Note: Descriptions are shown in the official language in which they were submitted.
2191475
- 1 -
The invention relates to a drug, containing one or more
plasma derivatives as active substance or inactive ingredient,
and to a starting material of assured quality for the
preparation of such drugs, as well as to a method for preparing
these drugs. The invention also relates to a method for the
preparation of starting materials of assured quality,
particularly of plasma pools of assured quality.
Human plasma is of exceptional clinical importance as a
pharmaceutical preparation or as a starting material for the
preparation of plasma derivatives, respectively, particularly
for substitution therapy in the case of a congenital or acquired
deficiency of plasma components. However, when human plasma is
used, care must be taken that no infectious agents are
contained, which can be transferred with the pharmaceutical
preparation or with the plasma derivatives, respectively.
Infectious agents, which can possibly occur in blood, include
above all viruses which can be transferred through blood
(hematogenous viruses), such as HI viruses or hepatitis viruses
(hepatitis A, B, C or non-A-non-B), but also parvovirus, which
can be transmitted by blood.
Because of the great need for drugs containing plasma
derivatives, the economical preparation of these drugs is
possible only on an industrial scale.
Plasma is obtained from donors and pooled for the production
of pharmaceutical preparations. The size of a conventional pool
is about 2,000 to 6,000 individual plasma donations. There is a
risk that the entire plasma pool gets contaminated by a single,
virus-contaminated plasma donation.
Although as early as the late first half of the 20th century
human albumin was successfully made into a virus-free
preparation by heating. This at first was not possible for all
other drugs, which could be obtained from plasma, because of
their heat sensitivity. Up to now, adequately prepared albumin
has been used on millions of occasions; nevertheless, there have
never been infections attributable to human blood-borne viruses.
In contrast, virus infections, particularly those due to
hepatitis viruses and, since the 1980s, on a large scale also
those due to the AIDS virus, have been reported for many other
drugs prepared from plasma.
{
2191475
2 -
Around 1980, heat treatments were carried out for the first
time with appropriately stabilized Factor VIII concentrates with
the intention of inactivating virus contaminants. At first,
however, a large loss in the activity of Factor VIII had to be
accepted and the actual inactivation potential remained unknown.
By improving the heat inactivation methods and through
other, new, inactivation methods, it was finally possible to
produce drugs from plasma, which in most cases did not lead to
virus infections in recipients. Concomitantly with this
development, there was also an improvement in the selection of
donors and donations with the objective of excluding those
donors and donations suspected of viremia and thus of a virus-
containing plasma.
For some time now, the detection of certain viral antigens
or of antibodies in the blood has been used in an attempt to
exclude those donations which yield a positive result, and not
to introduce them in a larger plasma pool which is to be used as
a starting material for the preparation of blood products. In
the case of individual donors who do not have symptoms of a
disease or pathological examination results in any examination,
yet may nevertheless may harbor certain viruses in their blood
over extended periods of time even at high concentrations, the
occurrence of such viremias due to a particular virus can now be
detected unambiguously with the help of an amplification method.
After pooling plasma units, a single plasma donation
contaminated with viruses, is of course diluted; however, the
detection of viral genome sequences with the help of
amplification reactions is so sensitive that virus genomes or
their sequences can be determined unambiguously even in such
dilutions; and if, as mentioned above, they fall below a certain
detection limit, they then no longer have clinical relevance in
the sense of the possibility of an infection.
The EEC Regulatory Document Note for Guidance, Guidelines
for Medicinal Products Derived from Human Blood and Plasma
(Biologicals 1992, 20:159-164) proposes a quality assurance
system for checking plasma donors and plasma donations,
respectively. Accordingly, each plasma donation must be analyzed
with validated tests for the absence of virus markers, such as
hepatitis B antigen or HIV-1 and HIV-2 antibodies, since these
2191475
- 3 -
are indicative of a corresponding viral infection of the plasma
donor. Tests for excluding a hepatitis C infection should also
be carried out.
According to the European Pharmacopoeia special tests should
be carried out on each donation for determining hepatitis B
surface antigen and for hepatitis C virus and HIV antibodies.
(European Pharmacopoeia, 2nd Edition, Part II, 1994, pages 853
to 854).
An FDA guideline of 3-14-1995 provides for the PCR testing
of an end product (an immunoglobulin product) as an additional
safety factor.
Despite the proposed tests, it is emphasized in the EEC
guidelines that the safety of individual plasma donations is not
assured adequately by merely checking for these virus markers.
Even if the absence of said markers in a plasma sample is
confirmed, viremia of the donor cannot be excluded. Because
viral antigens and corresponding antibodies cannot be detected
immediately after the infection, the first markers of a viral
infection frequently occur only weeks or months after contact
with the infectious material. This critical period after the
infection and before the occurrence of antibodies generally is
referred to as the "window period". However, the point of time
after infection, at which the first viral markers are
detectable, varies from virus to virus.
Moreover, it has also become known that, for some drugs
prepared from plasma, viruses are depleted or inactivated in the
course of the production process and that such products by
themselves are virus-safe to a high degree.
Although virus inactivations of plasma derivatives have been
carried out extremely successfully on an industrial scale,
hematogenous viruses such as AIDS, hepatitis A, B and C viruses,
have nevertheless been transmitted in rare instances, and it
therefore had to be assumed that the manufacturers, in spite of
using a constant manufacturing method, produced a few batches of
virus-contaminated products (Lancet 340, 305 to 306 (1992); MMWR
43 (28), 505 to 509 (1994), Thromb. Haemost. 68, 781 (1992).
This probably resulted from excessive contamination of certain
starting batches. Since only indirect methods are available for
excluding virus-contaminated plasma donations during the
2191475
4 -
recovery of plasma, it is possible that the starting material is
so heavily contaminated, that the otherwise successfully used
virus inactivation and virus depletion methods are no longer
sufficient for producing virus-safe end products.
The human infectious dose for HIV, HCV and HBV is not known
and cannot be determined at present. The determination of the
infectious dose in tissue cultures (TCID50: tissue culture
infectious dose) or in the animal model (CID50: chimpanzee
infectious dose) therefore gives only an approximation of the
human infectious dose. Moreover, in some cases, people are not
infected with HIV, HCV or HBV in spite of having been exposed
thereto. A human infectious dose of such a virus is therefore
not necessarily infectious.
Piatak et al. (Science 1993, 259:1749-1754) determined the
TCID50 of HIV to be 1 TCID50/104 copies of HIV RNA. Shimizu,
Y.K. et al. (PNAS. Natl. Acad. Sci. USA 1993, 90: 6037-6041)
determined the CID50 of an HCV strain to be 1 CID50/1 copy of
RNA.
Eder et al. (The Role of the Chimpanzee in Research, Symp.
Vienna 1992, 156 to 165) were able to show that 20 copies of HBV
DNA/ml of plasma correspond to a CID50 of 1.
In the case of a plasma pool or other plasma starting
materials, it is particularly necessary to take care that the
virus load (virus contamination) is as low as possible, so that,
if necessary, the virus contamination can be lowered at least to
below the infectious dose by additional virus-inactivation steps
or by measures for depleting viruses. It would be desirable that
the viral contamination of the starting material be such, that
the number of copies of the viral nucleic acid already is below
the infectious dose for chimpanzees.
It is the object of the present invention to provide a drug
containing one or more plasma derivatives, in which there no
longer is any danger of a virus contamination with hematogenous
viruses capable of reproduction, resulting from excessive
contamination of certain starting batches.
A more specific objective is to provide a starting material
or intermediate of assured quality, whose virus load must not
exceed a specified maximum value.
According to the invention, this objective is achieved by a
2191475
- 5 -
drug containing one or more plasma derivatives as active
substance or as auxiliary ingredient, for which the starting
material or the intermediates incurred in the preparation of the
plasma derivatives are not contaminated by virus or whose load
of one or more hematogenous viruses capable of reproduction does
not exceed a defined limiting value,
- the absence of a virus load of certain hematogenous viruses
capable of reproduction being determined by an excess of virus-
neutralizing antibodies in the starting material or in the
intermediate, or by a protective immunity of the plasma donor at
the time of the plasma donation,
- otherwise the genome equivalents of the respective viruses
of interest in the starting material or in the intermediate
being determined by a quantifiable controlled and non-inhibited
method for the detection or determination of nucleic acids,
the thus quality-assured starting material or intermediate,
respectively, for the preparation of the finished plasma
derivative being subjected to at least one substantial virus
depletion or virus inactivation step, and the finished, quality-
assured plasma derivative obtained being worked up to a drug by
known methods.
The accomplishment of the objective comprises the
determination of the extent of the contamination or virus load
present in the starting material, which virus load can no longer
be eliminated by a method of inactivating or depleting the
viruses. Thus, the problem is solved by determining the
potential virus contamination in a starting material and by not
processing those starting materials further or to exclude them
from processing, as long as this high degree of contamination
exists.
For this purpose, each plasma derivative starting material
and possibly also for the intermediates incurred at the
preparation of plasma derivatives which are to be subjected to a
virus depletion or virus inactivation step, and finished plasma
derivatives are to be examined and treated in such a manner,
that it is ensured in a reliable manner that such drugs,
prepared from blood plasma can no longer, not even sporadically,
transmit hematogenous viruses capable of reproduction. In doing
so, the starting material shall be examined by the use of
CA 02191475 2008-06-04
24242-531
6 -
selected amplification techniques in order to determine an
upper limit of a possible virus load, which starting
material or intermediate will still be subjected to at least
one substantial virus inactivation or virus depletion step,
respectively, in order to arrive at a drug which will not
result in the transmission of hematogenous viruses.
