Note: Descriptions are shown in the official language in which they were submitted.
CA 02211621 1997-07-28
W096/24380 PCT~S96101507
-- 1 --
h~l~VS A~D COMPQSITIONS FOR R~GUT ~TION OF CD28 EXPRESSTQN
I. FIELD OF I~IE lN VhN'l'lON
The invention is in the field of modulating gene expression
through the use of oligomers, particularly those oligomers
effective in treating immune system-mediated diseases.
II. BACRGRQUn~D OF THE lNV~N-llQN
While the immune system plays a crucial role in protecting
higher organisms against life-threatening infections, the immune
system also plays a crucial part in the pathogenesis of numerous
diseases. Those diseases in which the immune system plays a
part include autoimmune diseases in which the immune system
reacts against an au~ologous antigen, e . g., systemic lupus
erythematosus, or diseases associated with immunoregulation
initiated by reaction to a foreign antigen, e. g., graft vs. host
disease observed in transplantation rejection.
The pathogenesis and exacerbation of many common T-cell
mediated diseases result from an inappropriate immune response
driven by abnormal T-cell activation. The presence of activated
T-cells have been reported in many T-cell mediated skin diseases
(Simon et al., (1994) J. Invest ~erm., 103:539-543). For
example, psoriasis, which afflicts 2~ cf the Western population
includins four million Americans, is a skin disorder
characterized by keratinocyte hyperproliferation and abnormal
dermal and epidermal infiltration of activated T-cells. Many
reports suggest a major role of these activated T-cells in the
pathogenesis of psoriasis (Baadsgaard et al ., ( l990) J. Tnvest
CA 02211621 1997-07-28
W096/24380 PCT~S96/01507
-- 2
~m., 95:275-282, Chang et al., (1992) Arch. Derm., 128:1479-
1485, Schlaak et al ., (1994) J. Invest Derm., 102:145-149) and
in AIDS-exacerbated psoriasis (Duvic (1990) J. Invest. 3erm.,
~Q:38S-40S). In psoriasis, activated lesional T-cells t
predominantly release the Thl cytokines (IL-2, interFeron-gamma)
(Schlaak et al., (1994) J. Invest Derm., 102:145-149). These
secreted cytokines induce normal keratinocytes to express the
same phenotype (HLA DR+/ICAM-1+) as found in psoriasis lesions
(Baadsgaard et al., (1990) J. Invest Der~., 9~:275-282). Also,
by virtue of its in vitro and in vivo proinflammatory properties
and because it is secreted in large amounts by both activated
T-cells and keratinocytes from psoriatic lesions, IL-8 is
considered to be a major contributor to the pathologic changes
seen in psoriatic skin such as keratinocyte hyperproliferation.
Furthermore, one of the B7 family of receptors (the natural
ligands for CD28 found on activated APC), BBl,has been shown to
be expressed in psoriatic but not unaffected skir, keratinocytes
(Nickoloff, et al., (1993) Am. J. Patholooy, 142:1029-1040).
A number of other diseases are thought to be caused by
aberrant T-cell activation, including Type I (insulin-dependent)
diabetes mellitus, thyroiditis, sarcoidosis, multiple sclerosis,
autoimmune uveitis, rheumatoid arthritis, systemic lupus
erythematosus, inflammatory bowel disease (Crohn's and
ulcerative colitis) and autoimmune hepatitis. In addition a
variety of syndromes including septic shock and tumor-induced
cachexia may involve T-cell activation and augmented production
of potentially toxic levels of lymphokines. Normal T-cell
activation also meaiates the rejection of transplanted cells and
organs by providing the necessary signals for the effective
destruction o the "foreign" donor tissue.
rl ~n~s~ Isr currs IDI 11 ~
~CA 02ill621 1997-07-28
W 096/24380 PCTnUS96/01507
-- 3
The activation of T-lymphocytes leading to T-cell
proliferation and gene expression and secretion of specific
immunomodulatory cytokines requires two independent signals.
The first signal involves the recognition, by specific T-cell
receptor/CD3 complex, of antigen presented by major histocompa-
tibility complex molecules on the surface of antigen presenting
cells (APCs). Antigen-nonspecific intercellular interactions
between T-cells and APCs provide the second signal that serves
to regulate T-cell responses to antigen. These secondary or
costimulatory signals determine the magnitude of a T-cell
response to antigen. Costimulated cells react by increasing the
levels of specific cytokine gene transcription and by
stabilizing selected mRNAs. In the absence of costimulation,
T-cell activation results in an aborted or anergic T-cell
response. One key costimulatory signal is provided by
interaction of the T-cell surface receptor CD28 with B7-related
molecules on APC (Linsley and Ledbetter (1993) Ann. Rev.
Immunol., 11:191-212). CD28 is constitutively expressed on 95
of CD4+ T-cells (which provide helper functions for B-cell
antibody production) and 50~ of CD8+ T-cells (which have
cytotoxic functionsi (Yamada et al., (1985) Eur. ~. Immunol.
15:1164-1168). Following antigenic or in vitro mitogenic
stimulation, further induction of surface levels of CD28 occurs,
as well as the production of certain immunomodulatory cytokines.
These include interleukin-2 (IL-2), required for cell cycle
progression of T-cells, interferon-gamma, which displays a wide
variety of anti-viral and anti-tumor effects and interleukin-8
(IL-8), known as a potent chemotactic factor for neutrophils and
lymphocytes. These cytokines have been shown to be regulated by
the CD28 pathway of T-cell activation (Fraser et al., (1991)
Science, ~:31,-316, Seder et al ., (' 994) ~. rx~. Med.,
CA 02211621 1997-07-28~
W096/24380 PCT~S96101507
, - 4 -
179:299-304, Wechsler et al., (1994) J. Imml~nol.,
153:2515-2523). IL-2, interferon-gamma, and IL-8 are essential
in promoting a wide range of immune responses and have been
shown to be overexpressed in many T-cell mediated disease
states.
In some T-cell mediated skin disorders such as allergic
contact dermatitis and lichen planus, CD28 was expressed in high
levels in the majority of dermal and epidermal CD3+ T-cells but
in normal skin and basal cell carcinoma (a non T-cell mediated
skin disease), CD28 was expressed only in perivascular T-cells.
Similarly, in both allergic contact dermatitis and lichen
planus, B7 expression was found on dermal dendritic cells,
dermal APCs and on keratinocytes but not in normal skin and
basal cell carcinoma (Simon et al., (1994) J. Invest Derm.,
lQ~:539-543)- Therefore this suggests that the CD28/B7 pathway
is an important mediator of T-cell-mediated skin diseases.
Aberrant T-cell activation associated with certain
autoimmune diseases caused by the loss of self-tolerance is
predominantly characterized by the presence of CD28+ T-cells and
expression of its ligand, B7 on activated professional APCs
(monocyte, macrophage or dendritic cells). These include
autoimmune Graves thyroiditis (Garcia-Cozar et al., (1993)
Immunol., 12:32), sarcoidosis (Vandenbergh et al. , (1993) Int.
Immunol., 5:317-321), rheumatoid arthritis (Verwilghen et al.
(1994) 4 . Immunol., 15 3:1378-1385) and systemic lupus
erythematosus (Sfikakis et al., (1994) C~in. Exp. Immunol.,
96:8-14). In normal T-cell activation, which mediates the
rejection of transplanted cells and organs, the binding of CD28
by its appropriate B7 ligand during T-cell receptor engagement
is critical for proper allogeneic response to foreign antigens,
for example, on donor tissue (Azuma et al ., ( 1992) ~. F.xp Med.,
~ I l ~ r~ ~Tr ~ ~
-
'CA 02211621 1997-07-28
W096l24380 PCT~S96101507
-- 5
175:353-360, Turka et al., (1992) Proc. Nat. Acad. Sci. USA,
89:11102-11105).
Traditional therapies for autoimmune diseases do not
prevent T-cell activation; the effector step in the autoreactive
immune responses to self-antigen. Drugs, such as steroids and
non-steroid anti-inflammatory drugs (NSAIDS), are currently used
to ameliorate symptoms, but they do not prevent the progression
of the disease. In addition, steroids can have side effects
such as inducing osteoporosis, organ toxicity and diabetes, and
can accelerate the cartilage degeneration process and cause
so-called post-injection flares for up to 2 to 8 hours. NSAIDS
can have gastrointestinal side effects and increase the risk of
agranulocytosis and iatrogenic hepatitis. Immunosuppressive
drugs are also used as another form of therapy, especially in
advanced disease stages. However, these drugs suppress the
entire immune system and often treatment has severe side effects
including hypertension and nephrotoxicity. Also established
immunosuppressants such as cyclosporin and FK506 cannot inhibit
the CD28-dependent T-cell activation pathway (June et al.,
(1987) Mol. Cell. Biol., 7:4472-4481).
Given the shortcomings of currently-available pharma-
ceuticals and methods for treating immune system-mediated
diseases, it is of interest to provide new methods and com-
positions for treating such diseases.
III. SUMMARY OF THE lNv~NllON
The subject invention provides methods and compositions for
the treatment of immune system-mediated diseases. The composi-
tions of the in~ention have the property of reducing the
expression of CD28 in cells of interest, which in turn moderate
pathogenic effects of the immune system in an immune system-
- = =
CA 02211621 1997-07-28
W 096/24380 PCTnUS96/01507
-- 6
mediated disease. The subject methods of reducing CD28
expression may also serve as methods of reducing the effects of
antigenic stimulation of CD28+ T cells, thereby decreasing the
level of activation of CD28~ T cells and the release of cytokines
associated with T cell activation, including interleukin-2,
interferon-gamma, and interleukin-8. The compositions of the
invention include many different oligomers capable of reducing
the expression of CD28.
One aspect of the invention is to provide oligomers capable
of reducing the expression of CD28 by interfering with the
expression of CD28. The oligomers of the invention have nucleic
acid base sequence homology to a CD28 gene or a CD28 gene
transcript, or a portion thereof, where the homology is
sufficient to permit formation of a nucleic acid double-stranded
helix or triple-stranded helix under intracellular conditions.
The oligomers of the invention may be DNA, RNA, or various
synthetic analogs thereof. In particular embodiments, oligomers
having 11 to 50 bases comprising at least two sequences of GGGG
separated by 3 to S bases.
Another aspect of the invention is to provide genetic
engineering vectors for the intracellular expression of
oligomers of the invention in cells of interest, preferably
cells that naturally express CD28.
Another aspect of the invention is to provide pharmaceu-
tical formulations comprising one or more different oligomers of
the invention. The pharmaceutical formulations may be adapted
for various forms of administration to the boay or
administration to cells to be reintroduced into the body.
Another aspect of the invention is to proviae methods for
the treatment of immune system-mediated diseases. The methods
of the invention invoive modulating CD28 expression by
'CA 02ill621 1997-07-28
W096l24380 PCT~S96/01507
-- 7
administering an effective amount of the oligomers of the
invention. The methods of the invention include methods of
treating autoimmune disease, methods of reducing inflammation,
response, methods of reducing the production of selected
cytokines, methods of inactivating T cells, and methods of
immunosuppressing a transplant patient.
IV. RRT~F DESCRIPTIQN OF THE DRAWING~
Figure l is the sequence of the 5' untranslated region of
the CD28 gene (lA) and the mRNA sequence of human CD28 (lB, lC).
Figures lB and lC represent different contiguous portions of a
polynucleotide sequence.
Figure 2 is a graphical representation of the percentage of
viable (live) T-cells following treatment with various CD28-
specific and control phosphorothioate and phosphorothioate-
3'hydroxypropylamine oligonucleotides.
Figure 3 is a graphical representation of anti-CD3
monoclonal antibody/PMA-induced CD28 expression in human T-cells
from two donors (GV0l0 and JC0ll;, (A) and the effect of
CD28-specific and control phosphorothioate (B, batch l and 2)
and phosphorothioate-3'hydroxypropylamine (C) oligonucleotides
on anti-CD3 monoclonal antibody/PMA-induced CD28 expression in
peripheral blood T-cells from the same 2 donors.
Figure 4 is a graphical representation of A) the induction
of T-cell proliferation by mitogens in human T-cells from donor
KS006 and B) the effect of CD28-specific and control
phosphorothioate oligonucleotides on anti-CD3 monoclonal
antibody/PMA-induced human T-cell proliferation.
Figure 5 is a graphical representation of the induction of
interleukin-2 (IL-2) production by anti-CD3 monoclonal antibody
and PMA in human T-cells (A) and the effect of CD28-specif~c and
CA 02211621 1997-07-28'
W096/24380 PCT~S96/01507
-- 8
control phosphorothioate (B) phosphorothioate- 3'hydroxypropyl-
amine (C) oligonucleotides on anti-CD3 monoclonal antibody/
PMA-induced IL-2 production in human peripheral T-cells.
Figure 6 is a graphical representation of the induction of
interferon-gamma (IFNy) production by anti-CD3 monoclonal
antibody and PMA in human T-cells (A) and the effect of
CD28-specific and control phosphorothioate (B) phosphorothio-
ate-3'~hydroxypropylamine (C) oligonucleotides on anti-CD3
monoclonal antibody/PMA-induced interferon-gamma production in
human peripheral T-cells.
Figure 7 is a graphical representation of the induction of
interleukin-8 (IL-8) production by anti-CD3 monoclonal antibody
and PMA in human T-cells (A) and the effect of CD28-specific and
control phosphorothioate (B) phosphorothioate-3'hydroxypropyl-
amine (C) oligonucleotides on anti-CD3 monoclonal antibody/PMA-
induced IL-8 production in human peripheral T-cells.
