lP. However, the efficiency of infection was three orders
of magnitude less than that of cells not conjugated with DNP. This drop in virustiter is mainly due to difficulties of sçlecting DNP,-conjugated cells witn the
5 antibiotic. It appears that the CUIljl~ ~- action malces cells very wlnerable to
the drug and more t~lan 90% of the cells died two to three days after the
;l.,. reaction. V, irus particles with wild-type envelope do not infect CHO
cells. :~
The mutation of the cleavage site of th~ envelope precursor protein
(SNV-env-mD) complet.eiy abolished i~ifectivity. Only one colony was observed inD17 cells not conjugate~ with DNP. This finding coincides with earlier reports that
mutations in the envelope precursor cleavage site lead to non-infectious virus
particles. Cells transfected with pTC4 (Figure 2) did not produce vector particles
that were able to infec~ Dl7 or CHO cells at significant rn';ri~Of`;l~C Cells
transfected with pTC5 p oduced virus particles unable to infect D17 or CHO cells.
However, such particles significantly infected cells conjugated with DNP.
Wild-Type En~elope
~,
First, the presence of wild-type envelope in particles displaying an
antigen binding site against DNP was tested to determine whether there would be an
increase in the efficienc~l of infection of cells conjugated with DNP. It was found
that DNP conjugated ~IeLa cells could not be infected witb vector virus particles
that cont7uned ahe wild ty~e envelope alone. However, DNP conjugated cells couldbe infected with anti-~NP displaying retroviral vectors at a very low efficiency.
The titer mer~sured was about 10 infectious units per ml of tissue culture, ;~
medium. Virus partic:es that contained wild-type envelope in addition to the
targeting anti-DNP envelope infected cells lO to 30 times more efficienay. This
3 o data indicate that the presence of wild-type envelope can increase the efficiency of
infection of targeting vectors. Two additional sets of ~,A~II ' ' using other
t~rgeting molecules wele.performed to ~ullubuld~ this finding.
1. Infec,tivity studies with virus particles containing antibody-
envelope fusion proteins.` D17 celis, HeLa cells and Col-l cells were infected with
virus particles displayin~,an antigen binding site of an antibody (B6.2, Bird,R.E. et
al., 1988 and Colchel,D. et al., l990) directed against a cell surface protein
expressed on va~ious h~nian cadrcinoma cells. Vector virus particles were harvested
from a variety of différ$nt helper cell lines (Table 2). All virus particles were
2 1 8435~
1 - 14-
carrying a vector ~ ;"~ the bacterial beta-~?~r~o ~ cP gene. Infectivity was
determined by staining tl e cells with X-gal as described (Mikawa,T. et al.). Tne
number Qf blue cell colQnies was determined two to three days after infection. The
following virus particles were tested for infectivity: virus particles that do not
5 contain envelope (termed ~Ino env~), virus particles that contain wild-type envelQpe
?lone (termed wt-env - pSN), virus particles that contain targeting envelopes alone
which are antibody-emlelope fusion prQteins (termed TC24, TC25, and TC26 ?~S
described in Figure 6), and particles that cQntain wild-type plus targeting envelopes
(termed TC24+wt-env, ~C25+wt-env, and TC26+wt-env).