According to the invention, the target nucleic
acids which are to be detected during the determination of
the genome equivalents, can be amplified by different
amplification methods in blood, in plasma, in serum, or
plasma factions. Preferably, however, polymerase chain
reaction (PCR) or special types of PCR, respectively, are
used as detection or determination methods. For the
detection of specific viral genome sequences, the
amplification process must be selective for the nucleic acid
sequence to be amplified. The amplification of nucleic
acids in the plasma pools of the invention can be
accomplished by a series of amplification processes
described in the literature.
The amplification of specific viral genome
sequences requires a knowledge of the genome of the
individual, yet very different viruses, in order to
reproduce them and make them detectable.
In another aspect, the invention relates to a
method of preparing a plasma pool which is quality-assured
with respect to the contamination by hematogenous viruses
capable of reproduction ("quality-assured plasma pool")
comprising the steps of: (a) determining the absence of
contamination of an individual plasma donation by
hematogenous viruses capable of reproduction by the absence
of markers which indicate a corresponding viremia, or by an
CA 02191475 2009-11-12
24242-531
- 6a -
excess of virus-neutralizing antibodies in the starting
material, or by a protective immunity of the plasma donor at
the time of the plasma donation, and (b) determining the
genome equivalents of hepatitis C virus (HCV) by taking
samples from n individual donations, combining the
individual donation samples to m sample pools and detecting
the amount of viral HCV genomes or HCV genome sequences
present in these sample pools by means of a method for the
detection or determination of nucleic acids by polymerase
chain reaction (PCR) using an internal standard, whereupon
those individual donations (ng), whose detected amount of
viral genomes or genome sequences in the sample pool lies
below a defined limiting value, are combined into a quality-
assured plasma pool, and those individual donations (na),
whose detected amount of viral genomes or genome sequences
in the sample pool is larger than or equal to said defined
limiting value, are subjected to a further treatment or are
eliminated, n and m being positive integers, and n is
between about 2,000 to about 200,000.
In another aspect, the invention relates to a
method for the preparation of a drug containing one or more
plasma proteins which is quality-assured with respect to the
contamination by hematogenous viruses capable of
reproduction ("quality-assured plasma product drug")
comprising the steps of providing a plasma pool obtained by
a method as described above, and processing this plasma pool
to a quality-assured plasma product drug by including in
said processing at least one further virus depletion or
virus inactivation step.
CA 02191475 2008-06-04
24242-531
- 6b -
Different amplification methods for nucleic acids are based
on PCR. The PCR amplification method was first described in 1983
by Mullis et al. (US patents 4,683,195 and 4,683,202). Viral
genome sequences can also be amplified by "nested PCR" (Mullis
et al, Methods Enzymol. 1987, 155: 335-350) or by RT-PCR
(Powell, L.M., et al. Cell 1987, 50:831-840; Kawasaki, et al.
Proc. Natl. Acad. Sci. USA 1988, 85:5698-5702).
For the amplification and detection of RNA, the RNA must
first be transcribed into DNA. This method is described in WO
91/09944 as so-called RT-PCR and involves the use of reverse-
transcriptase.
The amplification products can then be analyzed by using
labeled nucleotides or oligonucleotide primers in the elongation
process and in the subsequent hybridizing or separation of the
products by gel electrophoresis.
Alternative methods to PCR have also been described.
One of these methods for amplifying nucleic acids is LCR
(ligase chain reaction) according to EP 0 320 308 and
2191475
- 7 -
EP 0 336 731 and Wu and Wallace (Genomics 1989, 4: 560 to 569).
Other enzymatic processes are NASBA (nucleic acid sequence
based amplification), 3SR (self-sustained sequence replication)
according to EP 0 310 229 and Guatelli, J.C. et al. (Proc. Natl.
Acad. Sci. USA 1990, 87:1874 to 1878) or TAS (transcription
based amplification system) according to EP 0 373 960 and Kwoh,
D.Y. et al. (Proc. Natl. Acad. Sci. USA 1989, 86:1173 to 1177).
In these methods, a series of enzymes, such as, e.g., a DNA
polymerase or an RNA polymerase, is used either simultaneously
or stepwise in the amplification.
Other amplification processes are based on the use of
replicases of the RNA bacteriophage Q(3 according to EP 0 361 983
and Lizardi et al. (TIBTECH 1991, 9: 53 to 58).
A further method describes the signal amplification by
branched DNA oligonucleotides instead of the extracted nucleic
acid (branched DNA signal amplification) according to Urdea,
M.S. et al. Nucleic Acids Res. Symp. Ser. 24 Oxford 1991, Pachl,
C.A. et al. XXXII Interscience Conference on Antimicrobial
Agents and Chemotherapy. Anaheim, October 1992 (abstract 1247).
The EP 0 590 327 A2 discloses an analytical method for blood
samples, which provides for the determination of viral RNA or
DNA of, for example, hepatitis C virus, HIV, or hepatitis B
viruses. The detection limit for a test for determining the
hepatitis B virus genome is 1,500 copies (150,000 copies/ml), if
the evaluation is conducted electrophoretically after staining
the gel. The blood samples partly are dried spots of blood.
After the analysis, no provision is provided for further
processing of the samples.
Methods for preparing hyperimmunoglobulin preparations
against certain viruses depart from blood or plasma that
originates from donors who have been immunized actively or have
already overcome a disease and therefore exhibit a protective
immunity. The blood of plasma donors who have been vaccinated
against pathogenic viruses contains a corresponding antibody
titer. In contrast to antibodies indicating viremia, such as HIV
antibodies, these antibodies are desirable.
The starting material or intermediate of assured quality,
used to prepare the drug according to the invention thus either
contains an excess of virus-neutralizing antibodies to a virus
2191475
8 -
of interest or no detectable amounts or amounts below a limiting
value of genomes or genome fragments of possibly present
hematogenous viruses capable of reproduction.
The plasma derivatives may be contained in the drug as
active substance or also as auxiliary ingredients. Active
substances include, for example, clotting factors,
immunoglobulins, fibrinolysis factors, enzyme inhibitors or
other enzymes or zymogenes or mixtures thereof present in the
plasma. Auxiliary ingredients include albumin or other
stabilizers, various inhibitors, co-factors, etc.
In principle, any material from which a particular
manufacturing process is started, such as a plasma pool, a
cryopoor plasma, or a Cohn II + III paste is to be regarded as a
starting material. A series of possible starting materials are
cited in an article by Heide et al. ("Plasma Protein
Fractionation" in "The Plasma Proteins", Frank W. Putnam, ed.
Academic Press New York, San Francisco, London 1977, page 545 to
597).
Intermediates are products derived from a starting material
in a particular manufacturing process which have been obtained
by the manufacturing steps provided, e.g., a prothrombin complex
in the preparation of Factor IX with plasma or cryopoor plasma
as the starting material.
A finished plasma derivative, which is worked up with
routine manufacturing methods into a drug, is prepared from the
starting material, optionally by way of intermediates, by the
product-specific manufacturing process. Of course, two or more
finished plasma derivatives can be combined together during this
working up.
Preferably, the virus contamination which is not present or
does not exceed the defined limiting value, exists for at least
two viruses, preferably selected from the group consisting of
HIV, HAV, HBV and HCV, and particularly of HIV and HCV.
Moreover, the present invention is not limited to the
viruses mentioned above; rather, the virus contamination, which
is not present or does not exceed a defined, limiting value, can
be determined for any hematogenous virus, e. g., parvovirus,
hepatitis non-A-non-B virus and for newly discovered viruses
which can be transmitted by blood or by products obtained from
2191475
9 -
blood and which turn out to be high risk viruses for man.
Preferably, the virus contamination which is not present or does
not exceed a defined limiting value, will be determined for all
known hematogenous viruses, provided that the presence of these
viruses in the drug would represent a danger for the patient.
The limiting value of the permissible contamination by
hematogenous viruses capable of reproduction, which in any case
should not exceed this value, depends primarily on the potential
of the detection reaction and on the resources, which are
suitable for evaluating the starting material and the
intermediate, respectively. The detection limit depends, for
example, on the volume of sample used for the detection
reaction. For example, if no viral genome equivalent can be
detected in a 20 l sample of a single donation and the
detection method used is capable of detecting a single genome
equivalent in the sample, it may be concluded that the maximum
contamination of the individual donation is less than 50 genome
equivalents per ml of plasma. If a negative detection result is
obtained and a further 20 l of sample are tested and again no
viral genome equivalent is detected, it may be concluded that
the maximum load of the single donation is less than 25 genome
equivalents per ml of plasma.
Maximum values of 500 genome equivalents, particularly
maximum values of 200 genome equivalents, preferably maximum
values of 100 genome equivalents and especially maximum values
of 50 genome equivalents per ml of starting material or of
intermediate have proven to be practical limiting values for the
permissible contamination by hematogenous viruses capable of
reproduction.
For a preferred assured starting material or intermediate
according to the invention, a virus inactivation or virus
depletion achieved by at least one method giving a reduction
factor of at least 4 is achieved in the preparation of the drug
from this starting material or intermediate of assured quality.
