Note: Descriptions are shown in the official language in which they were submitted.
CA 022l047l l997-08-08
WO 96/24668 PCTIUS95J01780
Human Chemokine Beta~ nd Human Chemokine Alpha-1
This invention relates to newly identi~ied
polynucleotides, polypeptides encoded by such
polynucleotides, the use of such polynucleotides and
polypeptides, as well as the production of such
polynucleotides and polypeptides. More particularly, the
polypeptides o$ the present invention are hllm~n ~h~mokine
polypeptides, sometimes hereinafter referred to as hllm~n
c~Pmnkine beta-ll (Ck~-11) and hllm~n ~hpmnkine alpha-l (Ck~-
1). The invention also relates to inhibiting the action of
such polypeptides.
~ hPm~kines~ also referred to as intercrine cytokine~,
are a subfamily of structurally and functionally related
cytokines. These molecule~ are 8-10 kd in size. In general,
~h~mnkines exhibit 20~ to 75~ homology at the amino acid
level and are characterized by four conserved cysteine
residues that form two disulfide bonds. Based on the
arrangement of the first two cysteine residues, ~h~mnkines
have been classified into two subfamilies, alpha and beta.
In the alpha subfamily, the first two cysteines are separated
by one amino acid and hence are referred to as the "C-X-C"
subfamily. In the beta subfamily, the two cysteines are in
an adjacent position and are, therefore, referred to as the
CA 02210471 1997-08-08
W O 96/24668 PCT~US9~J~78D
"C-C" subfamily. Thus far, at least eight different members
of this family have been identified in hllm~n~
The intercrine cytok~ n~s exhibit a wide variety of
functions. A h~ rk feature is their ability to elicit
chemotactic migration of distinct cell types, including
monocytes, neutrophils, T lymphocytes, basophils and
fibroblasts. Many rhemokines have proinflammatory activity
and are involved in multiple steps during an inflammatory
reaction. These activities include stimulation of hist~m;ne
release, lysosomal enzyme and leukotriene release, increased
adherence of target ~mm~lne cells to endothelial cells,
~nh~nced binding of complement proteins, induced expression
of granulocyte adhesion molecules and complement receptors,
and respiratory burst. In addition to their involvement in
inflammation, certain ch~mokines have been shown to exhibit
other activities. For example, macrophage inflammatory
protein 1 (MIP-1) is able to suppress hematopoietic stem cell
proliferation, platelet factor-4 (PF-4) is a potent inhibitor
of endothelial cell growth, Interleukin-3 (IL-8) promotes
proliferation of keratinocytes, and GRO is an autocrine
growth factor for m~l~nom~ cells.
In light of the diverse biological activities, it is not
surprising that chPmokines have been implicated in a number
of physiological and disease conditions, including lymphocyte
trafficking, wound he~l~ng, hematopoietic regulation and
~mmlln~logical disorders such as allergy, asthma and
arthritis.
Members of the "C-C" branch exert their effects on the
following cells: eosinophils which destroy parasites to
lessen parasitic infection and cause chronic inflammation in
the airways of the respiratory system; macrophages which
suppress tumor formation in vertebrates; and basophils which
release hist~m;ne which plays a role in allergic
inflammation. However, members of one branch may exert an
effect on cells which are normally responsive to the other
CA 02210471 1997-08-08
W096/24668 PCT~S95)01780
branch of chPm~kines and, therefore, no precise role can be
attached to the member~ o~ the br~nch~
While members of the C-C branch act pre~omin~ntly on
m~non11Clear cells and m~mh~rs of the C-X-C branch act
pr~n~;n~ntly on neutrophils a distinct chemnAttractant
property cannot be assigned to a chPm~kine based on this
gui~-Pl~ne. Some rh~mnkineS from one family show
characteristics of the other.
The polypeptides of the present invention have the
conserved cysteine residues, namely Ck~-ll has "C-C" and Ck~-
l has "C-X-C" regions, and they have high amino acid sequence
homology to known rh~mokines and have, therefore, been
putatively characterized as h11m~n ch~nkines.
In accordance with one aspect o~ the present invention,
there are provided novel polypeptides which are h11m~n Ck~
and Ck~-l as well as biologically active and diagnostically
or therapeutically useful fragments, analogs and derivatives
thereof.
In accordance with another aspect of the present
invention, there are provided isolated nucleic acid molecules
encoding such polypeptides, including mRNAs, DNAs, cDNAs,
genomic DNA as well as biologically active and diagnostically
or therapeutically useful fragments, analogs and derivatives
thereof.
In accordance with another aspect of the present
invention there are provided nucleic acid probes comprising
nucleic acid molecules of sufficient length to specifically
hybridize to Ck~-ll and Ck~-l sequences.
In accordance with yet a further aspect of the present
invention, there is provided a process for producing such
polypeptides by recombinant techniques which comprises
culturing recombinant prokaryotic and/or eukaryotic host
cells, cont~n~ng a Ck~-ll or Ck~-l nucleic acid sequence,
under conditions promoting expression of said protein and
subsequent recovery of said protein.
CA 022l047l l997-08-08
W O 96/24668
PCTnUS9~178
In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides encoding such polypeptides
for therapeutic purposes, for example, to treat solid tumors,
chronic infe~tions, lellk~m;~, T-cell mediated auto-
~
diseases, parasitic infections, psoriasis, asthma, allergy,to regulate hematopoiesis, to stimulate growth factor
activity, to ~ nh; h~ t angiogenesis and to promote wound
he~l ing.
In accordance with yet a further aspect of the present
invention, there are provided antibodies against such
polypeptides.
In accordance with yet another aspect of the present
invention, there are provided antagonists to such
polypeptides, which may be used to ;nh;h;t the action of such
polypeptides, for example, in the treatment of certain auto-
;mmllne diseases, atherosclerosis, chronic inflammatory and
infectious diseases, hist~m;ne and IgE-mediated allergic
reactions, prostagl~n~;n-independent fever, bone marrow
failure, cancers, silicosis, sarcoidosis, rheumatoid
arthritis, shock, hyper-eos;noph;l;c syndrome and fibrosis in
the asthmatic lung.
In accordance with another aspect of the present
invention there is provided a method of diagnosing a disease
or a susceptibility to a disease related to a mutation in the
Ck~-ll or Ck~-l nucleic acid sequences and the protein
encoded by such nucleic acid sequences.
In accordance with yet a further aspect of the present
invention, there is provided a process for utilizing such
polypeptides, or polynucleotides ~nCo~;ng such polypeptides,
for in vitro purposes related to scientific research,
synthesis of DNA and manufacture of DNA vectors.
These and other aspects of the present invention should
be apparent to those skilled in the art from the teachings
herein.
CA 02210471 1997-08-08
W096/24668 PCT~S95J01780
The ~ollowing drawings are illustrative of embodiments
of the invention and are not meant to limit the scope of the
inve~tion as encompassed by the claims.
Figure l displays the cDNA sequence and corresponding
deduced amino acid sequence of Ck~-ll. The initial 17 amino
acids represent the leader sequence such that the putative
mature polypeptide comprises 81 amino acids. The stAn~d
one-letter abbreviations for amino acids are used
Sequencing was performed usina a 373 Automatec1 DNA sequencer
(Applied Biosystems, Inc.). Sequencing accuracy is predicted
to be greater than 97% accurate.
Figure 2 displays the cDNA sequence and corresponding
deduced amino acid sequence of Ck~-l. The initial 22 amino
acids represent the leader sequence such that the putative
mature polypeptide comprises 87 amino acids. The stAn~rd
one-letter abbreviations for amino acids are used.
Figure 3 displays the amino acid sequence homology
between Ck~-ll (top) and the Rat RANTES polypeptide (bottom).
Figure 4 displays the amino acid sequence homology
between Ck~-l and Ovis Aries interleukin-8 (bottom).
In accordance with an aspect of the present invention,
there are provided isolated nucleic acids (polynucleotides)
which encode for the mature polypeptides having the deduced
amino acid sequences of Figures l (SEQ ID No. 2) and 2 (SEQ
ID No. 4) or for the mature polypeptides encoded by the cDNAs
o~ the clones deposited as ATCC Deposit No. 75948 (Ck~-ll)
and 75947 (Ck~-l) on November ll, 1994.
Polynucleotides encoding Ck~-ll may be isolated from
numerous hl1m~n adult and fetal cDNA libraries, for example,
a human fetal spleen cDNA library. Ck~-ll is a member of the
C-C branch of chem~kines. It cont~in~ an open reading frame
encoding a protein of 98 amino acid residues of which
approximately the first 17 amino acids residues are the
putative leader sequence such that the mature protein
comprises 81 amino acids. The protein exhibits the highest
CA 02210471 1997-08-08
W 096124~68
P~-l/u~fJvI780
degree of homology to the Rat R~NTBS polypeptide wltn
identity and 47% s;m;l~ity over a stretch of 89 amino acids.
It is also important that the four spatially conserved
cysteine residues in rhemnkines are found in the
polypeptide~.
Polynucleotides encoding Ck~-1 may be isolated from
numerou~ h~ n adult and fetal cDNA libraries, for example,
h~ n tonsils cDNA library. Cka-1 is a member of the C-X-C
branch of rhPmnk;ne~ It Cr~nt~; n~; an open rP~1; n~ frame
~n~A~ ng a protein of 109 amino acid residues of which
a~ro~lmately the fir8t 22 amino acids residues are the
putative leader sequence such that the mature protein
comprises 87 amino acid The protein ~h;h; ts the highest
degree of homology to interleukin-8 from Sheep (Ovis Aries)
with 31% ;~nt; ty and 80~ similarity over a stretch of 97
amino acids. It is also important that the four sp~t~lly
conserved cysteine residues in chemok; nP~ are found in the
polypeptides.
The polynucleotides of the present invention may be in
the form of RNA or in the form of DNA, which DNA includes
CDN~, genomic DN~, and synthetic DNA. The DNA may be double-
str~n~eA or single-stranded, and if single str~nA~A may be
the coding strand or non-coding (anti-sense) strand. The
coA;ng sequence which ~ncoAPs the mature polypeptides may be
; ~nt; cal to the coding se~l~nc~ shown in Figure~ 1 (SBQ ID
No. 1) and 2 (SEQ ID No. 3) or that of the deposited clones
or may be a different coding sequence which coding sequence,
as a result of the rP~llnA~cy or degeneracy of the genetic
code, Pnco~c the same mature polypeptides as the DNA of
Figures 1 (SEQ ID No. 1) and 2 (SEQ ID No. 3) or the
deposited cDNA8.
The polynucleotides which Pn~o~ for the mature
polypeptides of Figures 1 (SEQ ID No. 2) and 2 (SEQ ID No. 4)
or for the mature polypeptides encoded by the deposited cDNAs
may include: only the ~oA~ ng sequence for the mature
CA 02210471 1997-08-08
W096/24668 PCT~S95101780
polypeptide; the coding sequence for the mature polypeptide
and additional coding sequence ~uch a~ a leader or secretory
~equence or a ~L~Lotein sequence; the coding sequence for
the mature polypeptide (and optionally additional coding
sequence) and non-coding sequence, such as introns or non-
coding ~equence 5' and/or 3' of the coding sequence for the
mature polypeptides.
Thus, the term "polynucleotide encoding a polypeptide"
~ncnmrA~seS a polynucleotide which includes only coding
sequence for the polypeptide as well as a polynucleotide
which include~ additional coding and/or non-coding sequence.
The present invention further relates to variants of the
her~n~hove described polynucleotides which encode for
fragments, analogs and derivatives of the polypeptide having
the ded~ced amino acid se~uences of Figures 1 ~SEQ ID No. 2)
and 2 (SEQ ID No. 4) or the polypeptides encoded by the cDNAs
of the deposited clones. The variant of the polynucleotides
may be a naturally occurring allelic variant of the
polynucleotides or a non-naturally occurring variant of the
polynucleotides.
Thus, the present invention includes polynucleotides
encoding the same mature polypeptides as shown in Figures l
(SEQ ID No. 2) and 2 (SEQ ID No. 4) or the same mature
polypep~ides encoded by the cDNA of the deposited clones as
well as variants of such polynucleotides which variants
encode for a fragment, derivative or analog of the
polypeptides of Figures l (SEQ ID No. 2) and 2 (SEQ ID No. 4)
or the polypeptides encoded by the cDNA of the deposited
clones. Such nucleotide variants include deletion variants,
su~stitution variants and addition or insertion variants.
