Note: Descriptions are shown in the official language in which they were submitted.
CA 02229938 1998-02-19
W O 97/07404 PCTAUS96~137
Title of the Invention
I~ln~S OF ASSESSING MHC ChASS I EXPRESSION AND
PR~-L~l~S CAPABLE OF MODULATING CLASS I EXPRESSION.
This is a continuation-in-part application of
U.S.S.N. 08/480,525 filed June 7, 1995 which is a
continuation of U.S.S.N. 08/073,830 filed June 7, 1993,
which is herein incorporated by reference in its entirety.
Field of the Invention
This invention is in the field of treatment of
autoimmune diseases and transplantation rejection in a
m~mm~l, More specifically, this invention relates to
methods for treating and preventing these diseases using
drugs capable of suppressing expression of the major
histocompatibility complex (MHC) Class I molecules and to
methods for the development or assessment of drugs that
are capable of suppressing MHC Class I expression. This
invention also relates to genes and their corresponding
proteins capable of modulating MHC Class I expression.
Backqround of the Invention
A primary function of the immune response is to
discriminate self from non-self antigens and to eliminate
the latter. The immune response involves complex cell to
cell interactions and depends primarily on three major
cell types: thymus derived (T) lymphocytes, bone marrow
derived (B) lymphocytes, and macrophages. The immune
response is mediated by molecules encoded by the major
histocompatibility complex (MHC). The two principal
classes of MHC molecules, Class I and Class II, each
comprise a set of cell surface glycoproteins ("Basic and
Clinical Immunology" (1991) Stites, D.P. and Terr, A.I.
(eds), Appelton and Lange, Norwalk, Connecticut/San Mateo,
California). MHC Class I molecules are found on virtually
all somatic cell types, although at different levels in
different cell types. In contrast, MHC Class II molecules
are normally expressed only on a few cell types, such as
lymphocytes, macrophages and dendritic cells.
CA 02229938 1998-02-19
WO 97/07404 PCTrUS96/13715
Antigens are presented to the immune system in
the context of Class I or Class II cell surface molecules;
CD4+ helper T-lymphocytes recognize antigens in
association with Class II MHC molecules, and CD8+
cytotoxic lymphocytes (CTL) recognize antigens in
association with Class I gene products. It is currently
believed that MHC Class I molecules function primarily as
the targets of the cellular immune response, whereas the
Class II molecules regulate both the humoral and cellular
immune response (Klein, J. and Gutze, E., (1977) "Major
Histocompatibility Complex" Springer Verlag, New York;
Roitt, I.M. (1984) Trianqle, (Engl Ed) 23:67-76; Unanue,
E.R. (1984) Ann. Rev. Immunology, 2:295-428). MHC Class I
and Class II molecules have been the focus of much study
with respect to research in autoimmune diseases because of
their roles as mediators or initiators of the immune
response. MHC-Class II antigens have been the primary
focus of research in the etiology o~ autoimmune diseases,
whereas MHC-Class I has historically been the focus of
research in transplantation rejection.
Graves' disease is a relatively common
autoimmune disorder of the thyroid. In Graves' disease,
autoantibodies against thyroid antigens, particularly the
thyrotropin receptor, alter thyroid function and result in
hyperthyroidism ("Basic and Clinical Immunology" (1991)
Stites, D.P. and Terr, A.I. (eds), Appelton and Lange,
Norwalk, Connecticut/San Mateo, Cali~ornia: pages 469-
470). Thyrocytes from patients with Graves' disease have
aberrant MHC-Class II expression and elevated MHC Class I
expression. (Kohn et al., (1992) In "International
Reviews of Immunology," Vol. 912:135-165).
Thionamide therapy has historically been used to
treat Graves' disease. The most commonly used thionamides
are methimazole (MMI), carbimazole (CBZ) and propyl-
thiouracil (PTU). These thionamides contain a thiourea
group; the most potent are thioureylenes (W.L. Green
CA 02229938 1998-02-19
W O 971074~4 PCTrUS96/13715
(1991) In Werner and Ingbar's "The Thyroid~: A
Fundamental Clinical Text" 6th edition, L. Braverman and
R. Utiger (eds), J.B. Lippincott Co. page 324). The
thionamides restore a euthyroid state by inhibiting
thyroid peroxidase catalyzed formation of the thyroid
hormones produced by the thyroid stimulating autoantibody
stimulated thyroid (Solomon, D.H. (1986) In "Treatment of
Graves' Hyperthyroidism". Ingbar, S.H., Braverman, L.E.
(eds) The ~Thvroid: JB Lippincott Co., Philadelphia,
Pennsylvania, p. 987-1014; Cooper, D.S. (1984) N. Engl. J.
Med., 311: 1353-1362; Cooper, D.S. (1991) Treatment Of
Thyrotoxicosis. In Werner And Ingbar's The Thyroid: A
Flln~mental and Clinical Text," 6th edition. L. Braverman
and R. Utiger (eds), J. B. Lippincott Co. pages 887-916).
It has been reported that MMI and PTU can inhibit
peroxidase-dependent enzymes in the kidney and that MMI
can inhibit gastric peroxidase in rat gastric mucosa
(Zelman, S.J. et al., (1984) J. Lab. Clin. Med. 104:185-
192; Bandyopadhyay, U. et al., (1992) Biochem J. 284:305-
312). PTU has also been reported to inhibit hepatoxicity
associated with alcoholism (Orrego, H. et al., (1987) N.
Engl. J. of Med. 317:1421-1427). Thionamides have been
used to treat Graves' patients for extended periods of
time with the majority of patients experiencing no
complication related to this therapy (Cooper, D.S. (1991)
Treatment Of Thyrotoxicosis. In Werner And Ingbar's The
Thyroid: A Flln~m~ntal and Clinical Text," 6th edition.
L. Braverman and R. Utiger (eds), J. B. Lippincott Co.
pages 887-916). Allergic reactions, including such
sy~m~ptoms as fever, rash, urticaria, occur in 1-5~ of
patients. Toxic reactions to thionmide treatments are
rare, occurring in only 0.2 to 0.5~ of the patients
(Cooper, D.S. (1991) Treatment Of Thyrotoxicosis. In
Werner And Ingbar's The ThYroid: A Fl~n~m~ntal and
Clinical Text," 6th edition. L. Braverman and R. Utiger
(eds), J. B. Lippincott Co. pages 887-916).
CA 02229938 1998-02-19
WO 97/07404 PCT~US96/13715
- 4-
In addition to the effect of thionamides on
thyroid hormone synthesis, it was recognized that
thionamide therapy in Graves' disease was associated with
a reduction in thyroid autoantibodies (Cooper, D.S. (1982)
N. Clin. Endocrinol. Metab. 29:231-238; Kuzuya, N. et al.,
S J. Clin. Endocrinol. Metab. 48:706-714; Bech, K. and
Madsen, S.N. (1980) Clin Endocrinol (Oxf) 13:417-26;
Hallengren, B. et al. (1980) J. Clin. Endocrinol. Metab
51:298-301S Cooper, D.S. (1991) Treatment Of
Thyrotoxicosis. In Werner And Ingbar's "The Thyroid: A
Fnn~mental and Clinical Text," 6th edition. L. Braverman
and R. Utiger (eds), J. B. Lippincott Co. pages 887-916).
Studies on the mechanism by which thionamides exert this
effect are contradictory. One hypothesis suggests that
the thionamides act directly on thyroid follicular cells
and that the subsequent modulation in thyroid activity
results in the immune effects (Volpe et al., (1986) Clin.
~ndocrinol~ 25:453-462). A second hypothesis suggests
that thionamides act directly on lymphocytes, particularly
thyroid lymphocytes (Weetman, A.P. (1992) Clin
Endocrinol. 37:317-318; McGregor, A.M. (1980) Brit. Med.
J., 281:968-969). It has also been suggested that MMI
interferes with antigen handling by accessory cells
because these cells possess a peroxidase enzyme system
(Weetman, A.P. (1983) Clin. Immuno. and Immunopath, 28:39-
45). The current consensus appears to be that the
therapeutic action of the thionamides, including the
immunosuppressive effects, is thyroid specific and intra-
thyroidal (D.S. Cooper (1991) Treatment Of Thyrotoxicosis.
In Werner And Ingbar's The Thyroid: A Fundamental and
Clinical Text," 6th edition. L. Braverman and R. Utiger
(eds), J. B. Lippincott Co. pages 888-889).
Results of studies involving the use of MMI in
the treatment of diabetes are also contradictory. Hibbe,
T. et al., (1991); Diabetes Res. and Clin. Practice 11:53-
58, report that MMI enhances the development of
CA 02229938 1998-02-19
W O 97/07404 PCT~US96/13715
-- 5--
streptozotocin-mediated diabetes in mice. In contrast,
Waldhausl, W. et al. (1987) Akt. Endokrin. Stoffw. 8, 119
(abstract) report enhanced remission in 54~ of 11 patients
treated with MMI shortly after diagnosis of type I
diabetes, basing their therapy on reputed effects of MMI
on T helper cells. These authors reported no change in
the levels of Class I and Class II antigens and it is
unclear whether the effect was due to MMI or natural
remission of the disease over the 9 month "honeymoon"
period. In the BB rat, MMI depressed spontaneous
development of thyroiditis but did not reduce the
incidence of diabetes (Allen, F.M. et al., (1986) Am. J.
Med. Sci., 292: 267-271; Braverman, L.E. et al., (1987)
Acta. Endocrinol. (Coppenhagen) Suppl. 281: 70-76).
Saji, M. et al. (1992a); Proc. Natl. Acad. Sci.
U.S.A. 89:1944-1948 describe hormonal regulation of MHC-
class I genes in the rat thyroid cell line, FRTL-5.
Treatment of the FRTL-5 cell line with thyroid stimulating
hormone (TSH) resulted in decreased transcription of MHC
class I DNA and reduced cell surface levels of MHC Class I
antigens. Recently, a report by Saji, M. et al., (1992b)
J. Clin. Endocrinol. Metab. 75:871-878, demonstrated that
agents such as serum, insulin, insulin-like growth factor
- I (IGF-l), hydrocortisone and thyroid stimulating
thyrotropin receptor autoantibodies from Graves' patients
decrease MHC-Class I gene expression in that FRTL-5 cells.
In addition, treatment of the FRTL-5 cells with MMI or
high doses of iodide resulted in decreased MHC Class I
gene expression. The effect of MMI on reduction of MHC
Class I expression was shown to be at the level of
transcription and was additive with thyroid stimulating
hormone and other hormones which normally suppress Class I
in these cells. Sa~i, M. et al. (1992b) J. Clin.
Endocrinol. Metab. 75:871-878, suggest a new mechanism by
which MMI may act in the thyroid during treatment of
Graves' disease; no extrapolation was made to any other
-
CA 02229938 1998-02-19
W O g7/07404 PCTrUS96/13715
autoimmune diseases. Prior to these studies it was known
that Rous sarcoma virus, adenoviruses 12 and 2 and certain
Gross viruses reduced expression of MHC Class I; however,
SV40, Rad LV, and Mo MuLV viruses can increase Class I MHC
expression (Singer & Maguire (1990) Crit. Rev. in Immun.
10:235-257).
Systemic lupus erythematosus (SLE) is a chronic
autoimmune disease that, like Graves', has a relatively
high rate of occurrence. SLE affects predominantly women,
the incidence being 1 in 700 among women between the ages
- 10 of twenty and sixty ("Cellular and Molecular Immunology
(1991) Abbus, A.K., Lichtman, A.H., Pober, J.S. (eds);
W.B. Saunders Company, Philadelphia: page 360-370). SLE
is characterized by formation of a variety of
autoantibodies and by multiple organ system involvement
("Basic and Clinical Immunology" (1991) Stites, D.P. and
Terr, A.I. (eds), Appelton and Lange, Norwalk,
Connecticut, San Mateo, California: pages 438-443).