P?rticles aiat do not CQnta n any^ env'elope were found to be basically
not infectious. Particl~s tnat contain wild-type envelope were infectious only on
D17 cells which contail a vi?~ble receptor for wild-type SNV. The particles werenot infectious on HeL cells or Col-l cells. Particles that contained targeting
envelopes only were infectious on D17 and HeLa cells. The efficiency of infection
on D17 cells was less th~n 5% of that of virus containing wild-type envelope. Such
particles were not infectious on Col-l cells. The addition of wild-type envelopeincreased efficiency of infection 10 to 50 fold. Further, Col-l cells that could not
be infected with particles containing either envelope alone could be infected with
20 particles containing bot'~ 'wild-type env and targeting env. This data indicates that
the wild-type envelope adds a function improving or even completely enabling virus
penetration (Table 2). ' These data also show that the level of infectivity is
dependent on the positio~n within the envelope gene at which the antibody is fused to
the envelope. '
2. Infectivity studies with virus particles containing Sl~TV-MLV-
fusion proteins. CHTG cells (described in Albrit~nn,T. M et aT., 1989) expressing
the receptor of ecotropic'murine leukemia virus as well as D17 cells were infected
with virus harvested from cells expressing targeting envelopes (SNV-MLV-chi-C
3 o and S~TVMLV-chi-D) alone or from helper cells expressing targeting envelope plus
wildtype envelope. ~irus particles were carrying the lly~lullly~;~l B resistancegene. Infected cells ~ere selected for hygromycin resistance and the number of
ll~ylu...y~.. resistant c~l~l colonies was dPiPrmil-P/l Retroviral vector particles
containing the targeting envelope alone were not infectious. The particles became
35 infectious after wild-type envelope was added to the particles. Particles with
wild-type envelope alon~'~'are not infectious on CHTG cells (Table 3).
i
21 84354
- 15 ~
Discussion
i: `
Targetio~ velope
The data, obtained with retroviral particles containing antibody-
envelope fusion proteir.s showed that such particles are competent for infection.
Surprisingly, TC4, a ~,oDstruct that con¢ains the scFv ger~e fused to enY in themiddle of SU did not ~ive virus parti~les capable of binding DNP. This may be
due to an unstable SU-'~q complex. This hypothesis is supported by the finding
that such particles failed to bind to DNP-BSA-Sepharose. Low level infectivity of
such particles on Dl7 cells may resalt fror~ unspecific--adsorption of virus particles
containing TM only. Ur~rPrifir~lly adsoIbed virus particles (depleted of SU) mayoccasional penetrate the cell.
Cells trai-:sfected with pTC5 produce virus particles with chimeric
envelopes without a functional retroviral membrane fusion domain. This
. t;-~n is based on the finding that virus particles containing uncleaved
envelope precursor prote.ins (SNV-env-mD) are not infectious. However, it is
known that some aDtib~xly molecules are iniP.rn~li7P~i by cells after binding to cell
surface by an unkDowll tnPrh~nicm. The data show that such aD infPrn~li7~inn
mechanism might be suff!cient to allow internali7ation of the virus particle aDd the
consequent ~ - -i of a successful infection.
Arrlir~ nc of Vector Particles
With Antibody-Envelope Fusion Proteins in Gene Therapy
In all apl-lications of human gene therapy so far, the oells of interest
were isolated from the patient, purified from other cell tyres, aDd iDfected iD tissue
culture with retroviral vector particles which were harvested from helper cells.3 o After expansion of the ~reated cells in tissue culture, they were re-injected iDto the
patient. The infection cf cells has to be done in vi~ro, since the retroviral vector
particles used (derived from a~ l.vLIul~ic murine I~LIvvilu~) have a broad host
range. Thus, if injec~ord directly into the blood stream of a patient, such virus
particles would infect all kinds of tissue. Besides other risks, this treatment would
35 be inefficient, since the chance that the gene will be delivered to its
target cell is very low.
This clinical gene therapy protocol may be sufficient to obtain insight
into how efficient aD~ llolw beneflciary gene therapy will be for the patient. Indeed,
21 84354
- 16 -
'!~
the clinical data look very prornising (Eglitis, rersonal ~v~ n), However,
the eurrent elinical protocvl is very laborious, time c~n~ll ning, very costly, and,
therefore~ not suitable ~}for general elinical ~rp~ For general elinieal
it will be LeeessaIy to injeet the gene transfer vehicle directly into the
body of thepatient. I .
.~
The d~ v~r,~l~L of a retroviral vector rartiele that only infects one
sreeific eell type, may ~llow the direet 3njection of the veetor into the patient's
blood stream. The d~ lvl of vector partieles eontaining antibody-envelore
0 chimeras may be the first step towards this goal and may open a new area of possible ~rrlir~ n~ of gene therapy in vivô: ~
'r'
j Wild-Type En~elope
~i
Retroviral vector partieles whieh display am antigen binding site of an
antibody can srecificall~nfect eells that eontain a antigen sreeific for the antibody.