Figure 8 is a graphical representation of the induction of
interleukin-2 receptor (IL-2R, otherwise known as CD25) (A) and
intracellular adhesion molecule-l (ICAM-l otherwise known as
CD54) (B) expression by anti-CD3 monoclonal antibody and PMA in
human peripheral T-cells treated with and without CD28-specific
and control phosphorothioate 3'hydroxypropylamine oligonucleo-
tides.
Figure ~ is a graphical representation of CD28 expression
in HUT 78 (A) and Jurkat (B) human T-cell lines before and after
anti-CD3 monoclonal antibody and PMA treatment, and the effect
of CD28-specific phosphorothioate oligonucleotides in anti-CD3
monoclonal antibody and PMA-treated Jurkat cells (C).
Figure lO is a graphical representation of the effect of
CD28-spec f~c phosphorothioate oligonucleotides on interleukin-2
T~ ~L~ n~ e~
CA 02ill621 1997-07-28
W096l24380 PCT~S96/01507
g
production in anti-CD3 monoclonal antibody and PMA-treated HUT
78 (A) and Jurkat (B) human T-cell lines.
Figure 11 is a graphical representation of the effect of
phosphorothioate oligonucleotides on surface expression of
accessory molecules and on cytokine secretion in activated T
cells.
Figure 12 is a graphical representation of the effect of
phosphorothioate oligonucleotides on CD28 and CD25 mRNA levels.
Figure 13 is a graphical representation of the specificity
of oligonucleotides RT03S (SEQ ID NO: 4~) and RT04S (SEQ ID NO:
45) with respect to inhibitory effect on functional CD28
expression.
Figure 14 is a graphical representation of the tolerance
induction in vi tro by the CD28-specific oligonucleotides, RT03S
(SEQ ID NO: 44) and RT04S (SEQ ID NO: 45).
Figure 15 is a graphical representation of the in vi tro
stability of 32P-labeled phosphorothioates, RT03S (SEQ ID NO: 44)
and RTC06S (SEQ ID NO: 48) in extracellular supernatants (top
panel) and Jurkat cell lysates (bottom panel).
V. DET~TT~D DESCRIPTION QF SPECIFIC ~M~ODIMENTS
Described herein are methods and compositions for treating
immune system-mediated diseases, wherein the desired therapeutic
effect is achieved by decreasing the expression of CD28, thereby
abrogating activated CD28~ T cell function and decreasing
activation of other immune system cells. The inventor has
discovered that antigen-dependent T cell activation may be
inhibited by decreasing the expression of CD28 in CD28~ T cells.
The invention provides numerous compounds that may be used to
decrease the expression of CD28 in T cells.
CA 02211621 1997-07-28
W096/24380 PCT~S96/01507
- 10 -
The invention described herein involves the discovery that
decreasing CD28 expression in T cells can interfere with the
antigen-specific activation of T cells. The discovery may be
used to provide numerous methods of treating immune system-
mediated diseases with oligomers targeted to CD28 and with non-
oligomer compounds that decrease CD28 expression. By employing
the discoveries of the biological effects of decreasing CD28
expression as described in this application, numerous methods of
treating immune system-mediated diseases are provided, such
methods may employ non-oligomer compounds that have not yet been
synthesized or purified.
One aspect of the invention is to provide for oligomers
that can be used to inhibit gene expression of certain genes is
an established technique frequently referred to as the use of
"anti-sense'~ oligonucleotides or "anti-sense therapy." Numerous
publications on the construction and use of anti-sense are
available. Exemplary of such publications are: Stein et al.,
Scie~ce, 261:1004-1012 (1993); Milligan, et al., J. Med. Chem.,
36:1923-1937 (1993); Helene, et al . , J. Biochim. Biophys. Acta,
1049:99-125 (1990); Wagner, Nature., 372:333-335 (1994); and
Crooke and Lebleu, Anti-sense Research and Ap~lications, CRC
Press, Boca Raton (1993). The term "anti-sense" as used herein,
unless indicated otherwise, refers to oligomers (including
oligonucleotides) capable of forming either double-stranded or
triple-stranded (triplex) helices with polynucleotides so as to
interfere with gene expression. The principles of anti-sense
design and use described in these publications, and other
similar publications, may be used by the person of ordinary
skill in the art to design, make, 2nd use various embodiments of
the CD28 specific oligomers of the invention.
CA 02211621 1997-07-28
W096/24380 PCT~S96101507
The oligomers of the invention are capable of modulating
the expression of the CD28 gene. The oligomers of the invention
include those oligomers that have the property of being able to
form either a double-stranded polynucleotide helix by
hybridizing with CD28 transcripts (or portions thereof), or a
double-stranded polynucleotide helix by hybridizing with a
portion or portions of a CD28 gene, wherein the helix formation
may occur under intracellular conditions. The oligomers of the
invention also include those oligomers that are capable of
affecting the regulation of gene expression such as by acting as
molecular decoys and preventing protein-nucleic acid interaction
of transcription factors with regulatory elements of the
untranslated regions of the CD28 gene. Additionally, the
oligomers of the invention include those oligomers that are
capable of forming a triple-stranded polynucleotide helix with a
portion or portions of a CD28 gene, wherein the helix formation
may occur under intracellular conditions. Both doubie-stranded
helix and triple-stranded helix base pairing relationships
between nucleic acid bases (e.g., adenine-thymine, cytosine-
guanine, uracil-thymine) are known to the person of ordinary
skill in the art and may be employed in the design of the
oligomers of the invention. Regions of the CD28 gene or CD28
gene transcript at which double-stranded helix or triple-
stranded helix formation can occur with a given oligomer of the
invention are said to be "targeted" by that oligomer.
Human CD28 is a 90-kDa homodimeric transmembrane glyco-
protein present on the surface of a subset of T cells. CD28 is
present on mos~ CD4~ T cells and about 50~ of CD8~ T cells. The
DNA sequence encoding human CD28 has been resolved as can be
found, among other places, in Lee et al. Journal of Immunology,
145:344-352 ( 990) and on publicly accessible gene databases
CA 02211621 1997-07-28
W 096124380 PCTnUS96/01507
- 12 -
such as GenBank. The human CD28 gene comprises four exons, each
defining a functional domain of the predicted protein.
Transcription products of varying sizes have been observed to be
produced from the human CD28 gene. The oligomers of the
invention may be designed by referring to the published
nucleotide sequence of the CD28 gene or the sequence of CD28
gene-derived cDNAs. The compositions and methods of the
invention may be readily adapted for use in m~mm~l s other than
humans by referring to the sequence of the CD28 gene from non-
human m~mm~l s . the sequence of non-human CD28 gene may be
obtained by, among other methods, using previously identified
CD28 gene sequences from humans (or other mammals) as gene
library hybridization probes and/or PCR (polymerase chain
reaction) amplification pri~.ers. While the published nucleotide
sequences of the CD28 gene are believed to be accurate, the
subject invention may be practiced by the person of ordinary
skill in the art even if the published nucleotide base sequence
of CD28 contains sequencing errors. The proper nucleotide base
sequence errors in published sequences may be detected by, among
other means, re-sequencing regions of the CD28 gene (or CD28
gene transcripts) targeted by the oligomers of the invention.
Re-sequencing may be performed by means of conventional DNA
sequencing technology.
The oligomers of the invention preferably comprise from
about 11 to about 50 nucleic acid base units. It will be
readily appreciated by the person of ordinary skill in the art
that oligomers of the invention may be significantly longer than
50 nucleic acid base units. In a more preferred embodiment of
the invention, the oligomers comprise from about 8 to about 25
nucleic acid base units; more preferably from about 14 nucleic
acid base units to about 22 nucleic base units. The preferred
_ ~ ~ rL ~r~JT~-~J r~-~n~
'CA 02211621 1997-07-28
W096/24380 PCT~S96/01507
- 13 -
size limitations for the oligomers of the invention pertain only
to those oligomers that are to be administered extracellularly
to a cell and are not applicable to intracellularly produced
CD28 specific oligomers, e.g., as produced from vectors for the
genetic manipulation of target host cells.
The oligomers of the invention may have numerous different
nucleic acid base sequences. The oligomers of the invention may
be selected to reduce expression of CD28 by hybridizing (through
nucleic acid - nucleic acid interaction) to virtually any region
of a CD28 transcript of CD28 gene in order to reduce expression
of CD28, or by hybridizing (through nucleic acid - protein
interaction) to non-nucleic acid molecules that recognize
untranslated sequences of the CD28 gene. For example, oligomers
of the invention may be selected so as to be able to hybridize
to translated regions of a CD28 transcript, untranslated regions
of a CD28 transcript, unspliced regions of a CD28 transcript,
CD28 gene introns, CD28 promoter sequences, and CD28 regulatory
sequence, the 5' cap region of a CD28 transcript, CD28 gene
coding regions, and the like (including combinations of various
distinct regions). Preferred embodiments of the CD28 gene and
CD28 gene transcripts by the oligomers of the invention are in
the translational and/or transcriptional initiation regions of
the CD28 gene (and transcripts thereof). By varying the
location of the CD28 or CD28 gene transcript in which helix
formation may occur through the selection of the nucleic acid
base pair sequence of the oligomer, the potency of the oligomer,
i . e., the amount required to produce the desired biological
effect will be varied. Preferred embodiments of the oligomers
of the invention have the highest possible potency. The potency
of different oligomers of the invention may be measured by
various La vi~ro assays known to the person of ordinary skill in
CA 02211621 1997-07-28
W096/24380 PCT~S96/01507
- 14 -
the art. Examples of such assays can be found in the
experiments section of this application. The person of ordinary
skill in the art will appreciate that it not desirable to
produce oligomers that are targeted to polynucleotide sequences
that are also present at gene locations other than the CD28
gene. For example, it would be undesirable to produce an
oligomer targeted to the ~1~ sequence in the 5' untranslated
region of the CD28 transcript (the ~1~ region of the CD28 is
described in Lee et al., Journal of Immunoloay, 145:344-352
(1990)). The use of oligomers that form double-stranded or
triple-stranded helices with gene or transcripts of genes other
than CD28 may be minimized by performing homology searches of
oligomer nucleotide base sequences against polynucleotide
sequence information present in publicly accessible data bases
such as GenBank.
In a preferred embodiment of the invention, the subject
oligomers exhibit perfect nucleic acid base complementarity to
the selected target sequence, i. e ., every nucleic acid base in
the oligomer may enter into a base pairing relationship with a
second (or third) nucleic acid base on another strand of a
double (or triple) helix. However, a person of ordinary skill
in the art will appreciate that various oligomers specific for a
CD28 gene target and/or capable of inhibiting CD28 expression
may have nucleotide base sequences that lack perfect
hybridization to the CD28 gene (either strand), CD28 gene
transcripts, or CD28-specific regulatory proteins.
In preferred embodiments of the oligomers of the invention
are oligomers havlng the following nucleotide base sequences:
'CA 02ill621 1997-07-28
W096124380 PCT~S96101507
- 15 -
5'TTGTCCTGACGATGGGCTA3' (5EQ ID NO:l) RTOl
5'AGCAGCCTGAGCATCTTTGT3' (SEQ ID NO:2) RT02
5'TTGGAGGGGGTGGTGGGG3' (SEQ ID NO:3) RT03
5'GGGTTGGAGGGGGTGGTGGGG3' (SEQ ID NO:4) RT04
In particularly preferred embodiments of the invention, the
oligomers having the nucleotide base sequences indicated in
RTOl, RT02, RT03, and RT04, are phosphorothioates. Particularly
preferred oligomers are phosphorothioate-3lhydrQxypropylaminel
as described in Tam et al., Nucl. Acid. Res. 22:977-986 (1994~.
Oligomers of the invention may be designed so as to
decrease the expression of CD28 in T cells that have
internalized extracellularly applied oligomers of the invention.
Additionally, oligomers of the invention may be designed so as
to decrease expression of CD28 when the oligomers are produced
intracellularly through the use of genetic expression vectors.
Inhibition of CD28 expression may be effected through (I) inter-
ference with CD28 gene transcription, (ii) interference with
the transcription of CD28 gene transcripts, (iii) interference
with the processing of CD28 gene transcripts, or any combination
of (I), (ii), and (iii). The precise degree and mechanism of
the interference of CD28 expression will depend on factors such
as the structure of the particular oligomer, the nucleotide base
sequence of the oligomer, the dosage of oligomer, the means of
administering the subject oligomer, and the like.
The term "oligomer" as used herein refers to both naturally
occurring polynucleotides, e.g., DNA, RNA, and to various
artificial analogs of naturally occu~ring nucleic acids that
have the ability to form either double-stranded or triple-
stranded helix ~ith DNA or RNA. Many oligomers that are
artificial analogs of naturally occurring polynucleotides have
properties ~ha~ make them superior to DNA or RNA for use in the
CA 02211621 1997-07-28'
W096/24380 - 16 - PCT~S96101507
methods of the invention. These properties include higher
affinity for DNA/RNA, endonuclease resistance, exonuclease
resistance, lipid solubility, RNAse H activation, and the like.
For example, enhanced lipid solubility and/or resistance to
nuclease digestion results by substituting an alkyl group or
alkoxy group for a phosphate oxygen in the internucleotide
phosphodiester linkage to form an alkylphosphonate oligonucleo-
tide or alkylphosphotriester oligonucleotide. Non-ionic
oligomers such as these are characterized by increased
resistance to nuclease hydrolysis and/or increased cellular
uptake, while retaining the ability to form stable complexes
with complementary nucleic acid sequences.