Current therapies for treating SLE involve the use of
corticosteroids and cytotoxic drugs, such as cyclosporin.
Immunosuppressive drugs such as cyclosporin, FK506, or
rapamycin suppress the immune system by reducing T cell
numbers and function (Morris, P.J. (1991) Curr. O~in. in
Immun., 3:748-751). While these immunosuppressive
therapies alleviate the symptoms of SLE, and other
autoimmune diseases, they have numerous severe side
effects. In fact, extended therapy with these agents may
cause greater morbidity than the underlying disease.
Women suffering from SLE who have breast cancer
face particular difficulties. These individuals are
immunosuppressed as a result of corticosteroid and
cytotoxic drug treatment for SLE; radiotherapy for the
treatment of the cancer would additionally enhance the
immunosuppressed state. Further, radiation therapy, a
current method of choice can exacerbate disease expression
or induce severe radiation complications. For these
,
CA 02229938 1998-02-19
W 097J~74~4 P~AUS96n37~S
individuals, alternative therapies that would allow for
simultaneous treatment of SLE and the cancer are greatly
needed. In general, alternative therapies or new methods
of assessing the therapeutic potential of drugs for
treating autoimmune diseases are greatly needed.
As is true for autoimmune diseases, there is a
great need for different ways of treating or preventing
transplantation rejection. Transplantation rejection
occurs as a result of histoincompatibility between the
host and donor; it is the major obstacle in successful
transplantation of tissues. Current treatment for
transplantation rejection, as for autoimmune disease,
involves the use of a variety of imml~nosuppressive drugs
and corticosteroid treatment.
Faustman et al., (PCT International Application
No. 92/04033) identify a method for inhibiting rejection
of a transplanted tissue in a recipient ~n; m~ 1 by
modifying, eliminating, or masking the antigens present on
the surface of the transplanted tissue. Specifically,
this application suggests modifying, masking, or
eliminating human leukocyte antigen (HLA) Class I
antigens. The preferred masking or modifying drugs are
F(ab)' fragments of antibodies directed against HLA-Class
I antigens. However, the effectiveness of such a therapy
will be limited by the hosts' immune response to the
antibody serving as the masking or modifying agent. In
addition, in organ transplantation this treatment would
not affect all of the cells because of the perfusion
limitations of the masking antibodies. Faustman et al.
disclose that fragments or whole viruses be trans~ected
into donor cells, prior to transplantation into the host,
to suppress HLA Class I expression. Use of whole or
fragments of virus presents potential complications to the
recipient of such transplanted tissue since some viruses,
SV40 in particular, can increase Class I expression
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
(Singer and Maguire (l990) Crit. Rev In Immunol. l0:235-
237, TABLE 2).
- Durant et al. (British Patent No. 592, 453)
identify isothiourea compositions that may be useful in
the treatment of autoimmune diseases and host versus graft
(HVG) disease and assays for assessing the
immunosuppressive capabilities of these compounds.
However, this study does not describe MMI or the
suppression of MHC Class I molecules in the treatment of
autoimmune diseases.
U.S. Patents 5,0l0,092 and 5,097,441 describe a
method for reducing nephrotoxicity resulting from
administration of an antibiotic in a m,7mm;71 by
coadministration of the antibiotic with either MMI or CBZ.
These patents neither suggest nor teach the use of MMI to
lS suppress MHC Class I expression in the treatment of
autoimmune diseases or in the treatment and prevention of
transplantation rejection, a then suppression of Class I
molecules as a therapeutic indication of drug to be used
in treating auto7mml7n~ diseases and transplantation
rejection.
SUMMARY OF THE INVENTION
This invention relates to methods for treating
autoimmune diseases in m~mm;71s and for preventing or
treating transplantation rejection in a transplant
recipient. These methods involve administering to a
m,7mm;71 in need of treatment a drug capable of suppressing
expression of MHC Class I molecules. This invention also
relates to pretreating transplantable cells, tissues or
organs prior to transplantation into a recipient with a
drug capable of suppressing MHC Class I molecules. In
particular this invention relates to the use of MMI in
treating autoimmune diseases in m;7mm,71s and for preventing
or treating transplantation rejection in a transplant
recipient. In addition, this invention further includes
methods for in vivo and n vitro assays for the
CA 02229938 1998-02-19
W O 97/07404 PCTAUS96/13715
development and assessment of drugs capable of suppressing
expression of MHC Class I molecules.
One in vivo method may be comprised of three
steps. First, MHC Class I deficient mice are used to
evaluate the importance of MHC Class I in a particular
experimental autoimmune disease. Second, an ~nim~l which
is useful as a model for a particular autoimmune disease,
either experimentally induced or spontaneous, i8 exposed
to the drug being evaluated. Third, the therapeutic
potential of the drug is evaluated by the alleviation of
symptoms or signs of the autoimmune disease in the treated
;~ n ; m~ 1 .
Another in vivo method may be also comprised of
three steps. First, a m~mmAlian cell line, tissue or
organ is treated with the drug. Second, the treated
cells, tissues, or organs are transplanted into a m~mm~l
which may also be treated with the drug. Third, the cells
are removed from the recipient m~mm~l and cell survival is
evaluated.
There are a vareity of methods provided herein
for the in vitro assays. In one method the ability of the
drug to suppress expression of MHC Class I molecules is
assessed by treating m~mm~l ian cells with a candidate
drug, combining cell extracts from the treated cells with
MHC Class I regulatory nucleic acid sequences, detecting
formation of a complex between the nucleic acid sequences
and proteins from the extract, and comparing alterations
in complex formation in extracts from treated and
untreated cells. In another in vitro method, the
therapeutic potential of the drug may be evaluated by its
ability to down regulate Class I transcription in cells.
By way of example down regulation of MHC Class I
transcripts may be assessed by reporter gene assays.
In yet another in vitro assay the ability of a
drug to suppress expression of MHC Class I molecules is
CA 02229938 1998-02-19
W O 97/07404 PCT~US96/13715
-- 10--
evaluated by its ability to alter expression of proteins
capable of modulating expression MHC Class molecules.
Yet another object of the invention is to
provide nucleic acid sequences which encode proteins
capable of modulating MHC Class I expression.
It is yet another object of this invention to
provide a recombinant molecule comprising a vector and all
or part of the nucleic acid sequences provided herein
which are capable of modulating Class I expression.
It is yet another object of this invention to
produce recombinant proteins encoded by all or part of the
nucleic acid sequences encoding the proteins capable of
modulating MHC Class I.
It is a further object of this invention to
provide monoclonal or polyclonal antibodies reactive with
those proteins, peptides or portions thereof.
An object of the invention is to provide a
method for treating m~mmAls suffering from autoimmune
diseases.
Another object of the invention is to provide a
method of preventing or treating rejection of a tissue in
a transplant recipient.
A further object of the invention is to provide
a method for preventing rejection of cells containing a
recombinant gene transplanted into a mAmm~l in need of
gene therapy.
Another object of the invention is to provide i
vivo and in vitro assays for the assessment and
development of drugs capable of suppressing MHC Class I
molecules.
A further object of the invention is to provide
in vivo and in vitro assays that are predictive of the
therapeutic usefulness of candidate drugs.
DESCRIPTION OF FIGURES
Figures lA-lD shows that Class I-deficient mice
generate anti-16/6Id antibodies, but not anti-DNA or anti-
CA 02229938 1998-02-19
W O g7~74~4 PCT~US96rI37I5
nuclear antigen antibodies. Serial two-fold dilutions of
sera were assayed by ELISA 10 weeks after ;mmllnlzation.
Results are the average of measurements of 5 individual
animals and are expressed as OD at 405 nm X 103, as a
function of serial serum dilutions. Standard deviation
values did not exceed 10~ of the mean. Sera of 16/6Id-
1mmlln;zed control 129 mice (O), 16/6Id-imml7n;zed Class I-
deficient mice (-), and ovalbumin-lmml~n;zed Class I-
deficient ~mice(-).
lA. Titration of 16/6Id binding in the sera of
lmmlln;zed mice; purified 16/6Id immobilized on plates.
lB. Titration of single-stranded DNA binding in
the sera of immunized mice; single-stranded DNA
immobilized on plates.
lC. Titration of nuclear antigen binding in the
sera of immunized mice; nuclear extract immobilized on
plates.
lD. Titration of ovalbumin binding in the sera
of immunized Class I-deficient mice (-); ovalbumin
immobilized on plates. Sera of Class I-deficient mice
which were not ; mmlln; zed with ovalbumin (~) are the
control in this experiment.
Figures 2A-2D show that Class I-deficient mice
do not respond to immunization with monoclonal anti-16/6Id
antibody. Serial two-fold dilutions of sera were analyzed
by ELISA, 7 weeks after immunization. Results are the
average of measurements of 6 animals. Standard deviation
value did not exceed 10~ of the mean. Sera of anti-
16/6Id-immunized control 129 (-) and anti-16/6Id-immunized
class I-deficient mice (-)
2A. Titration of anti-16/6Id binding in the
sera of immunized mice; purified rabbit polyclonal anti-
16/6Id immunoglobulin immobilized on plates.
2B. Titration of single-stranded DNA binding in
the sera of ;mm~ln;zed mice; single-stranded DNA
immobilized on plates.
CA 02229938 1998-02-19
WO 97/07404 PCTAUS96113715
- 12-
2C. Titration of 16/6Id binding in the sera of
;mmlln;zed mice; 16/6Id immobilized on plate.
2D. Titration of nuclear antigens binding in
the sera of immunized mice; nuclear extract immobilized on
plate.
Figures 3A-3B shows immunohistological
~ml n~tion of kidney sections of Class I-deficient (3Bj
and control 129 (3A) mice injected with 16/6Id. Frozen
kidney sections (5 ~m thick) were fixed and stained with
FITC-conjugated, gamma chain-specific goat anti-mouse IgG
(magnification X200). The kidney sections shown are from
one individual in each group and are representative of
that group.
Figures 4A-4D. Figures 4A and 4B show the
appearance of anti-16/6Id and anti-DNA antibodies in mice
exposed to a single immunization and boost with a human
monoclonal anti-DNA antibody bearing the 16/6Id. Figures
4C and 4D show titers of the anti-16/6Id and anti-DNA
antibodies in mice 21 1/2 weeks after treatment with MMI.
4A. Shows the titer of anti-16/6Id antibodies
in mice prior to treatment with MMI. Control Balb/c mice
which received no immunization (Q); 16/6Id immunized mice
which will or will not be treated with MMI or MMI plus
thyroid hormone, specifically thyroxine (T4)(O, ~, O).
4B. Shows the titer of anti-DNA antibodies in
mice prior to treatment with MMI. Designations are the
same as in (A).
4C. Shows the titer of anti 16/6Id antibodies
in mice after treatment with MMI or MMI and thyroxine
(T4). Control animals ;mml~n;zed with 16/6Id but receiving
no treatment (O); ~n;m~ls immunized with 16/6Id then
treated with 60 days of MMI (-), or with 60 days of MMI
and T4 (O); animals which were not ;mmlln;zed with 16/6Id
but were treated with 60 days of MMI O) or animals
treated with 60 days of MMI and T4 (O).
CA 02229938 1998-02-19
WO 97~07404 PCTAUS96/I3715
4D. Shows the titer of anti DNA antibodies in
mice after treatment with MMI or MMI and thyroxine (T4).
Designations are the same as in (C).
Figure 5 shows the relative white blood cell
(WBC) count as a percentage of the WBC in 16/6Id-treated
S control animals with no exposure to MMI or thyroxine (T4)
(-); in 16/6Id-treated animals exposed to MMI(O); and
16/6Id-treated animals exposed to MMI and T4(~) at 3
months, 5 months and 8 months after the boost.