However, the effieienc~l of the gene transfer can be low. We lly~ull.~;~ that the
fusion of the targeting ~eptide to the envelope impaired the natural fusion function
of the envelope whieh is essential for effieient penetration of the virus. Thus, the
2 o hypothesis that the addition of a wild-type envelore may 4 ' ~ ' ' this
~I,ulL~v.llil,~ was tested.
New retroviral veetor rartieles eontaining two different types of
targeting envelopes were construeted. These targeting envelopes were: (I) fusionproteins containing the imtigen binding site of an antibody fused to various carboxy
terminal portions of the envelope protein of spleen neerosis virus, SNV; and (2)fusion proteins eonsistin`g of the reeeptor binding domain of ecoMLV fused to
various carboxy termin~l portions of the SNV., similar to the antibody envelope
eonstruets (Figure 6).
Iargeting envelopes alone are little or not infeetious on cells that
contain a reeeptor for the targeting envelope. The addition of wild-type envelope to
particles containing targ~ting envelopes dramatieally increased or even eompletely
enabled infeetivity on target eells that eould hardly or not at all infected with virus
rarticles containing either envelope alone. This data show that the Vll:~llU~IiUll of
particles containing mixed envelopes dramatieally improves the efficiency of gene
transfer into specifie target eells and, therefore, provides a valuable tool to
introduce genes into speeifie target eells.
`: 2184354
- 17-
This met~lcd can be probably be improved by mutating the natural
receptor binding domain of the wild-type envelope (e.g., by site directed
" ,1 ,;;,... cic). Using a wild-type envelope containing a non-functional receptor
binding site in mixed envelope retroviral vector particles may enable to also target
5 cells that contain a rec ptor for the wildtype envelope without loosing target cell
~ ificlq~
, ' ,
:
21 84354
- 18 -
Table 1
;
Infectivity of Retroviral Vector Particles
on D17 ~nd C.~O Cells With and Withont DNP C~
:~
Viriis titer (cf i/ml)
Envelope Binding l~ D17 cells D17+DNP -CHO-DNP CHO+DNP
of virus DNP
particle
10 SNV~nv-mC nd 105 1o2 - 0 0
SNV-env-mD - 1 0 0 0
TC4 - 10 0 0
TCS + s lo2 0 10
~ Virus 1~S hnrvested from tissue cultur~ ceL~s expressing S~V gag-po~ nnd the envelope
protein indicated in the left coLurn ~see a~so Figure 2). All cells contoined pJDZ14H`r o
retroviral vector expressins the hysromycin B ~ ...re ~ sene. Infected cells were
selected tor hygrorlycin r~lsistance. The nurber of hygrorycin resistant ce~ ~ colonies las
determined t~lo to three ~eeks after infection (after a~l ce~Ls hDd died in unlnfected control
plntes). D~P binding of vector particles i~as the determined by mensuring revers~ ir~u ~
DCtiVity br~l to B~A ~ e partic~es. nd: not det~r~ined; 0: no hyaromycin
resistant colonl6s ~er~ dete ted. Virus titers are express~d ns co~ony forming units (cfu) per
ml of tissue cu~ture supernatnnt mrdiun.
.
2 1 84354
- 19 -
Table 2
Infer~ti~ity of Retro~ LI Vector Partides Display~g The B6.2 SiLngle Chain
Antigen Binding Peptide
ConstrLLct Titer (CFU/ml)
gag-pol + D17 HeLa COL-1
no env 1 nd -*
wt-env (DSN) . 1,000 nd nd
TC26 : 40 10 nd
TC24 20 5 nd
TC25 45 20 nd
TC26 + wt-env 1,100 90 45
TC24 + wt env 10,000 250 115
TC25 + wt-env ~ 4,000 100 55
Plasmid constructs pTC24, prc2'i, and pTC26 were transfected into D17 ccl~ that
~xpress retroviral core proteins (ga3-pol) and the vector pCXL ~HiXawa,T.), or ~nto th~
retrovir~l prc~aaing line DS~ also containing the pCXL vector ~in .,o L~ r~.~ion uith R
plJsmid expressins an Dntlbiotic resistance sene). The pCXL vector tr~nsf~rs th~ bact~ri~l
,a-s~l-ctosidase ~taco sene. Virus was harvested from stabLe transfected cell-~ines and fr~sh
D17 cells, HeL~ cells, or Col-~ c~Lls w~r~ infected. Tw~ days Rft~r infection, cells w~r~
steined with X-gal Blue cclls indicate infected ceLLs ~xpressing th~ LacZgene. Virus t~ters
ar~ ~xpressed ns colony formina units per mL tissue culture supernatant medium hArvested from
helper cells ~cfulml).