A~ here~n~hove indicated, the polynucleotides may have
a coding sequence which is a naturally occurring allelic
variant of the coding sequences shown in Figures l (SEQ ID
No. l) and 2 (SEQ ID No. 3) or of the coding sequence of the
deposited clones. As known in the art, an allelic variant is
t
--7--
CA 02210471 1997-08-08
W O 96/24668
PCTnUS95101780
an alternate form of a polynucleotide ~equence which may have
a ~ubstitution, deletion or addition of one or more
nucleotides, which does not substantially alter the function
of the encoded polypeptide.
The present invention also includes polynucleotides,
wherein the coding sequence for the mature polypeptides may
be fused in the same reading ~rame to a polynucleotide
8equence which aids in expression and secretion of a
polypeptide from a host cell, for example, a leader sequence
which functions as a ~ecretory sequence for controlling
transport of a polypeptide from the cell. The polypeptide
having a leader sequence is a preprotein and may have the
leader sequence cleaved by the host cell to form the mature
form of the polypeptide. The polynucleotides may also encode
for a proprotein which is the mature protein plus additional
5' amino acid residues. A mature protein having a
prosequence is a ~ U~7 otein and is an inactive form of the
protein. Once the prosequence is cleaved an active mature
protein re~; n~ .
Thus, for example, the polynucleotides of the present
invention may encode for a mature protein, or for a protein
having a prosequence or for a protein having both a
prosequence and a presequence (leader sequence).
The polynucleotides of the present invention may also
have the coding sequence fused in frame to a marker sequence
which allows for purification of the polypeptides of the
present invention. The marker sequence may be a hexa-
histidine tag supplied by a pQE-9 vector to provide for
purification of the mature polypeptides fused to the marker
in the case of a bacterial host, or, for example, the marker
sequence may be a hemagglutinin (HA) tag when a m~ n
host, e.g. COS-7 cells, is used. The HA tag corresponds to
an epitope derived from the influenza hemagglutinin protein
(Wilson, I., et al., Cell, 37:767 (1984)).
CA 02210471 1997-08-08
WO 96/24668
PCT~S95101780
The present invention further relates to
polynucleotides which hybridize to the herPin~hove-described
sequences if there is at least 50~ and pre~erably 70~
identity between the sequences. The present invention
particularly relates to polynucleotides which hybridize under
stringent conditions to the her~n~hove-described
polynucleotides. As herein used, the term "stringent
conditions" means hybridization will occur only if there i8
at least 95~ and preferably at least 97~ identity between the
sequences. The polynucleotides which hybridize to the
her~tn~hove described polynucleotides in a preferred
embo~m~nt encode polypeptides which retain substantially the
same biological function or activity as the mature
polypeptides ~nco~ by the cDNAs of Figures 1 (SEQ ID No. l)
and 2 tSEQ ID No. 3) or the deposited cDNAs.
The deposit(s) referred to herein will be m~lnt~ined
under the terms o~ the Budapest Treaty on the International
Recognition of the Deposit of Micro-org~ni ~m~ for purposes of
Patent Procedure. These deposits are provided merely as
convenience to those of skill in the art and are not an
admission that a deposit is required under 35 U.S.C. 112.
The sequence of the polynucleotides cont~n~ in the
deposited materials, as well as the amino acid seguence of
the polypeptides encoded thereby, are incorporated herein by
reference and are controlling in the event of any conflict
with any description of sequences herein. A license may be
reguired to make, use or sell the deposited materials, and
no such license is hereby granted.
The present invention further relates to polypeptides
which have the deduced amino acid seguences of Figures 1 (SEQ
ID No. 2 ) and 2 (SEQ ID No. 4) or which have the amino acid
sequence encoded by the deposited cDNA, as well as fragments,
analogs and derivatives of such polypeptides.
The terms "fragment," "derivative~ and ~analog~ when
referring to the polypeptides of Figures 1 (SEQ ID No. 2) and
_g_
CA 02210471 1997-08-08
W O 96/2~668
~CT~S95101780
2 (SEQ ID No. 4) or that encoded by the deposited cDNA, means
polypeptides which retain ess~nt~lly the same biological
function or activity as such polypeptides. Thus, an analog -
includes a proprotein which can be activated by cleavage of
the ~lv~Lotein portion to produce an active mature
polypeptide.
The polypeptides of the present invention may be
recombinant polypeptides, natural polypeptides or synthetic
polypeptides, preferably re~omhin~nt polypeptides.
The fragment, derivative or analog of the polypeptides
of Figures l (SEQ ID No. 2) and 2 (SEQ ID No. 4) or that
encoded by the deposited cDNAs may be (i) one in which one or
more o~ the amino acid residues are substituted with a
conserved or non-conserved amino acid residue (pre~erably a
conserved amino acid residue) and such substituted amino acid
residue may or may not ~e one encoded by the genetic code, or
(ii) one in which one or more of the amino acid residues
includes a substituent group, or (iii) one in which the
ma~ure polypeptide i~ fused with another compound, such as a
compound to increase the half-life of the polypeptide (for
example, polyethylene glycol), or (iv) one in which the
additional amino acid~ are fused to the mature polypeptide,
such as a leader or secretory sequence or a sequence which is
employed for purification of the mature polypeptide or a
proprotein ~equence. Such fragment~, derivatives and analogs
are deemed to be within the scope of those skilled in the art
from the teachings herein.
The polypeptides and polynucleotides of the present
invention are preferably provided in an isolated fonm, and
preferably are purified to homogeneity.
The term llisolated" means that the material is removed
from its original envi~ollme~lt (e.g., the natural environment
i~ it i~ naturally occurring). For example, a naturally-
occurring polynucleotide or polypeptide present in a living
An~m~l is not isolated, but the same polynucleotide or
--10--
-
CA 02210471 1997-08-08
W O 96/24668
PCTnUS95~0~780
polypeptide, separated ~rom ~ome or all o~ the coexisting
materi~ls in the natural system, is isolated. Such
polynucleotides could be part of a vector and/or such
polynucleotides or polypeptides could be part of a
composition, and still be isolated in that such vector or
composition is not part of its natural envi~o~ t.
The present invention also relates to vectors which
include polynucleotides of the present invention, host cells
which are genetically engineered with vectors o~ the
invention and the production of polypeptides of the invention
by recomh~ n~nt techniques.
Host cells are genetically engineered (transduced or
transformed or transfected) with the vectors of this
invention which may be, for example, a cloning vector or an
expression vector. The vector may be, for example, in the
form of a plasmid, a ~iral particle, a phage, etc. The
engineered host cells can be cultured in conventional
nutrient media modified as appropriate ~or activating
promoters, selecting transformants or amplifying the Ck~
or Ck~-1 genes. The culture conditions, such as temperature,
pH and the like, are those previously used with the host cell
~elected for expression, and will be apparent to the
ordinarily skilled artisan.
The polynucleotides of the present invention may be
employed for producing polypeptides by recombinant
techni~ues. Thus, for example, the polynucleotide may be
included in any one of a variety of expression vectors for
expressing a polypeptide. Such vectors include chromosomal,
no~chromosomal and synthetic DNA se~uences, e.g.,
derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmids; vectors derived from
C~Tnh~n~tions of plasmids and phage DNA, viral DNA such as
vaccinia, adenovirus, fowl pox virus, and pseudorabies.
However, any other vector may be used as long as it is
replicable and viable in the host.
-
CA 022l047l l997-08-08
W 096/24668 PCTnUS955~1780
The appropriate DNA sequence may be inserted into the
vector by a variety of procedures. In general, the DNA
sequence is inserted into an appropriate restriction
~n~nnllClease site(s) by procedures known in the art. Such
procedures and others are deemed to be within the scope of
those skilled in the art.
The DNA ~equence in the expression vector is operatively
linked to an a~lopriate expression control sequence(s)
(promoter) to direct mRNA synthesis. As representative
examples of such promoters, there may be mentioned: ~TR or
SV40 promoter, the E. coli. lac or trP, the phage 1;~mh~:3 PL
~ n~oter and other promoters known to control expression o~
genes in prokaryotic or eukaryotic cells or their ~iruses.
The e~q?ression vector also c~n~ n~ a ribosome h; nA~ng site
for translation initiation and a transcription terminator.
The vector may also include appropriate sequences for
am.plifying expression.
In addition, the expression vectors preferably contain
one or more selectable marker genes to pro~ide a phenotypic
trait for selection of transformed host cells such as
dihydrofolate reductase or neomycin resistance for eukaryotic
cell culture, or such as tetracycline or ampic;ll; n
resistance in E. coli.
The vector cont~; n~ ng the appropriate DNA sequence as
here~n~hove described, as well as an appropriate promoter or
control sequence, may be employed to transform an appropriate
host to permit the host to express the protein.
AS representative examples of .~c~riate hosts, there
may be mentioned: bacterial cells, such as E. coli,
StrePtomyces, S~lmonella tYph~mllrium; fungal cells, such as
yeast; insect cells such as DrosoPhila S2 and Spodoptera Sf9;
~n;m~l cells such as CHO, COS or Bowes m~l ~n~m~;
adenoviruses; plant cells, etc. The selection of an
u~riate host is deemed to be within the scope of those
skilled in the art from the teachings herein.
-12-
More particularly, the present invention also includes
recombinant constructs comprising one or more of the
sequences as broadly described above. The constructs
comprise a vector, such as a plasmid or viral vector, into
which a sequence of the invention has been inserted, in a
forward or reverse orientation. In a preferred aspect of this
embodiment, the construct further comprises regulatory
sequences, including, for example, a promoter, operably
linked to the sequence. Large numbers of suitable vectors
and promoters are known to those of skill in the art, and are
commercially available. The following vectors are provided
by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen),
pBS, pD10, phagescript, psiX174, pBluescript SK, pBSKS,
pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); pTRC99a,
pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO,
pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG,
pSVL (Pharmacia). However, any other plasmid or vector may
be used as long as they are replicable and viable in the
host.
Promoter regions can be selected from any desired gene
using CAT (chloramphenicol transferase) vectors or other
vectors with selectable markers. Two appropriate vectors are
pKK232-8 and pCM7. Particular named bacterial promoters
include lacI, lacZ, T3, T7, gpt, lambda PR, PL and trp.
Eukaryotic promoters include CMV immediate early, HSV
thymidine kinase, early and late SV40, LTRs from retrovirus,
and mouse metallothionein-I. Selection of the appropriate
vector and promoter is well within the level of ordinary
skill in the art.
In a further embodiment, the present invention relates
to host cells containing the above-described constructs. The
host cell can be a high eukaryotic cell, such as a
mammalian cell, or a lower eukaryotic cell, such as a yeast
cell, or the host cell can be a prokaryotic cell, such as a
bacterial cell. Introduction of the construct into the host
-13-
CA 02210471 1997-08-08
W O ~6/~4668
PCTnUS95101780
cell can be e~ected by calcium phosphate transi~ection, DEAE-
Dextran mediated transfection, or electroporation (Davis, L.,
Dibner~ M., Battey, I., Basic Methods in Molecular Biology,
(1986)~.
The constructs in host cells can be used in a
conventional m~nnPr to produce the gene products encoded by
the recQmh~n~nt se~lPncP~. Alternatively, the polypeptides
of the invention can be synthetically produced by
conventional peptide ~ynthesizers.
Mature proteins can be expressed in m~mm~l ian cells,
yeast, bacteria, or other cells under the control of
appropriate promoters. Cell-free translation systems can
also be employed to produce such proteins using RNAs derived
from the DNA constructs of the present invention.
A~Lo~riate cloning and expression vectors for use with
prokaryotic and eukaryotic hosts are described by Sambrook,
et al., Molecular Cloning: A Laboratory ~ml~ 1, Second
Bdition, Cold Spring Harbor, N.Y., (1989), the disclosure of
which is hereby incorporated by re~erence.
Transcription of the DNA ~nco~; ng the polypeptides of
the present invention by higher eukaryotes is increased by
inserting an enh~ncer sequence into the vector. Rnh~ncers
are cis-acting elements of DNA, usually about from 10 to 300
bp that act on a promoter to increase its transcription.
Examples include the SV40 Pnh~n~er on the late side of the
replication origin bp 100 to 270, a cytomegalovirus early
~o.l~ter Pnh~ncer, the polyoma Pnh~ncer on the late side of
the replication origin, and adenovirus Pnh~ncers.