The plasma protein-containing drug according to the
invention has the advantage that, on the basis of the assured,
limited contamination of the starting material of the plasma
protein by one or more hematogenous viruses capable of
reproduction, a protein-preserving method for inactivating or
2191475
-
depleting the virus is sufficient for obtaining the plasma
protein in a virus-safe form. Preferably, a protein-preserving
method is carried out which has a reduction factor of not more
than 4, in order to inactivate or eliminate any virus load of
possibly present hematogenous viruses capable of reproduction. A
protein-preserving method enables the activity and integrity of
a plasma protein to be maintained to the greatest extent
possible. A method is regarded as protein-preserving, in which
50% or more and preferably 80% or more of the (specific)
activity of the protein to be recovered is maintained. Even a
single virus inactivation or virus depletion in the course of
the manufacturing process for the drug according to the
invention is sufficient for completely inactivating or
eliminating, respectively, any viruses possibly present.
It has been shown that, for a starting material or an
intermediate, respectively, which is used for the preparation of
plasma derivatives or drugs and to which a test virus has been
added, the virus load can be decreased greatly by a virus
depletion, which precedes a virus inactivation step provided for
(for example, EP-A-0 506 651). The depletion can be carried out
by known methods, such as nano filtration, precipitation
reactions, dialysis, centrifugation, chromatographic
purification steps, etc. For inactivating viruses, a series of
physical, chemical or chemical/physical methods are known, which
comprise, for example, a heat treatment, such as that of
EP-A-159 311 or EP-A-0 637 451, a hydrolase treatment according
to EP-A-0 247 998, a radiation treatment or a treatment with
organic solvents and/or tensides, e.g. that of EP-A-0 131 740.
Further suitable virus inactivation steps during the preparation
of plasma fractions and drugs are described in EP-A-0 506 651 or
in WO 94/13329. Different inactivation methods are analyzed in
Eur. J. Epidermal. 3 (1987), 103 - 118; the reduction factor is
dealt with in the ECIII/8 115/89-EN guideline of the EC
Commission.
The inventive measures make possible a pooled starting
material, particularly a plasma pool, or an intermediate,
respectively, of outstanding quality with increased safety.
Preferably, plasma donors are selected for the preparation
of the plasma pool quality-assured according to the invention,
2191475
- 11 -
who have been actively immunized against or are immune to one or
several of the viruses, who thus exhibit a protective immunity,
for example due to an appropriate vaccination. The plasma donors
preferably have been vaccinated against a hepatitis virus,
particularly against the hepatitis A virus, in order to exclude
a corresponding infectious potential of the plasma.
If plasma is the starting material, preferred embodiments of
the quality assurance according to the invention consist in that
- the genome equivalents of all the viruses of the group HIV,
HBV, HCV, parvovirus and HAV are determined,
- the genome equivalents of all the viruses of the group HIV,
HBV, HCV and parvovirus, as well as an excess of HAV antibodies
are determined,
- the genome equivalents of all the viruses of the group HIV,
HBV and HCV, as well as an excess of HAV and parvovirus
antibodies are determined,
- the genome equivalents of all the viruses of the group HIV,
HBV and HCV, as well as an excess of HAV antibodies are
determined,
- the genome equivalents of all the viruses of the group HIV,
HBV and HCV, as well as an excess of parvovirus antibodies are
determined,
- the genome equivalents of all the viruses of the group HIV,
HBV and HCV are determined,
- the genome equivalents of all the viruses of the group HIV
and HCV are determined,
- the genome equivalents of all the viruses of the group HIV
and HCV, as well as an excess of HBV antibodies, are determined.
The quality-assured plasma pool according to the invention
can be obtained, for example, also by selecting plasma donors,
who have been vaccinated against hepatitis A and hepatitis B
viruses and who therefore, because of their anti-infectious
immunity, can have an antibody titer in their blood. These
antibodies have been formed due to active immunization and are
therefore not indicative of viremia. The plasma donations are
examined individually for the absence of markers which indicate
a corresponding viremia. For this purpose, for example, a test
for determining hepatitis C virus antibodies and, optionally,
HIV antibodies is carried out with the help of a validated ELISA
12 2191475
- -
test system. Certain liver values, such as ALT and GPD values,
are also markers for the hepatitis C virus. If the absence of
the viral markers in the donor plasma is confirmed, proof of the
absence of a genome or genome fragment of AIDS viruses (HIV- 1)
and, optionally, hepatitis C virus in a plasma pool of the
individual plasma donations is furnished as a further criterion
for selection. This procedure is recommended in spite of the
confirmation that this plasma donation does not contain any
antibodies against HIV, which are indicative of a viral
infection. The time from infection with an HIV virus until the
possible detection of corresponding antibodies may, especially
for these viruses, be several months. A plasma pool which was
tested merely for the absence of HIV antibodies, can therefore
not be made available as a controlled plasma pool which does not
contain any infectious viruses capable of reproduction or
contains them below a defined limiting value.
One of the measures, according to the invention for assuring
the limited contamination by hematogenous viruses capable of
reproduction comprises, aside from the quantifiable, controlled
and non-inhibited method of detecting or determining nucleic
acids, is detection of virus-neutralizing antibodies in the
plasma pool according to the invention. Validated test systems,
such as, e.g., appropriate enzyme immune tests, are also to be
used for determining the antibody titer. The samples used for
the method can optionally be lyophilized and subsequently
reconstituted.
Besides plasma pools, cryo precipitates or other early
intermediates are considered as starting materials for this
invention. Early intermediates are those which are obtained from
human plasma in the production of drugs, which will still be
subjected to virus depletion or virus inactivation. What has
been stated here in connection with the plasma pool,
particularly the possibility of combining like-wise assured,
smaller amounts into larger ones, also applies - as far as
possible - according to the invention to other starting
materials. Therefore the mixing of quality-assured starting
materials or intermediates, respectively, of the same kind into
a larger pool of quality-assured starting materials or
intermediates, respectively, is provided for according to the
2191475
13 -
invention.
Such high quality criteria for a starting material or an
intermediate, respectively, have not yet been met. On the one
hand, it has not been considered to be necessary to exclude
completely a viremia caused by a plasma pool contaminated with a
virus. Plasma pools are used primarily for the preparation of
plasma derivatives, that is, of pharmaceutical products on the
basis of plasma proteins. In this preparation, however, an
additional measure for inactivating and/or depleting viruses
potentially present must be carried out, which reduces the risk
of transmission of pathogenic viruses by the finished products
by a multiple, so that the usual assays prescribed according to
the state of the art are regarded as adequate.
According to the invention, only those starting materials or
intermediates, respectively, which exhibit an excess of virus-
neutralizing antibodies or an assured, limited load of viral
genome sequences are used for the further working up of the
product. Starting material which does not satisfy the
requirements according to the invention, and it is unsuitable
for further processing into drugs within the scope of the
present invention, can nevertheless not be described
demonstrably as infectious, since the amount of genome
equivalents, determined with a nucleic acid amplification
method, only gives the upper limit for the contamination by the
viruses capable of reproduction. The amount of genome
equivalents determined therefore gives the "true value" of the
load of viruses capable of reproduction only when all genome
equivalents originate from active viruses.
From several, starting materials assured according to the
invention, a larger amount may be obtained by mixing, which then
complies with the same safety criteria.
In the case of a plasma pool, the latter may be provided as
a small pool which is composed of about 2 to about 20 individual
plasma donations. At least 10 small pools can be combined into a
minipool of about 20 to 200 and preferably about 200 individual
plasma donations. The next order of magnitude is a macropool of
about 200 to 2,000 and preferably of about 2,000 individual
plasma donations, which optionally is prepared by mixing at
least 10 minipools. Several macropools can be combined into a
2191475
- 14 -
multimacropool of up to 200,000 individual donations.
According to the invention, the evidence for viral genomes
or genome fragments can be furnished for each of these pool
sizes. By testing the small pools and the subsequent combination
of the checked small pools into a larger pool, for example, a
minipool, a quality never described before is obtained even by a
larger pool.
A special embodiment of the invention therefore consists in
a plasma pool obtained by mixing minipools, which preferably
consist of about 200 individual donations, to a macropool, which
preferably consists of about 2,000 individual donations.
A further preferred embodiment consists of a plasma pool,
which is characterized in that a macropool is combined by mixing
with any desired number of other macropools to a multimacropool
of up to 200,000 individual donations.
Yet another preferred embodiment consists in a plasma pool,
the minipools of which are obtained by mixing small pools
consisting of two to about 20 individual donations.
In selecting a starting material for the fractionation of
blood plasma for preparing plasma fractions or finished plasma
derivatives, respectively, and drugs, a relatively large amount
is to be preferred for reasons of economy. Until now, however, a
plasma pool of the magnitude of a macropool or of a
multimacropool, which could be regarded as not contaminated by
viruses due to the detection of viral genomes or genome
fragments, has not been available. It is not sufficient to
furnish proof only for a multimacropool, since too great a
dilution effect arises from the mixing together of more than
2,000 individual plasma donations, and the number of genomes to
be detected very frequently is smaller than the limit of
detection of a test method. By the testing of small sub-units
and the subsequent combining into larger units, this problem of
detectability is overcome and an economically interesting amount
is obtained.
The quality-assured starting material according to the
invention is outstandingly suitable for the preparation of
fractions containing plasma proteins as intermediates or for the
preparation of finished drugs.
The measures provided for the starting material,
2191475
15 -
particularly for the plasma pools, can of course be used
analogously for plasma fractions of all types. According to a
further aspect, therefore, the present invention also relates to
quality-assured, finished plasma derivatives, the contamination
of which by reproducible hematogenous viruses is safely limited
through the use of quality-assured starting material.