-~ experimeDt not done
nd: no infected cells w~retdet~cted in inf~ction experimeDts using a total of 2 mL supernatant
tissue culture medium.
-20- 21 84354
Table 3
Infectivib o~ Retrilviral Vector Particles Containing Chimeric En~elopeProtein~i of MLV and SNV
Virus titer (cfu/ml)
Envelope
of virLls particle D 17 cells CHTG
10 cells
MLY-SNV-chiC nd nd
MLV-SNV-chiD nd nd
MLV-SNV-chiC lo6 103
+ wt SNV
15 MLV-SNV-chiD lo6 103
+ wt SNV
DSN 105 nd
Virus w s.harvested from tissue culture cells expressiM SNV aag-pol nnd the
envelope protein indic~ted In the left column (see nlsa Figure 6~. All experiments were
performed with pJD214HY ~ retrovirnl vector transferrina the hy3romycin resistDnce gene. Virus
titers ~re expressed s hygrxycin resistant colony forming units per ml of tissue culture
supernet~nt medium. SNV-~LV-chiC~wt SNV nnd SNV-MLV-chiDIwt SNV are cell lines expressing
chimeric enve~r,pes of !ILV ~nd SNV plus thc envelope of wild type twt) SNV. DSU c~lls nre SNV
based h~lper c~lls ~xpressina gag-pol and SNV env frx two different plnsmid constructs Virus
titers ~re expressed ns colony forming units (cfu) per m~ of tissue cultur~ supern tnnt medium.
nd: no hyarr,mycln resistnnt colonies were detected using a totnl of Sml tissue culture medium
21 84354
- 21 -
The term ' oligr~nllrlr~tir?P" as used herein refers to primers, probes,
o]igomer fragments to be detected, oligomer controls, and unlabeled blocldng
oligomers. Ol "..~ rJ~ P are molecules comprised of two or more
dc~ yl;l~ ;rlr~ or li' -'- ~IPC The term "primer" as used herein refers
5 to an ~ , preferably an ~ ' JI,~ ' ' either naturally
occurring such as a purified restriction digest or ~y 'Iy produced, which is
capable of acting as a poInt of initiation of synthesis when subjc~ctPd to conditions in
which synthesis of a primer extension product, which is rn-r' y to a nucleic
acid strand, is induc~A, i.e., in the pre ence of r lrlrotiri.oc an agent for
0 poly nn such as a DNA pOlyI..~a~v~ and a suitable t ~ e and pH.
The primer must be ~urrIci~I~ly long to prime the synthesis of extension products in
the presence of the polymeri~ation agent. Methods for amplifying and detecting
nucleic acid sequences ~y polymerase chain reaction (PCR) are described in detail
in United States pat~.nts no. 4,683?195, 4,683,202, and 4,965,188, which
15 disclosures are i. ~ r~l herein by reference.
Figure 1 is a diagram illustrating helper cells expressing retroviral
proteins. A) Helper celis are made by the ?r~nCf~C~ir.n of plasmids expressing all
retroviral proteins necessary to form infectious virus particles. One plasmid is20 designed to express all corelproteins (expression of gag and pol). The other
plasmid is designed to express the envelope ~ uul~o~ t~ . Both plasmid
constructs do not contain retroviral cis/acting sequences for virus replication (t?.g.,
rn~-ArcOI~fi~n sequence.~ a primer binding site etc.). POlya~ ..yla~uII takes place in
non/retroviral ~olyadellylalion recognition sequences. B) After I.. -f 1;. l) of the
2s retroviral vector, the vector RNA genome is ~nr-Ar~iI' ' into core structures. The
helper oell is producing retroviral particles that only contain the vector genome with
the gene(s) of interest. The vector contains all cislacting sequenres for replication.