Figures 6A-6B show the development of immune
complexes in the kidneys of 16/6Id-treated mice treated
with MMI (6B) versus 16/6Id-treated ~n;m~l S not treated
with MMI (6A).
Figures 7 A-D shows the effect of MMI treatment
on lymphocyte populations during experimental SLE disease.
The experimental SLE disease resulted from treatment with
16/6Id.
7A. Shows the distribution of the lymphocyte
populations in mice ;mmlln;zed with 16/6Id
( ~ ); mice ;mmlln; zed with 16/6Id and
treated with MMI and thyroxine (T4) ( ~ );
mice ;mmlln;zed with 16/6Id and treated with
T4 ( ~ ); mice immunized with 16/6Id and
treated with MMI (~tlll)i and mice immunized
with 16/6Id and administered placebo
( ~ ).
7B. Shows the levels of Class I on T cells over
time in mice immunized with 16/6Id ( ~ )
and mice immunized with 16/6Id and treated
with MMI ( ~ ).
7C. Shows the levels of Class I on B cells over
time in mice immunized with 16/6Id ~ )
and mice ;~mlln;zed with 16/6Id and treated
with MMI ( ~ ).
7D. Shows the levels of Class II on B cells
over time in mice immunized with 16/6Id
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
( ~ ) and mice ;mmllnized with 16/6Id and
treated with MMI ( _ ).
Figures 8 shows the effect of 2 months of MMI
treatment (15 mg released over 30 days by pellet
implantation) on anti-DNA antibody titers in NZBxNZWFl
mice. Control ~n;m~l s (BxWFl) (~) and BxWFl animals
treated with MMI (o). NZBxNZWFl mice are a mouse model of
SLE that develop spontaneous SLE.
Figure 9A-9B shows the sequence of PDl promoter
(SEQ ID NO:l) with the 151 (bold) (bases 54 to 220 of SEQ
ID NO:l), 114 (bold and underlined) (bases 221 to 320 of
SEQ ID NO:l), 140 (bold and boxed) (bases 321 to 455 of
SEQ ID NO:l) and 238 (bold and wavy box) (bases 456 to 692
of SEQ ID NO:l) regions or fragments of the 5' portion of
the PDl promoter. The 238 region (bases 456 to 692 of SEQ
ID NO:l) includes an AT rich 105 region (underlined)
(bases 588 to 692 of SEQ ID NO:l). The ATG start site is
noted by the amino acid 3 letter code starting with Met.
The numbers at the right indicate the number of base pairs
counting from the first nucleotide in the uppermost line.
Figure 10 shows the silencer and enhancer
regions of the 140 fragment (SEQ ID NO:2) with
oligonucleotides used to map the region for activity in
gel mobility shift assays. The silencer region which is
relevant to the MMI effects on complex formation in
mobility gel shift assay is noted by the opposites arrows
separated by a thyroid transcription factor-2 (TTF-2)-like
binding element which is insulin-sensitive. Mapping of
silencer-and enhancer-binding sites was by inhibition of
complex formation by various double-stranded (ds)-
oligonucleotides. A series of ds-oligonucleotides
spanning the 140-bp AvaII-DdeI DNA fragment was tested for
the ability to compete against enhancer and silencer
complexes. Of these, the only ones that competed were
those contained within the 96-bp segment shown. To
determine important residues for binding, variant ds-
SUBS 11 l UTE SHEET (RULE 26)
CA 02229938 1998-02-19
W 097~07404 PCT~US96~137~5
oligonucleotides were synthesized and tested for their
abilitie~ to inhibit silencer and enhancer complex
formation. Boxed regions represent sequences determined
by the inhibition studies using the ds-oligonucleotides to
be critical for complex formation, dots denote residues
identical to the native sequence. For simplicity, only
one strand of the ds-oligonucleotide sequence used in
competition studies is shown.
~ igure 10 (top) shows oligonucleotides used to
map the silencer-binding site. Arrows delineate
boundaries to the silencer element. Figure 10 (bottom)
shows oligonucleotides used to map the enhancer-binding
site. Arrows delineate the interrupted, inverted repeat
of the enhancer.
Figure 11 shows the alignment of the 114
fragment (SEQ. ID NO:36), 140 fragment (SEQ. ID NO:37) and
105 fragment (SEQ ID NO:35) of the 238 fragment (bases 456
to 692 of SEQ ID NO:1) to show sequence homology. The
silencer region is outlined in 140 (SEQ ID NO:37) by the
arrows as in Figure 10. All respond to MMI, as does 151.
Also identified, as in Figure 10, is the TTF-2 like
sequence. The (*) denotes identity with the 140 fragment;
the (-) homology with the 140 fragment in at least one
other fragment; the (--) denote gaps inserted by the
computer to derive the best fit. On the right, the
numbers denote the residue in each fragment which is
defined in Figure 9 when each is sequentially numbered
starting with number one.
Figures 12 A-D show mobility-shift assays using
the radiolabelled 140 (bases 321 to 455 of SEQ ID NO:1),
114 (bases 221 to 320 of SEQ ID NO:l) and 151 (bases 54 to
220 of SEQ ID NO:l) fragments noted in Figure 9 and cell
extracts from FRTL-5 rat thyroid cells. Cell extracts
from treated or untreated FRTL-5 cells were incubated with
the radiolabelled DNA fragments, and resulting DNA
fragment-protein complexes were electrophoresed in a
CA 02229938 1998-02-19
W O 97/07404 PCT~US96/13715
-- 16--
polyacrylamide gel and visualized by autoradiography. The
complex affected by MMI is denoted A.
12A. Shows the gel mobility shift assays of the
140 radiolabelled fragment (bases 321 to 455 of SEQ ID
NO~ lane 1 contains the 140 radio-labelled fragment
(bases 321 to 455 of SEQ ID NO:1) alone; lane 2 contains
cell extracts from FRTL-5 rat thyroid cells maintained in
the presence of 6H medium and treated with MMI; lane 3
contains oell extracts from FRTL-5 rat thyroid cells
maintained in the presence of 6H medium and not treated
with MMI; lane 4 contains cell extracts from FRTL-5 rat
thyroid cells maintained in the presence of the 5H medium;
lane 5 contains cell extracts from FRTL-5 rat thyroid
cells maintained in the presence of 5H medium and treated
with MMI; lane 6 contains cell extracts from FRTL-5 rat
thyroid cells maintained in the presence of 5H medium and
treated with thyroid stimulating hormone (TSH); and lane 7
contains cell extracts from FRTL-5 rat thyroid cells
maintained in 5H medium and treated with MMI and TSH.
12B. Shows the gel mobility shift assays of the
114 radiolabelled fragment (bases 221 to 320 of SEQ ID
NO:l) with FRTL- 5 rat thyroid cell extracts. Lane 1
contains the 114 radiolabelled fragment (bases 221 to 320
of SEQ ID NO:l) alone; lane 2 contains cell extracts from
FRTL-5 rat thyroid cells maintained in the presence of 6H
medium and treated with MMI; lane 3 contains cell extracts
from FRTL-5 rat thyroid cells maintained in the presence
of 6H medium and not treated with MMI; lane 4 contains
cell extracts from FRTL-5 rat thyroid cells maintained in
the presence of the 5H medium; lane 5 contains cell
extracts from FRTL-5 rat thyroid cells maintained in the
presence of 5H medium and treated with MMI; lane 6
contains cell extracts from FRTL-5 rat thyroid cells
maintained in the presence of 5H medium and treated with
thyroid stimulating hormone (TSH); and lane 7 contains
CA 02229938 1998-02-19
WO 97~74~4 - PCTAUS96~I3715
- 17-
cell extracts from FRTL-5 rat thyroid cells maintained in
5H medium and treated with MMI and TSH.
12C. Shows the gel mobility shift assays of the
lS1 radiolabelled fragment with FRTL-5 cell extracts.
Lane 1 contains the 151 radiolabelled fragment alone; lane
2 contains cell extracts from FRTL-5 rat thyroid cells
maintained in the presence of 6H media and treated with
MMI; lane 3 contains cell extracts from FRTL-5 rat thyroid
cells maintained in the presence of 6H medium and not
treated with MMI; lane 4 contains cell extracts from
FRTL-5 rat thyroid cells maintained in the presence of the
5H medium; lane 5 contains cell extracts from FRTL-5 rat
thyroid cells maintained in the presence of 5H medium and
treated with MMI; lane 6 contains extracts from FRTL-5
rat thyroid cells maintained in the presence of 5H medium
and thyroid stimulating hormone (TSH). Lanes a-d in
Figure 12C shows the formation of the A complex in the gel
shift mobility assays of the 151 radiolabelled fragment
(bases 54 to 220 of SEQ ID NO:1) plus FRTL-5 cell extracts
can be competed by unlabelled 105 (bases 588 to 692 of SEQ
ID N0:1), 140 (bases 321 to 455 of SEQ ID NO:1), 151
(bases 54 to 220 of SEQ ID NO:1) and 114 (bases 221 to 320
of SEQ ID N0:1) fragments. The incubation mixture in lane
(a) contains the 151 radiolabelled fragment (bases to 54
to 220 of SEQ ID NO:1), cell extracts from FRTL-5 rat
thyroid cells maintained in the presence of 5H medium, and
unlabelled 105 fragment (bases to 588 to 692 of SEQ ID
NO:1); lane (b) contains the 151 radiolabelled fragment
(bases to 54 to 220 of SEQ ID N0:1), cell extracts from
FRTL-5 rat thyroid cells maintained in the presence of 5H
medium, and unlabelled 140 fragment (bases 321 to 455 of
SEQ ID N0:1); lane (c) contains the 151 radiolabelled
fragment (bases to 54 to 220 of SEQ ID NO:1), cell
extracts from FRTL-5 rat thyroid cells maintained in the
presence of 5H medium, and unlabelled 151 fragment (bases
to 54 to 220 of SEQ ID NO:1); lane (d) contains the
CA 02229938 1998-02-19
WO 97/07404 PCTrUS96/13715
- 18-
radiolabelled 151 fragment (bases 54 to 220 of SEQ ID
NO:l), cell extracts from FRTL-5 rat thyroid cells
maintained in the presence of 5H medium and unlabelled 114
fragment (bases 221 to 320 of SEQ ID NO:l).
12D. Shows the gel mobility shift assays of the
radiolabelled-140 fragment (bases to 321 to 455 of SEQ ID
N0:1) with extracts from treated and untreated FRTL-5 cell
maintained in 3H medium. Unlike 5H medium, 3H medium
contains no insulin. The incubation in lane (j) contains
the 140 radiolabelled fragment (bases 321 to 455 of SEQ ID
NO:l) alone; lane (e) contains cell extracts from FRT~-5
rat thyroid cells maintained in the presence of 3H medium;
lane (f) contains cell extracts from FRTh-5 rat thyroid
cells maintained in 3H medium and treated with MMI; lane
(g) contains cell extracts from FRTL-5 rat thyroid cells
maintained in the presence of 3H medium and treated with
TSH; lane (h) contains cell extracts from FRTL-5 rat
thyroid cells maintained in the presence of 3H medium and
treated with MMI and TSH; lane (i) contains unlabelled 105
fragment together with cell extracts from FRTL-5 rat
thyroid cells maintained in the presence of 3H medium.
Figure 13 shows transfection data with
chloramphenicol acetyltransferase (CAT) chimeras showing
that MMI inhibits full length MHC Class I PDl promoter
activity. FRTL-5 rat thyroid cells were transfected with
the full length PDl promoter, CAT chimeric construct and
the cells either received no treatments ( ~ ), treatment
with MMI ( ~ ), treatment with TSH ( ~ ) or treatment
with TSH and MMI ( ~ ).