Moreover, the present invention of course also relates to
finished plasma derivatives obtained according to a preparation
method from a starting material quality-assured according to the
invention, or from one or several intermediates whose quality is
assured according to the invention.
The drugs produced from the finished plasma derivatives
prepared according to the invention by pharmaceutical
formulation are also included in the present invention.
Moreover, the present invention relates to a method for the
preparation of a drug containing one or more plasma derivatives
from a quality-assured starting material or from a quality-
assured intermediate obtained during the preparation of the
plasma derivatives, the quality-assured starting material or
intermediate not being contaminated by one or more hematogenous
viruses capable of reproduction or being contaminated by an
amount which does not exceed a defined limiting value, and the
defined limiting value being selected in the case of the
determination of the genome equivalent of the respective virus
by a quantifiable, controlled and not inhibited method for the
detection or determination of nucleic acids according to one or
more of the following criteria:
- a detection limit of the nucleic acid amplification
method(s) of at least 10,000 copies of selected nucleic acid
sequences;
- a certain number of genome equivalents, particularly a
number of below 500 genome equivalents, preferably below 200
genome equivalents, more preferably below 100 genome equivalents
and especially preferably below 50 genome equivalents per ml of
starting material or intermediate.
According to the invention, other permissible selection
criteria with respect to the limiting values are:
- a limiting value determined by means of a cell culture test,
preferably a TCID50 per ml or the genome equivalent contained in
2191475
- 16 -
this amount, respectively,
- a limiting value determined by means of an animal model,
preferably a CID50 per ml, or the genome equivalent contained in
this amount, respectively.
These limiting values are preferred because of their
practical relevance (dependent on the detection potential of an
examining method) and their biological relevance (particularly
the TCID and CID values).
The highly sensitive PCR method has the disadvantage that
even very slight amounts of certain impurities which can get
into the test material, will also be amplified, which may give
rise to falsely positive results.
A preferred embodiment of the method according to the
invention is characterized by the use of more than one system of
detection or when determination is used for nucleic acids, the
systems of detection or determination preferably being selected
such that the one system excludes falsely positive results and
an other system, excludes falsely negative results.
Preferably, at least two different PCR methods are used, at
least one method being used for screening and at least one
method used for confirmation.
In the case of the DTS-PCR (Dual Targeting Southern Blot
PCR), the amplification of the extracted nucleic acids is
followed by a separation of the synthesized nucleic acids by
agarose gel electrophoresis and subsequent Southern Blot after
hybridization with a digoxigenin (DIG)-labeled probe. The
evaluation is carried out by way of a densitometric
determination of the band intensity. To exclude falsely negative
results, which can be caused by a mis-priming between PCR
primers and template because of a sequence heterogeneity, the
nucleic acid extracts are amplified and analyzed once more in a
second PCR with further primers, which differ from the first
pair of primers. The DTS-PCR is checked by the addition of a
synthetic nucleic acid as internal standard and falsely negative
results are excluded.
In order to additionally verify the results obtained, for
example, in the DTS-PCR, the LIF-PCR (laser-induced fluorescence
PCR) is preferably used as the further method.
By using non-radioactively-labeled primers (preferably,
2191475
17 -
primers labeled with a fluorescent dye), the PCR products can be
detected by LIF-PCR. The detection of the amplification products
can, however, also be simplified by the incorporation of non-
radioactively-labeled nucleotide analogs during the elongation
reaction into the newly synthesized nucleic acids. In LIF-PCR,
the nucleic acid is amplified in the presence of fluorescence-
labeled primers and the amplification products are subsequently
separated by PAGE. For each sample of the LIF-PCR, additional
negative and positive controls are carried out. The detection
and quantification of the PCR products is accomplished by means
of a gene scanner. In particular, falsely negative results are
excluded and positive results are confirmed by the internal
double standardization of the LIF-PCR.
According to the invention, falsely positive or falsely
negative results can be excluded through the use of positive and
negative controls. The described combination of two different
PCR methods, particularly of the DTS-PCR and the laser-induced
fluorescence-PCR (LIF-PCR) enables large numbers of samples to
be tested in routine controls, and thus primarily falsely
negative results can be excluded and falsely positive results
can be avoided.
An additional aspect of the invention resides in
concentrating the test samples, whereby even lower loads of
viral genome sequences can be detected. The sensitivity of the
method according to the invention can be increased by additional
measures, by concentrating the plasma samples or the genome
equivalents contained therein, a ten-fold to one hundred-fold
increase in the sensitivity being preferred.
Thus, in a preferred embodiment of the method according to
the invention, the samples from the starting materials (e.g.,
individual donations or sample pools) or the intermediate or the
genome equivalents contained therein are concentrated,
preferably by lyophilization, adsorption or centrifugation.
According to the invention a method is used which allows for
a quantifiable, controlled and non-inhibited procedure for
detecting or determining genome sequences. However, when
determining the limited load of viruses capable of reproduction
in the plasma pool by detection of viral genomes or genome
sequences, it may happen that certain inhibitors of the
2191475
- 18 -
detection method are present in the samples, so that a non-
inhibited amplification is not possible right away.
It has been proven that the virus contamination of a plasma
pool, determined by a PCR method, may be underestimated. Factors
may be present in the plasma pool which can affect the
sensitivity of a PCR determination method appreciably (Nucleic
Acids Research 16 (21), 10355 (1988)). These so-called
inhibitors of the PCR reaction are removed by the method
according to the invention before the detection reaction or are
excluded during the detection reaction by the use of a genome
standard. The presence of such inhibitors is excluded if the
internal standard is amplifiable and detectable at the
appropriate rate in the pool.
It is well known that substances occurring in the plasma,
such as heparin, high salt concentrations and polyethylene
glycol, can inhibit the PCR reaction (BioTechniques 9(2), 166
(1990) and Journal of Clinical microbiology 29(4) 676 - 679
(1991)).
Thus, a preferred embodiment of the method according to the
invention is characterized in that inhibitors of the
amplification possibly present are removed from or depleted in
the samples of the individual donations or in the sample pools.
These additional methods for removing or neutralizing
amplification inhibitors in the blood, plasma or serum,
comprise, for example, ultracentrifugation of the samples and
decanting the supernatant with inhibitors contained therein and
the extraction of the nucleic acid, as well as the treatment of
the samples with heparinase, polyamines or the pre-purification
of the nucleic acids by means of HPLC. Unrestricted
amplification of the nucleic acid is ensured by the higher
purity of the nucleic acids.
According to a preferred variant of the method, primer
pairs, specific for several viruses, are used in the
amplification test, so that the presence of several types of
viruses can be assayed simultaneously. In a particularly
preferred test, two or more viruses, selected from the group of
HIV, HAV, HBV and HCV are assayed.
In particular, RNA viruses are subject to a high mutation
rate, as a result of which variants or subtypes of a known
2191475
19 -
strain may occur very rapidly, whose genome sequence differs
more or less from that of the wild type sequences. However, for
a sensitive amplification method, such as, e.g., PCR, a
particularly high efficiency of the amplification is a
prerequisite for the detection and quantitative determination of
a very small copy number of a viral genome sequence, in order to
determine the copies actually present in a sample. Insufficient
annealing of the primers with the template decreases their
efficiency. Appropriate care in selecting the primers must
therefore be ensured.
Preferred primer pairs are selected such that they encode
conserved genome sequences of the individual hematogenous
viruses to be assayed, the suitability of the primers being
established on appropriate samples of a representative sample
cross section of the viruses to be investigated.
Besides the previously identified, known genome sequences of
HIV, HCV and HBV, their sub-types can also be detected by
selecting the primers for the amplification reaction. According
to the invention, this is accomplished in that the primers used
are selected from a highly conserved genome region of the
respective virus. Thus, only primers whose specificity for all
relevant sub-types has been confirmed will be used for the
selection of the inventive starting material or intermediate by
means of LIF-PCR and DTS-PCR.
Within the scope of epidemiological monitoring, newly
occurring viral strains of the target viruses are assayed to see
whether they contain the corresponding templates, against which
the primers used are directed. On the basis of changes found
within a known group of viral strains, it will then be possible
to synthesize appropriate new primers for the quantitative
detection of existing copies of a new viral strain. Therein, the
sensitivity of the assay with the newly synthesized primers
should be at least equal to that of the primers already tested.
Appropriate, new primers for conserved nucleic acid
sequences must be developed for newly occurring target viruses.
To check the method of detecting or determining nucleic
acids in a sample, one or several internal standards or
reference preparations are added to a sample, preferably before
or while the method is carried out, the standards being
2191475
- 20 -
determined or detected simultaneously with any viral genomes or
genome sequences which may be present, in one and the same
assaying vessel.
This procedure offers the possibility of an even more exact
quantitation of the content of viral nucleic acids or even
better estimation of the detection limit of the amplification
method, particularly if the internal standard(s) is (are) used
in an amount close to the detection limit of the respective
amplification reaction.
The individual donations, combined according to the
invention into a quality-assured plasma pool, can be combined
with further, like-wise quality-assured plasma pools, so that a
quality-assured minipool, macropool or multimacropool is
provided. The advantages of a larger pool, prepared from
quality-assured smaller pools, have already been sufficiently
described.