Thus, in infected tar~,et ce~ls, the vector genome is reverse transcribed and
integratfA into the genome. Due to the lack of retroviral protein coding genes in
3 o the vector genome, no virus particles are produoed from infected target cells. C)
Helper cells that contain a plasmid express â modihed envelope gene. The helper
cell is very similar to that shown above. However, chimeric envelope genes were
constructed that contain the antigen binding domain of an antibody at the amino
terminus fused to the carboxy terminus of the envelope gene. Such particles may
35 only bind to and infcct target cells that contain an antigen structure which is
recogniz~A by the antibody moiety of the chimeric envelope protein.
Figure 2 is a diagram illustrating plasmids expressing mutant
envelope genes of spleerl necrosis virus (SNV). Genes are expressed from the Rous
2 t 84354
- 22 -
sarcoma virus promoter ~RSV/pro) and polyadenylated within the poly~dc;,.~
signal of herpes simplex virus thymidine kinase gene (llK/poly(A)). The polylini~er
Of rT~ crrjrt was inserted between the promoter and the polyadenylation sequenceto allow the easy clonillg of genes into this vector (plasmid sequences that abut the
5 vector are not shown). a/b) point mutations were introduced into the env gene by
site directed . ~ ,,.... 5.c to create new restriction enzyme ~4t;,uliul. sites(indicated by an ~). All enzymes cut exactly between tvo codons creating blunt
ends for easy ligation without shifting the reading frame. c/d) chimeric envelope of
containing an antigen ~inding peptide fused to the carboxy terminus of env. e)
10 pJD214Hy, a retrovira~. vector used in all studies to test the transfer of genes by
retroviral vector particl~s.
Figure 3 sh.ows the sequence of the single chain antibody gene (scFv)
against the hapten DNP.
Figure 4 illustrates retroviral packaging cells. A) A eucaryotic cell
containing two differellt plasmids for the production of retroviral vector particle
proteins. A retroviral ~;ector transfected into such cells and carrying the gene of
interest is ~ , by retroviral core proteins. The envelope expression
20 vectors expresses targeting envelopes (e.g., a antigen binding peptide fused to the
envelope). Virus particles are produced that infect a target cell only that contains a
receptor specific for th~ antigen binding site. The helper shown under B) is similar
to that shown above ex~,t that it also contains a gene expression vector coding for
the wild-type envelope. Virus particles produced from such helper cells contain
25 "mixed" envelopes which consist of the targeting envelope and the wild-type
envelope. Formation of mixed oligomers is possible because both, the targeting as
welL as the wild-type envelope contain a complete TM peptide which mediates the
formation of oligomers.
Figure 5 illustrates a eucaryotic gene expression vector (pTC13) to
obtain high level of gene products that contain a ER recognition sequence. The
vector shown has been derived from a another gene expression vector (termed
pRD114) which is described in Sheay,W. et al., 1993. The vector shown differs
from pRD114 in that it ~ontains a gene fragment coding for a ER l~v~;lliliu,. signal
3 5 sequence to enable the ~ransrort of proteins through the ~ J~ 1-'- reticulum. It
contains two i~co~ iliol~sites for the restriction enzymes NruI and StuI which cut
between two codons du~v~Ll~Ll~alll of the ER signal sequence coding region. DNA
fragments coding for arly peptide can be inserted into this vector. Translation of
the inserted gene is lerminated by using one of the three stop codons.
2184354
- 23 -
.