Figures 14A-B shows the gel shift mobility
assays of the radiolabelled 238 fragment (bases 456 to 692
of SEQ ID NO:l) (Figure 14(A)) or the radiolabelled K
oligonucleotide (SEQ ID NO:38) (Figure 14(B)) with
extracts from treated or untreated FRTL-5 rat thyroid
cells maintained in 5H medium. The complex affected by
MMI is denoted by A.
CA 02229938 1998-02-19
W ~ 97107404 PCT~US96f~371~
14A. Shows the gel mobility shift assays of the
radiolabelled 238 fragment (bases to 456 to 692 of SEQ ID
NO:1) incubated with extracts from treated or untreated
rat thyroid FRTL-5 cells maintained in 5H medium and with
unlabelled double-stranded (ds) oligonucleotides shown in
Figure 10. The incubation in lane 1 contains the 238
radiolabelled fragment (bases to 456 to 692 of SEQ ID
NO:1) alone; lane 2 contains cell extracts from FRTL-5 rat
thyroid cells maintained in the presence of 5H medium and
not treated with MMI; lane 3 contains cell extracts from
FRTL-5 rat thyroid cells maintained in the presence of 5H
medium and unlabelled 105 fragment (bases to 588 to 692 of
SEQ ID NO:1); lane 4 contains cell extracts from FRTL-5
rat thyroid cells maintained in the presence of the 5H
medium and unlabelled 114 fragment (bases to 221 to 320 of
SEQ ID NO:1); lane 5 contains cell extracts from FRTL-5
rat thyroid cells maintained in the presence o~ 5H medium
and unlabelled 140 fragment (bases to 321 to 455 of SEQ ID
NO:1); lane 6 contains cell extracts from FRTL-5 rat
thyroid cells maintained in the presence of 5H medium and
unlabelled 151 fragment (bases to 54 to 220 of SEQ ID
NO:1); lane 7 contains cell extracts from FRTL-5 rat
thyroid cells maintained in 5H medium and unlabelled K-
oligonucleotide (SEQ ID NO:38); lane 8 contains cell
extracts from FRTL-5 rat thyroid cells maintained in the
presence of 5H medium and unlabelled ds-oligonucleotide S2
(SEQ ID NO:4) (shown in Figure 10); lane 9 contains cell
extracts from FRTL-5 rat thyroid cells maintained in the
presence of 5H medium and unlabelled ds-oligonucleotide S3
(SEQ ID NO:10) (shown in Figure 10); lane 10 contains cell
extracts from FRTL-5 rat thyroid cells maintained in the
presence of 5H medium and unlabelled ds-oligonucleotide S8
(SEQ ID NO:8) (shown in Figure 10); lane 11 contains cell
extracts from FRTL-5 rat thyroid cells maintained in the
presence of 5H medium and unlabelled ds-oligonucleotide S6
(SEQ ID NO:6) (shown in Figure 10); lane 12 contains cell
CA 02229938 1998-02-19
W O g7/07404 PCTrUS96/13715
- 20-
extracts from FRTL-5 rat thyroid cells maintained in the
presence of 5H medium and unlabelled ds-oligonucleotide S1
(SEQ ID NO:3) (shown in Figure 10); lane 13 contains cell
extracts from FRTL-5 rat thyroid cells maintained in the
presence of 5H medium and unlabelled ds-oligonucleotide S7
(SEQ ID NO:7) (shown in Figure 10); lane 14 contains cell
extracts from FRTL-5 rat thyroid cells maintained in the
presence of 5H medium and treated with MMI and TSH; lane
15 contain~ unlabelled K-oligonucleotide (SEQ ID NO:38)
plus cell extracts from FRTL-5 rat thyroid cells
maintained in the presence of 5H medium and treated with
MMI and TSH.
14B. Shows the gel mobility shift assays of
radiolabelled K-oligonucleotide (SEQ ID NO:38) incubated
with extracts from treated or untreated rat thyroid cells
maintained in 5H medium. In lane 16, the incubation
contains the radiolabelled K oligonucleotide (SEQ ID
NO:38) with cell extracts from FRTL-5 rat thyroid cells
maintained in the presence of 5H medium alone. In lane 17
the incubation contains radiolabelled K oligonucleotide
(SEQ ID NO:38) with cell extracts from FRTL-5 rat thyroid
cells maintained in the presence of 5H medium and treated
with MMI; lane 18 contains the radiolabelled K
oligonucleotide (SEQ ID NO:38) with cell extracts from
FRTL-5 rat thyroid cells maintained in the presence of the
5H medium and treated with TSH; lane 19 contains the
radiolabelled K oligonucleotide (SEQ ID NO:38) and cell
extracts from FRTL-5 rat thyroid cells maintained in the
presence of 5H medium and treated with MMI and TSH.
Figures 15A-15B show the effect of MMI and TSH
on the transcription rate of MHC class I in FRTL-5 thyroid
cells maintained in medium with insulin and 5~ serum
(Figure 15A) or without insulin and only 0.2~ serum
(Figure 15B). FRTL-5 thyroid cells maintained for 7 days
in 5H medium plus 5~ calf serum (Figure 15A) or 4H medium
3S plus 0.2~ serum (Figure 15B) were exposed to lxlO-I~ TSH,
CA 02229938 1998-02-19
W ~ 97JO7404 P~US96n37
- 21-
5 mM MMI, or both. After 24 hours, nuclei were isolated
and incubated with [32p] UTP before nuclear RNA was
purified, then hybridized to an excess of class I cDNA and
~-actin (Saji, M., Moriarty, et al., (1992b) J. Clin.
Endocxinol. Metab. 75, 871-878; Isozaki, O., et al.,
(1989) Mol. Endocrinol. 3, 1681-1692). After
autoradiography and densitometry, the ratio of
radiolabeled class I to actin RNA was set at unity in the
control cells never exposed to TSH or MMI and the values
from treated cells compared. The level of ~-actin RNA
transcripts was not affected by the treatments. Values
are the mean of 3 experiments; significant increases or
decreases at P~0.05 (*) or P<0.01 (**) are noted. The
class I transcription rate in control cells in 4H medium
plus 0.2~ serum tFigure 15B) was approximately 3.2-~old
higher than in 5H medium plus 5~ serum (Figure 15A),
consistent with an approximately 4-fold higher in class I
RNA levels under the respective conditions (Saji, M.,
Moriarty, et al., (1992b) J. Clin. Endocrinol. Metab. 75,
871-878).
Figures 16A-16B show the effect of MMI and TSH
on the promoter activity of CAT chimeras of 5'-deletion
mutants of the swine class I promoter in FRTL-5 cells.
(Figure 15A) FRTL-5 cells grown in 6H medium (+TSH) were
transfected by electroporation with the different
constructs of the PD1 5'-flanking region. After 12 hours,
the medium was changed to fresh 6H medium (+TSH), fresh 6H
medium plus 5 mM MMI (+TSH/+MMI), or fresh 5H medium with
no TSH or MMI; CAT activity was measured 36 hours later.
Conversion rates were normalized to luciferase levels and
protein; the activity of the -1100 bp construct in cells
maintained in 6 H medium (first black bar) was assigned a
control value of 100~. Differences in the basal level of
expression for the different constructs reflect activity
of different regulatory elements which have already been
described Weissman, J. D. and Singer, D. S. (1991) Mol.
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 22-
Cell. Biol. 11, 4217-4227; Giuliani, C., et al., (1995) J.
Biol. Chem. 270, 11453-11462; Ehrlich, R., et al., (1988)
Mol. Cell Biol. 8, 695-703; Maguire, J. E., et al., (1992)
Mol. Cell. Biol. 12, 3078-3086; Howcroft, T. K., et al.,
(1993) EMB0 J. 12, 3163-3169), some of which are
summarized in (Figure 16B). Values are the mean i S.E. of
three different experiments, each performed in duplicate.
(Figure 15B) Graphic representation of the different
constructs. Regulatory elements noted include the
following: (a) the silencer/enhancer region important in
regulating constitutive class I levels in different
tissues; (b) Enhancer A; (c) the interferon response
element; (d) the 38 bp constitutive silencer containing
(e) the CRE-like sequence within the constitutive silencer
element. Also noted is (f) the CCAAT box important in
initiation of transcription. The numbering of these
elements and in all subsequent figures is determined from
+1, the start of transcription (Giuliani, C., et al.,
(1995) J. Biol. Chem. 270, 11453-11462) which is
nucleotide 1091 in Figure 9.
Figures 17A-17B show the ability of
oligonucleotides to prevent formation of the Frl40
protein/DNA complex which is modulated by MMI and TSH
(Figure 12A). (Figure 17B) indicates it is the silencer
element, -724 to -697 bp which is involved in complex
formation (Figure 17A); formation is also inhibited by
class I promoter fragments containing related silencer
element sequences 5' and 3' to Frl40 two of which are
described in Figure 11. In Figure 17A, cells were
cultured in 5H medium with no TSH for 7 days. Cell
extracts were prepared and incubated with the Frl40
radiolabeled probe, -770 to -636 bp, of the PD1 promoter.
The arrow marked (A) denotes the protein/DNA complex
decreased by MMI and TSH and identified as the silencer
element based on inhibition by a 250-fold excess of the S2
(SEQ ID No: 4) and S6 (SEQ ID No: 6) but not the E9
CA 02229938 1998-02-19
W O 97/07404 P ~ ~US96/137IS
- 23-
oligonucleotides (Fig. 10). The arrow marked (b) denotes
the protein/DNA complex identified as the enhancer element
based on inhibition by the S6 (SEQ ID No: 6)
oligonucleotide, which only partially inhibits the
silencer element, and E-9 which inhibits only the
enhancer. The S3 (SEQ ID No: 10) oligonucleotide is the
control and has no effect. The arrow denoted (c)
indicates a protein/DNA complex whose function is unknown
at this time. In Figure 17B, the same extracts were
incubated with a 100-fold excess of unlabeled Fragments 5'
and 3' to Frl40: Fr 151 (-1047 to -881 bp), Frll4 (-880 to
-771- bp), and FrlO5 (-503 to -399 bp). These class I
regions contain areas with significant homology to the
silencer in Frl40 (SEQ ID No: 37) (Figs. 11 and 12A-D).
Figures 18A-18C show the effect of increasing
salt concentration (Figure 18A) and of antisera to the p50
or p65 subunits of NF-KB (Figure 18B) or to c-fos family
members (Figure 18C) on the silencer complex formed with
Frl40 (SEQ ID No: 37). FRTL-5 cells were cultured in 5H
medium with no TSH for 7 days. Cell extracts were
prepared, incubated with the Frl40 (SEQ ID No: 37)
radiolabeled probe, -770 to -636 bp, of the PD1 promoter,
and complex formation measured by EMSA. The silencer
complex characterized in Figures 12A-D, 14A-B, and 17A-B
is denoted with an arrow. In (Figure 18A), increasing
concentrations of KCl were added to the incubation
mixture; in (Figure 18B) and (Figure 18C) the noted
antisera or normal serum (lane 3, Figure 18C) were
preincubated with the extracts before probe was added.
The dashed line denotes the location of a ''supershiftedll
complex. Antisera against fos B, c-fos, fra-l, and fra-2
are, respectively, sc-48, sc-413, sc-183, and sc-57 from
Santa Cruz. The results indicate the silencer complex
(arrow) is comprised of more than one protein/DNA complex
(Fig. 18A-C) and that one of the proteins is the p65
subunit of NF-KB (Fig. 18B) and another is a c-fos family
CA 02229938 1998-02-19
W O 97/07404 PCTAUS96/13715
- 24-
member (Fig. 18C), probably other than fra-1, fra-2 or fos
B.