According to a further aspect, the present invention relates
to a method of preparing a plasma pool as a quality-assured
starting material with an assured, limited contamination by
viruses capable of reproduction, from two or more individual
donations, which is characterized by the following steps:
- taking samples from n individual donations,
- combining the individual donation samples to m sample pools
and
- detecting the amount of viral genomes or genome sequences
present in this sample pool by means of a quantifiable,
controlled and non-inhibited method for the detection or
determination of nucleic acids,
whereupon those individual donations (ng), whose detected
amount of viral genomes or genome sequences in the sample pool
lies below a certain limiting value, are combined into a
quality-assured plasma pool, and those individual donations
(na), whose detected amount of viral genomes or genome sequences
in the sample pool is larger than or equal to the limiting
value, are subjected to further treatment or are eliminated, n
and m being positive integers. A further treatment of the
individual donations can be carried out, for example, by
depleting viral genome equivalents or by admixing virus-
neutralizing, antibody-containing fractions.
2191475
- 21 -
In a further method step, also for the further treatment of
the eliminated na individual donations, samples may again be
taken, and these individual donation samples may be combined to
ma sample pools, na and ma being positive integers with ma- 2
and the ratio of ma:na being larger than the ratio of m:n. The
amount of viral genomes or genome sequences in this sample pool
may again be detected by means of a quantifiable, controlled and
non-inhibited method for the detection or determination of
nucleic acids, whereupon those individual donations, whose
detected amount of viral genomes or genome sequences in the
sample pool lies below a certain limiting value, are combined
into a quality-assured plasma pool and those individual
donations, whose detected amount of viral genomes or genome
sequences is equal to or larger than the limiting value, are
subjected to a further treatment or are eliminated. This method
can be repeated until the number of individual donations which
are to be further treated or eliminated has reached, or fallen
below, a fixed number.
By these means, a simple method is provided to permit any
potential individual plasma donation with an impermissibly high
load of viruses capable of reproduction to be eliminated with a
few tests from an almost infinitely large plasma pool. On the
other hand, suitable individual donations, which have been
eliminated by the methods used until now, together with a virus-
contaminated individual donation, if analyzed jointly, are
recognized by simple method steps and can be processed to a
finished plasma derivative.
Thus, a further objective of the invention can be reached,
i.e. to discover a single infected donor even in a large plasma
pool in a simple and cost-saving manner in order to exclude him
from further donations and to pass him on immediately to medical
help. With that, the safety of the donor colony is increased.
The number of individual donations comprised by the plasma
pool subjected to the method of the invention, usually amounts
to 2 to 200,000 (n = 2 to 200,000) and preferably to 20 to
20,000, more preferably to 200 to 2,000, and especially to 200.
The number m lies above all between 1 and 100,000, and
preferably between 2 and 1,000. The number fixed for the
individual donations that are to be treated further or
2191475
- 22 -
eliminated practically amounts to 100, preferably to 10 and
particularly preferably to 1. Thus, in the last case, the virus-
contaminated individual donation is identified as such. In
practice, however, this is indicated only for reasons of
identifying the plasma donor; the number is therefore usually
fixed between 10 and 100.
If necessary, the sample pools can be assayed for virus-
neutralizing antibodies to the viruses to be assayed in addition
to the detection or determination of nucleic acids.
As a rule, with those sample pools, in which antibodies to
viruses have been found, the respective individual donations are
combined and used further: Those individual donations, from
which no antibodies have been detected in the sample pool, are
then passed on to further treatment or eliminated.
Moreover, the present invention relates to the quality-
assured starting material or intermediate, in particular the
plasma pool, prepared within the scope of the method according
to the invention, as well as to the quality-assured finished
plasma derivative, which preferably has been assayed once more
for viral genome equivalents or for the presence of virus-
neutralizing antibodies, respectively.
The present invention also comprises a drug obtainable from
a quality-assured, finished plasma derivative from human plasma
by pharmaceutical formulation steps.
According to a further aspect, the present invention relates
to a method for the preparation of drugs containing one or more
plasma derivatives, which are free of various hematogenous
viruses capable of reproduction, which method is characterized
by the following method steps:
- providing a starting material or an intermediate incurred
during the preparation of the plasma derivatives and derived
from human plasma,
- assuring the quality of the starting material or
intermediate by demonstrating the absence of viral contamination
by hematogenous viruses capable of reproduction or by
determining that such contamination is present in an amount
which does not exceed a particular limiting value,
- the absence of contamination by certain hematogenous
viruses capable of reproduction being detected by an excess
2191475
- 23 -
of virus-neutralizing antibodies in the starting material or
intermediate, respectively, or by a protective immunity of
the plasma donor at the time of the plasma donation,
- otherwise the genome equivalents of the respective
viruses of interest being determined in the starting
material or in the intermediate, respectively,
- subjecting the thus quality-assured starting material or
intermediate, respectively, to at least one further substantial
virus depletion or virus inactivation step before the finishing
of the plasma derivatives and
- working up the quality-assured, finished plasma derivative
thus obtained by methods known per se into a drug.
In a preferred method for preparing drugs from human plasma,
a quality-assurance step is employed for at least one
intermediate in the course of the production process.
According to a preferred embodiment, the quality assurance
step is carried out on the intermediate, which is subjected to a
substantial virus depletion or virus inactivation step. Most
preferred is the quality assurance of each intermediate, which
is to be subjected to a susbtantial virus depletion or virus
inactivation step.
The invention will be described by the following examples,
to which it shall not be limited.
Examples:
1. General Principle of PCR
1.1 General Principle of the DTS-PCR (Dual Targeting
Southern Blot)
Nucleic acids are amplified with PCR by means of a first
specific primer pair, the PCR products are subsequently
separated electrophoretically on an agarose gel and blotted on a
filter. The filter-bound PCR products are hybridized with a
digoxigenin (DIG)labeled probe, which binds within the amplified
genome sequence, and detected after a development reaction. The
band intensity is determined quantitatively by means of a
densitometer. In a further PCR using a second primer pair
differing from the first primer, the nucleic acid is amplified
and also detected by Southern blot analysis. Due to the PCR of
two different regions of a genome sequence and their
visualization by means of hybridization, falsely negative
2191475
24 -
results can be reduced and positive results can be verified.
1.2. General Principle of LIF-PCR (Laser-Induced
Fluorescence Labeled)
Nucleic acids of various origins were amplified by means of
PCR using primers which have fluorescent groups. The analysis
and quantitation of the amplified products obtained was carried
out with the help of an automatic DNA sequencer with laser-
induced fluorescence measuring equipment (DNA Sequencer 373A
with Gene Scan software from Applied Biosystems). This
instrument is able to separate the fluorescence-labeled PCR
products according to size by means of gel electrophoresis in a
polyacrylamide gel under denaturing conditions and to determine
their amount quantitatively. The copy number of certain
sequences in the sample is determined on the basis of the
intensities obtained for PCR products of nucleic acids, which
are to be quantified, and of at least two internal standards.
1.2.1. Extraction of the DNA of Viral Particles
500 l of the sample were centrifuged for 20 minutes at
70,000 rpm in an ultracentrifuge. The pellet is dissolved in 500
l of 10 mM Tris/HC1, pH 8.0, and 10 l of proteinase K
(Boehringer Mannheim, 20 mg/ml) as well as 10 l of 20% SDS.
After an overnight incubation at 37 C or a 4-hour incubation at
56 C, a known amount of standard nucleic acid is added, after
which the sample is successively extracted with phenol and
chloroform, and 10 l of glycogen (Boehringer Mannheim, 20
mg/ml) are added. Subsequently, the product is precipitated with
ethanol, centrifuged, and the pellet is washed and finally re-
dissolved in water.
1.2.2. Extraction of Residual Viral DNA
500 p,l of the sample are dissolved in 5 l of 10 mM
Tris/HC1, pH 8.0, and 10 l of proteinase K (20 mg/ml). After an
overnight incubation at 37 C or an incubation for 4 hours at
56 C, a known amount of standard nucleic acid is added, the
sample is successively extracted with phenol and chloroform, and
i1 of glycogen (20 mg/ml) are added. Subsequently, the
product is precipitated with ethanol, centrifuged, and the
pellet is washed and finally re-dissolved in water.
1.2.3. Extraction of the RNA for the PCR
1 ml of plasma or plasma diluted with PBS is centrifuged for
CA 02191475 2008-06-04
24242-531
- 25 -
20 minutes at 70,000 rpm. The supernatant was removed by
suction. The pellet was taken up in 1 ml of guanidium
isothiocyanate solution (RNAzol of Biotex) and 5 Rl of 1 mg/ml
of tRNA from yeast and a predetermined amount, such as 20 l, of
standard RNA were added. A specified number, such as 400 and
1,200 copies, of the minus RNA standard and the plus RNA
standard are added and vortexed. The solution is heated for 10
minutes at 70 C, after which 1/10 volume of chloroform is added
and the mixture incubated on ice for 10 minutes. This is
followed by 5 minutes of centrifuging in a table-top centrifuge,
and the supernatant is transferred to new tubes. 500 l of
isopropanol are added, and the temperature is maintained at -
80 C for 15 minutes. This is followed by 10 minutes of
centrifuging, washing twice with 70% ethanol, and the pellet is
taken up in 50 l of water. For the RT-PCR, 5 Rl were used.