While numerous oligomers that are analogs of naturally
occurring nucleic acids are explicitly described herein, and/or
are otherwise known to the person of ordinary skill in the art,
it will be appreciated that numerous oligomers that are nucleic
acid analogs that may be developed in the future may be readily
adapted by those of ordinary skill in the art to inhibit the
expression of CD28 genes. A brief review of different currently
available DNA/RNA analogs that may be used as oligomers of the
invention by selection of the appropriate nucleic acid base
sequence so as to target CD28 genes (and transcripts thereof) is
provided below. The various oligomers described in those
publications are examples, not limitations, of different
possible embodiments of oligomers that may be adapted for
inhibition of CD28 expression in the methods and compositions of
the invention. Methylphosphonate (and other alkyl
phosphonate) oligomers can be prepared by a variety of methods,
both in solution and on insoluble polymer supports (Agrawal and
Fiftina, Nucl. Acids Res., 6:3009-3024 (1979); Miller et al . ,
~iochemistry, 18:5134-5142 (1979); Miller et al. , ~ . ~3iol.
CA 02ill621 1997-07-28
W096l24380 PCT~S96101507
- 17 -
S~9~ 9659-9665 ~1980); Miller et al., Nllcl. Ac;~s ~es.,
~L:5189-5204 (1983)i Miller et al., Nucl. Acids Res., 11:6225-
6242 (1983); Miller et al., Rioche~istry, 2S:5092-5097 (1986);
Sinha et al., Tetrahedr5n Tett. 24:877-880 (1983); Dorman et
al., Tetrahedron, 4Q:95-102 (1984); Jager and Engels,
Tetrahedron Lett., 25:1437-1440 (1984); Noble et al., Nucl.
Acids Res., 12:3387-3404 (1984) Callahan et al., Proc. Natl.
Acad. Sci. USA, 83:1617-1621 (1986); Koziolklewicz et al.,
Chemica Scri~ta, 26:251-260 (1986); Agrawal and Goodchild,
Tetrahedron Lett., 38:3539-3542 (1987); Lesnikowski et al.,
Tetrahedron Lett., 28:5535-5538 (1987); Sarin et al., Proc.
Natl. Acad. Sci. USA, 85:7448-7451 (1988).
Additional oligoribonucleotide analogs for use as oligomers
are described in Inova et al., Nucleic Acid~s Res., lS:6131
(1987) (2 -O-methylribonucleotides), Inova et al., F~RS Tlett.
215:327 (1987).
Descriptions of how to make and use phosphorothioates and
phosphorodithioates can be found in, among other places, the
following publications: United States Patent No. 5,292,875,
United States Patent No. 5,286,717, United States Patent
No. 5,276,019, Patent No. 5,264,423, United States Patent
No. 5,218,103, United States Patent No. 5,194,428, United States
Patent No. 5,183,885, United States Patent No. 5,166,387, United
States Patent No. 5,151,510, United States Patent No. 5,120,846,
United States Patent No. 4,814,448, United States Patent No.
4,814,451, United States Patent No. 4,096,210, United States
Patent No. 4,094,873, United States Patent No. 4,092,312, United
States Patent No. 4,016,225, United States Patent No. 4,007,197,
United States Patent No. 3,972,887, United States Patent No.
3,9i7,621, and United States Patent No. 3,907,815, Dagle et al.,
Nuc'. Aci~s Res. 18:4751-4757 (1990), Loke et al., Prc-. Natl.
CA 02211621 1997-07-28
W096/24380 PCT~S96101507
- 18 -
Acad. Sci. USA, 86:3474-3478 (1989), LaPlanche, et al., Nucleic
Aci~.~ Res., 14:9081 (1986) and by Stec, et al ., J. Am. Chem.
Soc. 106:6077 (1984), and Stein et al ., Nucl. Acids Res.
16:3209-3221 (1988).
Descriptions of how to make and use phosphoramidates can be
found in among other places the following publications: Agrawal
et al ., Proc. Natl. Acad. Sci., 85:7079-7083 (1988), Dagle et
al., Nucl. Acids Res., 18(6):4751-4757 (1990), Dagle et al.,
Nucl. Acids Res. 19(8):1805-1810 (1991),
Other polynucleotide analogs of interest include compounds
having acetals or thioacetals in the backbone structure.
Examples of how to make and use such compounds can be found,
among other places in, Gao et al ., Biochemistry 31:6228-6236
(1992), Quaedflieg et al., Tetrahedron Tett. 33(21):3081-3084
(1992), Jones et al., J. Orc. Chem. 58:2983-2991 (1993).
Other polynucleotide analogs of interest include compounds
having silyl and siloxy bridges in the backbone structure.
Examples of how to make and use such compounds can be found,
among other places in Ogilvie and Cormier, Tetrahedron Lett.,
26(35):4159-4162 (1985), Cormier and Ogilvie, Nucl. Acids Res.
16(10):4583-4594 (1988), PCT publication WO 94/06811.
Other polynucleotide analogs of interest include compounds
having silyl and acetamidate bridges in the backbone structure.
Examples of how to make and use such compounds can be found,
among other places in Gait et al., J. Chem. ~oc., Perkin Trans.
1:1684 (1974), Mungall and Kaiser, J. Orq. Chem. 42(4):703-706
(1977), and Coull et al ., and Tetrahedron Lett. 28(7):745-748
(1987).
Polynucleotide analogs having morpholino-based backbone
linkages have also been described. Information on how to make
and use such nucleotide analogs can be found i.., among other
_ ... . _ _ _ .. . .. . .~ - I D C~rrlIT~_CU c~rJQIII ~ 7~ _ .
'CA 02ill621 1997-07-28
W096/24380 PCT~S96/01507
-- 19 --
places, United States Patent Nos. 5,034,506, 5,235,033,
5,034,506, 5,185,444.
Polynucleotide analogs having various amine, peptide, and
other achiral and/or neutral linkages have been described:
Caulfield et al., ~3ioorqanic & Medicinal Chem. T.ett.,
3(12):2771-2776 (1993), Mesmaeker et al., ~3ioorqanic & Me~;cinal
Chem. Lett., 4(3):395-398 (1994); An~ew. Chem. In~. Ed. En~l.,
33(2):226-229 (1994), United States Patent No. 5,1~6,315, and
United States Patent No. 5,142,047.
Polynucleotides having thioether and other sulfur linkages
between subunits are described in, among other places Schneider
~ and Brenner, ~etrahedro~ T~ett., 31(3):335-338 (1990), Huang et
al., J. O~g. Chem., $6:3869-3882 (1991); Musicki and Widlanski,
Tetrahedron Lett., 32(10):1267-1270 (1991); Huang and Widlanski,
Tetrahedro~ Lett., 33(19):2657-2660 (1992); and Reynolds et al.,
J. Orq. Chem. 57:2983-2985 (1992), and PCT publication WO
91/15500.
Other polynucleotide analogs of interest include peptide
nucleic acids (PNAs) and related polynucleotide analogs. A
description o how to make and use peptide nucleic acids can be
found in, among other places, Buchardt e t al ., Trends in
Biotech., 11 (1993) and PCT publication WO 93/12129.
Other oligomers for use in anti-sense inhibition have been
described in Thuong et al ., Proc. Natl. Acad. Sci., 84:5129-5133
(1987), United States Patent No. 5,217,866, Lamond, ~iochem.
Soc. Transactions, ~l:1-8 (1993) (2'-O-alkyloligoribonucleo-
tides), Ono et al ., ~ioconjugate Chemistry, 4:499-508 (1993)
(2'-deoxyuridine analogs carrying an amino linker a. the 1'-
position of deoxyribose), Kawasai et al ., ~ . Med. Chem., 36:831-
841 (1993) (2'-deoxy-2'-fluoro phosphorothioate oligonucleo-
CA 02211621 1997-07-28
W096/24380 PCT~S96101507
- 20 -
tides), PCT publication WO 93/23570, Augustyns et al., Nucl.
Acids Res., 21(20):4670-4676 (1993).
Additionally, oligomers may be further modified so as to
increase the stability of duplexes and/or increase cellular
uptake. Examples of such modifications can be found in PCT
publication WO 93/24507 entitled "Conformationally Restrained
Oligomers Containing Amide or Carbamate Linkages for Sequence-
Specific Binding," Nielsen et al., Science, 254:1497-1500
(1991), PCT publication WO 92/05186 entitled "Modified Internu-
cleoside Linkages," PCT publication WO 91/06629, filed October
24, 1990 and United States Patent 5,264,562 filed April 2~,
1991, both of which are entitled "Oligonucleotide Analogs with
Novel Linkages," PCT publication WO 91/13080 entitled "Pseudo-
nucleosides and Psuedonucleotides and their Polymers," PCT
publication WO 91/06556 entitled "2'-Modified Oligonucleotides,"
PCT publication WO 90/15065 filed on 5 June 1990 entitled
"Exonuclease Resistant Oligonucleotides and Methods for
Preparing the Same," and United States Patent No. 5,256,775.
The oligomers of the invention comprise various nucleic
acid bases. In addition to nucleic acid bases found to occur
naturally in DNA or RNA, e . g., cytosine, adenine, guanine,
thymidine, uracil, and hypoxanthine, the oligomers of the
invention may comprise one or more nucleic acid bases that are
synthetic analogs of naturally occurring acid bases. Such non-
naturally occurring heterocyclic bases include, but are not
limited to, aza and deaza pyrimidine analogs, aza and deaza
purine analogs as well as other heterocyclic base analogs,
wherein one or more of the carbon and nitrogen atoms of the
purine and pyrimidine rings have been substituted by
heteroatoms, e. g., oxygen, sulfur, selenium, phosphorus, and the
like. Preferred base moieties are those bases that may be
CA 02211621 1997-07-28
W096l24380 PCT~S96tO1507
- 21 -
incorporated into one strand of double-stranded polynucleotides
so as to maintain a base pairing structural relationship with a
naturally occurring base on the complementary strand at the
double-stranded polynucleotide.
The invention provides many methods of treating a variety
of immune disorders. The terms "treatment" or "treating" as
used herein with reference to a disease refers both to prophy-
laxis and to the amelioration of symptoms already present in an
individual. It will be appreciated by the person of ordinary
skill in the art that a treatment need not be completely
effective in preventing the onset of a disease or in reducing
the symptoms associated with the disease. Any reduction of the
severity of symptoms, delay in the onset of symptoms, or delay
in the progression of severity of symptoms is desirable to a
patient. Immune disorders that can be treated by the methods of
the invention include the diseases in which CD28 expressing T
cells mediate or con'ribute to an undesired idiopathic e~fect.
Inhibition of CD28 expression results in the decrease of
expression of cytokines normally produced by activated CD28~ T
cell, such cytokines include interleukin-2, interferon gamma,
and interleukin-8. Accordingly, the methods of the invention
include, but are not limited to, methods of treating diseases in
which pathogenesis is mediated through interleukin-2,
interferon-gamma, interleukin-8, or a combination thereof,
whereby a T cell mediated immune response is interrupted or
reduced. Examples of immune disorders that may be treated by
administering the subject oligomers to a patient include organ
transplantation rejection, septic shock, tumor-induced cachexia,
and numerous auto-immune diseases. Autoimmune diseases that may
be treated by the subject methods include diseases that are
mediated by aberrant T cell activation including ~ype I
CA 02211621 1997-07-28
W 096124380 PCTrUS96/01507
- 22 -
(insulin-dependent) diabetes, thyroiditis, sarcoidosis, multiple
sclerosis, autoimmune uveitis, ulcerative colitis, aplastic
anemia, systemic lupus erythematosus, rheumatoid arthritis,
parasite induced inflammation and granulomas, Crohn's disease,
psoriasis, polymyositis, dermatomyositis, scleroderma,
vasculitides, psoriatic arthritis, Graves disease, myasthenia
gravis, autoimmune hepatobilliary disease, and the like.
Additionally, the methods and compositions of the invention
provide for the treatment of a variety of syndromes, including
septic shock and tumor-induced cachexia, in which the pathogenic
effects are mediated, at least in part, by the lymphokine
secreted from activated CD28+ T cells.
The disease treatment methods of the invention comprise the
steps of administering an effective amount of the subject
oligomers to a patient. The precise dosage, 1. e., effective
amount, of CD28-specific oligomer to be administered to a
patient will vary with numerous factors such as the specific
disease to be treated, the precise oligomer (or oligomers) in
the therapeutic composition, the age and condition of the
patent, and the like. Protocols for determining suitable
pharmaceutical dosages are well known to those of ordinary skill
in the art and can be found, among other places, in Remington's
Pharmaceutical Science (latest edition), Mack Publishing
Company, Easton, Pa., and the like.
In addition to administering the CD28 targeted oligomers
directly to a patient, the invention contemplates methods of
treatment in which CD28 cells (or cells having the potential to
express CD28) are removed from a patient (with or without other
cells) and transformed with one or more different oligomers of
the invention. Transformation may be by any of a variety of
means well known to the person skilled in the art, e . g.,
__ _ __ _ ~ ~~ ~TLL~ r~ L~r / n~ C~_ __ _ _ _
CA 02211621 1997-07-28
W 096124380 PCTrUS96/01507
- 23 -
electroporation, cationic lipids such as DOTMA or DOSPA, and the
like. Transformed cells may then be reintroduced into the body.
Another aspect of the invention is to provide methods of
treating immune disorder by means of administering CD28-specific
oligomers, wherein the oligomers are produced intracellularly
through recombinant polynucleotide expression vectors.