Figures l9A-19C show the CAT activity of
p(-1100)CAT (Figure l9A), p(-127)CAT (Figure l9B), or
p(-127NP)CAT (Figure l9C) transfected into FRTL-5 cells
S with or without cotransfection by a plasmid containing an
oligonucleotide with the sequence of oligo K (SEQ ID No:
38), the thyroglobulin (TG), insulin response element
(IRE), or oligo KM, a mutant thereof which loses
insulin-responsiveness (Santisteban, P., et al., ~1992)
Mol. Endocrinol. 6, 1310-1317; Aza-Blanc, P., et al.,
(1993) Mol. Endocrinol. 7, 1297-1306). FRTL-5 cells grown
in 5H medium plus 5~ calf serum were cotransfected with
the different constructs of the PD1 5'-flanking region
plus 20 or 40 ~g of a plasmid with an oligonucleotide
having the sequence of oligo K (Oligo K1, and Oligo K2,
respectively). Alternatively, cotransfection was with 40
~g of oligo KM, a mutated form of oligo K described
previously (Santisteban, P., et al., (1992) Mol.
Endoc~inol. 6, 1310-1317; Aza-Blanc, P., et al., (1993)
Mol. Endocrinol. 7, 1297-1306) p(-127NP)CAT is the
p(-127)CAT chimera (Figure 16A) containing a
nonpalindromic mutation (see Fig. 25A) of the CRE in the
downstream silencer. CAT activity was measured 36 hours
later and conversion rates normalized to growth hormone
levels. The activity of control transfections with the
vector into which the oligo K sequences were inserted was
assigned a value of 100~ (first open bar in each panel).
Differences in the CAT activity of cells cotransfected
with Oligo K (SEQ ID No: 38) or its mutant were compared
to the control values. Values are the mean ~ S.E. of
three different experiments, each performed in duplicate.
In (Figure l9A), one star(*) denotes a significant
(P<0.05) increase in activity caused by oligo K1; two
stars (**) denotes a significant increase by oligo K2
CA 02229938 1998-02-19
WO 97/07404 PCTAUS96/13715
- 25
(P~0.01). In (Figure l9C), the increase in the presence
of oligo Kl is significant, P<0.01.
Figures 20A-20B shows the nucleotide and deduced
amino acid sequence of the clone designated Sox-4 obtained
by screening a rat FRTL-5 cell expression library with
oligonucleotide K (SEQ ID No: 38), the insulin responsive
element of the thyroglobulin promoter, which can inhibit
the ability of methimazole (MMI) and TSH to decrease the
silencer c~mplex with Frl40 of the class I promoter (see
Figure 12 A-D and 14A-B). The sequence contains 1422
nucleotides whose open reading frame encodes a 442 amino
acid residue protein with a molecular weight of about
53,040. Differences in amino acid residues from mouse
Sox-4 are noted under the rat sequence by the specific
replacement residues. Differences from human Sox-4 (Van
de Wetering, M., et al., (1993) EMB0 Journal 12,3847-3854)
are noted by dashed lines. Rat and mouse Sox-4 are 32
residues smaller than human Sox-4 (Farr, C. J., et al.,
(1993) M~mm~ian Genome 4, 577-584). All of the extra
residues in human Sox-4, which are not noted, cluster
within the one region of the protein containing the amino
acid differences from mouse and human Sox-4 as noted; they
are in large measure glycine and alanine residues (Farr,
C. J., et al., (1993) M~mm~i ian Genome 4, 577-584). The
boxed residues are amino acids which are the same in rat,
mouse and human Sox-4 genes. The Sox-4 proteins are
members of the HMG (high mobility group) class of
transcriptional regulators, which bind DNA in a sequence
specific fashion; the HMG box is boxed in bold. In
addition to the HMG box, a common feature of all three
Sox-4 proteins is a serine-rich carboxy terminal tail with
multiple putative casein kinase and histone kinase
phosphorylation sites (Van de Wetering, M., et al.,
(1993) EMB0 Journal 12,3847-3854; Farr, C. J., et al.,
(1993) M~mm~l ian Genome 4, 577-584).
SU8STITUTE SI~EEl (RULE 26)
CA 02229938 1998-02-19
W O 97/07404 PCT~US96/13715
- 26-
Figure 21 shows the ability o~ recombinant rat
Sox-4 protein, 50 ng, to form a protein-DNA complex when
incubated with radiolabeled oligonucleotide K (SEQ ID
NO:38), oligonucleotide Z (the equivalent insulin
responsive element of the thyroid peroxidase promoter), or
mutants thereof, which lose the ability to compete for the
binding of thyroid transcription factor-2 (TTF-2) in EMSA
(Santisteban, P., et al., (1992) Mol. Endocrinol. 6, 1310-
1317; Francis-Lang, H., et al., (1992) Mol. Cell Biol. 12,
576-588; Aza Blanc, P., et al., (1993) Mol. Endocrinol. 7,
1297-1306). Also used is a control oligonucleotide,
oligonucleotide C from the thyroglobulin promoter, which
is adjacent to the oligonucleotide K site and does not
bind-TTF-2 but can bind thyroid transcription factor-1
(TTF-1) or Pax-8 (Guazzi, S., et al., (1990) EMBO J., 9,
3631-3639; Francis-Lang, H., et al., (1992) Mol. Cell
Biol. 12, 576-588; Santisteban, P., et al., (1992) Mol.
Endocrinol. 6, 1310-1317; ~nnin;, M., et al., (1992) Mol.
Cell Biol. 12, 4230-4241; Aza Blanc, P., et al., (1993)
Mol. Endocrinol. 7, 1297-1306). The synthetic double-
stranded oligonucleotides were end labeled with [~y32p] ATP
and T4 polynucleotide kinase then purified on an 8~ native
polyacrylamide gel before use. Binding reactions were
carried out in a volume of 30 ~l for 20 min at room
temperature; reaction mixtures contained 1 ~g recombinant
protein and 0.5 ~g poly(dI-dC) in 10 mM Tris-Cl (pH 7.9),
1 mM MgCl2, 1 mM dithiothreitol, 1 mM ethylenediamine
tetraacetic acid (EDTA), 5% glycerol, and 200 mM Kcl.
Labeled probe, 50,000 cpm, was added and the incubation
continued an additional 20 min at room remperature. DNA-
protein complexes were separated on 5~ native
polyacrylamide gels.
Figures 22A-22B show Northern analyses of
different rat tissues (Figure 22A) and of rat FRTL-5
thyroid cells treated with various hormone mixtures for
the periods of time noted, 24 hours or 1 week (Figure
CA 02229938 1998-02-19
w o 97~74~4 PCT~US96/1371
- 27-
22B). In Figure 21 A, a rat Multiple Tissue Northern Blot
(Clontech, Palo Alto, CA) was employed for the Northern
analysis, containing mRNA from the noted rat tissues. In
Figure 21B, the mRNA was prepared from cultured
nonfunctional FRT (Fisher rat thyroid), BRL (Buffalo rat
liver), and functional FRTL-5 (Fisher rat thyroid strain
L-5) cells using the QDTM rapid poly (A)+mRNA isolation
system (5Prime~3Prime Inc., Boulder, C0) or from human
thyroid or.thymus tissue and rat ovary tissue. Northern
analyses used 1.5 ~g RNA per lane, 1~ agarose gels
containing 2~ formaldehyde, and nylon filters (Nytran,
Schleicher and Schuell, Keene, NH). For both Figures 21A
and 21B, full length rat SOX-4 or rat ~-actin cDNA
(provided by Dr. B Paterson, NCI, Bethesda, MD) was
radiolabeled by random priming. Prehybridization and
hybridization (l.Ox106 cpm/ml) was performed in Quickhyb
Hybridization Solution (Stratagene, LaJolla, CA). Washings
were carried out as previously described (Isozaki, O., et
al., (1989) Mol. Endocrinol. 3,1681-1692).
Figure 23 shows the ability of an antibody to
Sox 4 to inhibit silencer and enhancer complex formation
between Frl40 and an FRTL-5 cell extract. FRTL-5 cells
were cultured in 5H medium with no TSH for 7 days. Cell
extracts were prepared, incubated with the Frl40
radiolabeled probe, -770 to -636 bp, of the PD1 promoter,
and complex formation measured by EMSA. The silencer and
enhancer complexes characterized in Figures '2, 14, 17 and
18 are noted. The IgG fraction of sera from preimmune or
;mmllnlzed rabbits (Lanes 2 and 3, respectively) were
preincubated with the extracts before probe was added.
The antibody was created by immunizing rabbits with KLH-
conjugated peptide 359 to 373 (GSSSSDDEDDLLD) of rat Sox-4
(Figure 20) according to a standard protocol (Genosys
Biotechnologies, Inc., The Woodlands, Texas). IgG was
purified by affinity chromatography with Protein A-
Sepharose CL-4B columns and was desalted on a Pierce
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
(Rockford, IL) desalting column equilibrated in phosphate
buffered saline, pH 7.4. The IgG eluent was dialyzed
against 100 ~olumes of phosphate buffered saline, pH 7.4,
for 18 hours at 4~C and concentrated by centrifugation at
500xg for 3.5 hours at 4~C in a Centricon 10 unit (Amicon,
Beverly MA). IgG could be stored at -20~C until assay.
The rabbit antibody used herein reacts with the synthetic
peptide at a 1:10,000 dilution, is peptide specific, i.e.
does not r~ecognize another hydrophilic peptide from Sox-4
mimicking residues 226 to 239 (Figure 20), and can detect
Western blotted recombinant Sox-4 as measured by ELISA.
Figures 24A-24B show DNAase I protection
analysis on a class I PD-1 genomic fragment, -800 to -605
bp, created by polymerase chain reaction (PCR) (Saiki, R.
K., et al., (1988) Science 239, 487-491 46). The template
was the PD-1 5'-flanking region containing the 140
fragment (Ehrlich, R., et al., (1988) Mol. Cell Biol. 8,
695-703; Maguire, J., et al., (1992) Mol. Cell Biol. 12,
3078-3086). The forward primer contained a BamHI site on
the 5'-end (underlined), ATAGGATCCGAATAGGAAACACGGAGTATACTG
ATTCAG, and extended from -800 to -770 bp of the PD-l
sequence. The reverse primer contained a HindIII site
(underlined), ATAAAGCTTCACTGGAGGTTTATGTCTGCTTCTGTGCTG and
extended ~rom -605 to -634 bp. The fragment was digested
by BamHI and HINDIII and inserted into a CAT chimera as
described (Ehrlich, R., et al., ~1988) Mol. Cell Biol. 8,
695-703; Maguire, J., et al., (1992) Mol. Cell Biol. 12,
3078-3086; Giuliani, C., et al. (1995) J. Biol. Chem. 270,
11453-11462). As needed, it was isolated by restriction
enzyme digestion (Ehrlich, R., et al., (1988) Mol. Cell
Biol. 8, 695-703; Maguire, J., et al., (1992) Mol. Cell
Biol. 12, 3078-3086); and purified from 2 ~ agarose gels
using a QIAEX extraction kit (Quiagen, Chatsworth, CA).