Generally, recombinant expression vectors will include
origins of replication and selectable marker~ permitting
transformation of the host cell, e.g., the ampicillin
resistance gene of E. coli and S. cerevisiae TRP1 gene, and
a promoter derived from a highly-expressed gene to direct
transcription of a downstream structural sequence. Such
promoters can be derived from operons encoding glycolytic
-14-
CA 02210471 1997-08-08
W O 96/24668
PCTnUS95101780
enzymes ~uch as 3-phosphoglycerate kinase ~PGK), a!-~actor,
acid phosphatase, or heat shock proteins, among others. The
heterologous structural sequence is assembled in appropriate
phafie with translation initiation and termination seguences,
and preferably, a leader sequence c~p~hle of directing
secretion of translated protein into the periplasmic space or
extracellular medium. Optionally, the heterologous sequence
can Pn~O~P a fusion protein including an N-terminal
identification peptide imparting desired characteristics,
e.g., stabilization or simplified purification of expressed
recombinant product.
Use~ul expression vectors for bacterial use are
constructed by inserting a structural DNA sequence encoding
a desired protein together with suitable translation
initiation and termination signals in operable reading phase
with a functional promoter. The vector will comprise one or
more phenotypic selectable m~rkers and an origin of
replication to ensure maintenance of the vector and to, if
desirable, provide ampli$ication within the host. Suitable
prokaryotic hosts for transformation include E. coli,
Bacillus subtilis, SAlm~nella ty~himllrium and various species
within the genera Psell~nm~n~, Streptomyces, and
Staphylococcus, although others may also be employed as a
matter of choice.
As a representative but nonlimiting example, useful
expression vectors ~or bacterial use can comprise a
selectable marker and bacterial origin of replication derived
from ro~mPrcially available plasmids comprising genetic
elements of the well known cloning vector pBR322 (ATCC
37017). Such cs~mPrcial vectors include, for example,
pKK223-3 ~Pharmacia Fine Chemicals, Uppsala, Sweden) and
pGEM1 (Promega Biotec, Madison, WI, USA). These pBR322
"backbone" sections are cs~hinP~ with an appropriate promoter
and the structural sequence to be expressed.
-15-
CA 02210471 1997-08-08
W ~ 96/24668 PCTrUS9~0178
Following transformation of a suitable host strain and
growth of the host strain to an appropriate cell density, the
selected promoter is induced by appropriate means (e.g.,
temperature shift or chemical induction) and cells are
cultured for an additional period.
Cells are typically harvested by centrifugation,
disrupted by physical or chemical means, and the resulting
crude extract retained for further puri~ication.
Microbial cells employed in expression o~ proteins can
be disrupted by any convenient method, including freeze-thaw
cycling, sonication, mechanical disruption, or use of cell
lysing agents, such methods are well know to those skilled in
the art.
Various m~mm~l ian cell culture systems can also be
employed to express recombinant protein. Examples of
m~mm~ n expression systems include the COS-7 lines of
monkey kidney fibroblasts, described by Gluzman, Cell, 23:175
~1981), and other cell lines capable of expressing a
compatible vector, for example, the C127, 3T3, CH0, HeLa and
BHK cell lines. ~mm~ n expression vectors will comprise
an origin of replication, a suitable promoter and enhancer,
and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites,
transcriptional termination sequences, and 5' flanking
nontranscribed se~uences. DNA se~uences derived from the
SV40 splice, and polyadenylation sites may be used to provide
the required nontranscribed genetic elements.
The polypeptides can be recovered and purified from
recombinant cell cultures by methods including ~mmoni um
sulfate or ethanol precipitation, acid extraction, anion or
cation exchange chromatography, phosphocellulose
chromatography, hydrophobic interaction chromatography,
affinity chromatography, hydroxylapatite chromatography and
lectin chromatography. Protein refolding steps can be used,
as necessary, in completing configuration of the mature
-16-
CA 02210471 1997-08-08
W O 96/24668 PCTnUS95101780
protein. Finally, high per~ormance liquid chromatography
(HPLC) can be employed for final purification steps.
The polypeptides of the present invention may be a
natura]ly purified product, or a product o~ chemical
synthetic procedures, or produced by recom~binant techniques
from a prokaryotic or eukaryotic host (for example, by
bacterial, yeast, higher plant, insect and m~m~ n cells in
culture) . Dep~n~; n~ upon the host employed in a rer~m~;n~nt
production procedure, the polypeptides of the present
invention may be glycosylated or ,m,~y be non-glycosylated.
Polypeptides o~ the invention may also include an initial
methionine amino acid residue.
The polynucleotides and polypeptides of the present
invention may be employed as research reagents and materials
for discovery of treatments and diagnostic~ to hllm~n disease.
The hllm~n r~Pm~kine polypeptides m, y be employed to
inhibit bone marrow stem cell colony formation as adjunct
protective treatment during cancer chemotherapy and ~or
leukemia.
The hnm~n rh~mokine polypeptides may also be employed to
~nh;h;t epidermal keratinocyte proliferation for treatment of
psoriasis, which is characterized by keratinocyte hyper-
proli~eration.
The hnm~n rhPmokine polypeptides may also be employed to
treat solid tumors by stimulating the invasion and activation
of host defense cells, e.g., cytotoxic T cells and
macrophages and by inhibiting the angiogenesis of tumors.
They may also be employed to enh~nce host defenses against
resistant chronic and acute infections, for example,
mycobacterial infections via the attraction and activation of
microbicidal leukocytes.
The hllm~n che~okine polypeptides may also be employed to
inhibit T cell proliferation by the inhibition of IL-2
biosynthesis for the treatment of T-cell mediated auto-;mml-nP
diseases and lymphocytic leukem;~s.
-17-
CA 02210471 1997-08-08
W O 96/24668 PCTnUS95J0~78
Ck~-11 and Ck~-1 may al~o be employed to stimulate wound
he~l iny, both via the recruitment of debris clearing and
connective tissue promoting inflammatory cells and also via
it~ control of excessive TGF~-mediated fibrosis. In this
8ame m~nnPr, Ck~-11 and Cka-1 may also be employed to treat
other fibrotic disorders, including liver cirrhosis,
osteoarthritis and plllm~n~y fibrosis.
The hllm~n ch~mokine polypeptides also increase the
presence of eosinophils which have the distinctive function
of killing the larvae of parasites that invade tissues, as in
schistosomiasis, trichinosis and ascariasis.
They may also be employed to regulate hematopoiesis, by
regulating the activation and differentiation of various
hematopoietic progenitor cells, for example, to release
mature leukocytes from the bone marrow ~ollowing
chemotherapy.
The polynucleotides and polypeptides ~ncoAed by such
polynucleotides may also be utilized for in vitro purposes
related to scientific research, synthesi~ of DNA and
manufacture of DNA vectors and for designing therapeutics and
diagnostics for the treatment of human disease.
Fragments of the full length Ck~-11 or Ck~-1 genes may
be used as a hybridization probe for a cDNA library to
isolate the full length gene and to isolate other genes which
have a high sequence similarity to the gene or similar
biological activity. Probes of this type generally have at
least 20 bases. Preferably, however, the probes have at
least bases and generally do not exceed 50 bases, although
they may have a greater number of bases. The probe may also
be used to identify a cDNA clone corresponding to a full
length transcript and a genomic clone or clones that CQnt~ i n
the co~plete genes including regulatory and promotor regions,
exons, and introns. An example of a screen comprises
isolating the coding region of the genes by using the known
DNA sequence to synthesize an oligonucleotide probe. Labeled
-18-
CA 02210471 1997-08-08
W096/Z4668 PCT~S95101780
oligonucleotides having a sequence complementary to that of
the genes of the present invention are used to screen a
library of human cDNA, genomic DNA or mRNA ~o determine which
members of the library the probe hybridizes to.
This invention i~ also related to the use of the Ck~
or Ck~-1 gene as part of a diagnostic assay for detectiny
diseases or susceptibility to diseases related to the
presence of mutations in the Ck~-11 or Ck~-1 nucleic acid
seque~ces. Such diseases are related to under-expression of
the hllm~n ~hemnkine polypeptides, for example, tumors and
c~nc~s.
Individuals carrying mutations in the Ck~-11 or Ck~-1
gene may be detected at the DNA level by a variety of
techniques. Nucleic acids ~or diagnosis may be obt~;n~ from
a patient's cells, such as from blood, urine, saliva, tissue
biop~y and autopsy material. The genomic DNA may be used
directly for detection or may be amplified enzymatically by
using PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to
analysis. RNA or cDNA may also be used for the same purpo~e.
As an example, PCR primers complementary to the nucleic acid
encoding Ck~-11 or Ck~-1 can be used to i~ntl fy and analyze
Ck~-ll or Ck~-1 mutations. For example, deletions and
insertions can be detected by a change in size of the
amplified product in comparison to the normal genotype.
Point mutations can be identified by hybridizing amplified
DNA to radiolabeled Ck~-11 or Ck~-1 RNA or alternatively,
radiolabeled Ck~-11 or Ck~-1 antisense DNA sequences.
Perfectly matched sequences can be distinguished from
m~sm~tched duplexes by RNase A digestion or by differences in
melting temperatures.
Genetic testing based on DNA sequence differences may be
achieved by detection of alteration in electrophoretic
mobility of DNA fragments in gels with or without denaturing
agents. Small sequence deletions and insertions can be
visualized by high resolution gel electrophoresis. DNA
-
--19--
CA 02210471 1997-08-08
W096/24668 PCT~S95J0178
~ragments of different sequences may be distinguished on
denaturing ~ormamide gradient gels in which the mobilities of
different DNA fra~m~nt~ are retarded in the gel at di~erent
positions according to their specific melting or partial
melting temperatures (see, e.g., Myers et al., Science,
230:1242 (1985)).
Sequence changes at specific locations may also be
re~ealed by nuclease protection assays, such as RNase and S1
protection or the chemical cleavage method (e.g., Cotton et
al., PNAS, USA, 85:4397-4401 (1985)).
Thus, the detection of a speci~ic DNA sequence may be
achie~ed by methods such as hybridization, RNase protection,
chemical cleavage, direct DNA se~lPnc~ ng or the use of
restriction enzymes, ~e.g., Restriction Fragment Length
Polymorphisms (RFLP)) and Southern blotting of genomic DNA.
In addition to more conventional gel-electrophoresis and
DNA se~l~n~ing~ mutations can also be detected by in situ
analysis.
The present invention also relates to a diagnostic assay
for detecting altered level~ of Ck~-11 or Ck~-1 protein in
various tissues since an over-expression of the proteins
comp~red to normal control tissue samples may detect the
presence of a disease or susceptibility to a disease, for
example, a tumor. Assays used to detect levels of Ck~-11 or
Ck~-1 protein in a sample derived ~rom a host are well-known
to those of skill in the art and include radioimmllnoassays,
competitive-h~ n~ ng assays, Western Blot analysis, ELISA
assays and "sandwich" assay. An ELISA assay (Coligan, et
al., Current Protocols in Tmmllnology, 1(2), Chapter 6,
(1991)) initially comprises preparing an antibody specific to
the Ck~-11 or Ck~-1 antigen, preferably a monoclonal
antibody. In addition a reporter antibody is prepared
against the monoclonal antibody. To the reporter antibody is
attached a detectable reagent such as radioactivity,
fluorescence or, in this example, a horser~sh peroxidase
-20-
CA 02210471 1997-08-08
W 096~668
PCTrUS9S~1780
enzyme. A sample is removed ~rom a host and incuDa~u ~
solid cu~o~L, e.g. a polystyrene dish, that binds the
proteins in the sample. Any free protein h;nAin~ sites on
the dish are then covered by incubating with a non-specific
protein like BSA. Next, the monoclonal Ant;hoAy is incubated
in the di~h during which time the monoclonal Ant; hoA; es
attach to any Ck~-11 or Ck~-1 proteins attArhP~ to the
poly~L~-~--e dish. All unbound m~noclonal Ant;hoAy is ~7-~hP~
out with buffer. The L~uLLer An~h~Ay l;nkP~ to horser~Ad;~h
~r~ A~e is now placed in the dish resulting in binding of
the ~vLLer Ant;hoAy to any monoclonal Ant;hoAy holln~l to
Ck~-11 or Cka-1. UnattA~hpA reporter AntihoAy is then W-A~heA
out. Per~Y;~A~e substrates are then AAAP~ to the di~h and
the amount of color developed in a given time period is a
measurement of the amount of Ck~-11 or Ck~-1 protein pre~ent
in a given volume of patient sample when cQ~rA~ed against a
stAn~A~d curve.