Intracellularly-produced CD28-specific oligomers are necessarily
RNA or DNA molecules. Recombinant polynucleotide vectors for
the expression of polynucleotide sequences of interest are well
known to the person of ordinary skill in the art of molecular
biology. Detailed descriptions of recombinant vectors for the
expression of polynucleotides of interest can be found in, among
other places, "Somatic Gene Therapy," ed. P. L. Chang, CRC
Press, Boca Raton (1995), R. C. Mulligan, Science, 260:926-932
(1993), F. W. Anderson, Science, 256:808-873 (1992), Culver et
al., Hum. Gene Ther., 2:107-109 (1991), and the like. Suitable
recombinant vectors for use in the subject methods of treating
immune disorders through genetic engineering are either able to
integrate into the genome of T cells or replicate in the
cytoplasm cf m cells. CD28-specific oligomers for use in
intracellular administration are preferably significantly longer
than CD28-specific oligomers for extracellular administration.
In a preferred embodiment of the subject methods of
intracellular CD28 administration, the CD28-specific oligomer is
complementary to one or more entire CD28 transcripts or the
entire CD28 aene; however, suitable intracellularly-produced
CD28-specific oligomers may be cons1derably shorter in length.
Unlike extracellularly-administered CD28-specific oligomers,
CD28-specific oligomers do not present problems with
intracellula- uptake or hydrolysis by extracellular enzymes.
CA 02211621 199i-07-28
W096/24380 PCT~S96/01507
- 24 -
The subject methods of using intracellular CD28-specific
oligomers may involve administering CD28-specific oligomer-
encoding recombinant vectors directly to a patient.
Alternatively, CD28-specific oligomer-producing vectors may be
administered directly to cells that have been removed from a
patient (i.e., stem cells, T cells, whole blood, marrow, etc. ),
whereby transformed cells are produced. The transformed cells
may be subsequently be reintroduced into a patient.
The invention also specifically provides for expression
vectors capable of expressing one or more of the oligomers of
the invention. Generally, such expression vectors comprise, in
operable combination, a promoter and a polynucleotide sequence
encoding an oligomer capable of inhibiting the expression of
CD28 in a T cell. Although many different promoters may be used
in the vectors of the invention, preferred promoters are capable
of driving the high level expression in T cells. The expression
vectors of the invention may also comprise various regulatory
sequences. Currently available expression vectors, especially
those vectors explicitly designed for gene therapy, may readily
be adapted for the expression of CD28-targeted oligomers of the
invention. The vectors may be adapted for the expression of
CD28-targeted oligomers using conventional genetic engineering
techniques such as those described in Sambrook et al., Molecular
Cloninc, 2nd Ed., Cold Spring Harbor Press, Cold Spring Harbor,
N.Y. (1989).
Another aspect of the invention is to provide
pharmaceutical formulations for the administration of the
oligomers of the invention so as to effect the treatment of
immune system-mediated diseases. These pharmaceutical for-
mulations may be readily produced by the person of ordinary
skill in the art of pharmaceutical science. Such formulations
CA 02211621 1997-07-28
W 096124380 PCTrUS96/01507 - 25 -
comprise one or more of the oligomers of the invention; however,
in embodiments of the invention comprising more than one
different types of oligomers, the oligomers are preferably
selected so as to not be able to hybridize with one another.
The pharmaceutical formulations of the invention may be adapted
for administration to the body in a number of ways suitable for
the selected method of administration, including orally,
intravenously, intramuscularly, intraperitoneally, topically,
and the like. In addition to comprising one or more different
oligomers of the invention, the subject pharmaceutical
formulations may comprise one or more non-biologically active
compounds, i.e., excipients, such as stabilizers (to promote
long term storage), emulsifiers, binding agen~s, thickening
agents, salts, preservatives, and the like.
Formulations for parenteral administration may include
sterile aqueous solutions, which may also contain buffers,
diluents, and other sui~able additives. Pharmaceutical
formulations of the invention may be designed to promote the
cellular uptake of the oligomers in the composition, e.g., the
oligomers may be encapsulated in suitable liposomes.
Pharmaceutical formulations for topicai administration are
especially useful for localized treatment. Formulations for
topical treatment included ointments, sprays, gels, suspensions,
lotions, creams, and the like. Formulations for topical
administration may include, in addition to the subject
oligomers, known carrier materials such as isopropanol,
glycerol, paraffin, stearyl alcohol, polyethylene glycol, etc.
The pharmaceutically acceptable carrier may also include a known
chemical absorption promoter. Examples of absorption promoters
are e.g., dimethylacetamide (United States Patent
No. 3,472,931), trichloro-ethanol or trifluoroethanol (United
.
CA 02211621 1997-07-28
W 096/24380 PCTnUS96/01507
- 26 ~
States Patent No. 3,891,757), certain alcohols and mixtures
thereof (British Patent No. 1,001,949), and British patent
specification No. 1,464,975.
In addition to the therapeutic uses of the subject
oligomers, the oligomers may also be used as an analytical
laboratory tool for the study of T cell activation. T cells
have several SUï face receptors in addition to CD28 and the
antigen specific T cell receptors. Difficulties arise in
studying the individual biological properties of selected
receptors because of potential and actual interactions between
multiple receptor-mediated pathways. By providing a mechanism
for decreasing CD28 expression in T cells, the oligomers and
methods of the invention also provide useful laboratory methods
for studying T cell behavior independently of the CD28
activation pathway.
The invention may be better understood by referring to the
following examples. The following examples are offered for the
purpose of illustrating the invention and should not be
interpreted as a limitation of the invention.
VI. EXAMPLES - SERIES 1
Oli~onucleotide~
Oligodeoxynucleotides were synthesized on an automated DNA
synthesizer (Applied Biosystems model 394) using standard'
phosphoramidite chemistry. ~-cyanoethylphosphoramidites,
synthesis reagents and CPG polystyrene columns were purchased
from Applied Biosystems (ABI, Foster City, CA). 3'-AminoModi-
fier C3 CPG columns were purchased from Glen Research (Sterling,
VA). For phosphorothioate oligonucleotides, the standard
oxidation bottle was replaced with tetraethylthiuram
disulfide/acetonitrile, and the standard API phosphorothioate
'CA 02ill621 1997-07-28
W O 96/24380 PCTrUS96101507
- 27 -
program was used for the stepwise addition of phosphorothioate
linkages. After cleavage from the controlled pore glass column,
the protecting groups were removed by treating the oligonucleo-
tides with concentrated ammonium hydroxide at 55~C for 8 hours.
The oligonucleotides were purified by HPLC using a reverse phase
semiprep C8 column (ABI). Following cleavage of the DMT
protecting group, treatment with 80 ~ acetic acid and ethanol
precipitation, the purity of the product was assessed by HPLC
using an analytical C18 column ~Beckman, Fullerton, CA). All
oligonucleotides of ~90 ~ purity were lyophilized to dryness.
Oligonucleotides were reconstituted in sterile deionized water
(ICN, Costa Mesa), adjusted to 400 ~M following evaluation of
OD260nm, aliquoted and stored at -20~C prior to experimentation.
In all cases, at least three batches of each oligonucleotide
listed in Table 1 were used.
C~ll linç~ and T cell puxi~ication
Peripheral blood mononuclear cells (PBMCs) were isolated
from the buffy coat following Ficoll-Hypaque density gradient
centrifugation of 60 ml blood from healthy donors. T-cells were
then purified ;~rom the PBMCs using Lymphokwik lymphocyte
isolation reagent specific for T-cells (LK-25T, One Lambda,
Canoga Park CA). An average yield of 40 - 60 x 1o6 T-cells were
then incubated overnight at 37~C in 20 - 30 ml RPMI-AP5
(RPMI-1640 medium (ICN, Costa Mesa, CA) containing 20 ~M HEPES
buffer, pH 7.~, 5~ autologous plasma, 1 ~ L-glutamine, 1 ~
penicillin/streptomycin and 0.05~ 2-mercaptoethanol) to remove
any contaminating adherent cells. In all experiments, T-cells
were washed with RPMI-AP5 and then plated on 96-well microtitre
plates at a ce l concentration of 2 - 3 x lC6 cells/ml.
CA 02211621 1997-07-28
WO 96124380 - 28 - PCT/US96/01507
o _, o
,, ~
r' r~ rD ~ ~ ' Z
~ - O ~ ,~ r~ r~
n ~ Drs) ~ r~
,i r.~ : o
O O ' ~1
, O ~ C~ ~ ~
r h h O O h
~ r O O
~a rA .,i ~~'l--I ~ ' '
~1: rA ~ r~l r~l
E-~ a,1 rl)r,LI I o o
~ ~ h h h
a L~ ~ _ r 0 4-1 ~ ~
- r~ ~
C _I~ ~ O
O _ - O I E~ ~
~1 . ~ O
- O
rJ rl) r~ ~ ~ O
rnrQ ~ rnrr~ r~
~ _ _ ~ C ~ O
Ln ~ Ln m rnrn r,~r~ rnC~
~3
~n rn ~ ~ rnrn O~ ~ rn t~ rn
~ ~, r~ ~ r:n rn C~ r;~ r3 rQ ~ ~
W O z ~Ir~l r~ Dr~r~ rJ~ ,~~ ~r' 0l 0 ~1
E~
r~ Ur~r,~
r~
U Ur~r,~
r.~r5 r~ U
U U ~ r~ E~ U ~ r~E~r~ U
r~ r3 ~5 U r5E~ ~ U U ~U~
U U U r~ U ~ ~5U U U ~
~I r.~ E~ ~ ~ V r~ r~r~E~ r5 Cl~ ,5
5 C~ ~ ~5 r5 C~E~r~ U o~l U
r5 U r~ r~ U U Ut~ E~ U ~3 r~
V r3E~ U E~ 5 rn ,5
U r5r~ r~ r~ U r5r~E~ U r~
E~ ~ 5 ~5 5 U ~ ~ U U
U U r~ ~ UU 5 '5t~e~ ~ U
~ E~ U UE~ E~ U ,5
~ U V r~ r~ r5 UE~ r~ U C~
E~ r~ r~ r5 U ~E~ E~ ,5 ,5
E- r5 ~ r~ E~ r5 U ~ ~ r~; r
C~ ~5
O O O o O o a
o ~ ~ ~ ~ U u ~u ~u ~ r O ~
O ~ C~
o
. . ~ ~ ~ _~-- ~ r ~ ~ r r~ ~ r ~
CA 02211621 1997-07-28
WO 96/24380 PCT/US96101S07
- 29 -
~Z; rD D U7 0
Z ~r7 u7 r~J~1 ~ O U7rD r~ ~ r7 ~D O r~ ~7 0 ~ O O
_I r r7r~ O ~D ~r7 ~DrJ~r~ O ,1 ~1~I r~ r1 ~r ~ J_l
r~ ~ rlr~7 ~L7~D r~rr r~rD ,1 1 1 ,1 I r--
r ~ I I I Irs~ rn ~ I U7 1 U7
~L7 r7 ~ U7 _I~17rJ~ r~r7 ~ ~ rD r rD ~ rr~ r.~l
U7,1u7 r~ ~~ ~r~ r~rD O O ~r~ or~l r7
,I r~l r7 ~7 u7 ~Dr~ r~r~ rDa~ r~ ~1 ~ ~1 ~I r~
8 8 ~o o 8 8 o8
.,, .,, .,, .~ .,, .. , .. , ..
07C7 ~7~7 07 07 C7 C
r.l
r ~ ~ r ~ r
5~ C J, ~ a
E-~ ~ ~ ~ ~ ~ ~ o n r~ r nrr o n o n n
rlrlrl rl rl ~rl rl ~r-- ~ r ~rl r ~rl
~757~7 t~ C7 ~7t7 ~ ~7 t17 - -
~)~Ja) o oo o o aJ
O 5~S~ h
~ ' ~ ? ~ ??? ~'~~ ' -? '?
.,.,., ., .., ., ~ .. ..