Coding strand data are presented in Figure 24A; noncoding
strand results are in Figure 24B. The fragment was end-
labeled with [cy32p] dCTP and Klenow fragment, then purified
CA 02229938 1998-02-19
W O 97/07404 PCT~US96113715
- 29-
on an 8~ native polyacrylamide gel. DNAase I footprinting
(Ikuyama, S., et al., (1992) Mol. Endocrinol. 6, 1701-
1715; Shimura, H., et al., (1993) J. Biol. Chem. 268,
24125-24137) used 1, 5 or to 10 ~g purified recombinant
proteins. Initial incubation was for 20 min at room
temperature in a 20 ~l reaction volume with 10 mM Tris-Cl,
pH7.6, 5 mM MgCl2, 0.1~ triton X-100, no KCl, and 1 ~g
poly(dI-dC). After addition of the probe (50,000 cpm), the
reaction mixture was incubated for 20 min at room
temperature. DNA probes were then digested with 0.5 unit
DNAase I (Promega, Madison, WI) for 1 min at room
temperature. The reactions were terminated with 80 ~l
stopping solution (20 mM Tris HCl, pH 8.0, 250 mM NaCl, 20
mM ethylenediaminetetraacetic acid (EDTA), 0.5~ sodium
dodecyl sulfate (SDS), 10 ~g proteinase K, and 4 ~g
sonicated calf thymus DNA). After incubation at 37 C for
15 min, the digested products were phenol extracted,
ethanol precipitated, and separated on an 8~ sequencing
gel. Maxam and Gilbert A+G and C+T sequencing reactions
(Maxam, A. M., et al., (1980) Methods EnzYmol. 65, 499-
560) were used to locate the footprinted regions. The
region footprinted by Sox-4 and a control recombinant
protein, the p50 subunit of NF-KB, are noted to the right
of each panel and compared with the silencer and enhancer
regions of the class I promoter (see Figure 10).
Figures 25A-25B show the effect of modifications
of the CRE-like element on activity of the p(-127)CAT
promoter and effect of CRE-like element on the activity of
a heterologous promoter. In Figure 25A, the CRE-like
element in the p(-127)CAT promoter construct was either
deleted (~CRE) or mutated to a nonpalindromic sequence as
noted (NP CRE). The CAT activities of these derivative
constructs were compared with that of the parental
p(-127)CAT activity following transfection into FRTL-5
cells and their incubation in 3H medium plus 5~ calf serum
for 2 days. Conversion rates were normalized to hGH
CA 02229938 1998-02-19
W O 97/07404 PCT~US96/1371
- 30-
levels and protein. CAT activities are expressed relative
to the parental p(-127)CAT, which averaged 2-fold higher
CAT activity than the pSV0 control chimera; data are the
mean i S.E. for 3 separate experiments. Statistically
significant increases (PcO.05) from p(-127)CAT are noted
by the star. In Figure 25B, class I DNA sequences between
-127 and -90 bp (designated CRE) were introduced at the 3'
end of constructs containing the SV40 promoter ligated to
the CAT gene and transfected into FRTL-5 cells as
described (Shimura, Y. et al. (1994) J. Biol. Chem. 269,
31908-31914). CAT activities were measured after
maintaining the cells ~or 2 days in 3H medium plus 5~ calf
serum and normalizing conversion rates to hGH levels and
protein. Constructs containing the CRE are
diagrammatically represented on the left of the Figure.
lS Arrows depict the orientation and the number of copies of
the CRE present. Also shown are two mutant constructs from
which the CRE site was either deleted (~CRE) or mutated to
a nonpalindromic (NP CRE) form (Fig. 25A). CAT activities
are presented relative to the parental promoter construct,
pCAT, which contains a minimal SV40 promoter and averaged
44 _ 5~; values are the mean i S.E. for 3 separate
experiments. Statistically significant decreases are
indicated as P~ 0.05 (*) or P<0.01 (**).
Figures 26A-26B show that TSH treatment of FRTL-
5 cells induces the formation of novel protein/DNA
complexes between cell extracts and a fragment of the 5'-
flanking region of the class I promoter from -168 to -1 bp
(Frl68; nucleotides 923 to 1190 in Figure 9). Figure 26A,
is a diagrammatic representation of the 5' flanking region
of the class I gene promoter. All numbers are relative to
the start of transcription, designated +1 as defined in
Giuliani C., et al (1995) J. Biol Chem. 270:11453-11462
herein incorporated by reference. The CRE-like sequence
is indicated at -107 to -100 base pairs (bp)., as are the
positions of the CAAT and TATA boxes, enhancer A (EnH),
CA 02229938 1998-02-19
WO 97/07404 PCTfiUS96/13715
and the interferon response element (IRE). The DNA
fragments used in the electrophoretic mobility shift
assays (EMSA) are indicated. In Figure 26B, EMSA are
performed using the radiolabeled Frl68 probe incubated
with extracts from FRTL-5 cells maintained in the absence
(-) or presence (+) of lxlO-I~ TSH for 48 hours after 6
days in 3H medium plus 5~ serum. The Frl68 probe was
incubated with either extract alone (lanes 1 and 5) or in
the presence of a 100-fold excess of either unlabeled
Frl68 (lanes 2 and 6), Frl27 (nucleotides 964 to 1090 in
Figure 9), (lanes 3 and 7), or CRE-1, a 38 bp silencer
including the CRE like site (nucleotides 964 to 1001 in
Figure 9) (lanes 4 and 8). In this and all other
experiments involving CRE-1 to be described it can be
replaced by a 48 base pair (bp) sequence extending 10
nucleotides on the 3' end with no difference on results.
Protein/DNA complexes are denoted by the letters A to G; F
and G represent complexes present in the TSH-treated cell
extracts only.
Figures 27A-27B show the effect of MMI and/or
TSH treatment of FRTL-5 cells on the ability of cellular
extracts to form protein/DNA complexes with radiolabeled
Frl68 of the MHC 5'-flanking region (Figure 27A) in the
absence or presence of an unlabeled oligonucleotide (oligo
TIF) with the sequence of the TSH receptor (TSHR) insulin
response element (Figure 28C; .Shimllra, Y., et al. (1994)
J. Biol. Chem. 269, 31908-31914) or (Figure 27B) an
unlabeled oligonucleotide with the sequence of the 38 bp
downstream silencer with (NP CRE) or without (CRE-1) a
nonpalindromic mutation of the CRE. Cells were maintained
7 days in 5H medium (no TSH) plus 5 ~ calf serum (lane 1;
5H Basal) at which time 5 mM MMI (lane 2), lxlO-I~ TSH
(lane 5), or the two together (Lane 4) were added for 36
hours before extracts were prepared and incubated with
32P-radiolabeled Frl68 of the MHC 5'-flanking region, -168
bp to +1. In Figure 27A, complex formation was evaluated
CA 02229938 1998-02-19
WO 97/07404 PCTrUS96/13715
by EMSA in the absence of an unlabeled competitor (lanes
1, 2, 4, 5) or in the presence of a 250-fold excess of an
oligonucleotide with the sequence of the TSHR insulin
response element (Oligo TIF) or the TG insulin response
element (Oligo K). In Figure 27B, complex formation with
the extract from MMI-treated cells was evaluated in the
absence of an unlabeled competitor (lane 2) or in the
presence of a 250-fold excess of an oligonucleotide with
the sequen~ce of the downstream 38 bp silencer (CRE-1; lane
3) or its nonpalindromic counterpart (NP CRE as noted in
Fig. 25A; lane 4). The probe alone is in lane 1 of Figure
27B. The arrow denotes the complex whose formation is
increased by TSH/MMI treatment of the cells but inhibited
from forming by in vitro addition of oligo TIF or CRE-1.
Figures 28A-28C show the effect of MMI on the
promoter activity of p(-1100)CAT or p(-127)CAT transfected
into FRTL-5 cells with or without cotransfection by a
plasmid containing an oligonucleotide having a mutated
sequence of the TSHR insulin response element (Shimura,
Y., et al. (1994) J. Biol. Chem. 269:31908-1914) (TIF
mutant 2) which does not lose insulin-responsiveness.
Using a DEAE-dextran procedure, FRTL-5 cells grown in 6H
medium (+TSH) were cotransfected with the di~ferent
constructs of the PD1 5'-flanking region plus a plasmid
with or without an oligonucleotide having the sequence of
mutant 2 of oligo TIF, the TSHR insulin response element
(Shimura, Y., et al., (1994) J. Biol. Chem. 269,
31908-31914). After 12 hours, the medium was changed to
fresh 6H medium plus or minus 5 mM MMI (MMI) and CAT
activity was measured 36 hours later. After normalization
of conversion rates and protein values, the activity of
the -1100 (Figure 28A) or 127 bp (Figure 28B) constructs
in cells maintained in 6 H medium and cotransfected with
plasmid containing no oligonucleotide was assigned a
control value of 100~ (first open bar in each panel).
Differences in the expression of cells cotransfected with
CA 02229938 1998-02-19
W~ 97~07404 PCr~lJS96~1371~i
the oligonucleotide containing the oligo TIF mutant
(second open bar in each panel) were evaluated both in the
absence (open bars) or presence of MMI (stippled bars).
In Figure 28C, the sequences and activities of the mutants
are summarized. Oligo TIF mutant 2 contains a mutation
which loses single strand binding activity but retains
insulin responsiveness when compared with wild type TSHR
(Figure 28C; Shimura, Y., et al., (1994) J. Biol. Chem.
269, 3190~-31914). Values are the mean i S.E. of three
different experiments, each performed in duplicate. In
Figures 28A and 28B, one star (*) denotes a significant
decrease (PcO.O1) in activity caused by MMI; three stars
(***) denotes a signi~icant loss (PcO.O1) in the ability
of MMI to decrease promoter activity. In Figure 28A, two
stars (**) denotes a an increase (PcO.05) in basal
lS promoter activity caused by the oligonucleotide
cotransfection in the absence of MMI.
Figures 29A-29B show that in the absence of TSH,
the 38 bp silencer region containing the CRE-like
sequence, -127 to -9Obp forms multiple protein/DNA
complexes with extracts from FRTL-5 cells, one of which
appears to be CREB. Figure 29A additionally shows their
formation depends on the CRE-like sequence, -107 to -100
bp, and on sequences flanking the CRE. The radiolabeled
double-stranded 38 bp DNA fragment, -127 to -90 bp, termed
CRE-1, was incubated with extracts from FRTL-5 cells
maintained in 3H medium plus 5~ calf serum for 6 days and
complexes were analyzed by EMSA. In Figure 26A, complex
formation was evaluated in the presence or absence of the
noted unlabeled double-stranded oligonucleotides: CRE-1,
~CRE-1 with the CRE-like sequence deleted, and a Promega
CRE which contains the consensus CRE and flanking residues
from the somatostatin promoter. The amount of each
competitor in fold excess over probe is noted at the top
of each set of gels, along with a diagrammatic
representation of the structure of the competitor. In
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 34-
Figure 26B, incubations were performed in the presence of
2 ul of rabbit antiserum against CREB2, mXBP, ATF2, or
CREB-327, as indicated (lanes 1-4, respectively); the
dashed line notes the supershifted complex resultant from
incubation with the CREB-327 antibody. hetters represent
groups of complexes formed by the extract. The improved
separation of the A complex region in the Experiment in
Figure 26B was achieved using a lower gel concentration
during the.separation.