A competition assay may be employed wherein An~; hodies
speci~ic to Ck~-11 or Cka-1 are attArh~A to a solid support
and labeled Ck~-11 or Ck~-1 and a sample derived from the
host are passed over the solid 8U~Ol L and the amount of
label detected, for example by liquid scintillation
chromatography, can be correlated to a quantity of Ck~-11 or
Ck~-1 in the sample.
A ~ s~n~' ich" assay is similar to an ELISA assay. In a
"sandwich" assay Ck~-11 or Cka-1 i~ pas~ed over a solid
s~oLL and bind8 to Ant~hoAy attAchP~ to a 801id support.
A second antibody is then bound to the Ck~-11 or Cka-1. A
third An~; ho~y which is labeled and ~pecific to the second
antibody is then passed over the solid support and binds to
the second ~n~; ho~y and an amount can then be ~lAnt; fied.
This invention provides a method for identification of
the receptors for the hn~~n chp-m~k;np polypeptides. The gene
F~nco~l;n~J the receptor can be i~f~nt; fied by numerous methods
known to those of skill in the art, for example, ligand
-21-
CA 02210471 1997-08-08
W 096/24668 PCTnUS95Jal78
pAnn~n~ and FACS sorting (Coliyan, et al., Current Protocols
in I-m--mun.l 1(2), Chapter 5, ~1991)). Preferably, expression
cloniny is employed wherein polyadenylated RNA is prepared
from a cell responsive to the polypeptides, and a cDNA
library created from this RNA is divided into pools and used
to transfect COS cells or other cells that are not responsive
to the polypeptides. Transfected cells which are grown on
glass slides are exposed to the labeled polypeptides. The
polypeptides can be labeled by a variety of means including
iodination or inclusion of a recognition site for a site-
specific protein kinase. Following fixation and incubation,
the slides are subjected to autoradiographic analysis.
Positive pools are identified and sub-pools are prepared and
retransfected using an iterative sub-pooling and rescreening
proces~, eventually yielding a single clones that encodes the
putative receptor.
As an alternative approach for receptor identification,
the labeled polypeptides can be photoaffinity linked with
cell ~ .~Ldne or extract preparation~ that express the
receptor molecule. Cross-linked material is resol~ed by PAGE
analysis and exposed to X-ray film. The labeled complex
cont~n;ng the receptors of the polypeptides can be excised,
resolved into peptide fragments, and subjected to protein
microse~l~nc~ng~ The amino acid sequence obtained from
microse~l~c;ng would be used to design a set of degenerate
oligonucleotide probes to screen a cDNA library to identify
the genes encoding the putative receptor~.
This invention provides a method of screening compounds
to identify agonists and antagonists to the human ch~mokine
polypeptides of the present invention. An agonist is a
compound which has S;m; 1 ~r biological functions of the
polypeptides, while antagonists block such functions.
Chemotaxis may be assayed by placing cells, which are
chemoattracted by either of the polypeptides of the present
invention, on top of a filter with pores of sufficient
-22-
CA 02210471 1997-08-08
WO 96/24668
PCTIUS95101780
diameter to admit the cells (about 5 ~m). Solutions of
potential agonists are placed in the bottom o~ the chamber
with an appropriate control medium in the upper compartment,
and thus a concentration gradient of the agonist is measured
by colln~ i ng cells that migrate into or through the porous
membrane over time.
When assaying ~or antagonists, the hllm~n ~h~mokine
polypeptides of the present invention are placed in the
bottom chamber and the potential antagonist is ~ to
determine if chemotaxi~ of the cells is prevented.
Alternatively, a m~mm~ n cell or n,~ dne preparation
expressing the receptors of the polypeptides would be
incubated with a labeled human chemskine polypeptide, eg.
radioactivity, in the presence of the compound. The ability
of the compound to block this interaction could then be
measured. When assaying for agonists in this fashion, the
hllm~n ~h~m~kines would be absent and the ability of the
agonist itself to interact with the receptor could be
measured.
Examples of potential Ck~-11 and Ck~-1 antagonists
include antibodies, or in some cases, oligonucleotides, which
bind to the polypeptides. Another example of a potential
antagonist is a negative ~ n~nt mutant of the polypeptides.
Negative ~n~i n~nt m~l~Ants are polypeptides which bind to the
receptor of the wild-type polypeptide, but fail to retain
biological activity.
Antisense constructs prepared using antisense technology
are also potential antagonists. Antisense technology can be
used to control yene expression through triple-helix
formation or antisense DNA or RNA, both of which methods are
based on binding of a polynucleotide to DNA or RNA. For
example, the 5' coding portion of the polynucleotide
sequence, which encoAes for the mature polypeptides of the
present invention, is used to design an antisense RNA
oligo~ucleotide of from about 10 to 40 base pairs in length.
CA 02210471 1997-08-08
W O 96/24668
PCT~S95/0~780
A DNA oligonucleotide is designed to be complementary to a
region of the gene involved in transcription (triple- helix,
see Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et
al, Science, 241:456 (1988); and Dervan et al., Science, 251:
1360 (1991)), thereby ~eve~lting transcription and the
produc~ion of the hllm~n ch~mokine polypeptides. The
antisense RNA oligonucleotide hybridizes to the mRNA in vivo
and blocks translation of the mRNA molecule into the
polypeptides (antisense - Okano, J. Neurochem., 56:560
(1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene
Expression, CRC Press, Boca Raton, FL (1988)). The
oligonucleotides described above can also be delivered to
cells such that the antisense RNA or DNA may be expressed in
vi~o to ; nh; h; t production of the hllm~n ch~okine
polypeptides.
Another potential human ~h~m~kine antagonist is a
peptide derivative of the polypeptides which are naturally or
synthetically modified analogs of the polypeptides that have
lost biological function yet still recognize and bind to the
receptors of the polypeptides to thereby effectively block
the receptors. Examples of peptide derivatives include, but
are not limited to, small peptides or peptide-like molecules.
The antagonists may be employed to inhibit the
chemotaxis and activation of macrophages and their
precursors, and of neutrophils, basophils, B lymphocytes and
some T cell subsets, e.g., activated and CD8 cytotoxic T
cells and natural killer cells, in certain auto-;mmllnP and
chronic inflam~atory and infective diseases. Examples of
auto-immllne diseases include multiple sclerosis, and insulin-
dependent diabetes.
The antagonists may also be employed to treat infectious
diseases including silicosis, sarcoidosis, idiopathic
plllm~n~ry fibrosis by preventing the recruitment and
activation of mononllrlear phagocytes. They may also be
employed to treat idiopathic hyper-eosinophilic syndrome by
-24-
CA 02210471 1997-08-08
W O 96/~4668
PCT~S9~101780
preventing eosinophil production and migration, Endotoxic
shock may also be treated by the antagonists by preventiny
the migration of ~acrophages and their production of the
hllm~n rh~mok; n~ polypeptides of the present invention.
The antagonists may also be employed for treating
atherosclero~i8, by preventing monocyte infiltration in the
artery wall,
The antagonists may also be employed to treat histamine-
m~ ted allergic reactions and im-m-lmological disorders
including late phase allergic reactions, chronic urticaria,
and atopic dermatitis by i nh~ h; ting ch~mnkine-induced mast
cell and basophil degranulation and release of hist~m; n~,
IgE-me~;~ted allergic reactions such as allergic asthma,
rhinitis, and eczem.a m.ay also be treated.
The antagonists m~y also be employed to treat chronic
and acute in~lam~tion by pre~enting the attraction of
monocytes to a wound area. They may also be employed to
regulate normal plllmnn~ry macrophage populations, since
chronic and acute inflammatory plllm~n~ry diseases are
associ.ated with sequestration of msnsnllrlear phagocytes in
the lung.
Antagonists m.~y also be employed to treat rheumatoid
arthritis by preventing the attraction of monocytes into
synovial fluid in the joints of patients. Monocyte influx
and activation plays a significant role in the pathogenesis
of both degenerative and inflammatory arthropathies.
The antagonists may be employed to interfere with the
deleterious cascades attributed prim,arily to IL-l and TNF,
which prevents the biosynthesis of other inflammatory
cytokines. In this way, the antagonists may be employed to
prevent inflammation. The antagonists may also be employed
to inhibit prostagl~n~ n-independent fever induced by
chl~m~kines.
-25-
CA 02210471 1997-08-08
W096/24668 PC~S95~0~780
The antagonists may also be employed to treat cases o~
bone marrow failure, for example, aplastic AnPm~ and
myelodysplastic syndrome.
The antagonists may also be employed to treat asthma and
allergy by preventing eosinophil accumulation in the lung.
The antagonists may also be employed to treat subepith~
basement membrane fibrosis which is a prom~n~nt feature o~
the asthmatic lung.
The antagonist~ may be employed in a composition with a
pharmaceutically acceptable carrier, e.g., as hereina~ter
described.
The human ch~okine polypeptides and agonists and
antagoni~ts may be employed in romh;nAtion with a suitable
pharmaceutical carrier. Such compositions comprise a
therapeutically ef~ective amount of the polypeptide, and a
pharmaceutically acceptable carrier or excipient. Such a
carrier includes but is not limited to SAl ~ne, buffered
saline, dextrose, water, glycerol, ethanol, and combinations
thereof. The formulation should suit the mode of
n~ stration .
The invention also provides a pharmaceutical pack or kit
comprisiny one or more contA~Pr~ ~illed with one or more of
the ingredients of the pharmaceutical compositions of the
invention. Associated with such contA~ner(s) can be a notice
in the form prescribed by a governmental agency regulating
the ma~ufacture, use or sale of phar~aceuticals or biological
products, which notice re~lects d~lo~al by the agency of
manu~acture, use or sale for human A~m; ni stration. In
addition, the polypeptides and agonists and antagonists may
be employed in conjunction with other therapeutic compounds.
The pharmaceutical compositions may be A~m1 n~ stered in
a convenient m~nner such as by the topical, intravenous,
intraperitoneal, intramuscular, intratumor, subcutaneous,
intr~n~l or intradermal routes. The pharmaceutical
compo~ition~ are ~min;stered in an amount which is e~ective
-26-
CA 02210471 1997-08-08
W 096124668
PCT~S9~ 780
for treating and/or prophylaxis of the specific indicatlon.
In general, the polypeptides will be ~*m; n~ stered in an
amount of at least about 10 ~g/kg body weight and in most
cases they will be ~m~n~tered in an amount not in excess of
about 8 mg/Kg body weight per day. In most cases, the dosage
i~ from about lQ ~g/kg to about 1 mg/kg body weight daily,
k; n~ into account the routes of ~-; n; ~tration, syn~toms,
etc.
The hl~-n chemokine polypeptide~, and agonists or
antagonists which are polypeptide~, may be employed in
accordance with the present invention by e~re~sion of such
polypeptide~ iR YiVo, which i~ often referred to a~ "gene
therapy n
Thus, for example, cells from a patient may be
engineered with a polynucleotide (DNA or RNA) en~oA;~g a
polypeptide ex vivo, with the engineered cells then being
provided to a patient to be treated with the polypeptide.
Such method8 are well-known in the art. For example, cells
may be enyineered by procedures known in the art by use of a
retroviral particle cQntA;n;ng RNA ~nr~;ng a polypeptide of
the present invention.
S;m;l~ly, cells may be engineered in vivo for
expre~sion of a polypeptide in vivo by, for example,
procedures known in the art. As known in the art, a producer
cell for producing a retroviral particle contA;n;ng RNA
encoding the polypeptide of the present invention may be
;n;~tered to a patient for engineering cells in vivo and
expression of the polypeptide in vivo. These and other
methods for A~m;n~tering a polypeptide of the present
invention by such method should be apparent to those skilled
in the art from the ~A~h;ngs of the present invention. For
example, the expression vehicle for engineering cells may be
other than a retrovirus, for example, an adenovirus which may
be used to engineer cells in vivo after comh~nAtion with a
~uitable delivery vehicle.
CA 02210471 1997-08-08
W O 96/24668 PCTnUS95101780
The sequences o~ the present invention are also valuable
for chromosome identification. The sequence is specifically
targeted to and can hybridize with a particular location on
an individual human chromosome. Moreover, there is a current
need for identifying particular sites on the chromosome. Few
chromo~ome marking reagents based on actual se~uence data
(repeat polymorphi~ms) are presently available for marking
chromosomal location. The mapping of DNAs to chromosomes
according to the present invention is an important ~irst step
in correlating those se9uences with genes associated with
disease.
Briefly, sequences can be mapped to chromosomes by
preparing PCR primers (preferably 15-25 bp) ~rom the cDNA.