~ ~ ~ r rc r~ o
C C' C CL~ ---- -- -- -- C' -- C
U7r7r7 r7r~7 r~7 C r7 ~) u7 U7
~3
[l~ U7rn U.7r~.7rn U.7 U.7 rn rn r:n U.7 rn rn rn rn U7 rn rn C.7
r5r~ ~¢r~ r~
~' N r~1 ~r un ~r7 r rD a~ O ~I N r~7 ~ U7 ~17 r~ r~ r~ o
CY ~ r-l ~ ~I r~ _I ~1 ~1 ~I N N N N N N N N N N 1'~)
rn
E~ U ~ V U ~ U E~ C) r~
U~ U ~ ~ U C~ C~
~ U U U U U ~ U C~
o~ r~ ~:C U E~ U U U U V ~ U ~ C~
U U UC~ U ~ ~ ~ ~ C~ U E~
rn U ~ W E~ E~ U
V ~ C~ U ~:1 UE~ ~ U E~~) U ~7 ~ U ~¢ V
U r5 ~ ~ ~ U ~ C~ E~ VE~ ~ C.7C~ E~ U ~
U .¢ U ,¢ U ~ ~ C7 E~ U~) U ~¢ U ~ r C U V U
V V U V U U ~ U E~E~ U ~ ~ ~ ~: V V E~
V E~E~ U ~ C~ V U V E~ ~ ~ U V E~
E~ V U U E~ V ~ V V U ~
VE~ ~ U V U E~ U V ~: ~ U ~ V ~ U V
V E~ U V E~ U V V V U U U ~ V V E~
V E~ u V ~ ~7 ~ VE~ V ~¢ U ~¢ V
U V~: V ~¢ U ~ V E~E~ U V r~Ci ~ E~ E~ V
I U E~ ~ ~ VE~ U U E~ v U E~ E~ ~ V v ~ V
U U ~: V V U U ~ ~ U ~ U E~
U V ~ U u ~E~ V ~ ~ U U V ~ ~ V
V ~ U V ~ V V ~ ~E~ U V E~ V
~7 r~r~rn o ri N r~ ~ u~~D r- r7 rn o _I N r~
O O O O O ~~ N N N ~ N
~ ~ C~1~ ~ r 12~ r ~ ~:C~ rY r~ ~ r.
o
CA 02211621 199i-07-28
WO 96124380 PCT/US96101507
- 30 --
o ~ a~
O ~ ~ a~ ~ ~
z ~1 a~ ,~ ~ ~1 ~1
r l l l I
~, o o o o o
L~ LOl Ll L~ L~ L~
cn ~ 0
' ~ O O ~1 Ul
O O
tJl 0~ -
Q) Q)
~) Q a '~
L L a Q Q
E-~ (I Q r'
.. ,,,~ .. ,y ,y ~
~ rl ~1 rl
u~ In In ~n Ln ul
O 'I ~ ~ ~ U~ ~D
O~ Z~'1 1~ ~ 1'~ IY~ 1-'1
U~
U C~ ,¢
cn U ~ ~ ~ E~
E~ U E~
~ ~ U E~
U E~ ~ ~ ~ E~
U E~ U C~
E~ U ~ ~ E~ E~
~ V U ~ ~ E~
f~ ~ U ~ ~ E~
U E~ ~ V
U U ~ ~ ~
In ~o r a~ a~ o
O
o
.. .cl Inc~rm IT~ CLIC~T IDI 11 ~ '~
~A 02ill621 1997-07-28
W096t24380 PCT~S96tOl507
- 31 -
The T-cell lymphoma cell lines, Jurkat E6-1 (CD28+/CD4+)
cells (152-TIB) and HUT 78 (CD28-/CD4+) cells (TIB-161) (ATCC,
Rockville, MD) were maintained in RPMI-10 (RPMI-1640 medium con-
taining 20 ~M HEPES buffer, pH 7.4, 10 ~ fetal calf serum (FCS)
(Hyclone, Logan, UT), 1 ~ L-glutamine and 1 ~ penicillin/strep-
tomycin).
Mi~o~en-induced T-CP1 1 a~tiVatiQn
and oligonucleotide treatment
Prior to the addition of human peripheral T-cells or T-cell
lymphoma cell lines (0.2 - 0.3 x 106), duplicate 96-well
microtitre plates were pre-coated with purified anti-CD3
monoclonal antibody (mAb) (6.25 - 200 ng/well) (clone HIT 3a,
Pharmingen, San Diego, CA) and washed twice with cold
phosphate-buffered saline, pH 7.4 (PBS). Anti-CD3 mAb-treated
T-cells were further activated by the addition of 2 ng phorbol
12-myristate 13-acetate (PMA) (Calbiochem, La Jolla, CA) and
incubated for 48 h at 37~C. Anti-CD3/PMA-activated T-cells were
treated with 1 - 20 ~M CD28-specific and control oligonucleo-
tides immediately following activation and re-treated 24 h
later. T-cells from one duplicate plate was used for immunoflu-
orescence analysis and the supernatants used for cytokine
studies and the second plate was used for T-cell proliferation
analysis.
Tm~nofluore~cence ~tudies.
Following activation, lSO ml cell supernatan~ from the
first duplicate microplate was transferred to another microplate
for analysis of cell-derived cytokine production. The remaining
cells were washed twice wit~ isoton~- saline solution, pH 7.4
CA 02211621 1997-07-28
W 096/24380 PCTnUS96101507
- 32 -
(Becton Dickinson, Mansfield, MA) and resuspended in 50 ml
isotonic saline solution and split into two samples. One sample
aliquot was co-stained with either PE-CD28/FITC-CD4 or
PE-CD54/FITC-CD25 mAb and non-specific fluorescence was assessed
by staining the second aliquot with PE/FITC-labeled
isotype-matched control monoclonal antibody. All
fluorescence-labeled monoclonal antibodies were obtained from
Becton Dickinson (San Jose, CA). Incubations were performed in
the dark at 4~C for 45 min using saturating mAb concentrations.
Unincorporated label was removed by washing in PBS prior to the
analysis with a FACScan flow cytometer (Becton Dickinson).
Antigen density was indirectly determined in gated live cells
and expressed as the mean channel of fluorescence (MCF).
Surface expression of specific antigens (CD54, CD25) was repre-
sented as the mean channel shift (MCS) obtained by subtracting
the MCF of FITC- or PE-labeled isotype-matched (IgG1) control
mAb-stained cells from the MCF of FITC- or PE-labeled
antigen-specific mAb stained cells. Alternatively, surface
expression of the CD4~-subset of cells stained with CD28 mAb was
determined by subtracting the MCF of CD28~ CD4~ from the MCF of
CD28- CD4- cells. The viability of control untreated and oligo-
nucleotide-treated cells were determined in each batch of all
oligonucleotides in multiple donors by staining with the vital
dye, propidium iodide (5 ~g/ml final concentration). The
percentage of live cells which excluded propidium iodide was
determined by flow cytometry and was > 90 ~ (range 90 - 99 ~)
following treatment with all batches of all oligonucleotides at
a dose range of 1 - 20 ~M (Figure 2).
. . . I IT~ C ~ CCT ~D I 11 ~
CA 02ill621 1997-07-28
W 096/24380 PCTnUS96tO1507
- 33 -
~ytok;ne ~na31 yses.
Cell-derived human cytokine concentrations were determined
in cell supernatants from the first duplicate microplate.
Mitogen-induced changes in interleukin-2 (IL-2) levels were
determined using a commercially availa~le ELISA kit tR & D
systems Quantikine kit, Minneapolis, MN) or by bioassay using
the IL-2-dependent cell line, CTLL-2 (ATCC, Rockville, MD).
Mitogen-induced changes in interferon-gamma and interleukin-8
(IL-8) levels were determined by ELISA using kits from Endogen
(Cambridge, MA) and R ~ D systems (Quantikine kit, Minneapolis,
MN) respectively. All ELISA results were expressed as pg/ml and
the CTLL-2 bioassay as counts per minute representing the
IL-2-dependent cellular incorporation of 3H-thymidine (ICN, Costa
Mesa, CA) by CTLL-2 cells.
T-cell proliferation assay.
The second duplicate microplate in all experiments were
analyzed for changes in mitogen-induced T-cell proliferation.
72h following anti-CD3/PMA activation and in the absence or
presence of oligonucleotides, cells were pulsed with 1 ~Ci
3H-thymidine (ICN, Costa Mesa, CA) and incubated overnight at
37~C. Mitogen-induced cell growth, as assessed by incorporation
of radioactive label, was determined by harvesting the cells and
scintillation counting on a Wallac Betaplate counter (Wallac,
Gaithersburg, MD).
Inhibition of CD28 expression in activated
h~m-n T-cells by CD28-specific oli~onucleotides
Anti-CD3/PM~ treatment of human T-cells increased the
surfac~ expression of CD28 (using immunofluorescence analysis)
from a MCS of 122 ~7.74 in resting T-cells to a MCS of lSO +9.27
CA 02211621 1997-07-28
W096/24380 PCT~S96101507
- 34 -
(n = 9). The difference in CD28 expression in resting and
activated T-cells is defined as mitogen-induced CD28 expression
(Figure 3A). Figure 3B and 3C shows the treatment of
anti-CD3/PMA-activated T-cells with phosphorothioate (denoted as
S-oligomers, Figure 3B) and phosphorothioate-3' amine (denoted
as A-oligomers, Figure 3C) forms of CD28-specific and control
oligonucleotides in 2 donors and with 2 separate batches of each
oligonucleotide. Of the four candidate oligonucleotides, RT01 -
RT04, (Table 1), in the dose range 2 - 10 ~M, both
phosphorothioate and phosphorothioate-3' amine forms of RT03 and
RT04 were the most active inhibitors of mitogen-induced CD28
expression, both inhibiting induced CD28 expression by greater
than 50~ (IC50) at 5 ~M or less. These two oligonucleotides,
which differ in length, were designed to hybridize with a
stretch of double-stranded DNA, 5' upstream of the transcription
initiation site of the CD28 gene. No similar dose-dependent
inhibition of mitogen-induced CD28 expression was observed with
the control oligonucleotides, RTC01 (SEQ ID NO: 5) - RTC06 (SEQ
ID NO: 10) (Table 1). All experiments were performed on at
least three batches of each oligonucleotide using T-cells from 7
donors. The fact that oligonucleotide regulation of CD28
expression was demonstrable in human T-cells is critical because
peripheral, epidermal and dermal T-lymphocytes are the intended
target of CD28-specific oligonucleotides.
Tnh;h; tion of mito~en-induced T-cell
proliferation by CD28-speci~ic oligonucleotides
The mitogenic effect of anti-CD3/PMA treatment was
demonstrable by the augmented proliferation observed following
the activation cf resting T-cells. The incorporation of
3H-thymidine, represented as counts per minute, was 301641 +
...... .... . ... ~1 1n~'J LLT~ ~U~T lQI II ~ '~
CA 02211621 1997-07-28
W096/24380 PCT~S96/01507
- 35 -
47856 (n = 9) in activated T-cells and 650 + 566 (n = 9) in
resting T-cells. The effect of anti-CD3 and PMA on T-cell
proliferation are synergistic as shown in Figure 4A. Figure 4B
shows a representative experiment of the effect of CD28-specific
and control phosphorothioate oligonucleotides on
anti-CD3/PMA-activated T-cell proliferation. In at least seven
separate experiments, all in the dose range 2 - 10 ~M, both
phosphorothioate (data not shown) and phosphorothioate-3~ amine
(Figure 4B) forms of RT03 and RT04 were the most active
inhibitors of mitogen-induced T-cell proliferation, inhibiting
T-cell proliferation by up to 45~. No similar dose-dependent
inhibition of mitogen-induced T-cell proliferation was observed
with the control oligonucleotides, RTCO1 (SEQ ID NO: 6) - RTCO6
(SEQ ID NO: 10). Here, treatment with CD28-specific oligo-
nucleotides, RT03 and RT04, could reverse the hyperproliferation
of activated T-cells thus demonstrating that regulation of the
CD28 pathway had a significant effect on one vital biological
function of T-cell activation, T-cell proliferation.
Tnh;hition of activated T-cell-derived cytoki~e
~oductiQn by CD28-specific Qligo~ucleoti~es
Activated T-cells produce a variety of immunomodulatory
cytokines including IL-2, interferon-gamma and IL-8. CD28
-inducible restriction elements for IL-2 and IL-8 have been
demonstrated in the promoter sequences for both genes and have
subsequently been shown to be regulated by the CD28 pathway
(Fraser et al., (1991) Science 251:313-316, Seder et al., (1994)
J Exp Med 179:299-304). Interferon-gamma also has been shown to
be regulated by the CD28 pathway (Wechsler et al., J. Immunol.,
153:2S15-2523 (1994)). Anti-CD3/PMA treatment of resting
T-cells dramatically increased the T-cell -derived levels of all
CA 02211621 1997-07-28
W 096/24380 PCTnUS96101507
- 36 -
three cytokines (Figures 5A, 6A and 7A). Figure 5, 6 and 7 res-
pectively depict the effect of phosphorothioate (B) and
phosphorothioate-3' amine ~ versions of CD28-specific and
control oligonucleotides on IL-2, interferon-gamma, and IL-8
production in activated T-cells from the same representative
donor. The CD28-specific oligonucleotides, RT03 (SEQ ID NO: 3)
and RT04 (SEQ ID NO: 4) but not the control oligonucleotides,
RTCO1 (SEQ ID NO: 5)- RTC06 (SEQ ID NO: 10) (data not shown)),
inhibited mitogen-induced IL-2, interferon-gamma, and IL-8
production in activated T-cells in a dose-dependent manner.
Both phosphorothioate (ICso 5 ~M) and phosphorothioate-3~ amine
(IC~o lO ~M) forms of the CD28-specific oligonucleotides were
equally active in the dose range 2 - 10 ~M. Similar results for
all three cytokines were seen with 4 or more different donors.
These observations demonstrate that CD28-specific oligonucleo-
tides were also capable of regulating multiple effector
molecules of the CD28 pathway of T-cell activation.
Specificity of oligonucleotide inhibition of CD28 expre~sion.
The specificity of the CD28-specific oligonucleotides, RT03
and RT04 was evaluated by three methods.
(1) CD28-independent T-cell activation markers.
The first method was to determine whether these CD28-
specific oligonucleotides were able to inhibit the expression of
other human T-cell activation markers which act independently of
the CD28 costimulatory pathway. Activation of resting T-cells
significantly increases the expression of both the IL-2 receptor
(CD25) and the intracellular adhesion molecule, ICAM-1 (CD54).
However, both these accessory molecules are regulated
independently o the CD28 pathway (June et al., Mol. Cell Biol.,
7:4472-4481 (1987), Damle et al., J. Immunol., 149:2541 (1992)).