Figures 30A-30C shows that the 38 bp silencer
region containing the CRE-like sequence forms complexes
with both thyroid transcription factor-1 (TTF-1) and Pax-8
in addition to CREB; it further shows their formation is
independent of the poly(dI-dC) concentration. The
double-stranded, radiolabeled 38 bp DNA fragment, -127 to
-90 bp (CRE-l), was incubated with extracts from FRTL-5
cells maintained in 5H medium plus 5~ calf serum for 6
days; complexes were analyzed by EMSA in 3.0 (Figure 30B)
as well as 0.5 (Figure 30A) ~g/ml poly(dI-dC). In Figure
30A, complex formation was evaluated in the presence or
absence of the noted unlabeled, double-stranded
oligonucleotides: CRE-1, ~CRE-1 with the CRE-like sequence
deleted, an oligonucleotide containing the TTF-1 element
in the TSHR, and a mutant thereof which loses TTF-1
binding and activity in the FRTL-5 cell. The sequences of
the oligonucleotides containing the TSHR TTF-l element and
its mutant are presented in the Figure 30C (Shimura, H.,
et al., (1994) Mol. Endocrinol. 8, 1049-1069; Ohmori, M.,
et al., (1995) EndocrinoloqY, 136, 269-282). The TSHR
TTF-1 site does not bind Pax-8 (Shimura, H., et al.,
(1994) Mol. Endocrinol. 8, 1049-1069; Ohmori, M., et al.,
(1995) E~docrinology, 136, 269-282; Civitareale, D., et
al., (1993) Mol. Endocrinol. 7, 1589-1595). In Figure 30B
complex formation was again evaluated in the presence or
absence of CRE-1, an oligonucleotide containing the TTF-1
element in the TSHR, and a mutant thereof, which loses
CA 02229938 1998-02-19
W O g7/07404 PCT~US96fl37IS
TTF-1 binding and activity in the FRTL-5 cell. In
addition, the incubations were performed in the presence
of a double-stranded oligonucleotide from the
thyroglobulin promoter which contains a site able to
interact with TTF-1 and Pax-8, termed TG oligo C, and a
mutant thereof, which loses TTF-l and Pax-8 binding and
activity in FRTL-5 cells. The sequences of the
oligonucleotides containing the TG oligo C element and its
mutant are presented in the Figure 30C; (Civitareale, D.,
et al., (1989) EMBO J., 2537-2542; Guazzi, S., et al.,
(1990) EMBO J. 9, 631-3639; Francis-Lang, H., et al.,
(1992) Mol. Cell. Biol. 12, 576-588; zAnn;n;, M., et al.,
(1992) Mol. Cell. Biol. 12, 4230-4241; Shimura, H., et
al., (1994) Mol. Endocrinol. 8, 1049-1069; Ohmori, M., et
al., (1995) EndocrinoloqY, 136, 269-282). The amount of
each competitor was 100-fold in excess of probe. Letters
represent groups of complexes formed by the extract; the
TTF-1 and Pax-8 cont~;n;ng complexes with the 38 bp
silencer are noted based on the inhibition data.
Figures 31A-31C show the C complexes formed with
the 38 bp silencer region containing the CRE-like sequence
appear to involve proteins able to bind either its coding
or noncoding strands (Figure 31A); in addition these show
that these appear to involve single strand binding
proteins which are important in TSH/cAMP suppression of
TSHR gene expression in FRTL-5 thyroid cells. (Figure
3lB). The double-stranded radiolabeled 38 bp DNA
fragment, -127 to -90 bp, termed CRE-1, was incubated with
extracts from FRTL-5 cells maintained in 5H medium plus 5
calf serum for 6 days; complexes were analyzed by EMSA in
0.5 ~g/ml poly(dI-dC). In (Figure 31A) complex formation
was evaluated in the presence or absence of a 100-fold
excess over probe of the unlabeled single strand
oligonucleotides comprising the coding and noncoding
strand of CRE-1. In (Figure 31B) complex formation was
evaluated in the presence or absence of a single strand
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/1371
- 36-
oligonucleotide from the noncoding strand of the TSHR,
which binds a single strand binding protein termed SSBP
(Shimura, H., et. al. (1995) Mol. Endocrinol., 9, 527-
539), and a single strand oligonucleotide from the coding
strand of the TSHR which binds a Y-box protein termed
thyrotropin receptor suppressor element protein-l (TSEP-l)
(See Figure 38 and Example 11). These are termed oligo
SSBP and oligo TSEP-l, respectively; their sequences are
presented.in Figures 3lC. The amount of each unlabeled
oligonucleotide, in fold-excess over probe, is noted.
Cell extracts were made by a modification of a described
method (Dignam, J., et al., (1983) Nucleic Acids Res. 11,
1475-1489). The reaction mixtures contained 1.5 fmol of
[32p] DNA, 3 ~g cell extract, and 0.5 ~g poly(dI-dC) in 10
mM Tris-Cl (pH 7.9), 1 mM MgCl2, 1 mM dithiothreitol, 1 mM
ethylenediamine tetraacetic acid and 5~ glycerol.
Unlabeled double- or single-stranded oligonucleotides were
also added to the binding reaction as competitors and
incubated with the extract for 20 min prior the addition
of labeled DNA. Following incubations, reaction mixes were
subjected to electrophoresis on 4 or 5 ~ native
polyacrylamide gels at 160 V in lxTBE at 4~C.
Figures 32A-32B show that the single strand
components of the 38 bp silencer region containing the
CRE-like sequence (CRE-l) form complexes with proteins in
FRTL-5 thyrocyte extracts which bind the Y-box or TSHR
suppressor element protein-l (TSEP-l) (Figure 32A) and the
single strand binding protein (SSBP) (Figure 32B) sites of
the TSHR minimal promoter. The single-strand components
of the radiolabeled 38 bp DNA fragments, -127 to -90 bp,
termed CRE-l, were incubated with extracts from FRTL-5
cells maintained in 5H medium plus 5~ calf serum for 6
days; complexes were analyzed by EMSA in 0.5 ~g/ml
poly(dI-dC) as described in Figure 30A-C. In Figure 32A,
complex formation was evaluated using the radiolabeled
coding strand of CRE-l in the presence or absence of a
CA 02229938 1998-02-19
W O g71074U4 PCT~US96/1371S
100-fold excess over probe of the unlabeled single strand
oligonucleotides containing wild type (WT) and mutated
sequences of each of the three TSEP-l binding sites of the
TSHR (see Example 11). The sequences of the competitor
oligonucleotides and their location in the TSHR 5'-
~lanking region are noted below the gel; the dark barsrepresent the CCTC motif which appears to be important for
TSEP-l binding by each site in the TSHR (See Example 11).
In each case the mutant 1 (Mut. 1) oligonucleotide binds
TSEP-l whereas the mutant 2 (Mut. 2) form loses binding
activity (See Example 11). The oligo TSEP-l site accounts
~or the 5' decanucleotide activity in the tandem repeat
(TR) of the TSHR which is known to suppress the
constitutive enhancer activity of the TSHR CRE (Ikuyama,
S., et al., (1992) Mol. Endocrinol. 6, 1701-171S;
Shimura, H., et al., (1993) J. Biol. Chem. 268, 24125-
24137); the TR and CRE sites of the TSHR 5'-flanking
region are noted. In (Figure 32B), complex formation was
evaluated using the radiolabeled noncoding strand of CRE-l
in the presence or absence of a 100-fold excess over probe
of the unlabeled single strand oligonucleotide containing
wild type (WT) and a mutated sequence of the SSBP binding
site on the noncoding strand of the TSHR 5'-flanking
region. The SSBP binds to a site on the noncoding strand
of the TSHR 5' and contiguous with the TTF-l site, which
is double-stranded; the mutation noted eliminates SSBP
binding and activity but not TTF-l binding and activity
(Shimura, H., et al., (1994) Mol. Endocrinol. 8, 1049-
1069; Ohmori, M., et al., (1995) Endocrinoloqy 136, 269-
282; Shimura, H., et al., (1995) Mol. Endocrinol., 9, 527-
539).
Figure 33 shows TSH treatment of FRTL-5 cells
decreases CREB and TTF-l binding to the class I 38 bp
silencer region containing the CRE-like sequence and
causes a relative increase in C complex formation, which
includes protein/DNA complexes with TSEP-l and the SSBP.
CA 02229938 1998-02-19
WO 97/07404 PCTAUS96113715
- 38-
The radiolabeled double-stranded 38 bp DNA fragment, -127
to -90 bp, termed CRE-l, was incubated with extracts from
FRTL-5 cells maintained in 5H medium plus 5~ calf serum
for 6 days then treated for 16 additional hours with the
same medium or the same medium plus lxlO-I~M TSH.
Incubations were performed in the presence or absence of
2 ul of rabbit antiserum against CREB-327. Complexes were
analyzed by EMSA, as described in Figs. 29, 30, 31 and 32,
but in the-presence of 3 ~g/ml poly(dI-dC). The A, B, and
C complex areas are noted (Figures 29, 30, 31 and 32); the
A region contains complexes with CREB and Pax-8, the B
with TTF-l, and the C with TSEP-l and SSBP (Figs. 29, 30,
31 and 32).
Figures 34A-34B show the effect of oligo TIF
(Shimura, Y. et al., (1994) J. Biol. Chem., 269:31908-
3194; Figure 32), one of the TSEP-l b;n~;ng sites on the
TSHR, on the formation of the TSH-induced protein/DNA
complexes with radiolabeled Frl68, -168 to +1 bp (Fig.
34A) or radiolabeled Frl27, -127 to +1 bp.(Fig. 34B).
FRTL-5 cells were maintained 6 days in 5H medium with 5
calf serum at which time fresh 5H medium or 5H medium
containing lxlO-I~M TSH (6H) was added for 36 hours. Cell
extracts were prepared, incubated with 32P-radiolabeled
Frl68 (Figure 34A) or Frl27 (Figure 34B) of the MHC 5'-
flanking region, and evaluated by EMSA. Incubations were
additionally performed in the presence or absence of
double stranded oligo TIF, a TSEP-l binding site on the
TSHR or mutants thereof (Fig. 32), one of which, TIF Mut-
2, loses TSEP-l binding activity because of a mutation in
the CCTC binding motif. In (Figure 34B) we additionally
show that the oligonucleotide from the TG promoter able to
bind TTF-l or Pax-8 does not prevent formation of the TSH-
induced complex (negative control), whereas CRE-l does
inhibit formation of the TSH-induced complex.
Figures 35A-35C shows the effect of 10 ~M
forskolin on the Class I gene promoter activity of a
CA 02229938 1998-02-19
W O g7/07404 PCTnUS96/1371
- 39-
series of deletion mutants spanning 1100 bp of 5~
flanking sequence (A) or of the 38 bp silencer region
cont~; n; ng the CRE when attached to a heterologous
promoter. In (Figure 35A), FRTL-5 cells were grown to 75
confluency then maintained 6 days in 5H medium plus 5~
calf serum. Cells were returned to 6H medium for 12 h and
transfected with a CAT chimera containing 1100 bp of 5'-
flanking region of the swine class I promoter p(-llOO)CAT
by electr~poration or with 5'-deletions of p(-llOO)CAT.
Bach deletion is denoted by the position of its 5'
residue. After 12 additional hours the medium was changed
to fresh 5H medium in the presence or absence of 10 ~M
forskolin. CAT activity was assayed 36 hours later;
conversion rates were normalized to hGH levels and
protein. Results are expressed relative to pSV0, the
parental CAT vector with no promoter and no forskolin in
the medium, whose activity is set at 100~. Values are the
mean + S.E. of 3 experiments; statistically significant
increases or decreases at P~0.05 (*) or P<0.01 (**) are
noted. In (Figure 35B) cells were similarly handled but
were transfected with pCAT Promoter containing one or two
copies of the 38 bp silencer as illustrated in Figure 35C.
After 12 additional hours, the medium was changed to fresh
5H medium in the presence or absence of 10 ~M forskolin.
CAT activity was assayed 36 hours later; conversion rates
were normalized as above, and results expressed relative
to the parental pCAT Promoter vector with no insert and
no forskolin in the medium, whose activity is set at 100~.
Values are the mean ~ S.E. of 3 experiments; a
statistically significant effect of forskolin at P<0.05
(*) is noted. The forskolin action is duplicated in
Figure 35B by either lxlO-10M TSH and 5mM MMI.
Figure 36 shows the formation of the TSH-induced
r complex depends on DNA sequence elements between -90 and
-1 bp. FRTL-5 cells were maintained 6 days in 5H medium
with 5~ calf serum at which time fresh 5H medium or 5H
CA 02229938 1998-02-19
W O 97/07404 PCT~US96tl3715
- 40
medium containing lxlO-I~M TSH (6H) was added for 36 hours.
Cell extracts were prepared, incubated with 32p_
radiolabeled Frl27 of the MHC 5'-flanking region, and
evaluated by EMSA. Incubations were additionally performed
in the presence or absence of unlabeled Frl27, Fr89, or
CRE-1 (positive control), at the noted fold-concentrations
over probe.