Computer analysis of the 3' untranslated region is used to
rapidly select primers that do not span more than one exon in
the genomic DNA, thus complicating the amplification process.
These primers are then used.for PCR screening of somatic cell
hybrids cont~ining individual human chromosomes. Only those
hybrids contA;n~ng the human gene corresponding to the primer
will yield an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure
for assigning a particular DNA to a particular chromosome.
Using the present invention with the same oligonucleotide
primers, sublocalization can be achieved with panels of
fragments from specific chromosomes or pools of large genomic
clones in an analogous m~nn~, Other mapping strategies that
can similarly be used to map to its chromosome include in
situ hybridization, prescreening with labeled flow-sorted
chromosomes and preselection by hybridization to construct
chromosome specific-cDNA libraries.
Fluorescence in situ hybridization (FISH) of a cDNA
clones to a met~h~e chromosomal spread can be used to
provide a precise chromosomal location in one step. This
technique can be used with cDNA as short as 500 or 600 bases;
however, clones larger than that have a higher likelihood of
-28-
CA 02210471 1997-08-08
W096/24668 PCT~S95101780
hi n~i ng to a unique chromosomal location with su~ficient
signal intensity for simple detection. FISH requires use of
the clones from which the EST was derived, and the longer the
better. For example, 2,000 bp is good, 4,000 is better, and
more than 4,000 is probably not necessary to get good results
a reasonable percentage of the time. For a review o~ thi~
technique, see Verma et al., ~llm~n Ch~u~l~osomes: a ~nll~l of
Basic Techniques, Pel~d,.,o-l Press, New York (1988).
Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the
chromosome can be correlated with genetic map data. Such
data are found, for example, in V. McKusick, Men~elian
Inheritance in Man (available on line through Johns Hopkins
University Welch Medical Library). The relationship between
genes and diseases that have been mapped to the same
chromosomal region are then identified through linkage
analysis (coinheritance of.physically adjacent genes).
Next, it is necessary to determine the differences in
the cDNA or genomic sequence between affected and unaffec~ed
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then
the mutation is likely ~o be the causative agent of the
disease.
With current resolution of physical mapping and genetic
mapping techniques, a cDNA precisely localized to a
chromosomal region associated with the disease could be one
of between 50 and 500 potential causative genes. (This
assumes l megabase mapping resolution and one gene per 20
kb).
The polypeptides, their fragments or other derivatives,
or analogs thereof, or cells expressing them can be used as
an imm~lnogen to produce antibodies thereto. These antibodies
can be, for example, polyclonal or monoclonal antibodies.
The present invention also includes ch;m~ic, single chain,
and hllm~nized antibodies, as well as Fab fragments, or the
-29-
CA 02210471 1997-08-08
W O 96/24668
PCTnUS95/01780
product o~ an Fab expression library. various procedures
known in the art may be used for the production of such
antibodies and fragments.
Antibodies generated against the polypeptides
corresponding to a sequence of the present invention can be
obt~inP~ by direct injection of the polypeptides into an
~n;m~l or by ~m;ni stering the polypeptides to an ~nim~l,
preferably a nonhllm~n . The antibody so obtained will then
bind the polypeptides itself. In this m~nn~r, even a
sequence encoding only a fragment o~ the polypeptides can be
used to generate antibodies h; n~l ng the whole native
polypeptides. Such antibodies can then be used to isolate
the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any tech~ique
which provides ~nt ~ ho~; es produced by continuous cell line
cultures can be used. Examples include the hybrido
technique (Kohler and Milstein, 1975, Nature, 256:495-497),
the trioma technique, the human B-cell hybridoma technique
(Kozbor et al., 1983, Tmmllnology Today 4:72), and the EBV-
hybridoma technique to produce hum.~n monoclonal antibodies
(Cole, et al., 1985, in Monoclonal Antibodies and r~nc~
Therapy, Alan R. Liss, Inc., pp. 77-96).
Techniques described for the production of single chain
antibodies (U.S. Patent 4,946,778) can be adapted to produce
single chain antibodies to immnnogenic polypeptide products
of this invention. Also, transgenic mice may be used to
express h~lm~nized antibodies to immllnogenic polypeptide
products of this invention.
The present invention will be further described with
reference to the following examples; however, it is to be
understood that the present invention is not limited to such
examples. All parts or amounts, unless otherwise specified,
are by weight.
-30-
CA 022l047l l997-08-08
W O 96124668
PCT~S95101780
In order to ~acilitate underst~n~ng of the ~ollowing
examples certain frequently occurring methods and/or terms
will ~e described.
"Plasmids" are designated by a lower case p preceded
and/or followed by capital letters and/or numbers. The
starting plasmid~ herein are either ~omm~rcially available,
publicly aV~A;lAhle on an unrestricted basis, or can be
constructed from available plasmids in accord with published
procedures. In addition, equivalent pla~mid~ to those
described are known in the art and will be apparent to the
ordinarily ~killed arti~an.
"Digestion" of DNA refers to catalytic cleavage of the
DNA with a restriction enzyme that acts only at certain
sequence~ in the DNA. The various re~triction enzyme~ u~ed
herein are comm~rcially avail_ble and their reaction
conditions, cofactors and other requirements were used as
would be known to the ordinarily ~killed arti~an. For
analytical purposes, typically l ~g of plasmid or DNA
fragment is used with about 2 units of enzyme in about 20 ~l
of bu~er ~olution. For the purpo~e o~ i~olating DNA
fragments for plasmid construction, typically 5 to 50 ~g of
DNA are digested with 20 to 250 unit~ of enzyme in a larger
volume. Appropriate buffer~ and substrate amounts for
particular restriction enzyme~ are ~pecified by the
manufacturer. Incubation times of about l hour at 37~C are
ordinarily used, but may vary in accordance with the
supplier's instructions. After digestion the reaction is
electrophore~ed directly on a polyacrylamide gel to isolate
the desired fragment.
Size separation of the cleaved fragments is performed
using 8 percent polyacrylamide gel de~cribed by Goeddel, D.
et al ., Nucleic Acids Res., 8:4057 (1980).
"Oligonucleotides" refers to either a single strAn~e~
polydeoxynucleotide or two compl~m~ntAry polydeoxynucleotide
strands which may be chemically synthe~ized. ~uch synthetic
-31-
CA 02210471 1997-08-08
W096124668 PC~S95101780
oligonucleotides have no 5' phosphate and thus will not
ligate to another oligonucleotide without ~ g a phosphate
with an ATP in the presence of a kinase. A synthetic
oligonucleotide will ligate to a fragment that has not been
dephosphorylated .
"~igation" refers to the process of ~orming
phosphodiester bonds between two double stranded nucleic acid
fragments (Maniatis, T., et al., Id., p. 146). Unless
otherwise provided, ligation ,m,~y be accomplished using known
buffers and conditions with lO units to T4 DNA ligase
("ligase") per 0.5 ~g of approximately equimolar amounts of
the DNA fragments to be ligated.
Unle~ otherwise stated, transformation was performed as
described in the method of Graham, F. and Van der Eb, A.,
Virology, 52:456-457 (1973).
Exam~le l
Bacterial Ex~ression and Purification of Ck~
The DNA ~equence encoding for Ck~-ll, ATCC # 75948, is
initially amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' end sequences of the processed
Ck~-ll nucleic acid sequence (minus the putative signal
peptide sequence). Additional nucleotides corresponding to
the Ck~-ll gene are added to the 5' and 3' end seqllPnr~-
~respectively. The 5' oligonucleotide primer has the sequence
5' CCCGCATGCCAA~ L~GTGGCACCA 3' contains a SphI restriction
enzyme site (bold) followed by 18 nucleotides of Ck~-ll
coding sequence (underlined) starting from the second
nucleotide o~ the sequences rn~in~ for the mature protein.
The ATG codon is included in the SphI site. In the next
codon following the ATG, the first base is from the SphI site
and the rem~ining two bases correspond to the second and
third base of the first codon (residue 18) of the putative
mature protein. The 3' sequence 5'
CCCGGATCCCAATGCTTGACTCGGACT 3' ront~in~ complem~nt~ry
CA 02210471 1997-08-08
W O 96/24668
PCT/USg5/01780
seq~l~n~ C to a BamHl site (bold) and is followed by 18
nucleotides of gene specific se~n~fi preceding the
termination codon. The restriction enzyme _ites correspond
to the restriction enzyme sites on the bacterial expression
vector pQE-9 (Qiagen, Inc. Chat~worth, C~). pQ~-9 ~nco~
~nt;h~otic resistance (Ampr), a bacterial origin of
replication (ori), an IPTG-regulatable ~ro...oter operator
(P/O), a ribo80me h; n~; n~ site (RBS), a 6-His tag and
restriction enzyme sites. pQE-9 i8 then digested with SphI
and R, ~'1 . The ~rl;fied ~e~l~nc~Q are ligated into pQE-9
and are inserted in frame with the se~uence ~nroA;~ for the
histidine tag and the RBS. The ligation mixture is then used
to transform the E. coli ~train M15/rep 4 (Qiagen, Inc.) by
the procedure described in S~l,~ ook, ~. et al., Molecular
Cloning: A Laboratory ~nll~l, Cold Spring Laboratory Press,
(1989). M15/rep4 cont~;nQ multiple copies of the pl~Pr;A
pREP4, which expresse8 the lacI repressor and also confers
kanamycin resistance (Kanr). Transformants are i~nt;fied by
their ability to grow on ~B plate~ and ampic;ll;n/kanamycin
resistant colonies are selected. Plasmid DNA is isolated and
confirmed by restriction analysis. Clones cont~n~ng the
desired constructs are grown overnight (0/N) in liquid
culture in LB m~; A supplemented with both Amp (100 ug/ml)
and Ran ~25 ug/ml). The 0/N culture i8 used to inoculate a
large culture at a ratio of 1:100 to 1:250. The cells are
yl~.~ to an optical density 600 (O.D.~) of between 0.4 and
0.6. IPTG ("I~o~o~l-B-D-thiogalacto pyranoside~) is then
~e~ to a final conc~ntration of 1 mM. IPTG induces by
inactivating the lacI repressor, clearing the P/0 l~ ng to
increased gene expre sion. Cells are y ~.~ an extra 3 to 4
hours. Cells are then harvested by centrifugation. The cell
pelle~ is solubilized in the chaotropic agent 6 Molar
Guanidine HCl pH 5Ø ~fter clarification, solubilized Ck~-
11 is purified from this solution by chromatography on a
Nickel-Chelate column under conditions that allow for tight
CA 02210471 1997-08-08
W O 96/24668 PCTAUS9~101780
h;n-l~n~ by proteins ~ont;:l;n~ng the 6-His tag (Hochuli, E. et
al., J. a~"~tography 411:177-184 (1984)). Ck~-11 ( ~98~
pure) is eluted from the column in 6M guanidine HCl. Protein
renaturation out of GnHCl can be accomplished by several
protocols ~Jaenicke, R. and Rudolph, R., Protein Structure -
A Practical Approach, IRL Press, New York (1990)).
Initially, step dialysis is utilized to remove the GnHCL.
Alternatively, the purified protein isolated ~rom the Ni-
chelate column can be bound to a second column over which a
decreasing l~ne~r GnHCL gradient is run. The protein is
allowed to renature while bound to the column and is
subsequently eluted with a buffer con~;n~ng 250 mM
Imidazole, 150 mM NaC1, 25 mM Tris-HCl pH 7.5 and 10%
Glycerol. Finally, soluble protein is dialyzed against a
storage buffer cont~;ntng 5 mM ~m~on~um Bicarbonate.
Example 2
Bacterial ExDression and Purification of Ck~-1
The DNA ~equence encoding for Ck~-1, ATCC # 75947, is
initially amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' end sequences of the processed
Ck~-l nucleic acid se~uence (minus the putative signal
peptide sequence). Additional nucleotides corresponding to
Ck~-l are added to the 5' and 3' end se~l~nce~ respectively.