CI IRC I ITI IT~ rT 1~
CA 02211621 1997-07-28
W096/24380 PCT~S96101507
- 37 -
Figure 8 shows the effect of CD28-specific and control oligo-
nucleotides on CD25 (Figure 8A) and CD54 (Figure 8B) expression
in mitogen- activated T-cells. No significant decrease in the
activated T-cell expression of both CD25 and CD54 were observed
following treatment with all CD28- specific and control oligo-
nucleotides in the dose range 2 - lO ~M. This clearly
demonstrates the specificity of the CD28-specific oligonucleo-
tides in inhibiting expression of their target protein.
(2) CD28-negative T-cell line, HUT 78
The second method was to demonstrate that the CD28 pathway
was really the target for CD28-specific oligonucleotides by
comparing mitogen-induced IL-2 production in a CD28+, T-cell
leukemia cell line, Jurkat E6-l and a CD28-, T-cell lymphoma
cell ~ine, h~ 78. Figure 9A con~lrms the absence of CD28
expression in both resting and activated HUT 78 cells whereas
constitutive levels of CD28 increases upon activation in Jurkat
E6-l cells (Figure 9B). In CD28+ Jurkat E6-l cells,
CD28-specific but not control oligonucleotides were able to
inhibit mitogen-induced CD28 expression (Figure 9C) and also
mitogen-induced IL-2 production (Figure lOB). In contrast, in
CD2&- HUT 78 cells, mitogen-induced IL-2 production was not
affected by CD28-specific and control oligonucleotides (Figure
lOA). This clearly demonstrates the specificity of these oligo-
nucleotides to inhibit only CD28-regulated IL-2 production.
(3) Specific activation of CD28 pathway
The third method was to activate resting T-cells specif-
ically via the CD28 pathway using anti-CD28 monoclonal antibody
in combination with mitogens (anti-CD3/PMA) using identical
protocols to those used in activating T-cells with mi~ogens
alone. Anti-CD28 mAb in combination with PMA or anti-CD3 mAb
has been previously shown to provide the costimulatory signal to
CA 02211621 1997-07-28
W096/24380 PCT~S96/01507
- 38 -
resting T-cells and promote only CD28-dependent and not
TCR-dependent augmentation of T-cell proliferation and cytokine
production (June et al., (1987) Mol. Cell Biol., 7:4472-4481).
Phosphorothioate and phosphorothioate-3~ amine versions of
CD28-specific but not control oligonucleotides were able to
inhibit CD28-dependent activation of IL-2, IL-8 and interferon-
gamma production and T-cell proliferaticn in
anti-cD28/mitogen-activated resting T-cells (data not shown).
This clearly demonstrates that only the CD28-specific oligo-
nucleotides act only on the CD28 pathway of T-cell activation.
VII. EXAMPLES - SERIES 2
Qligonucleotides
Oligonucleotides were synthesized with an Applied Bio-
systems 394 DNA synthesizer. Phosphorothioate linkages were
introduced after the standard oxidation bottle was replaced with
tetraethylthiuram disulfide/acetonitrile. The purity of the
oligonucleotides was assessed by analytical HPLC. All oligo-
nucleotides of ~90 ~ purity were lyophilized to dryness and
reconstituted in water (400 ~M). At least three batches of each
oligomer listed in Tables 3 and 5 were used. 5' labeling of
oligonucleotides was achieved using T4 polynucleotide kinase and
32 p-yATP-
T cell activation studies
Peripheral blood mononuclear cells (PBMCs) were isolatedfrom healthy donors by density gradient centrifugation followed
by T cell enrichment using Lymphokwik (One Lambda).
Contaminating monocytes were removed by adherence to plastic.
Purified T cells were ~ 99~ CD2~ HLA-DR~ and ~ 5 ~ CD25~.
.... ..... . .. _ 1'1 tnrT~rJ IT~l~ IJl~
-
CA 02211621 1997-07-28
W096l24380 PCT~S96/01507
- 39 -
Jurkat E6-1 (CD28+/CD4') T cells and HUT 78 (CD28-/CD4~) T cells
and the monocytic cell line, THP were obtained from ATCC. Cells
were cultured at a concentration of 0.2 - 0.3 x 106/well and
activated with plate-immobilized anti-CD3 monoclonal antibody
(mAb) (HIT3A 0.25 ~g/ml) (Pharmingen) and 2 ng phorbol
12-myristate 13-acetate (PMA) (Calbiochem).
ImmunQfluoresce~ce studies
Cells were co-stained with either PE-CD28/FITC-CD4 or
PE-CD54/FITC-CD25 mAb or with PE/FITC-labeled isotype-matched
controls (Becton Dickinson). Cell surface antigen density
(CD28, CD54, CD25) was confirmed by flow cytometry (FACScan,
Becton Dickinson). Viability was assessed by propidium iodide
(5 ~g/ml) exclusion in control untreated and oligo-treated CD4~
cells from multiple donors and was typically ~ 90 ~ (range 90 -
99 ~) following 48h incubation with 1 - 10 ~M of each batch of
all oligonucleotides.
Proliferation and cytokine assaYs
Proliferative responses were assessed by measuring 3H
-thymidine (1~ Ci, ICN) incorporation for the last 16h of each
assay. Cells were harvested onto filters and DNA synthesis was
measured following scintillation counting on a Wallac Betaplate
counter. Cytokine concentrations in culture supernatants were
assayed using ELISA kits for IL-2, IL-8 (R & D Systems) and IFN-
y (Endogen) or by bioassay using the IL-2-dependent cell line,
CTLL-2 (ATCC).
RT-P~R and South~rn Analysis
Total cellular RNA was extracted using Trizol reagent
(GIBCO/BRL). The cDNA synthesis reaction (Promega) was
,
CA 02211621 1997-07-28
W096l24380 PCT~S96/01507
- 40 -
performed using oligomer (dT)l5 primer and AMV reverse
transcriptase (H. C.). The PCR reaction (GeneAmp PCR kit,
Perkin-Elmer Cetus) consisted of 50 ~l mixture containing 3 ~l
of cDNA, dNTPs (each at 200 ~M), 0.5 ~M of each primer and 1
unit of Taq polymerase. The primers used were as follows:CD28,
S'-CTGCTCTTGGCTCTCAACTT-3' (sense) and 5' AAGCTATAGCAA GCCAGGAC-
3' (antisense), interleukin-2 receptor p55 alpha chain primers
(Stratagene) and pHE7 ribosomal gene. Kao, H.-T., Nevins, J. R.
(1983) Mol. Cell. Biol. 3, 2058-2065 Amplification conditions
were 45 sec at 94~C, 1 min at 57~C and 2 min at 72~C for 35
cycles, followed by 8 min at 72~C. PCR products were separated
on 2~ agarose, transferred to Hybond N+ membrane (Amersham) in
20 X SSC overnight and immobilized using 0.4 M NaOH. Blots were
hybridized with 32P-yATP labeled oligonucleotide probes. Washed
blots were then analyzed using PhosphorImager.
MT-R and alloa~tigen-specific T cell a~sa~3
For MLR responses, PBMCs were cultured (1:1) with mitomycin
C-treated (50 ~g/ml) PBMCs from a HLA-disparate individual. In
alloantigen-specific T cell assays, T cells isolated from PBMCs
of tetanus-toxoid-primed healthy donors were cultured (1:1) with
autologous mitomycin C-treated PBMCs in the presence of tetanus
toxoid (2 ~g/ml, List Biologicals). In both assays, 2 x 105
cells/well were cultured for 6 days at 37~C prior to further
analysis.
I~ ~i tro oliqonucleotide ~tability studies
Temporal oligonucleotide stability analyses were performed
as described previously (Tam, R. C., Li, Y., Noonberg, S.,
Hwang, D. G., Lui, G., Hunt, C. A., Garovoy, M. R. (1994)
Nl~cleic Ac;ds Res. 22, 977-986). Oligonucleotide aegradation
~r ~st lT~r ~t ~T rDl ll .r-~ ~ . ... . . .. . ..
CA 02211621 1997-07-28
W 096124380 PCTnUS96tO1507
- 41 -
profiles were assessed by electrophoresis and quantitated using
Nickspin columns.
Tnh;hition of CD28 expression bY phospllorothioate oli~onucleo-
tides is ~peci~ic and affe~t~ acti~ated T c~ll function.
Figure 11 summarizes the effect of the phosphorothioate
oligonucleotides from Table 3 on surface expression of accessory
molecules and on cytokine secretion in activated T cells. The
oligomers used were designed to hybridize to the 5' untranslated
region (UT) of the CD28 gene, and were either antisense (AS) or
G-rich sequences. Control oligomers were either sense strand
(SS) or complementary strand (CS) sequences. 48h treatment of
resting T cells (R) with anti-CD3 antibody and PMA augmented the
expression (Ac) of the accessory molecules, CD28(A), CD25(B) and
CD54~ and of the cytokines, IL-2(D), IFNy(E) and IL-8(F) Data
are presented as mean standard deviation of triplicate samples.
The cumulative effect o~ two additions (O and 24h) of 2~M ( ~),
5~M( ~) and lO~M (~) of the phosphorothioates from Table 3 on
activation-induced T cell function was monitored by
immunofluorescence analysis (accessory molecules) and by
determination of secreted cytokine levels using CTLL-2 bioassay
(IL-2) and ELISA (IFNy, IL-8). Surface antigen density (MCS), in
gated live CD4~ cells was measured as the increase in mean
channel of fluorescence compared to IgG1 controls. IL-2-
dependent cellular incorporation of 3H-thymidine was measured as
counts per minute (cpm) and immunoreactive IFNy and IL-8 as
pg/ml. The data shown, all derived from experiments performed
on T cells isolated from a single donor, are representative of
experiments from 9 separate donors.
Table 3. Phosphorothioate oligonucleotides
_
CA 02211621 199i-07-28
W096/24380 PCT~S96101507
- 42 -
Oligo Sequence (5' to 3')Description SEQ ID
NO
RTOlS TTG TGG TGA CGA TGG GCT A AS 5' UT 79-97 42
RT02S AGC AGC CTG AGC ATC TTT GT AS 5' UT 94-113 43
RT03S TTG GAG GGG GTG GTG GGG G-rich 5' UT 58-75 44
RT04S GGG TTG GAG GGG GTG GTG GGG G-rich 5' UT 58-78 45
RTCOlS TAG CCC ATC GTC AGG ACA A SS to RTOl 46
RTC02S ACA AAG ATG CTC AGG CTG CT SS to RT02 47
RTC06S AAC CTC CCC CAC CAC CCC CS to RT03 48
The data demonstrates that selected phosphorothioate
oligomers (Table 3) can specifically block activation-induced
CD28 expression in CD4~ T cells. In a representative donor
(Figure llA), activation-induced CD28 expression but not IL-2
receptor (CD25) or intracellular adhesion molecule-l (ICAM-l or
CD54) expression, was inhibited in a dose-dependent manner by
the phosphorothioate oligomers, RT03S (SEQ ID NO: 44) and RT04S
(SEQ ID NO: 45) ( ICso < 5 ~M). No similar inhibition was
observed with the antisense oligomers, RTOlS (SEQ ID NO: 42) or
RT02S (SEQ ID NO: 43) or the control oligomers, RTCOlS (SEQ ID
NO: 46), RTC02S (SEQ ID NO: 47) and RTC06S (SEQ ID NO: 48).
Furthermore, we provided evidence that the active oligomers
modulated activation-induced CD28 by blocking transcription in
activated human T cells. At 10 ~M, RT03S (SEQ ID NO: 44) and
RT04S (SEQ ID NO: 45) but not a representative control oligo,
RTC06S (SEQ ID NO: 48), reduced expression of activation-induced
levels of CD28 but not IL-2 receptor mRNA (Figure 12).
Figure 12 shows the effect of phosphorothioate oligonucleo-
tides at 10 ~M on CD28 and CD25 mRNA levels. Resting (lane 1)
~Il~n~n~T~ ~U c~rr~
CA 02211621 1997-07-28
W096/24380 PCT~S96101507
- 43 -
and anti-cD3/pMA-activated (6h) levels of CD28 and CD25 mRNA, in
the absence (lane 2) or presence of the oligonucleotides, RT03S
(SEQ ID NO: 44) (lane 4), RTC06S (SEQ ID NO: 64) (lane 5) and
RT03D (SEQ ID NO: 49) (lane 6) were detected following RT-PCR of
total cellular RNA and Southern analysis using specific,
radiolabeled probes. The CD28 probe was derived from exon 2
(5'-ACGGGGTTC AACTGTGATGGGAAATTGGGCAA-3') and for IL-2 receptor,
the probe was generated from the original primer mix. Equivalent
loading was assessed following hybridization with a probe
generated from pHE7 sense primer. RNA from CD28-deficient HUT
(7) and THP (8) cell lines were used as controls. The data shown
are representative of 3 separate experiments.
Thus the specific inhibition of CD28 mRNA levels by
biologically active phosphorothioates paralleled their effect on
CD28 surface protein. Moreover, active oligomers abrogated
activation-induced T cell function, as RT03S (SEQ ID NO: 44) and
RT04S (SEQ ID NO: 45) but not RTOlS (SEQ ID NO: 42) or RT02S
(SEQ ID NO: 43) or the control oligomers, RTCOlS (SEQ ID NO:
46), RTC02S (SEQ ID NO: 47) and RTC06S (SEQ ID NO: 48), markedly
inhibited ant--CD3/PMA-induced synthesis of the cytokines, IL-2,
IFNy and IL-8 by activated T cells (ICso < 5 ~M, range 2 - 10 ~M)
(Figure llB).