1.2.4. PCR for the Detection of DNA
The PCR formulation contains in a known manner an aliquot of
the extracted nucleic acid, PCR buffer (Boehringer Mannheim),
MgC12, dNTPs, primer, Taq*polymerase (Boehringer Mannheim, 5.0
units/ l) and water. The PCR is carried out according to the
instructions of the manufacturer of the buffer and the enzyme,
and according to conventional procedures, respectively (Mullis
et al., Methods in Enzymology 155: 335, 1987)_
1.2.5. RT-PCR for the Detection of HIV RNA
The RT-PCR formulation contains, in the usual manner, an
aliquot of the extracted nucleic acid in RT buffer from Perkin-
Elmer, MgC12, dNTPs, the RT primer and rT.th. polymerase
(Perkin-Elmer, 2.5 units/ l) and water. The RT is carried out
according to the instructions of the manufacturer of the buffer
and the enzyme, and according to conventional procedures,
respectively (Mullis et al., Methods in Enzymology 155: 335,
1987) in a PCR apparatus (GeneAmp PCR System 9600 of Perkin-
Elmer).
For the PCR, MgC12, a chelate buffer and the second primer
are further added. The PCR is then carried out as described
above.
1.2.6 Analysis of the Products
For determination and quantification of the PCR products,
0.5 to 1.0 Rl are taken from the PCR solution and analyzed in an
*Trade-mark
CA 02191475 2008-06-04
24242-531
- 26 -
Applied Biosystems 373 A instrument in accordance with the
instructions of the manufacturer.
1.3. Southern Blotting and Detection of the DTS-PCR
Products
Agarose gels were prepared for the gel electrophoretic
separation of the PCR products at a concentration intended for
the respective product. The gel run was carried out in lx
running buffer for electrophoresis. The PCR product samples were
mixed with Ficoll*/bromophenol blue in 0.5 x running buffer and
the prepared gel slots were charged. After the gel run, the PCR
products were denatured by incubation of the gel in 0.5 M
NaOH/1.5 M NaCl for 1 hour and subsequently neutralized. The DNA
was transferred to the filter (DuralonTM, Stratagene, La Jolla,
California), and the nucleic acid was bound to the membrane by
UV cross linking. The membrane was incubated for 1 hour at 68 C
in pre-hybridization buffer (6 x SSC, 0.5% SDS, 5 x Denhardt's,
100 Rg/ml of denatured DNA). The hybridization took place with a
dioxigenin-labeled DNA probe and subsequent visualization of the
bands by immune staining was achieved by means of alkaline
phosphatase-conjugated antibody, nitro blue tetrazolium (NBT)
and 5-bromo-l-chloro-3-indole phosphate (BCIP)_ The blots were
evaluated by densitometry.
1.4. Primers Used
The primers used for the LIF-PCR are summarized in Tables
1.1_ and 1.2.
The primers used for DTS-PCR, are SK38, SK39, SK145 and
SK431 (Ratner et al., 1985) for HIV; 32, R3, CHAA, Rl, ConAl,
ConaA2 and ConA (obtainable from Chiron) for HCV; and HBVla and
HBVlb (Kaneko et al., 1989), as well as HBV4a and HBV4b (Carman
et al., 1989) for HBV.
*Trade-mark
2191475
27 -
Table 1: Primers and Standard Plasmids Used for LIF-PCR and
DTS-PCR Table 1
Table 1.1: Primers for the Amplification and Detection in
LIF-PCR
----------------
Name of Oligo-
nucleotide
Orientation Sequence(5'-3') Virus Position
SK38(+) ATAATCCACCTATCCCAGTAGGAGAAAT HIV-1 1551-1568b
SK39(-) TTTGGTCCTTGTCTTATGTCCAGAATGC HIV-1 1665-1638b
HCV32 CTGTGAGGAACTACTGTCTT HCV 45-64C
HCVPT4 CGGTTCCGCAGACCACCTATG HCV 158-139c
+1780B CATTGATCCTTATAAAGAATTTGGAGC HBV 1780-1806d
-1950B CCAGCAGAGAATTGCTTGCCTGAG HBV 1973-1950
b numbering according to Ratner et al. (Nature 313: 277-284,
1985)
C numbering according to Han et al. (PNAS 88:1711-1715, 1991)
d numbering according to Fujiyama et al. (Nucleic Acids Res.
11:4601-4610,1983)
Table 1.2.: Standard Plasmids for LIF-PCR
Name Deletion/Insertion Virus
pgagl HIV-1
pgag-15 del. 1593-1607b HIV-1
pgag+12 ins.+l2bp Pos. 1593b HIV-1
pHCV-wt HCV
pHCV -7bp del. 126-1350 HCV
pHCV +8bp ins. +8bp Pos. 126c HCV
pHBV -wt HBV
pHBV -9bp del. 1868-1876d HBV
,pHBV +12b ins.+l2Pos.1868d HBV
b numbering according to Ratner et al. (Nature 313: 277-284,
1985)
C numbering according to Han et al. (PNAS 88:1711-1715,1991)
d numbering according to Fujiyama et al. (Nucleic Acids Res. 11:
4601-4610, 1983)
2191475
- 28 -
Example 2:
2.1. Quantitating HIV RNA in Plasma Samples from Donors by
LIF-PCR and DTS-PCR
A plasma donation was taken from HIV seronegative, healthy
test subjects and HIV seronegative p24 antigen-positive primary
infected test subjects. Plasma samples of the donors were tested
by means of LIF-PCR and DTS-PCR. Sample testing by means of DTS-
PCR was carried out with the primer pairs SK145/431 (primer pair
1) and SK38/39 (primer pair 2) (Table 1.1); samples with
positive hybridization signals were further tested by means of
LIF-PCR. For quantitation by means of LIF-PCR, the primers SK38
and SK39 (Table 1.1.) were used which bind in the cDNA sequences
of HIV-1 and give a 115 bp PCR product by means of RT-PCR of the
wild type RNA. The standard plasmids, pgagl, pgag-15 and pgag+12
(Table 1.2.) were used, resulting in 115 bp (pgagl), 100 bp
(pgag-15) and 127 bp (pgag+12) RT-PCR products. The standard
plasmids were coamplified and coanalyzed on the Gene Scans and
the copy-number/ml determined. The results of the quantitative
evaluation are summarized in Table 2.
Table 2
Test Subjects LIF-PCR DTS-PCR
Copies/ml PCR/Primer PCR/Primer
pair 1 pair 2
Hybridization Hybridization
Signal Signal
HIV-sero-/ 24 positive #1 3.4x105 + +
HIV-sero-/p24 positive #2 2.8x105 + +
HIV-sero-/p24 positive #3 2.7x106 + +
HIV-sero-/p24 positive #4 1.7x107 + +
HIV-sero-/p24 positive #5 5.5x105 + +
HIV-sero-/p24 positive #6 8.6x106 + +
HIV-sero-/p24 positive #7 2.3x107 + +
HIV-sero-/p24 positive #8 4.7x105 + +
With HIV seronegative, p24-antigen-positive plasma donors,
the minimum contamination was determined to be 2.8 x 105 and the
maximum 2.3 x 107 copies/ml.
29 - 2191475
-
2.2. Quantitation of HCV RNA in Plasma Samples from Donors
by LIF-PCR and DTS-PCR
A plasma donation was taken from HCV-seronegative, healthy
test subjects and from HCV primary infected test subjects.
Plasma samples from the donors were tested by means of LIF-PCR
and DTS-PCR. The DTS-PCR testing of the samples was carried out
with the primer pairs 32/R3 (primer pair 1) and CHAA/R1 (primer
pair 2) (Chiron); samples with positive hybridization signals
were further tested by means of LIF-PCR. For quantitation by
LIF-PCR, the primers HCV32 and HCVPT4 (Table 1.1.) were used,
which bind in the cDNA sequences of HCV and provide a 114 bp
product derived from the wild type RNA by RT-PCR. As the
standard plasmids, pHCVwt, pHCV-7 and pHCV+8 (Table 1.2.) were
used, which result in RT-PCR products 114 bp (pHCVwt), 107 bp
(pHCV-7) and 122 bp (pHCV+8) in length. The standard plasmids
were coamplified with the sample and coanalyzed on the Gene
Scans and the number of copies/ml was determined. The results of
the quantitative determination are summarized in Table 3.
Table 3
Test Subjects LIF-PCR DTS-PCR
Copies/ml PCR/Primer PCR/Primer
Pair 1 Pair 2
Hybridization Hybridization
Signal Signal
HCV-sero-/#l 1.3x105 + +
HCV-sero-/#2 3.8x105 + +
HCV-sero-/#3 1.6x106 + - +
HCV-sero-/#4 2.2x104 + +
HCV-sero-/#5 8.2x104 + +
HCV-sero-/#6 6.2x105 + +
HCV-sero-/#7 9.4x104 + +
HCV-sero+/##8 2.3x102 + +
With HCV-seronegative, primary infected plasma donors, the
minimum contamination was determined to be 2.2 x 104 copies/ml
and the maximum contamination 1.6 x 106 copies/ml.
2191475
- 30 -
2.3. Quantitation of HBV DNA in Plasma Samples from Donors
by LIF- PCR and DTS-PCR
A plasma donation was taken from HBV seronegative, healthy
test subjects and primary infected, HBsAg positive, anti-HBsAg
seronegative and HBsAg positive, antiHBsAg seropositive test
subjects. Plasma samples of the donors were assayed by means of
LIF-PCR and DTS-PCR. The sample testing by means of DTS-PCR was
carried out with the primer pairs HBVla/HBVlb (primer pair 1)
and HBV4a/HBV4b (primer pair 2) (Carman et al. 1989); samples
with positive hybridization signals were further tested by means
of LIF-PCR. For quantitation by LIF-PCR, the primers HBV+1780B
and HBV-1950B (Table 1.1) were used, which bind in the cDNA
sequences of the HBV genome and provide a 182 bp PCR product
derived from the wild type RNA by RT-PCR. The standard plasmids,
pHBVwt, pHBV-9 and pHBV+12 (Table 1.2.) were used, which provide
182 bp (pHBVwt), 173 bp (pHBV-9) and 194 bp (pHCV+12) RT-PCR
products. The standard plasmids were co-amplified with the
sample and coanalyzed on the Gene Scan , and the copy-number/ml
was determined. The results of the quantitative evaluation are
summarized in Table 4.