MLV-U3-pro: promoter.and enhancer of murine leukemia virus; Ad.V.leader:
tripartite leader sequence of adenovirus; SV40 poly(A): pol~ signal
sequence of simian viru~. ;40;
t
Figure ~.. illustrates plasmid vectors expressing targeting envelope
proteins. The PCR proiuct of the gene coding for the single chain antibody B6.2 (a
Eco47111 to NruI fragmen~, see Material and Methods) was cloned into the Nrul site
of pTC13 (Figure 5) to give plasmid pTC23. Carboxy terminal parts of the SNV
envelope gene were isol~ted and cloned into the NruI site downstream of the B6.210 antibody gene. The resulting targeting antibody-envelope fusion gene of pTC24and pTC25 are similar lo pTC4 and pTC5. pTC24 and pTC25 retain exactly the
same amount of SNV.envelope as pTC4 and pTC5, respectively. In pTC26 the
antibody coding genes abuts the envelope coding region at codon 167 of the
envelope gene. Plasmids pSNV-MLVchiC and pSNV-MLV-chiD are identical to
15 pTC4 and pTC5, except that *e antibody gene is replaced with a gene fragment
encoding for almost the complete SU peptide of MLV. In these clones the ER
transport signal sequen~e. (L) is from MLV. MLV-pro: promoter and enhancer of
murine leucemia virus, AVtl: tripartite leader sequence of ad~ vilus, L: ER
transport signal sequenc~-; B6.2scFV: gene encoding the single chain antibody B6.2;
20 poly(A) polyadeylation signal sequence of SV40; SU surface peptide coding region
of the SNV envelope; TM: Lldl~ llb~ coding region of the SNV envelope;
RSV: L)lullwt.. ~.d enhancer of Rous sarcoma virus.
A,, ' of References
.
,~lhrift~-n T M., Tseng,L., Scadden,D., and C ~' ,T.M.
1989. A putative murine ecotropic retrovirus receptor gene encodes a multiple
spanning protein and confers susceptibility to virus infection. Cell
57:659-666.
'
Battini,J.L Heard,J.M., and Danos,O. (1992) Receptor choice in
the envelope ~,ly~ulJluL~ s of d~ ULlUIJiC, xenotropic, and polytropic murine
leukemia viruses. J.Viro,l. 66: 1468- 1475.
Bird,R.E., Hardman,K.D., Jacobson,J.W., Johnson,S.,
K ' R M., Lee,S.-M., Lee, T., Pope,S.H., Riordan,G.S., and Whitlow,M
1988. Single-chain anti~en binding proteins. Science, 242; 423-426
.,
21 84354
- 24 -
Colcher,l~., Bird,R., Roselli,M., Hardman,K.D., Johnson,S,
Pope,S., Dodd,S.W., P~.ntoliano,M.W., Milenic,D.E. Schlom,J. 1990. in vitro
tumor targeting of a ~ single chain antigen-binding protein. J. Natl.
Canc. Inst. 82:1191-1197.
Cone,R.:;~. and M~ n,R C. 1984. Migh-effiency gene trarlsfer
into n~ n cells: generation of helper-free 1~ ' retrovirus with broad
n host range. Proc.Natl. Acad. Sci. USA 81:6349-6353.
o Courrloyer,D., Scarpa,M., Jones,S.N., Moore,K.A., Belmont,J.W.,
and Caskey,C.T, 1990. Gene therapy: a new approach for the treatment of genetic
disorders. Clin. Pharm~col. Ther. 47(1): 1-11 .
Danos,O. and Mulllgan,R.G. 1988. Safe and efficient generation of
5 I~ 1 letluvi~ L with ~ ul~ùilu~;c and ecotropic host ranges Proc, Natl.
Acad. Sci. 85: 6460-646~.
Davies,M.M. and Metzger,H. 1983. Structural basis of antibody
functlon. Annu. Rev. I.nmunol. 1:87117.
-.
Dougherty,J.P. and Temin,H.M. 1989. New retrovirus helper
cells with almost no nuc~leotide sequence homology to retrovirus vectors. J.Virol.
63, 3209-3212.
Friedmann,T. 1989. Progress toward human gene therapy. Science
244, 1275-1281. i~
Gritz,L., ~and J Davies 1983. Plasmid encoded lly~;lullly~;ll B
resistance: the sequence of hygromycin B ~ ot - .~f~ . gene and its
3 o expression in Fcrh~nrhi~ coli and Sa~ul.~u,~,y~. s cerevisiae. Gene 25, 179- 188.