As alternate costimulatory pathways can also induce
lymphokine synthesis in activated T cells (Damle, N. K.,
Klussman, K., Linsley, P.S., Aruffo, A. (1992) J. Immu~ol. 148,
1985-1992), - was important to determine whether the biological
activity of RT03S (SEQ ID NO: 44) and RT04S (SEQ ID NO: 45) was
specific to runctional CD28 expression. Accordingly, we
compared the e~f~ct of phosphorothioates on anti-CD3/PMA-induced
IL-2 production in a CD28 , T cell leukemia cell line, Jurkat
E6-1 and a CD28-, T cel' lymphoma cell line, HUT 78. As
CA 02211621 1997-07-28
W096/24380 PCT~S96/01507
- 44 -
summarized in Figure 13, 48h treatment of resting cells (R) with
anti-CD3 antibody and PMA increased CD28 expression (Ac) in
Jurkat (A, right) but not HUT 78 (A, left) cells. However,
activation augmented IL-2 production in Jurkat, (C left), and
HUT 78 (D, left) cells. The active oligonucleotides, RT03S (SEQ
ID NO: 44) and RT04S (SEQ ID NO: 45), at 1 ~M (~) 2(M ( ~), 5
~M ( ~) and lO ~M (~) inhibited CD28 expression (B) and IL-2
levels (C, right) in activated Jurkat cells but had no effect on
CD28-independent IL-2 secretion in activated HUT 78 cells (D,
right). The data shown are representative of three separate
experiments.
In Figure 13A, immunocytofluorometric analysis confirmed
the absence of CD28 expression in both resting and activated HUT
78 cells, whereas constitut ve levels of CD28 increased upon
activation in Jurkat E6-1 cells. Furthermore, in Jurkat E6-1
cells, RT03S (SEQ ID NO: 44) and RT04S (SEQ ID NO: 45) (range 1
- lO~M) significantly inhibited both activation-induced CD28
expression (Figure 13B) and IL-2 production (Figure 13C). In
contrast, although activated HUT 78 cells produced similar
levels of IL-2, no comparable oligo-dependent inhibition of this
lymphokine was observed (Figure 13D).
We also demonstrated that T cell activation (expression of
CD28, IL-2, IL-8 and IFNy) directed by a specific anti-CD28 mAb
in combination with anti-CD3, was blocked by biologically active
phosphorothioate oligomers (data not shown). Direct
crosslinking o CD28 molecules has been previously shown to
promote only CD28-dependent and not TCR-dependent augmentation
of T cell proliferation and cytokine production (June, C. H.,
Ledbetter, J. A., Gillespie, M. M., Lindsten, T., Thompson, C.
B. (1987) Mol. Cell Bio' 7, 4472-4481.). Taken together, our
- . -
CA 022il621 1997-07-28
W O 96/24380 PCTnUS96tO15n7
- 45 -
data strongly suggests that bioactivity of the active oligomers
was specific to the CD28 pathway of T cell activation.
IA~hibition of T cell proliferati~e re~ponse~ in alloanti~en-
dependent T cell a~say and primary allo~eneic mixed lymphocyte
reaction by phosphorothioate oliqonucleotides
We next compared the efficacy of the CD28-specific oligo-
nucleotides, RT03S (SEQ ID NO: 44) and RT04S (SEQ ID NO: 45) in
blocking antigen-specific primary immune responses in vitro. In
Figure 14, resting (A, B) and activated (E, F) levels of CD28
are indicated for tetanus toxoid-specific T cell assay (top
panel, A and B) and mixed lymphocyte reaction (bottom panel, E
and F). The percentage of CD4~, CD28-hi T cells is shown in the
right-han~ mark~r ~r A, B, E and F. Oligomer activity was
assessed by the potential of two additions (O and 96h) of 1 ~M
(O) 2~M ( ~), 5 ~M (~) and 10 ~M ( n)phosphorothioate oligo-
nucleotides from Table l to reduce the percentage of CD28-hi
expressing T cells (C, G) and activated T cell proliferation (D,
H) in each assay. Activation of T cells was induced in response
to tetanus toxoid (top panel) or following stimulation of
responder T cells (X) by mitomycin-C treated stimulator PBMCs
(Y) (bottom panel). These data are representative of three
separate experiments.
In Figure 14, using both tetanus toxoid-specific T cell
assay (Figure 14B) and primary mixed lymphocyte reaction (Figure
14F), we observed the appearance of a subpopulation of
activation-induced CD28-hi expressing T cells after the 6 day
assay period. Addition of RT03S (SEQ ID NO: 44) and RT04S (SEQ
ID NO: 45) (2 - 10 ~M) resulted in a dose-related diminution of
CD28-hi expression (Fig~. 14C, 14G) and a corresponding decrease
in tetanus toxoid-specific (Figure 14D) and responder cell
, . . , ~
CA 02211621 1997-07-28
W096/24380 PCT~S96101507
- 46 -
antigen-specific (Figure 14H) T cell proliferation. No similar
effect was observed with RTOlS (SEQ ID NO: 42) or the control
oligomers, RTCOlS (SEQ ID NO: 46), RTC02S (SEQ ID NO: 47) or
RTC06S (SEQ ID NO: 48).
In vitro oli~onucleotide stability extends the biolo~i~al
activity of phosphorothioate oligonucleotides.
It is known that modification of oligomers with phosphoro-
thioate internucleotide linkages can impart nuclease resistance
and thus extend the in vi tro bioactivity from 1 - 2h to 24h
(Stein, C. A., Cheng, Y. C. (1993) Science 261, 1004-1012.).
Table 4 shows the temporal effect of phosphorothioates, RT03S
(SEQ ID NO: 44) and RTC06S (SEQ ID NO: 48) on surface CD28
expression in the continued presence ~ or following removal of
oligonucleotide from the extracellular milieu on day 2 (D).
Monitoring was performed by immunofluorocytometry. Results are
expressed as the difference in surface antigen expression of
activated T cells (MCFA) and oligonucleotide-treated activated T
cells (MCFx). CD28 expression in resting T cells on day 2 to 4
was in the range 119 - 121. "ND" represents no distinguishable
difference.
~ 'T~ IT~ ~11~rT rD~
CA 02211621 1997-07-28
W096/24380 PCT~S96tO1507
- 47 -
Table 4. Temporal activity of phosphorothioates following
continuous or discontinuous oligonucleotide treatment
Differential CD28 expression (MCFA - MCFx)
RT03S (SEQ ID RTC06S (SEQ ID
NO: 44) NO: 47)
Day MCFA O 5 10 0 5 10
2 144.8 18.4 8.9 9.3 1.9 1.7 ND
3 C 135.621.9 15.9 5.1 ND ND 3.2
3 D 136.818.3 11.8 7.1 1.7 3.8
4 C 128.918.2 9.7 6.1 ND ND ND
4 D 130.12.3 ND ND ND ND ND
As shown in Table 4, the duration of effect of RT03S (SEQ
ID NO: 44) exceeded 24h and persisted through day 2, 3 and 4,
relative to oligomer dose. However, upon removal of RT03S (SEQ
ID NO: 44), from the extracellular milieu on day 2, the
inhibitory activity remained for 24h and was then completely
abolished within the next 24h. No oligomer activity was
observed with a representative control oligo, RTC06S (SEQ ID NO:
48) throughout the same time course. A similar phenomenon was
observed with oligo-mediated inhibition of activated T cell
proliferation (data not shown). Increased bioavailability
provided by phosphorothioate modification alone cannot account
for the remarkably prolonged bioactivity of RT03S (SEQ ID NO:
44). Thereforc, we demonstrated that the extended duration of
effect was asso_iated with additional in vitro stability
provided by the secondary structure of RT03S (SEQ ID NO: 44).
Figure ;- summarizes test results on the in vi tro stability
of 3:P-labeled phospho~othioates, RT03S ~SEQ ~D NO: 4 ' and
CA 02211621 199i-07-28
W096/24380 PCT~S96/01507
- 48 -
RTC06S (SEQ ID NO: 48) in extracellular supernatants (top panel)
and Jurkat cell lysates (bottom panel). (A) Time-dependent
degradation (0 - 95 h) of each oligonucleotide (2000 cpm) was
assessed by electrophoresis on a 20~ polyacrylamide denaturing
gel followed by visualization using a PhosphorImager~ (B) The
percentage of intact full length 32p_ RT03S (SEQ ID NO: 44) (o)
and 32p_ RTC06S (SEQ ID NO: 48) (-) remaining at each time point,
relative to t = 0, was determined in eluates from 10000 cpm of
extracellular supernatants and cell lysates applied through
Nickspin columns (Pharmacia). Molecular weight standards (Std),
2P-dNTP (N) and free 32P-orthophosphate (P) were simultaneously
analy2ed .
In Figure 15A, the electropherograms clearly show that, for
both extracellular supernatants (S) and cell lysates (L),
considerably more intact 32P-labeled RT03S (SEQ ID NO: 44) than
RTC06S (SEQ ID NO: 48) remained following a 96h incubation with
Jurkat cells. Consistent with this observation are the Nickspin
column data (Figure 15B). Here, the percentage of intact
oligomer recovered from RT03S (SEQ ID NO: 44) after 96h was 54~
(S) and 59~ (L) and from RTC06S (SEQ ID NO: 48) was 10~ (S) and
34~ (L). In addition, secondary structure alone is not
sufficient to account for the increased nuclease resistance and
duration of bioactivity of RT03S (SEQ ID NO: 44) as its
phosphodiester counterpart, RT03D had little bioactivity (Table
5) and from in vitro stability studies, only had a half-life of
24h (data not shown).
Table 5. Identification of oligonucleotide se~uence
responsible for inhibition of CD28 expression and CD28-dependent
IL-2 production
Cl IRCTITI IT~ CII~ 121 11 r
CA 02211621 1997-07-28
W096l24380 PCT~S96tO1507
- 49 -
* Relative inhibition o~ expression
Oligo Sequence CD28 IL-2 SEQ ID
NO:
RT03S (D) TTG GAG GGG ÇTG GTG GGÇ 100 (3) 100(44) 44(49)
RTllS GGG GAG GAG ÇGÇ CTG GAA 100 100 50
RT04S GGG TTG GAG GGG GTG GTG 123 100 45
GGÇ
RT05S TTG GAG GGG GAG GAG GGG 136 100 51
RT09S TTG GAG GGG GAG GTG GGG 126 100 52
RTlOS TTG GAG GCG GTG GT~ GCG 31 38 53
RT24S TTG GAG CCG GTG GTG GCC 40 57 54
RT25S TTG GAG GÇG CTC CTC GGG 44 25 55
RT23S TTG GAG CCG GTG GTG G 38 57 56
RT18S GGG GTG GTÇ GGG 103 120 57
RT19S G GGG TTG GGG 30 89 5 8
RTC07S TG GGG 2 2 59
RTC08S G GGG 2 2 60
RT20S CAC TGC GGG GAG GGC TGG 58 7 6 61
GG
RT21S ATG ÇGG TGC ACA AAC TGG 51 63 62
GG
RT15S AAC GTT GAG GGG CAT 26 52 63
RT06S TTC CAG CCC CTC CTC CCC 29 22 64
RTC06S AAC CTC CCC CAC CAC CCC 4 2 48
In preparing the data for Table 5, the in vitro activity of
phosphorothioate oligonucleotides was determined by their
ability to inhibit CD28 expression in anti-CD3/PMA-activated
peripheral human T cells and their effect on activated 'L-2
CA 02211621 1997-07-28
W096/24380 PCT~S96/01507
, - 50 -
production in Jurkat T cells. Results are expressed relative to
the activity of 5 ~M RT03S (SEQ ID NO: 44) (100~) whose range of
inhibition in 7 experiments was 52 - 79 ~ of CD28 expression
and 76 - 89 ~ of IL-2 production. The values for the
phosphodiester form of RT03D (SEQ ID NO: 49) are in parentheses.
Identi~ication of ~;n;m~l sequence which confers biolo~ical
acti~ity in ~itro
Active phosphorothioate, RT03S (SEQ ID NO: 44), is an 18
mer originally designed to hybridize to the 5' untranslated
region of the human CD28 gene, and has a sequence containing two
sets of contiguous four G's. To identify the sequence-related
factors critical for inhibition of activation-induced CD28
expression in human T cells and CD28-dependent IL-2 production
in Jurkat T cells, bases were selectively added, deleted or
substituted from RT03S (SEQ ID NO: 44) and activity assessed
relative to the parent oligomer (Table 5). Addition of three
G's at the 5' end (RT04S) or one or more changes of T to A in
the region between both four G sequences (RT05S (SEQ ID NO: 51),
RT09S (SEQ ID NO: 52)) did not reduce the inhibitory effect
relative to RT03S (SEQ ID NO: 44). Interestingly, the sense
sequence (RTllS (SEQ ID NO: 50)) also showed no change in
activity relative to RT03S (SEQ ID NO: 44). However, in
contrast, deletion or replacement of one or more G's by cytosine
(C) within both sets of four G's (RTlOS (SEQ ID NO: 53), RT24S
(SEQ ID NO: 54), RT25S (SEQ ID NO: 55), RT23S (SEQ ID NO: 56)
(SEQ ID NO: 56)) resulted in a marked loss of activity relative
to RT03S (SEQ ID NO: 44). Deletion of the six residues 5' of
the first four G's in RT03S (SEQ ID NO: 44) had no effect on the
inhibitory activi~y of the oligonucleotide (RT18S (SEQ TD NO:
57)). In con_rast, reducing (RT19S (SEQ ID NO: 58)) or
~ ~n~Trrl ITC ~LICCT ~DI 11 ~
CA 022il621 1997-07-28
W 096124380 PCTrUS96101507
~ - 51 -
increasing (RT20S (SEQ ID NO: 61), RT21S (SEQ ID NO: 62)) the
number of residues between both four G sequences dramatically
reduced the inhibitory activity relative to RT03S (SEQ ID NO:
44). TGGGG, GGGG or sequences containing 4 consecutive G's such
as RT15S (SEQ ID NO: 63 had little or no inhibitory activity
relative to RT03S (SEQ ID NO: 44). These data demonstrated that
the biological activity of RT03S (SEQ ID NO: 44) is dependent on
a specific sequence motif comprised of 2 sets of 4 contiguous
G's separated by 3 - 5 residues.