The 5' oligonucleotide primer has the sequence 5~
CCCGCATG~-l-l~-l~AGGTCTATTACACA 3' contains a SphI restriction
enzyme site (bold) followed by 21 nucleotides of Ck~-1 coding
sequence starting from the second nucleotide of the sequences
coding for the mature protein. The ATG codon is included in
the SphI site. In the next codon following the ATG, the
first base is from the SphI site and the rem~;n~ng two bases
correspond to the second and third base of the ~irst codon
(residue 23) of the putative mature protein. As a
consequence, the first base in this codon is changed from G
to C comr~ring with the original sequences, resulting in a
CA 02210471 1997-08-08
W 09612466~
P ~ nUS9~01780
Val to Leu ~ub~titution in the recorl~n~nt protein. The 3'
sequence 5' ~C~A-~C'~;~A~ AAAC 3~ contAin~
compl~ - t~y seqllPnr~fi to a BamH1 site (bold) and is
followed by 19 nucleotides of gene speci~ic ~equences
preceding the termination codon. The restriction enzyme
site~ corre~pond to the restriction enzyme ~ite~ on the
bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth,
CA). pQE-9 Pn~o~e~ A~t;h~otic resistance (Ampr), a bacterial
origin of replication (ori), an IPTG-re~llAt~hle promoter
operator (P/0), a ribo~ome h;nn;n~ site (RBS), a 6-His tag
and restriction enzyme ~ite~. pQ~-9 i~ then digested with
SphI and R~l, The amplified ~eqll~nce~ are ligated into
pQE-9 and are inserted in frame with the se~uence PnrO~i
for the hi~tidine tag and the RBS. The ligation mixture is
then used to transform the ~. coli M15/rep 4 (Qiagen, Inc.)
by the procedure de~cribed in Sambrook, J. et al., Molecular
Cloning: A Laboratory M~n~ , Cold Spring Laboratory Press,
(lg89). M15/rep4 cont~;nC multiple copie~ of the p~
pREP4, which expresses the lacI repressor and also confers
k~nA~ycin resi~tance (Kanr). Transformant~ are identified by
their ability to grow on LB plate~ and ampicillin/kanamycin
resi~tant colonies are selected. Plasmid DNA is isolated and
confinmed by re~triction analysis. Clone~ contA;n;ng the
desired con~truct~ are grown overnight (0/N) in liquid
culture in LB mP~; A supplemented with both Amp (100 ug/ml)
and ~an (25 ug/ml). The 0/N culture i~ used to inoculate a
large culture at a ratio of 1:100 to 1:250. The cell~ are
grown to an optical density 600 (O.D.~) of between 0.4 and
0.6. IPTG ("I~o~yl-B-D-thiogalacto pyrano~ide") is then
AA~P~ to a final concentration of 1 mM. IPTG ;n~llrP~ by
inactivating the lacI repre~sor, clearing the P/0 leading to
increa~ed gene expre~~ion. Cells are y. o;~n an extra 3 to 4
hour~. Cell~ are then harvested by centrifugation. The cell
pellet i~ ~olubilized in the chaotropic agent 6 Molar
Guanidine HCl pH 5Ø After clarification, ~olubilized Ck~-1
CA 02210471 1997-08-08
W 096t24668 PCT~US9S~27
is purified from this solution by chromatography on a Nickel-
Chelate column under conditions that allow for ti~ht h; n~ ng
by proteins cont~in~ng the 6-His tag (Hochuli, E. et al., ~.
C~ "~tography 411:177-184 (1984)). Ck~ 98~ pure) is
eluted ~rom the column in 6M guanidine HCl. Protein
renaturation out of GnHCl can be accomplished by several
protocol~ ~Jaenicke, R. and Rudolph, R., Protein Structure -
A Practical Approach, IRL Press, New York (1990)).
Initially, step dialysi8 is utilized to remove the GnHCL.
Alternatively, the purified protein isolated from the Ni-
chelate column can be bound to a second column over which a
decreasing linear GnHCL gradient is run. The protein is
allowed to renature while bound to the column and is
subsequently eluted with a bu~fer cont~;n~ng 250 mM
Imidazole, 150 m.M NaCl, 25 mM Tris-HCl pH 7.5 and 10%
Glycerol. ~inally, soluble protein is dialyzed against a
storage bu~fer contA~n~ng 5 mM Pmmontum Bicarbonate.
Exam~le 3
Expression of Recom~inant Ck~-11 in COS cells
The expression of plasmid, Ck~-11 HA is derived ~rom a
vector pcDNAI/Amp (Invitrogen) cont~n~ng: 1) SV40 origin of
replication, 2) ampic~ll tn resistance gene, 3) B.coli
replication origin, 4) CMV promoter followed by a polylinker
region, a Sv40 intron and polyadenylation site. A DNA
fragment encoding the entire Ck~-ll precursor and a HA tag
fused in frame to its 3' end is cloned into the polylinker
region of the vector, therefore, the recomh~n~nt protein
expression is directed under the CMV promoter. The HA tag
correspond to an epitope derived from the in~luenza
hemagglutinin protein as previously described (I. Wilson, H.
Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner,
1984, Cell 37, 767). The infusion of HA tag to the target
protein allows easy detection of the recombinant protein with
an antibody that recognizes the HA epitope.
-36-
CA 02210471 1997-08-08
W096/24668 PCT~S95/01780
The plasmid construction strategy is described as
follows:
The DNA sequence encoding ~or Ck,B-11, ATCC # 75948, i~;
constructed by PCR using two primers: the 5' primer si
AAAAAGCTTGCCATGGCCCTGCTACTG 3~ ~ntA; n~ a HindIII site
followed by 18 nucleotides of Ck~-11 coding sequence starting
from the minus 3 position relative to initiation codon; the
3~ seguence 5'CGCT~T~ TTAAGCGTAGT~ ACGTCGTATG>ATAGGTTA
ACTGCTGCGAC 3' contains compl~m~nt~y sequences to an XbaI
site, translation stop codon, HA tag and the last 18
nucleotides o~ the Ck~-11 coding sequence (not including the
stop codon). Therefore, the PCR product contains a HindIII
site, Ck~-11 coding se~uence followed by HA tag fused in
~rame, a tran~lation termination stop codon next to the HA
tag, and an XbaI site. The PCR amplified DNA ~ragment and
the vector, pcDNAI/Amp, are digested with HindIII and XbaI
restriction enzyme and ligated. The ligation mixture is
transformed into E. coli strain SURE (Stratagene Cloning
Systems, La Jolla, CA) the transformed culture is plated on
ampicillin media plates and resistant colonies are selected.
Plasmid DNA is isolated from transformants and e~m;ne~ by
restriction analysis for the presence of the correct
fragment. For expre~sion of the recom~inant Ck~-11, COS
cells are transfected with the expression vector by DEAE-
DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis,
Molecular Cloning: A Laboratory ~n~ , Cold Spring
Laboratory Press, (1989)). The expression of the Ck~-11 HA
protein is detected by radiolabelling and ~mmllnoprecipitation
method (B. Harlow, D. Lane, Antibodies: A Laboratory ~n~
Cold Spring Harbor Laboratory Press, (1988)). Cells are
labelled for 8 hours with 35S-cysteine two days post
transfection. Culture media are then collected and cells are
lysed with detergent (RIPA buffer (150 mM NaCl, 1~ NP-40,
0.1% SDS, 1% NP-40, 0.5~ DOC, 50mM Tris, pH 7.5). (Wilson, I.
et al., Id. 37:767 (1984)). Both cell lysate and culture
-37-
CA 02210471 1997-08-08
W O 96/24668 PCTlUS9~178D
mP~ are precipitated with a HA specific monoclonal
~nt;hoAy, Proteins precipitated are analyzed 3)y SDS-PAGE.
ExamPle 4
ExDression of Recombinant Ck~-1 in COS cells
The expression of plasmid, Cka-1 HA is derived ~rom a
vector pcDNAI/Amp (Invitrogen) cont~'n;ng: 1) SV40 origin of
replication, 2) ampi~ n resistance gene, 3) E.coli
replication origin, 4) CMV promoter ~ollowed by a polylinker
region, a SV40 intron and polyadenylation site. A DNA
fragment encoding the entire Ck~-1 precursor and a HA tag
fused in frame to its 3' end is cloned into the polylinker
region of the vector, therefore, the rec~mh;n~nt protein
expression is directed under the CMV promoter. The HA tag
correspond to an epitope derived from the influenza
hemagglutinin protein as previously described (I. Wilson, H.
Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner,
1984, Cell 37, 767). The infusion of HA tag to the target
protein allows easy detection of the re~mh;n~nt protein with
an ~nt; ho~y that recognizes the HA epitope.
The plasmid construction strategy is described as
follow~:
The DNA sequence encoding ~or Ck~-1, ATCC # 75947, is
constructed by PCR using two primers: the 5' primer 5'
AAAAAGCTTAGAATGAAGTTCATCTCG 3' contains a HindIII site
followed by 18 nucleotides of Cka-l coding sequence starting
from the minus 3 position relative to the initiation codon;
the 3' sequence 5' CGCTCTAGATTAAGCGTAGTCTGGGACGTCGTAl~lAG
GG~ -l-l 3' contains complPmpnt~ry sequences to an XbaI
site, translation stop codon, HA tag and the last 18
nucleotides of the Ck~-1 coding sequence (not including the
stop codon). Therefore, the PCR product contains a HindIII
site, Cka-1 coding sequence followed by HA tag fused in
frame, a translation termination stop codon next to the HA
tag, and an XbaI site. The PCR amplified DNA fragment and
-38-
CA 02210471 1997-08-08
WO 96124668
PCT/us9s~al78a
the vector, pcDNAI/Amp, are digested with HindIII and an XbaI
restriction enzyme and liyated. The ligation mixture i~
tran~ormed into E. coli strain SURE (Stratagene ~loning
Systems, ~a Jolla, CA) the trans~onmed culture is plated on
ampic;ll;n ~e~;~ plates and re~istant colonies are selected.
Plasmid DN~ is isolated from transformants and P~m; nP~ by
restriction analysi~ for the presence of the correct
fragment. For expres~ion of the reComLhin~nt Ck~-1, COS cells
are transfected with the expression vector by DEAE-DEXTRAN
method (~. Sambrook, E. Fritsch, T. Maniati~, Mol~r~ r
Cloning: A Laboratory ~nll~l, Cold Spring Laboratory Press,
(1989)). The expression of the Ck~-1 HA protein is detected
by radiol~hPll;n~ and i~m~lnoprecipitation method (E. Harlow,
D. Lane, ~nt;hofl;es: A Laboratory ~ml~l, Cold Spring Harbor
Laboratory Press, (1988)). Cells are 1 ~h~l 1 ed for 8 hours
with 35S-cysteine two days post transfection. Culture media
are then collected and cells are lysed with detergent ~RIPA
bu~er (150 mM NaCl, 1% NP-40, 0.1% SDS, 1~ NP-40, 0.5~ DOC,
50mM Tris, pH 7.5). (Wilson, I. et al., Id. 37:767 (1984)).
Both cell lysate and culture media are precipitated with a HA
~pecific monoclonal antibody. Proteins precipitated are
analyzed by SDS-PAGE.
Example 5
Cloninq and expression of Ck~-11 usinq the baculovirus
expression sYstem
The DNA sequence encoding the full length Ck~-11
protein, ATCC # 75948, is a~p1ified using PCR oligonucleotide
primers corresponA~n~ to the 5' and 3' seqll~n~ps of the gene:
The 5' primer has the sequence 5' cGr~r5~ccGccATcATG
GCCCTGCTACTGGCCCT 3' and c~nt~i ns a BamHI restriction enzyme
site (in bold) followed by 6 nucleotides resPmhl ~ ng an
efficient signal for the initiation of translation in
eukaryotic cells (Kozak, M., ~. Mol. Biol., 196:947-950
(1987) which is just behind the first 20 nucleotides of the
-39-
CA 02210471 1997-08-08
W 096/24668 PCTrUS9001780
Ck~-11 gene (the initiation codon for translation "ATG" is
underlined).
The 3' primer has the sequence 5~
CGGCGGTACCTGGCTGCACGGTCCATAGG 3' and cont~in~ the cleavage
~;ite i~or the restriction ention-7~lease A8p781 aIld 19
nucleotides complement~ry to the 3' non-translated sequence
of the Ck~-11 gene. The amplified sequences are isolated
~rom a 1~ agarose gel using a co~m~rcially available kit
("Geneclean," BIO 101 Inc., La ~olla, Ca.). The fragment is
then digested with the ~n~on~lcleases BamHI and Asp781 and
then purified again on a 1~ agarose gel. This ~ragment is
designated F2.
The vector pRG1 (modification of pVL941 vector,
discussed below) is used ~or the expression of the Ck~
protein using the baculovirus expression system (for review
see: Summers, M.D. and Smith, G.E. 1987, A m~nll~l of methods
for baculovirus vectors and insect cell culture procedures,
Texas Agricultural Exper~mPnt~l Station Bulletin No. 1555).