Hunter,E;.. ~ and Swanstrom.R l990. Retrovirus envelope
~Iy~l!luleills. Curr. Top: Microbiol. Immunol. 157:187-253.
Kohn,D.13,, Anderson,W.F., and Rl~ CP,M R 1989. Gene therapy
for genetic diseases. Ca~cer Tr~h~Qti~tion 7(2):179-192.
.:
-
2t 84354
- 25 -
Larson,S .M. 1990. Improved tumor targeting with r ~A~
.~ ' t, single-ch~in, antigen-binding protein. J. Natl. Canc. Inst. 82: 1189-
1 L90.
Markowit~,D., Goff,S., and Bank,A. 1988 A safe packaging line for
gene transfer: separation of viral genes on two different plasmids. J. Virol.
62:1120-1124.
Mikawa,T., D.A.Fischman, J.P.Dougherty, and A.M.C.Brown. In
vivo analysis of a new lacZ retrovirus vector suitable for LineaOe marking in avian
and other species. Exp. Cell Res. 195: 516-523.
MiLler,A.D. 1990. Progress toward human gene therapy. Blood
76(2? 271-278.
Mims,C..~. 1986. Virus receptors and ceLI tropism. J. Infect.
12: 199-204.
Ott,D., and Rein,A. 1992. Basis for receptor specificity of
l~u~ t~ ;c murine leukemia virus surface oly~:u~ t~ gp70SU. J. Virol.
66:4632-4638.
Riley,S.C!, Connors,S.J., Klinman,N.R., and Ogata,R.T. 1986.
Preferential expression of variable region heavy chain gene segments by
~l~ ' 2~4-dil~iLu~ lyl-specific BALB/c nneonatal antibody clonotypes.
Proc. Natl. Acad. Sci. ~3:2589-2593. Rolt,l. 198g. Ln "Essential Tl '-Oy .
Blachvell Scientific P~ ti-~nc
.~
Sheay,W., S.Nelson, I.Martine~, T.H.T.Chu., S.Bathia, and
3û R.Dornburg. 1993. ~ ll insertion of the adenovirus tripartite le~der
sequence enhances exp1é;ssion in universal eucaryotic vectors. p; ~t~hn~ r.c 15:856-861 .
Shinnick,'r.M., Lerner,R.A., and Sutcliffe,J.G. 1981. Nucleotide
sequence of Moloney mllrine leukemia virus. Nature 293:543-548.
Temin ,H.M. 1986. Retrovirus vectors for gene transfer: efficient
integration into and expression of exogenous DNA in vertebrate cell genomes, in
"Gene Transfer" (R.Ku-~Prl~r~tl PA ) Plenum Press, New York.
~ 21 8~}54
-26 -
~F`,
,
V~ c ~ ~, and Brown,P. 1988 Retroviruses, in ~Mobile DNA"
(M-Howe and D.Berg, FdS.) ASM, ~'dDl~i~ DC.
Wat~nabe,S., and H.M.Temin. 1983, CO~.DlL of a helper cell
line for avian ' ' ' virus clonlng vectors. Mol. Cell. Biol. 3, 2241-
æ4s.
Weiss,R~ Teich,N., Varmus,H., and Coffin,J. 1985. RNA tumor
lo viruses. Cold spring halbor Laboratory, Cold Spring Harbor, New York.
Whitlow,~q, and Filpula, D., Single-chain Fv proteins and their
fusion proteins. Methods- A '~ to methods In Enzymology. Vol. 2 pp 1-9.
Throughout this :~rplic~ti~m various p~ ti-.nc have been
referenced. The disclosures in these publications are ..~l~o dl~d herein by
reference in order to more fully describe the state of the art.
The invention being thus described, it will be obvious that the same
20 may be varied in many ways. Such variations are not to be regarded as a departure
from the spirit and sco~)e of the invention and all such m~ifi~tinnc are intended to
be inclo~ed within the s~ of the following claims