In view of the tolerogenicity imparted by disrupting CD28
function (Boussiotis, V. A., Freeman, G. J., Gray, G., Gribben,
J., Nadler, L. M. (1993) J. Exp. Med. 178, 1753-1763.), it was
important to examine whether oligo-mediated inhibition of CD28
expre~sion could provlde ~ more e~fective strategy for inducing
T cell anergy and alloantigen-specific tolerance in vitro. We
showed that the phosphorothioate oligomers, RT03S ~SEQ ID NO:
44) and RT04S, inhibited anti-CD3/PMA-induced CD28 expression in
human CD4~ T cells by reducing both mRNA and mature protein
levels relative to oligomer dose. Furthermore, in order to
demonstrate taraet specificity, we examined oligo-mediated
effects on IL-2 receptor and ICAM-1 expression: two accessory
molecules known to be regulated independently of the CD28
pathway (Damle, N. K., et al., (1992) J. Immunol. 148,
1985-1992; June, C.H. et al., (1987) Mol. Cell ~3iol. 7,
4472-4481; Stein, C. A., et al., Y.-C. (1993) Science 261,
1004-1012; Boussiotis, V. A., et al., (1993) J. Ex~. Med. 178,
1753-1763). Cc-respondingly, both activated message and protein
levels of CD25 and surface expression of CD54 were resistant to
oligomer action.
Costimula_ on via the CD28 pathway directly induces
expression of mmunomodulatory cytokines such as I~-2, IF~y and
_ _ _ _ _
CA 02211621 1997-07-28
W096/24380 PCT~S96101507
- 52 -
IL-8 in activated T cells (Fraser, J. D., et al., (1991) Science
251, 313-316 Jenkins, M. K., et al., (1991) J. Immunol. 147,
2461-2466; Seder, R. A., et al., (1994) J. Exp. Med. 179,
299-304; Wechsler, A. S., et al ., ( 1994) J. Immunol. 153,
2515-2523). For tolerogenicity to be successful, active
CD28-specific oligomers must abrogate this function.
~m;ni stration of active oligomers resulted in concomitant
modulation of activation-induced IL-2, IFNy and IL-8 production.
To underscore the exquisite specificity of the active oligomers
to inhibit CD28-dependent functions, we showed that they were
unable to prevent activation-induced IL-2 production in a
CD28-deficient cell line, HUT 78. Furthermore, maximal oligo--
mediated inhibition of IL-8 production in activated T cells
never exceeded 50~ suggestihg that an alternative regulatory
pathway driving CD28-independent IL-8 production was preserved.
Oligomer activity was not restricted to polyclonally activated T
cells, as inhibition of activation-induced CD28 levels resulted
in dramatically reduced T cell proliferation in both MLR and in
tetanus-toxoid-specific T cell assays. Thus, our active
oligomers mediated alloantigen-specific tolerance in vitro, and
provide a promising alternative to the ligand capture strategy
for inducing T cell hyporesponsiveness such as seen with CTLA 4
Ig, a high affinity B7 binder (Tan, P., Anasetti, C., Hansen, J.
A., Melrose, J., Brunvand, M., Bradshaw, J., Ledbetter, J. A.,
Linsley, P.S. (1993) J. Exp. Med. 177, 165-173.).
In determining the duration or effect of the active
pharmacophore, we observed that RT03S (SEQ ID NO: 44) showed
surprisingly persistent inhibition of both activated CD28
expression and C328-aependent T cell proliferation, even 96h
following oligomer treatment. Bioactivity was not related to
toxicity as upon removal of oligomer complete reversal of
CA 02211621 1997-07-28
W096/24380 PCT~S96101507
- 53 -
inhibitory activity occurred within 24h. Moreover, upon
comparison of the phosphorothioates, RT03S (SEQ ID N0: 44) and
RTC06S (SEQ ID NO: 48), our in vitro stability studies showed
that secondary structure, mediated by the G-rich sequence in
RT03S (SEQ ID NO: 44), increased two- to fourfold the nuclease
resistance typically associated with phosphorothioates (Stein,
C. A., Cheng, Y. C. (1993) Science 261, 1004-1012.). The
extended half life (96h) of 32P-RTo3S (SEQ ID NO: 44) correlated
with its duration of bioactivity. In addition, RT03D, the
phosphodiester counterpart of RT03S (SEQ ID NO: 44), exhibited
both reduced in vitro stability and bioactivity, an observation
which is consistent with previous reports (Maltese, J.-Y.,
Sharma, H. W., Vassilev, L., Narayanan, R. (1995) Nucleic Acids
Re~. 23, 1146-115I~. Therefore, stability imparted by secondary
structure is not solely responsible for the increased
bioactivity o~ RT03S (SEQ ID N0: 44). Thus the nuclease
stability granted by both phosphorothioate modification and
secondary structure may account for the prolonged inhibitory
activity of RT03S (SEQ ID N0: 44).
Single base pair substitution in hybridization-dependent,
antisense and antigene models can virtually abolish activity
(Maltese, J.-Y., Sharma, H. W., Vassilev, L., Narayanan, R.
(1995) Nucleic Acids Res. 23, 1146-1151.). In contrast,
activity of CD28-specific oligomers was only dramatically
reduced if sequential substitution occurred within both sets of
four G's implying defined structural requirement for oligomer
function. In addition, following cationic stabilization (100 mM
KC and NaCl) of the secondary structure present in RT03S (SEQ
ID NO: 44), the oligomer melting curve showed a transition
profile (data not shown) which is suggestive of G-quartet
formation (Hardin, C. C., Watson, T., Corregan, M., Bailey, C.
CA 02211621 1997-07-28
W096/24380 PCT~S96/01507
- 54 -
(1992) Biochemistry 31, 833-841). Taken together, our data
provide evidence that this class of CD28-specific oligomers act
via a hybridization- independent mechanism and that secondary
structure of the sequence, possibly through G-quartet formation,
delimits oligomer activity. Similarly, Bennett, C. F., Chiang,
M. Y., Wilson-Lingardo, L., Wyatt, J. R. (1994) Nucleic Aci~
Res. 22, 3202-3209, demonstrated that activity of their
phosphorothioate oligomers was based on possible G-quartet
formation in sequences containing two sets of three or more
consecutive G and this suggested that oligo-mediated regulation
of human phospholipase A~ was through specific nucleic
acid-protein interaction.
Specific protein recognitior. by a range of G-quartet
structures have been demonstrated in telomeres, centromeres
(Blackburn, E. H. (1990) J. Biol. Chem. 265, 5919-5921),
immunoglobulin switch regions (Shimizu, A., Honjo, T. (1984)
Cell 36, 801-803) and a class of regulatory oligomers called
aptamers (Bock. L. C., Griffin, L. C., Latham, J. A., Vermaas,
E. H., Toole, J. J. (1992) Nature 355, 564-566; Huizenga, D. E.,
Szostak, J. W. (1995) 3iochemistry 34, 656-665; Bergan, R.,
Connell, Y., Fahmy, B., Kyle, E., Neckers, L. (1994) Nucleic
Acids Res. 22, 2150-2154). In our studies, oligomers capable of
forming an intermolecular four stranded G-quartet structure from
a set of four contiguous G's, such as those in telomeres (Smith,
F. W., Feigon, J. (1992) Nature 356, 164-167), weakly inhibited
CD28 expression. An example of this was RT15S (SEQ ID NO: 63,
whose G-rich sequence was previously shown by otners to inhibit
c-myc expression (seauence 14 in Burgess, T. L., Fisher, E. F.,
Ross, S. L., Bready, J. V., Qian, Y.-X., Bayewitch, L. A.,
Coher., A. M., Herrera, C. J., Hu, S. S.-F., Kramer, T. B., Lott,
.. D., Ma_tin, r. ~ ;ierce, G. F., Simonet, _., Farrell, C. L.
_ _ ~IIQC ~IT~ C U ~rt~lll r ~t~
CA 02211621 1997-07-2X
W 096/24380 PCTnUS96101507
- 55 -
(1995) Proc. Natl. Acad. Sci. USA 92, 4051-4055). Another
G-rich structure, the intramolecular G-quartet, has been shown
to mediate aptameric inhibition of thrombin (Wang, K. Y.,
McCurdy, S., Shea, R. G., Sw~min~nthan, S., Bolton, P. H. (1993)
Biochemistry 32, 1989-1904; Macaya, R. F., Schultze, P., Smith,
F. W., Roe, J. A., Feigon, J. (1993) Prcc. Natl. Acad. Sci. USA
90, 3745-3749). Sequential analysis of RT03S (SEQ ID NO: 44)
predicts that paired G's of residues 3 - 4, 7 - 8, 12 - 13 and
16 - 17 can po~entially form such a G-quartet structure.
However, removal of residues 1 - 6 (RT18S (SEQ ID NO: 57)),
which disrupted the intramolecular quartet, was ineffective in
blocking the ~nhib_tion of CD28 expression and CD28-dependent
IL-2 production. These data suggest that th~ activity of RT03S
(SEQ ID NO: 44) arises from an alternate G-quartet structure.
RT~3S (SEQ ID NO: 44) indeed has a similar 12 mer sequence
to a motif predicted by others (Smith, F. W., Feigon, J. (1993)
Biochemistry 32, 8682-~692) to be essential for dimeric
G-quartet formation. Dimeric G-quartets can arise from two
strands of DNA, alternately ~arallel and antiparallel. Here,
adjacent strands contribute four G's to form four stacked
G-quartets. ~ mot f on each strand, consisting ~ twelve
residues with four bases separating two sets of contiguous four
G's, was associated with formation and stability. We have shown
that the core ' 2 mer sequence (RT18S (SEQ ID NO: 57)) has
similar activity to RT03S (SEQ ID NO: 44). Also G to C
substitutions (RTlOS (SEQ ID NO: 53), RT23S (SEQ TD NO: 56),
RT24S (SEQ I3 NO: 54), RT25S (SEQ ID NO: 55)) within both the
four C- regions resulted in a 56 - 69~ loss of inhibitory
activity rela_ive _o RT03S (SEQ ID NO: 44). Simiiarly,
inse~.ion (RT20~ ~SEQ D NO: 61', RT21S (SEQ TD NO: 62)~ or
deletion (RTlCS (S-Q _D NO: 58)) c_ bases separa_inc the sets o-
CA 02211621 1997-07-28
W096l24380 PCT~S96101507
- 56 -
G's reduced the relative bioactivity by S2 - 70~. Taken
together, these data suggest that a specific sequence motif,
which has the capability to form a dimeric G-quartet, is
critical for phosphorothioate oligo-mediated inhi~ition of
functional CD28 expression.
The mechanism by which this type of dimeric G-quartet
exerts its biological effect is unknown. However, several lines
of evidence substantiate the hypothesis that this motif enables
our active oligomers to function as decoys, presumably by
competitively hindering the interaction of a dimeric G-quartet
promoter sequence with a specific transcription factor. 1) An
oligomer corresponding to an upstream region of the CD28 gene
(RTllS (SEQ ID NO: 50)) exhibited equivalent biological activity
to RT03S (SEQ ID NO: 44). 2) Our active oligomers function via
a non-antisense mechanism. 3) These oligomers modulated CD28
mRNA expression; hence their bioactivity was not related to
direct target protein interaction. 4) G-rich promoter regions
are prevalent (Evans, T., Schon, E., Grazyna, G. M., Patterson,
J., Efstratiadis, A. (1984) Nucleic Acids Res. 12, 8043-805;
Kilpatrick, M. W., Torri, A., Kang, D. S., Engler, J. A., Wells,
R. D. (1986) J. ~iol. Ghem. 261, 11350-11354; Clark, S. P.,
Lewis, C. D., Felsenfeld, G., (1990) Nucleic Acids Res. 18,
5119-5126.), increasing the possibility that G-quartet-forming
promoter sequences are a general regulatory phenomena. 5)
Double stranded oligomers can act as decoys for the
transcription factor, E2F (Morishita, R., Gibbons, G. H.,
Horuchi, M., Ellison, K. E., Nakajima, M., Zhang, L., Kaneda,
Y., Ogihara, T., Dzau, V. J. (1955) Proc. Natl Acad. Sc . USA
92, 5855-5859). 6) G-rich oligomers have been shown to mediate
the induc_ion of Spl transcription factor (Perez, J. R., Li, Y.,
CA 022il621 1997-07-28
W096/24380 PCT~S96101507
- 57 -
Stein, C. A., Majumder, S., van Oorschot, A., Narayanan, R.
(1994) Proc. Natl. Acad. Sci. USA 9l, 5957-5961).
~ INCORPQRATION BY REFERENCE
All patents, patents applications, and publications cited
are incorporated herein by reference.
EOUIVALENTS
The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. Indeed, various modifications of the above-described
makes for carrying out the invention which are obvious tO those
skilled in the field of organic chemistry or related fields are
intended to be within the scope of the following claims.