This expression vector cont~; n.C the strong polyhedrin
promoter of the Autographa californica nuclear polyhedrosis
virus (AcMNPV) followed by the recognition sites for the
restriction ~n~onll~leaseS BamHI and Asp781. The
polyadenylation site of the simian virus (SV)40 is used ~or
efficient polyadenylation. For an easy selection of
recombinant viruses the beta-galactosidase gene ~rom E.coli
is inserted in the same orientation as the polyhedrin
promoter followed by the polyadenylation signal of the
polyhedrin gene. The polyhedrin sequences are flanked at
both sides by viral sequences for the cell-mediated
homologous recombination of cotransfected wild-type viral
DNA. Many other baculovirus vectors could be used in place
of pRG1 such as pAc373, pVL941 and pAcIM1 (Luckow, V.A. and
Summers, M.D., Virology, 170:31-39).
The plasmid is digested with the restriction enzymes
BamHI and Asp781 and then dephosphorylated using calf
-40-
CA 02210471 1997-08-08
W O 96124668
PCTlUSg~0]78D
intestinal phosphatase by procedures known in the art. The
DNA is then isolated from a 1~ agarose gel using the
co~ercially available kit ("Genecleanll BIO 101 Inc., La
Jolla, Ca.). This vector DNA is designated V2.
Fragment F2 and the dephosphorylated plasmid V2 are
ligated with T4 DNA ligase. E.coli HB101 cell~ are then
transformed and bacteria i~nt;fied that contained the
plasmid (pBac-Ck~-11) with the CK~-11 gene using the enzymes
BamHI and Asp781. The sequence of the cloned ~ragment is
confirmed by DNA se~l~ncing.
5 ~g of the plasmid pBac-CK~-11 is cotransfected with
1.0 ~g of a ~omm~rcially aV~ hl e l;ne~rized baculo~rirus
(IlBaculoGold~ baculovirus DNA", Pharmingen, San Diego, CA.)
u~ing the lipofection method (~elgner et al. Proc. Natl.
Acad. Sci. USA, 84:7413-7417 (1987)).
l~g of BaculoGold~ virus DNA and 5 ~g of the plasmid
pBac-CK~-11 are mixed in a sterile well of a mlcrotiter plate
cont~;n;n~ 50 ~l of serum free Grace's medium (Life
Technologies Inc., Gaithersburg, MD). Afterwards lO ~l
Lipofectin plus 90 ~1 Grace's medium are ~PA, m~ ~eA and
incubated for 15 minutes at room temperature. Then the
transfection mixture is added ~lo~ise to the Sf9 insect
cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate
with lml Grace's medium without serum. The plate is rocked
back and ~orth to mix the newly ~ solution. The plate is
then incubated for 5 hours at 27~C. After 5 hours the
transfection solution is lc.~.o~ed from the plate and 1 ml of
Grace's insect medium supplemented with 10% fetal calf serum
is ~ . The plate is put back into an incubator and
cultivation continued at 27~C for four days.
After four days the supernatant i~ collected and a
plaque assay performed s;m;l~r as described by Summers and
Smith (supra). As a modification an agarose gel with IlBlue
Gal" tLife Technologies Inc., Gaithersburg) i8 used which
allows an easy isolation of blue stained plaques. (A
CA 02210471 1997-08-08
W O 96t24668 PCT~USgSJ~7
detailed description of a "plaque assay~ can also be ~ound in
the u~er's guide for insect cell culture and baculovirology
distributed by Life Technologies Inc., Gaithersburg, page 9-
10) .
Four days after the serial dilution, the viruses are
~e~ to the cells and blue st~ ne~ plaques are picked with
the tip of an ~ppendorf pipette. The agar cont~n1ny the
recomhin~nt viruses is then re8uspended in an Eppendorf tube
cont~;n~ng 200 ~l of Grace's medium. The agar is l~-.,~ved by
a brief centrifugation and the ~upernatant c~nt~; n; ng the
reCo~mh;n~nt baculovirus is used to infect Sf9 cells seeded in
35 mm ~hes~ Four days later the supernatants of these
culture ~ hF~F: are harvested and then stored at 4~C.
Sf9 cells are grown in Grace's medium supplemented with
10% heat-inactivated FBS. The cells are infected with the
recomh;n~nt baculovirus V-CK~-11 at a multiplicity of
infection (MOI) of 2. Six hours later the medium is removed
and replaced with SF900 II medium minus methionine and
cysteine (Life Technologies Inc., Gaithersburq). 42 hours
later 5 ~Ci of 35S-methionine and 5 ~Ci 35S cysteine (Amersham)
are ~ . The cells are further incubated for 16 hours
before they are harvested by centrifugation and the labelled
proteins visualized by SDS-PAGE and autoradiography.
Example 6
Cloninq and exPression of Ck~-1 usinq the baculovirus
exPre~ion system
The DNA sequence encoding the full length Ck~-1 protein,
ATCC # 75947, is amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene:
The 5' primer has the sequence 5' GCC~TCCGCCATC
ATGAAGTTCATCTCGACATC 3' and r~nt~;n~ a BamHI restriction
enzyme ite (in bold) followed by 6 nucleotides re~emhl;ng an
efficient signal for the initiation of translation in
eukaryotic cells (Kozak, M., J. Mol. Biol., 196:947-950
-42-
CA 02210471 1997-08-08
W O 96/24668
PCTrU~9~D~78D
(1987) which is just hPhin~ the first 20 nucleotides of the
Cka-1 gene (the initiation codon ~or translation ~ATG~ is
underli n~
The 3' primer has the sequence 5' CGCGGGTACCGG
GTGG~AA 3' and cont~n~ the cleavage site for the
restriction Pn~nllrlease ASp781 (in bold) and 17 nucleotides
complementary to the 3' non-translated sequence of the Ck~-1
gene. The ampli~ied sequences are isolated from a 1% agarose
gel using a cqmmPrcially av~ hle kit ("Geneclean," BI0 101
Inc., La Jolla, Ca.). The fragment is then digested with the
en~Qnllcleases BamHI and Asp781 and then purified again on a
1~ agarose gel. This fragment is designated F2.
The vector pRG1 (modification of pVL941 vector,
discussed below) is used for the expression of the Ck~-1
protein using the baculovirus expression gystem (for review
see: Summers, M.D. and Smith, G.E 1987, A m~nll~l of methods
for baculovirus vector~ and insect cell culture procedures,
Texas Agricultural Exper~mPntAl Station Bulletin No. 1555).
This expres~ion vector contA~n~ the strong polyhedrin
promoter of the Autographa californica nuclear polyhedrosis
virus (AcMNPV) followed by the recognition sites for the
restriction ~n~nnllcleases BamHI and Asp781. The
polyadenylation site of the simian virus (SV)40 is used for
efficient polyadenylation. For an easy selection of
recombinant viruses the beta-galactosidase gene from E.coli
is inserted in the same orientation as the polyhedrin
~ L-oter followed by the polyadenylation signal of the
polyhedrin gene. The polyhedrin sequences are flanked at
both sides by viral sequences for the cell-m~ ted
homologous recomh~n~tion of cotransfected wild-type viral
DNA. Many other baculovirus vectors could be used in place
of pRG1 such as pAc373, pVL941 and pAcIM1 (Luckow, V.A. and
Summers, M.D., Virology, 170:31-39).
The plasmid is digested with the restriction enzymes
BamHI and Asp781 and then dephosphorylated using calf
-43-
CA 02210471 1997-08-08
W O 96/24668
PCT~Ss~1780
intestinal phosphatase by procedures known in the art. The
DNA i~ then isolated from a 1% agarose gel using the
commercially av~ ble kit ("Geneclean" BIO 101 Inc., La
Jolla, Ca.). This vector DNA is designated v2.
Fragment F2 and the dephosphorylated plasmid V2 are
ligated with T4 DNA ligase. E.coli B 101 cells are then
transformed and bacteria identified that contained the
plasmld (pBac-Ck~-1) with the Ck~-1 gene using the enzymes
BAmHI and Asp781. The sequence of the cloned fragment is
confirmed by DNA se~lPncing.
5 ~g of the plasmid pBac-Ck~-1 is cotransfected with 1.0
g of a comm~rcially av~ hl e 1ine~ized baculovirus
("BaculoGold~ baculovirus DNA", Phanmingen, San Diego, CA.)
using the lipofection method ~Felgner et al. Proc. Natl.
Acad. SCi. USA, 84:7413-7417 (1987)).
l~g of BaculoGold~ ~irus DNA and 5 ~g of the plasmid
pBac-Ck~-1 are mixed in a sterile well of a microtiter plate
~nnt~tntng 50 ~l of serum free Grace~s medium ~hife
Technologies Inc., Gaithersburg, MD). Afterwards 10 ~l
~ipofectin plus 90 ~l Grace's medium are ~e~ ~e~ and
incu~ated for 15 minutes at room temperature. Then the
trans~ection mixture is added ~ .ise to the Sf9 insect
cell~ (ATCC CRL 1711) seeded in a 35 mm tissue culture plate
with lml Grace's medium without serum. The plate is rocked
back and forth to mix the newly added solution. The plate is
then incubated for 5 hours at 27~C. After 5 hours the
trans~ection solution is removed from the plate and 1 ml of
Grace's insect medium supplemented with 10~ fetal calf serum
is ~e~. The plate is put back into an incubator and
cultivation continued at 27~C for four day~.
After four days the supernatant is collected and a
pla~ue assay performed stm; 1 ~r as described by Summers and
Smith (supra). As a modification an agarose gel with "Blue
Gal" (Life Technologies Inc., Gaithersburg) i~ used which
allows an easy isolation of blue st~i ned plaques. (A
-44-
CA 02210471 1997-08-08
W096~668 PCT~S95101~80
detailed description of a "plaque assay~' can also be ~ound in
the user's guide for insect cell culture and baculovirology
distributed by Life Technologies Inc., Gaithersburg, page 9-
10) .
Four days after the serial dilution, the viruses are
~e~ to the cells and blue st~; n~ pla~ues are picked with
the tip of an Eppendorf pipette. The agar cont~; ni ng the
rec~mb;n~nt viruses is then resuspended in an Eppendorf tube
contA;n;ng 200 ~l of Grace's medium. The agar is .e.l.o~ed by
a brief centrifugation and the supernatant cnnt~ining the
recomh;n~nt baculovirus is used to infect Sf9 cells seeded in
35 mm dishes. Four days later the supernatants of these
culture ~ h~$: are harvested and then stored at 4~C.
Sf9 cells are grown in Grace's medium supplemented with
10% heat-inactivated FBS. The cells are infected with the
recombinant baculovirus V-Cka-l at a multiplicity of
infection (MOI) of 2. Six hours later the medium is removed
and replaced with SF900 II medium minus methionine and
cysteine (Life Technologies Inc., Gaithersburg, MD). 42
hours later 5 ~Ci of 35S-methionine and 5 ~Ci 35S cysteine
(Amersham) are ~ . The cells are further incubated for 16
hours before they are harvested by centrifugation and the
labelled proteins visualized by SDS-PAGE and autoradiography.
Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
there~ore, within the scope of the appended cl~im~, the
invention m~y be practiced otherwise than as particularly
described.
CA 02210471 1997-08-08
W0~6/24668 PCT~S95)017X~
SEQUENCE LISTING
(1) r7RNRR~L INFORMATION:
(i) APPLICANT: LI, ET AL.
(ii) TITLE OF lNV~NllON: ~llm~n rhpm~kine Be~a-ll and
~llm~n ~h~m~kine Alpha-l
(iii) NUMBER OF SE~u~N~S: 16
(iv) CORRESPON~ Ann~R~s:
(A) ~nn~ SEE: CARELLA, BYRNE, BAIN, GILFILLAN,
CECCHI, STEWART & OhSTEIN
(B) ~'lK~-l: 6 BECKER FARM ROAD
(C) CITY: ROS~r-~ND
(D) STATE: h-EW JERSEY
(E) ~OUN'1'~Y: USA
(F) ZIP: 07068
(v) COM~uI~K READABLB FORM:
(A) MEDI~M TYPE: 3.5 INCH DISKETTE
(B) COM~U'1~K: IBM PS/2
(C) OPERATING SYSTEM: MS-DOS
(D) SOFTWARE: WORD PERFECT 5.l
(vi) CURR~NT APPLICATION DATA:
(A) APPhICATION NUMBER:
(B) FILING DATE: Con~ tly
(C) CLASSIFICATION:
~vii) PRIOR APPLICATION DATA
(A) APPhICATION NUMBER:
(B) FILING DATE:
-46-
=
CA 02210471 1997-08-08
W 096/24668 PCTrUS95/01780
d ~ iled description of a "plaque assay~ can also be found in
the ~ er's guide for insect cell culture and baculovirology
distributed by Life Technologies Inc., Gaithersburg, page 9-
10~
Four ~ays after the serial dilution, the viruses are
~ to the~cells and blue stA;ne~ pla~ues are picked with
the tip of an Eppendorf pipette. The agar contA;n~ng the
reromhinAnt vi~uses is then resuspended in an Eppendorf tube
cont~;n;ng 200 ~ of Grace's medium. The agar is removed by
a brief centrifu~ation and the supernatant cont~ n; ng the
reco~h;n~nt baculo~irus is used to infect Sf9 cells seeded in
35 mm dishes. Fou~ days later the supernatants of these
culture ~sh~s are h~rvested and then stored at 4~C.