Table 4
Test Subjects LIF-PCR DTS-PCR
opies/ml PCR/Primer PCR/Primer
Pair 1 Pair 2
Hybridization Hybridization
Signal Signal
HBV-sero-/HBsAg positive #1 1.4x105 + +
HBV-sero-/HBsAg positive #2 2.8x105 + +
HBV-sero-/HBsA positive #3 3.5x105 + +
HBV-sero-/HBsAg positive #4 1.3x108 + +
HBV-sero-/HBsAg positive #5 1.9x105 + +
HBV-sero-/HBsA positive #6 2.3x106 + +
HBV-sero+/HBsAg positive #7 5.6x104 + +
With HBV-seronegative, primary infected plasma donors, the
minimum contamination was determined to be 1.4 x 105 copies per
ml, and the maximum contamination 1.3 x 106 copies per ml,
respectively.
2191475
31 -
Example 3:
3.1. Assaying Plasma Pools of Different Sizes for HIV-1 RNA
Plasma samples from 10, 50, 100, 500 1,000 and 2,000 HIV
seronegative, p24 antigen-negative, healthy individual donors
were mixed into a sample pool. Each individual pool size was
mixed with one plasma sample from a donor with a primary HIV
infection with a high virus load of 2.3 x 107 copies/ml (sample
1) determined as in Example 1, with one plasma sample from a
donor with a primary HIV infection with a minimum contamination
of 2.8 x 105 copies/ml (sample 2) determined as in Example 1,
and, as the controls, with a defined preparation of HIV RNA with
1 x 104 copies/ml (sample 3), and 1 x 103 copies/ml (sample 4).
The quantifiable, viral copy number/ml for the respective pool
size was determined by means of LIF-PCR. The results of the PCR
evaluation are summarized in Table 5.1.
Result:
Table 5.1. shows that a viral contamination with a primary
infected anti-HIV seronegative, p24 antigen-positive individual
donation having a high load (2.3 x 107 copies/ml) as well as one
having a minimum contamination (3.8 x 105 copies/ml) can be
detected by means of PCR in a plasma pool of 10, 50, 100 and 500
individual donations. A donation, highly contaminated with HIV-
RNA could also be detected in a plasma pool from 1,000 and 2,000
individual donors; on the other hand, a donation with a minimum
contamination could no longer be detected in pools of this size.
A HIV-RNA load caused by a contamination with 1 x 104 copies/ml
in the individual donation could be detected in pools of up to
individual donations. In none of the pool sizes tested, was
it possible to detect viral genome sequences at a contamination
level of 1 x 103 copies per ml in the individual donation.
32 2191475
- -
0
a
E ~b - ' x
0 0 00
clUo~ c d
C
cis
a C:) 0 = .O x
0 0 0 r- 10 -d -d
N
N 0
a 0 E
E o 0 0
0 0 00 It
-d -d
0
o 0 =~I
a
ca -v w N - o
E > o 2 x x
o 'v 0 r. CL
0 rn r -d -d
UU a^~AU^ c'i d d
0
Gov 0 0 x
a.tnSAU~
a 0
C', 10
c N .b N o 2
E > o
.2 x x 2
r- CL
o`v 0 00 .o x -d
U N N
c~
a
^ .-. O N O M
C) CD
D M 00 x x
cd cd RS
F- Cn C/)
2191475
33 -
3.2. Increasing the Sensitivity by Concentrating the Samples
In order to increase the detection sensitivity in pool
sizes, in which HIV-RNA copies could not be detected, 10-fold
concentrated samples of the pooled plasmas were used for the
PCR. For this purpose, the 10-fold volume of the sample volume
in each case of samples 2, 3 and 4 of the individual plasma
pools, used in Example 3.1., was concentrated by centrifugation,
resuspended in a buffer with 1/10 of the initial volume and used
for the PCR. The results of the PCR evaluation are summarized in
Table 5.2.
By 10-fold concentrating the initial sample volume for the
PCR, it was possible to detect the minimum contamination of a
pool from 2,000 individual donors with one primary HIV-infected
donation (2.8 x 105 copies/ml). Likewise, it was possible to
increase the sensitivity of the detection in plasma pools from
50 and 100 individual donors with a viral contamination of 1 x
104 copies/ml in a single donation. A viral contamination with 1
x 103 copies/ml in a single donation could be detected only in
the smallest pool size from 10 individual donors.
In order to improve the detection of viral genomes in the
next higher pool size, the 100-fold of the initial volumes of
samples 3 and 4, used in Example 3.1., was concentrated in a
further experiment, resuspended in a buffer with 1/100 of the
initial volume and used for the PCR. The results of the PCR
evaluation are summarized in Table 5.3.
By concentrating the plasma sample 100-fold, a viral HIV-
genome contamination of 1 x 104 copies/ml in a single donation
could still be detected in a plasma pool from 500, 1,000 and
2,000 individual donors.
2191475
34 -
w
o
co
C CL
o It -d =c
o oo o
=~ c-,AV.-~ a c
a C)
4) U
o O
0
0 o U
V a -d
cc "10 S.
Fo 8 0 o x o
o o o O ~ -o -d o
A U c~i d d
al
N O
O N
ca r
E o= ' x c
o -: d o O r. L
en -c -d I
A A
4.4
0 0
!' o ti
a 0
0
-a
., ,0 En o o w Cd
o .- - E o .4?
0 0 0 rn =v t~4 "" a x
SAU ~ c
w .~AU~i 00 d V~ a, :c-i
a
o 0 0 0
cn O a C r-I
cd ^p `_ cn O O co co a b 4N c o
E > 0 2 X E > o =~ x
>, cd o =t7 0 O v1 00 "C7 >- co . 'b 0 O It
=O
-o v,SUW, a rs.:,-,~AUrn c
> 0
ao, N- o N- C)
C6 - .2 t- En
E >o. x x E>ox
Cc 0 r- L 00 "0
a .5AUc'i o~ > Lf),~AU.-
44 1 ~!l N N '-' N O O cn N O O N C)
C) O. 0. X 0. 0. 4) 0. 0. t].
03 00 X X D X X
C-i
H C C- H c~
35 - 2191475
-
Example 4
4.1. Testing Plasma Pools of Different Size for HCV-RNA
Plasma samples from 10, 50, 100, 500 and 1,000 HCV
seronegative, healthy individual donors were mixed into a sample
pool. Each individual pool size was mixed with one plasma sample
from a plasma donation of a donor with a primary HCV infection
having a high contamination of 1.6 x 106 copies/ml (sample 1),
which was determined as in Example 1, from a donor with a
primary infection with a minimum contamination of 2.2 x 104
copies/ml (sample 2), which was determined as in Example 1, and,
as the control, with a defined preparation of HCV with 1 x 103
copies/ml (sample 3) and 5 x 102 copies/ml (sample 4). The
quantifiable number of copies/ml for the respective pool size
was determined by means of PCR. The results of the PCR
evaluation are summarized in Table 6.1.
Result:
Table 6.1. shows that a viral contamination with a primary
infected donation having a high contamination of 1.6 x 106
copies/ml can be detected in a plasma pool consisting of 10, 50,
100, 500, and 1,000 individual donations. In pools from 100, 500
and 1,000 individual donors, HCV-RNA, caused by a single,
minimally contaminated donation (2.2 x 104 copies/ml) could no
longer be detected. Detection of HCV genome equivalents is
possible at a contamination of 2.2 x 104 copies/ml in a single
donation in pools from up to 10 and 50 donors. Viral genome
equivalent contaminations with a lower number of HCV copies of
about 1 x 103 or 5 x 102 copies/ml, respectively, in a single
donation could not be detected in any of the pool sizes tested.
36 2191475
- -
E
o b o vn -d -v -v
a.-. AV d c
~ E o
- c~ -n tiN, .-=
E > o .~ x
o b o o -d -b -b
cs,v,,5AU c-i c c c
o
0
CIO 0.4 Cd
o
E -
U o o o m -v -o ti
a.-.EAV .~ c c c
w
0
N p rl
E
-v n r- o
co
E E o . _' x x
o o o -v -v
Q cLcn,~C~ u c c
U
CD C)
ca W - -
E > o ._ x x
o o v ~- -v -v
a..- E Q U c-'i c c
p N p M
~p N N N- N N
a~ a a x n. X 0. -- n. --
Fco c c
37 - 2191475
-
4.2. Increasing the Sensitivity by Concentrating the
Samples
In order to increase the sensitivity in pool sizes, in which
HCV-RNA copies could not be detected, 10-fold concentrated
samples of the pooled plasmas were used for the PCR. For this
purpose, in each case the 10-fold volume of the sample volume of
samples 2, 3 and 4 of the individual plasma pools, used in
Example 4.1., was concentrated by centrifugation, resuspended in
a buffer with 1/10 of the initial volume and used for the PCR.
The results of the PCR evaluation are summarized in Table 6.2.
By the 10-fold concentration of the initial sample volume
for the PCR, it was possible to detect the minimum load of a
pool from 10, 50 and 500 individual donors with one primary HCV-
infected donation (2.2 x 104 copies/ml). Likewise, it was
possible to increase the sensitivity of the detection of a viral
contamination of 1 x 103 or 5 x 102 copies/ml, respectively, in
a single donation in plasma pools from 10 individual donors.