Sf9 cells are grown in Grace's medium supplemented with
10~ heat-inactivated F~S. The cells are infected with the
recomhin~nt baculovirus~; V-Ck~-1 at a multiplicity of
infection (MOI) of 2. Sixt~hours later the medium is removed
and replaced with SF900 ~ medium minus methionine and
cysteine (Life Technologies ~Inc., Gaithersburg, MD). 42
hours later 5 ~Ci o~ 35S-meth~on; n~ and 5 ~Ci 35S cysteine
(Amersham) are ~P~. The cells~-are further incubated for 16
hours before they are harvested~by centrifugation and the
labelled proteins visualized by SDS~PAGE and autoradiography.
Numerous modifications and var~iations of the present
invention are possible in light of th~e above teachings and,
therefore, within the scope of the ~ppended claims, the
invention may be practiced otherwise ~an as particularly
described
-45-
CA 022l047l l997-08-08
WO96/24668 PCT~S95101~80
(Viii) A1-1OKN~/AGENT INFORMATION
(A) NAME: FERRARO, GREGORY D.
(B) REGISTRATION N ~3ER: 36,134
(C) R~N~/DOCKET NUMBER 325800-272
(iX) TELECOMMUNICATION INFORMATION:
(A) TEL~N~ 201-994-1700
(B) TEL~FAX: 201-994-1744
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQu~;N~:~; C~Z~Ri~rTERISTICS
(A) L~N~1n 297 BASB PAIRS
(B) TYPE: NUCLEIC ACID
(C) ST~Nn~n~S: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE CDNA
(Xi) SE~N~ DESCRIPTION: SEQ ID NO:1:
ATGGCCCTGC TACTGGCCC~ CAGCCTGCTG L-llC'l~ CCC~AGC CCCAACTCTG 60
AGTGGCACCA ATGAAGCTGA AGACTGCTGC L~ ~-l~l~A CCCAGAAACC CAl-CCL-lL;LG 120
TACATCGTGA GGAACTTCCA CTACL-l-l--lC ATCAAGGATG G~TGCAGGGT GCCTGCTGTA 180
G'l-l~ACCA CACTGAGGGG CCGCCAGCTC TGTGCACCCC C~GACCAGCC CTGGGTAGA~ 240
CGCATCATCC AGAGACTGCA GAGGACCTCA GCCAAGATGA AGCGCCGCAG CAGTTAA 297
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQU~N~ CHARACTERISTICS
(A) LISNC~1~: 98 AMINO ACIDS
(B) TYP~3: AMINO ACID
(C) ST~PN~ S:
(D) TOPOLOGY: T.TNRZI~
(ii) MOLECULE TYPE PROTEIN
CA 022l047l l997-08-08
W 096/24668 PCT~US95/01780
(xi) SEQu~N~ DESCRIPTION: SEQ ID NO:2:
Met Ala Leu Leu Leu Ala Leu Ser Leu Leu Val Leu Trp Thr Ser
-15 -10 -5
Pro Ala Pro Thr Leu Ser Gly Thr Asn Glu Ala Glu Asp Cys Cys
1 5 10
Leu Ser Val Thr Gln Lys Pro Ile Pro Gly Tyr Ile Val Arg Asn
Phe HiS Tyr Leu Leu Ile Lys Asp Gly Cys Arg Val Pro Ala Val
. 35 40
Val Phe Thr Thr Leu Arg Gly Arg Gln Leu Cys Ala Pro Pro Asp
Gln Pro Trp Val Glu Arg Ile Ile Gln Arg Leu Gln Arg Thr Ser
60 65 70
Ala Lys Met Lys Arg Arg Ser Ser
75 80
~2) lN~'O~ SATION FOR SEQ ID NO:3:
(i) SEQU~N~ CHAR~CTERISTICS
(A) LENGTH: 333 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRPNnT~n~.~S: SINGLE
(D) TOPOLOGY: T.TNR~R
(ii) MOLECULE TYPE: cDNA
(xi) SEyu~N~ DESCRIPTION: SEQ ID NO:3:
ATGAAGTTCA TCTCGACATC TCTGCTTCTA ATGCTGCTGG TCAGCACCTC TCTCCAGTCC 60
AAG~l~l-l~l GGAGGTCTAT TAACACAAGC TTGAGGTGTA GAl~lG'lC~A AGAAGAAGCT 120
CA~l~-Ll-lAT CCCTAGACGC TTCATTGATC GAATTCAAAT CTTGGCCCCG TGGGAATGGT 180
TGTCC~AGAA AAGA~ATCAT A~l~-l~AAG AAGAACAAGT CAAl-l~l-~lG TGTGGACCCT 240
CAAGCTGAAT GGGTACAAAG A~TGATGGAA GTATTGAGAA AAAGAAGTTC TTCAACTCTA 300
CCAGTTCCAG TGl-l-lAAGAG AAAGATTCCC TGA 333
-48-
CA 02210471 1997-08-08
W096/24668 PCT~S95101780
(2) INFORMATION FOR SE:Q ID NO: 4:
(i) SEQu~ CHARACTERISTICS
(A) L~;N~1~: 10 9 AMINO ACIDS
(B) T~YPE: AMINO ACID
(C) STR~N~ S,~:
(D) TOPOLOGY T.T~l;~Z~
(ii) MOLECULE TYPE: PROTEIN
(xi) SE~u~L~ DESCRIPTION: SEQ ID NO:4:
Met ~yS Phe Ile Ser Thr Ser Leu heu Leu Met Leu ~eu Val Ser
-20 -15 -l0
Ser Leu Ser Pro Val Gln Gly Val Leu Glu Val Tyr Tyr Thr Ser
-5 l 5
Leu Arg ~ys Arg Cys Val Gln Glu Ser Ser Val Phe Ile Pro Arg
Arg Phe Ile ASp Arg Ile Gln Ile ~eu Pro Arg Gly Asn Gly CyS
Pro Arg Lys Glu Ile Ile Val Trp Lys Lys Asn Lys Ser Ile Val
Cys Val Asp Pro Gln Ala Glu Trp Ile Gln Arg Met Met Glu Val
Leu Arg ~ys Arg Ser Ser Ser Thr Leu Pro Val Pro Val Phe Lys
70 75 80
Arg Lys Ile Pro
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS
(A) L~l~: 27 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANv~vN~SS: SINGLE
(D) TOPOLOGY: LINEAR
-49-
CA 02210471 1997-08-08
W 096/24668 PCTrUS95/017X0
(ii) MOLECUhE TYPE: Oligonucleotide
(xi) SEQu~ DESCRIPTION: SEQ ID NO:5:
CCCGCATGCC A~ ~-l~AGT GGCACCA 27
(2) INFORMATION FOR SEQ ID NO:6:
(i) SE~u~N~ CHAR~CTERISTICS
(A) hENGTH: 27 BASB PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRZ~)~nNR.ss: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SE~u~N~ DESCRIPTION: SEQ ID NO:6:
TCcc AATGCTTGAC TCGGACT 27
(2) INFORMATION FOR SEQ ID NO:7:
(i) SE~;?u~sN~ RP,~'TERISTICS
(A) LENGTH: 30 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STR~NDEDNESS: SINGLE
(D) TOPOLOGY: T.TNli~R
(ii) MOLECULE TYPE': Oligonucleotide
(xi) S~YU~N~ DESCRIPTION: SEQ ID NO:7:
CCCGCATGCC ~ l~GA~GT CTATTACACA 30
(2) lN~ ~TION FOR SEQ ID NO:8:
-50-
CA 02210471 1997-08-08
W 096/24668 PCTrUS95101780
(i) SEyu~Nc~ CHARACTERISTICS
(A) LENGTH: 28 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STR~Nn~n~SS: SINGLE
(D) TOPOLOGY: T.TNRZ~
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEc~u~N~ DESCRIPTION: SEQ ID NO:8.
c~ ~TCCG GGAAlc-l-l-lc TCTTAAAC 28
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 27 BASE PAIRS
~B) TYPE: NUCLEIC ACID
(C) STR~Nn~nNR-~S: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SE~u~Nc~ DESCRIPTION: SEQ ID NO:9:
AAAAAGCrTG CCATGGCCCT GCTACTG 27
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 57 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: T~Tl~Z~R
(ii) MOLECULE TYPE: Oligonucleotide
-51-
CA 02210471 1997-08-08
W 096/24668 PCTrUS95/01780
(Xi) SEQU~r~ ; DESCRIPTION SEQ ID NO:10:
CG~-l~-lAGAT TAAGCGTAGT CTGGGACGTC GTATGGGTAT AGGTTAACTG CTGCGAC 57
~2) 1N~Okl-lATION FOR SEQ ID NO:11
(i) SEQU~N~ CHARACTERISTICS
(A) LENGTH: 27 BASE PAIRS
(B) TYPE NUCLEIC ACID
(C) STRPN~ J~-SS SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQu~N~ DESCRIPTION SEQ ID NO 11
AAAAAGCTTA GAATGAAGTT CATCTCG 27
(2) 1N~O~ ~TION FOR SEQ ID NO: 12:
(i) SEQUENCE CHARACTERISTICS
(A) L~N~1~: 54 BASE PAIRS
(B) TYPE NUCLEIC ACID
(C) STR~NV~V~SS SINGLE
(D) TOPOLOGY T.TNRZ~l~
(ii) MOLECULE TYPE: Oligonucleotide
(Xi) SEQUENCE DESCRIPTION SEQ ID NO: 12:
CGCTCTAGAT TAAGCGTAGT CTGGGACGTC GTATGGGTAG GGAAl~-l-l-lC TCTT 54
(2) INFORMATION FOR SEQ ID NO :13:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH 36 BASE PAIRS
-52-
CA 02210471 1997-08-08
W O g6/24668 PCTnUS95/01780
~B) TYPE: NnUCLEIC ACID
(C) STRANDEDNESS: SINGLB
~D) TOPOLOGY: LINFAR
(ii) MOLECULE TYPE: O1igOnUC1eOtide
(Xi) SEQU~N~ DESCRIPTION: SEQ ID NO:13:
CGCGGGATCC GCCATCATGG CCCTGCTACT GGCCCT 36
(2) INFORMATION FOR SEQ ID NO:14:
(i) SE~U~N~ CHARACTERISTICS
(A) L~N~1~: 29 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STR~NV~N~SS: SINGLE
~D) TOPOLOGY: T.TNRAR
(ii) MOLECULE TYPE: O1igOnUC1eOtide
(Xi) SEQU~N~ DESCRIPTION: SEQ ID NO:14:
CGGCGGTACC TGGCTGCACG GTCCATAGG 29
(2) INFORMATION FOR SEQ ID NO:15:
(1) SEQUENCE CHARACTERISTICS
(A) LENGTH: 35 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRP~I~ N~SS SINGLE
(D) TOPOLOGY: T.TNR~R
(ii) MOLECULE TYPE: O1igOnUC1eOtide
(Xi) SE~U~N~ DESCRIPTION: SEQ ID NO:15:
-S3-
CA 02210471 1997-08-08
W 096/24668 PCTrUS95/01780
GCCGGATCCG CCATCATGAA GTTCATCTCG ACATC 35
~2) ~ INFORMATION FOR SEQ ID NO:16:
(i) SEQu~C~ CHARACTERISTICS
(A) LENGTH: 27 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRAN~ s: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQu~N~ DESCRIPTION: SEQ ID NO:16: ~-
CGCGGGTACC GGTGTTCTTA GTGGAAA 2 7
-54-