In order to improve the detection of viral genomes in the
next higher pool size, the 100-fold of the initial volumes of
samples 3 and 4, used in Example 4.1., was concentrated in a
further experiment, resuspended in a buffer with 1/100 of the
initial volume and used for the PCR. The results of the PCR
evaluation are summarized in Table 6.3.
By concentrating the plasma sample 100-fold, a viral HCV-
genome contamination of 1 x 103 and 5 x 102 copies/ml in a
single donation could still be detected in a plasma pool from
100 individual donors.
38 - 2191475
-
Table 6.2. Quantifying HCV-RNA by means of LIF-PCR in Pools
of Different Sizes after a 10-Fold Concentration
Sample Plasma Pool Plasma Pool Plasma Pool Plasma Pool
from 10 from 50 from 100 from 500
Individual Individual Individual Individual
Donors Donors Donors Donors
Co ies/ml Copies/ml Co ies/ml Co ies/ml
Sample 2 2.0x104 4.1x103 2.1x103 4.0x102
(2.2x104)
Sample 3 9.5x102 n.d. n.d. n.d.
(1X103)
Sample 4 4.8x102 n.d. n.d. n.d.
(5x102)
Table 6.3. Quantifying HCV-RNA by means of LIF-PCR in Pools
of Different Sizes after a 100-Fold Concentration
Sample Plasma Pool Plasma Pool Plasma Pool Plasma Pool
from 100 from 500 from 1000 from 2000
Individual Individual Individual Individual
Donors Donors Donors Donors
Copies/ml Co ies/ml Copies/ml Co ies/ml
Sample 3 9.5x102 n.d. n.d. n.d.
(1X103)
Sample 4 4.7x102 n.d. n.d. n.d.
(5x102)
Example 5:
5.1. Testing Plasma Pools of Different Size for HBV-DNA
Plasma samples of 10, 50, 100, 500, 1,000 and 2,000 HBV
seronegative, healthy individual donors were mixed into a sample
pool. The pool was mixed with a plasma sample from a donor with
a primary HBV infection with a high contamination of 1.3 x 108
copies/ml (sample 1), which was determined as in Example 1, from
the plasma from a donor with a primary infection with a minimum
contamination of 1.4 x 104 copies/ml (sample 2), which was
determined as in Example 1, and, as the controls, with a defined
preparation of HBV with 5 x 103 copies/ml (sample 3) and
39 - 2191475
-
1 x 103 copies/ml (sample 4). The quantifiable number of
copies/ml for the respective pool size was determined by means
of PCR. The results of the PCR evaluation are summarized in
Table 7.1.
Table 7.1. shows that a viral contamination with a primary
HBV infected donation with a high genome contamination can be
detected in a plasma sample pool consisting of 10, 50, 100, 500,
1,000 and 2,000 individual donations. In pools from 500, 1,000
and 2,000 individual donors, HBV-DNA, caused by a single,
minimally contaminated donation (1.4 x 104 copies/ml) could no
longer be detected. Detection of HBV genome equivalents was
possible at a contamination of 5 x 103 copies/ml in a single
donation in pools from only 10 and 50 donors and with a
contamination of 1 x 103 copies/ml in a single donation in pools
from up to 10 donors.
40 2191475
- -
0
0 id
cad
E o => o.9
o b o 00 -d -d -d
N .~ A U ~; c c c
0
C
-o '
E o o.9 x
oo o O (14 -d -d -d
a~.~AU.-, d d d
N O
V] a E
.-cd - am., y
r: OL
O ~t d -d 't3
p 'C7 O
'nSAUN c c c
O
ti
0
O 0
C) 0
a a o E y õ 2 2
al b 4
E O = -' x x
a CO-'
U H C4
d c
0
v' 0 r J
p" y E 0 0 0
E E 0 -' x x x
Gov o 0_= to o -d
r
AUN N
Q
00
cad -p_ y O O O
.H fd c 0 0 0 N M 00 X
SL~U 't
w
.H
p N p
4) O O O
a~ 0 0. 0. x E. O
. r-
X
E-(/l C/) c/ (/) V)
2191475
41 -
5.2. Increasing the Sensitivity by Concentrating the
Samples
In order to increase the sensitivity in pool sizes, in which
HBV-DNA copies could not be detected, 10-fold concentrated
samples of the pooled plasmas were used for the PCR. For this
purpose, in each case the 10-fold volume of the sample volume of
samples 2, 3 and 4 of the individual plasma pools, used in
Example 5.1., was concentrated by centrifugation, resuspended in
a buffer with 1/10 of the initial volume and used for the PCR.
The results of the PCR evaluation are summarized in Table 7.2.
By the 10-fold concentration of the initial sample volume
for the PCR, it was possible to detect the minimum load of a
pool from 500 individual donors with one primary HBV-infected
donation of 1.4 x 104 copies/ml. Likewise, it was possible to
increase the sensitivity of detecting a viral contamination of 5
x 103 copies/ml from a single donation, in a plasma pool from
100 and 500 individual donors, and a contamination of 1 x 103
copies/ml from a single donation in a plasma pool from 50 and
100 individual donors.
In order to improve the detection of viral genomes in the
next higher pool size, the 100-fold of the initial volumes of
samples 3 and 4, used in Example 5.1., was concentrated in a
further experiment, resuspended in a buffer with 1/100 of the
initial volume and used for the PCR (Table 7.3.).
Result:
By concentrating the plasma sample 100-fold, a viral HIV-
genome contamination of 1 x 103 copies/ml in a single donation
could still be detected in a plasma pool from 500 and 1,000
individual donors.
2191475
42 -
0 0
o 1
4O)
o y}j~ 0
o .- V
V o ~ -rv
-v cs, a o
o ca ^o cn
C) 0 C)
o b o 'ti -o -o
o a C> 0
0 clSAU c ca
En Ln
0 0 N
cn a r-1
+ co E o Cl)
C3 '2 " o-
> 0
y cd C) 0 0 M 'd =b 44;
A A
o o
0 0 r+ 00 00
C4
E a a
d N C)
Cd w o o 0
E a x E o a x
=v
o 0 0 %0 o
0 -c U o 0 0 C14
av,--.AUc-i c p. ci,cv~AV c~ d
,- w
o E o a' I C
a
4) o o ca
E E > 0 .~ x x E E o o = ' x
co v o 0 oo
I- 0 0 W)
Q a.EAU -ti ¾ AU~
0
E X a
Cd 'L rn y ca vi y o 0
E 0 =?~ x .- x x
>1 cv O -6 _0 O ,A w ~O p 0 00
4~ 1 70 44
=H+ cz 4)
-P -P
0 8
N c-i p M 0 0 4) cal M^ ct
[~ 4) y 4) Q) o C G -t7 4) 4) 0 O
4) a 0. x a -- a 4) o. n. - a --
c~d x x cad X
F . .. C6 c c -v H V) V) V]
43- 2191475
Example 6:
Testing Plasma Pools of Different Sizes for HIV and HCV RNA
Plasma samples from 10, 50, 100, 500, 1,000 and 2,000 HIV
seronegative and HCV seronegative, healthy individual donors
were mixed into a plasma sample pool. Each individual pool size
was mixed with a plasma sample from a donor with a primary HIV
infection and from a donor with a primary HCV infection with a
high HIV load of 2.3 x 107 copies/ml and a HCV load of 1.6 x 106
copies/ml (sample 1), which were determined as in Examples 2.1
and 2.2, with a minimum HIV load of 2.8 x 105 copies/ml and a
HCV load of 2.2 x 104 copies/ml (sample 2), determined as in
Examples 2.1 and 2.2 and, as the controls, with a defined
preparation of HIV with 1 x 104 copies/ml and of HCV with 1 x
103 copies/ml (sample 3) and a preparation of HIV with 1 x 103
copies/ml and of HCV with 2 x 102 copies/ml (sample 4). The
respective pool sizes were tested by means of LIF-PCR using
primers specific for HIV and HCV for the presence of nucleic
acids specific for HIV and HCV, respectively. It was possible to
detect HIV-specific and HCV-specific genome sequences at
contamination with a maximum contamination of 2.3 x 107 HIV
copies/ml and 1.6 x 106 HCV copies/ml by a single donation up to
a pool size from 1,000 individual donors. HIV genome equivalents
were still found in pools of 500 individual donations
contaminated with a slightly contaminated donation, whereas HCV
genome equivalents could be found only in a pool from 50
individual donors. The sensitivity for the detection of HCV
genome sequences in the pools tested is thus a log step less
than that for HIV genome sequences.
7. Detection of the Neutralizing Effect of an HAV-Immunized
Donation on the HAV Virus Contamination in a Pool
The neutralizing potential of a plasma donation from a HAV-
immunized donor can be shown by in vitro neutralization tests.
For the detection of the neutralizing effect of HAV
antibodies on hepatitis A viruses present in the plasma, a
plasma pool from 100 pre-immunized HAV donors having a
protective immunity was tested, and the pool was mixed with HAV
(titer of 106.4TCID50/ml). After a 1 hour incubation at 37 C,
the HAV titer was determined. Due to the HAV antibodies present
in the plasma pool, the HAV infectivity could be reduced by
2191475
44 -
> 4.6 log steps. This shows that protective antibodies present
in the plasma from immunized donors can neutralize the virus
contamination in a larger plasma pool.