Figures 37A-37D show the ability of unlabeled
Frl40 to prevent formation of the MMI-induced protein/DNA
complex with radiolabeled Frl68 of the MHC 5'-flanking
region (Figure 37A) and of oligonucleotide E9, the
specific inhibitor of the upstream enhancer (Figure 17A),
to prevent complex formation with the 38 bp downstream
silencer (Figure 37B). In Figure 37A, FRTL-5 cells were
maintained 7 days in 5H medium (no TSH) plus 5 ~ calf
serum, at which time 5 mM MMI (5H MMI+) or 5 mM MMI plus
lxlO-l~ TSH (5H MMI/TSH+) were added for 36 hours. Cell
extracts were prepared, incubated with radiolabeled Frl68
of the MHC 5'-flanking region, -168 bp to the start of
transcription (+1), and complex formation evaluated by
EMSA in the absence of an unlabeled competitor (lst and
3rd lanes) or in the presence of a 250-fold excess of
unlabeled Frl40 (2nd lane). The arrow denotes the complex
whose formation is increased by TSH/MMI treatment of the
cells but inhibited from forming by in vitro addition of
oligo TIF or CRE-1 (see Figure 34). In (Figure 37B), the
extract from FRTL-5 cells maintained 7 days in 5H medium
(no TSH) plus 5 ~ calf serum was incubated with the
radiolabeled 38 bp downstream silencer (CRE-1, depicted in
Figure 37C). Incubation was in the presence or absence of
a 250-fold excess of the noted unlabeled oligonucleotides.
The arrows denoted a and b identify, respectively, the
TTF-1 and TSEP-1/SSBP complexes with the downstream
silencer. Oligonucleotide S6, which inhibits formation of
both the silencer and enhancer (Figure 17A) and E9 which
inhibits formation of only the enhancer (Figure 17A)
SVBSTtTVTE S~tEET (RULE 26)
CA 02229938 1998-02-19
W ~ 97JO7404 PC~US96/13715
decrease the formation of both complexes as does CRE-1
(lanes 4 and 8 vs. 3 respectively; Figure 37B).
Figures 38A-38B' show the nucleotide and deduced
amino acid sequence of TSEP-1 as derived from Clones 9,
31, and 40 obtained by screening a thyroid cell expression
library for a suppresor protein reactive with the 5'
decanuclotide tandem repeat of the TSHR. Organization of
the rat TSEP-1 cDNA and each clone is shown in Figure 38A;
the rectangular box indicates the coding region.
Nucleotide and amino acid sequence of TSEP-1 are shown in
Figure 38B. Nucleotide sequence is numbered ~rom the start
codon of TSEP-1 protein. Solid underlining indicates six
possible nuclear localization signals. To isolate the cDNA
encoding the protein that could bind to the coding
sequence of the 5'-decanucleotide in the rat TSHR ~;n;mAl
promoter and which might function as a suppressor by
interacting with it (Ikuyama, S., et al., (1992) Mol.
Endocrinol. 6, 1701-1715; Shimura, H., et al., (1993) J.
Biol. Chem. 268, 24125-24137), a rat FRTL-5 cell
expression library was screened (Akamizu, T., et al.,
(1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5677-5681)
using a Southwestern procedure (Vinson, C. R., et al.,
(1988) Genes Dev. 2, 801-806 ) and a radiolabeled
synthetic oligonucleotide representing the coding strand
of TR2, ssTR2(+), ( Shimura, H., et al., (1993) J.'Biol.
Chem. 268, 24125-24137). TR2 spans -177 to -138 bp of the
rat TSHR promoter, contains both the 5'- and 3'-
decanucleotides of the tandem repeat (TR), and extends
into the CT-rich domain 5' to the TR ( Shimura, H., et
al., (1993) J. Biol. Chem. 268, 24125-24137). The
protein was designated TSHR suppressor element-binding
protein-1 or TSEP-1, in accord with its proposed
functional role in TSHR gene expression. (Shimura, H. et
al. (1993) J. Biol. Chem. 263:24125-24137). Three clones,
with overlapping se~uences, were identified as candidates
for TSEP-1. Clone 40, 1405 bp, encoded a protein with an
SVBSmUTE SHEET (RULE 26)
CA 02229938 1998-02-19
W O 97/07404 PCT~US96/13715
- 42-
open reading frame of 322 amino acids (Figure 38A). Clone
9, 864 bp, contained 117 bp of 5'-flanking region, the ATG
start codon, and the N-terminal portion of the open
reading frame defined in clone 40 (Figure 38A). Clone 31,
1390 bp, contained a near full length open reading frame
S and the 3'-noncoding region of clone 40, including the
poly (A) signals (Fig. 38A). The cDNA derived from clone
9, fused with the ~-galactosidase gene and induced by IPTG
in a trans~ormed bacterial host, hybridized very strongly
with the coding strand of TR2 [ssTR2(+)], but very weakly
with the noncoding strand, [ssTR2(-)] or double-stranded
TR2. It did not hybridize with single or double stranded
TRlCRE, which spans -153 to -114 bp and encompasses the
3'-decanucleotide of the TR plus the CRE-like sequence, -
139 to -132 bp (Ikuyama, S., et al., (1992) Mol.
Endocrinol. 6, 1701-1715; Shimura, H., et al., (1993) J.
Biol. Chem. 268, 24125-24137). Experiments with purified
recombinant protein confirm that the cloned cDNA encoded a
protein interacting with the coding strand of the 5'
decanucleotide of the thyroid receptor (TR). Transfection
experiments establish that it is a suppressor.
Figures 39A-39C show the effect of mutations in
each decanucleotide of the TR on CAT activity after
cotransfection with pRcCMV-TSEP-l, which encodes the rat
Y-box protein, in FRT thyroid cells. Mutations of the
decanucleotides of the TR are denoted in Figure 39A, as is
the sequence of wild type promoter and the location of
each decanucleotide and the CRE-like site of the TSHR.
Figure 39B shows the raw data of a representative
experiment; Figure 39C presents the CAT activity relative
to the p8CAT promoter-less control, whose activity is
arbitrarily set at one. All cells were cotransfected with
pSVGH and conversion rates were normalized to growth
hormone (GH) levels. Cell lysates were prepared 48 h after
transfection with the TSHR promoter-CAT chimeras indicated
plus pRcCMV-TSEP-l (black bars) or its control, pRc/CMV
CA 02229938 1998-02-19
WO 97/07404 PCTAJS96/13715
- 43-
(white bars), which was used to construct the TSEP-1
expression vector. Activity in Figure 39C is the mean +
S.E. from four separate experiments. A significant
(p<0.01) Y-box (TSEP-1)-induced decrease in CAT activity
is noted by 2 stars. Mutation of the 5' decanucleotide is
Mt-l or Mt-2, result in a loss of TSHR suppression by
TSEP-1.
Figures 40A-A'-40D-D' show the ability of
pRcCMV-TSEP-1 to suppress expression, in FRTL-5 or FRT
cells, of TSHR promoter-CAT chimeras containing the
downstream (S-box) or upstream (TIF-associated) Y-box
binding sites. In Figure 40A, the TSHR promoter ch;mera,
pTRCAT5'-220 (Shimura, Y., et al. (1994) J. Biol Chem.
269, 31908-31914) was cotransfected into FRTL-5 cells with
either the pRcCMV-TSEP-l (white bar) or its control
plasmid, pRc/CMV. All cells were cotransfected with
plasmid pSVGH; cell lysates were prepared 72 h after
transfection and conversion rates were normalized to GH
levels. In the upper part of the panel, CAT activities are
presented relative to that of the p8CAT promoter-less
control, whose activity is arbitrarily set at one; in the
lower portion, CAT activities are presented as the ratio
of activity in the presence of the TSEP-l vector vs the
control vector [TSEP (+)/TSEP(-)]. A significant Y-box
(TSEP-1)-induced decrease in CAT activity by comparison to
the p8CAT control is noted by a star (pcO.05). In Figure
40B and Figure 40C, CAT activities of pTRCAT5'-177, 5'-
146, 5'-131, 5'-90 or a p8CAT control are shown as the
ratio of activity in cells cotransfected with pRcCMV-TSEP-
1 or its pRc/CMV control, [TSEP(+)/TSEP(-)], when
- 30 cotransfection were performed in FRTL-5 (Fig. 40B) or FRT
~ cells (Fig. 40C). All cells were cotransfected with
plasmid pSVGH. In the case of FRT cells, cell lysates
were prepared 48 h after transfection, in FRTL-5 cells 72
h after transfection; conversion rates were normalized to
illlUlt SREr ~
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
o - 43/1 -
GH levels. A significant TSEP-1-induced decrease in CAT
activity by comparison to the p8CAT
SUBSlllUltS~lEr~E2~)
CA 02229938 1998-02-19
WO 97/07404 PCTIIUS96/13715
- 44-
control is noted by a star (pcO.05). In Figure 40D,
ch;meras was created by ligating oligonucleotide TIF
containing the TSHR insulin response element sequence , -
220 to -188 bp (Shimura, Y., et al. (1994) J. Biol Chem.
269, 31908-31914), to the pCAT-Promoter plasmid from
Promega. Constructs are diagrammatically represented by
arrows and (+) designations to depict the direction and
number of the insulin response element se~uences. TIF
chimeras o~ the pCAT control were cotransfected with
pRcCMV-TSEP-1 or its pRc/CMV control into FRTL-5 cells and
CAT activity analyzed as above. In Figure 40D, bottom,
the Y-box (TSEP-1) activity [TSEP-1 (+)] is expressed
relative to the activity in the pRc/CMV control
transfections tTSEP-1 (-)]. The decrease effected by
pRcCMV-TSEP-1 is signi~icant (Pc0.02). In all experiments
denoting relative CAT activity, activities are the mean +
S.E. from three separate experiments.
Figures 41A-41D depict the downstream silencer
of the class I MHC promoter (Figure 41A), its relationship
to the interferon response element (Figure 41A), its role
and regulation by TSH and/or MMI in relationship to the
actions of the transcription factors, TTF-1 and TSEP-l as
modulators of downstream silencer activity (Figures 41B-
41D). The downstream silencer involving the CRE is noted
in Figure 41A. Its activity as a silencer is lost if the
CRE is mutated or deleted as shown in Figure 26A-B. As
shown in Figures 26 and 27, EMSA show that TSH and/or MMI
treatment of rat FRTL-5 cells increases the formation of a
specific DNA complex (arrow) with a 168 bp probe of the
class I promoter, -168 to +1 bp, as noted (Figure 41B).
Formation of the complex is prevented by including the
TSHR insulin response element, oligo TIF (Shimura, Y., et
al. (1994) J. Biol Chem. 269, 31908-31914) in the in vitro
binding reaction (lane 5) but not by including the
thyroglobulin insulin response element, oligo K (Figure
41B; see also Figure 27A). It is not formed using a 168
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96113715
- 45-
bp probe which has a nonpalindromic mutation of the CRE,
NP CRE, (Figure 4lB, lane 6; Figure 27B). Promoter
activity of the 127 bp class I promoter-CAT chimera
including the downstream silencer is decreased by MMI
(Figure 41C). The effect of MMI is lost if oligo TIF is
S cotransfected with the p(-127)CAT ch;m~ra but not if oligo
K is cotransfected (Figure 41C, see also Figures l9B and
28B). Cotransfection with a plasmid containing cDNA
encoding TTF-1 increases activity, whereas cotransfection
with a plasmid with a cDNA encoding TSEP-1 decreases
promoter activity (Figure 41C). The silencer interacts
with multiple proteins as evidenced by complex formation
in Figures 29, 30, 31, and 33, as summarized in Figure
41D; each of these requires an intact CRE to bind to the
downstream silencer (Fig. 41D). These have been
identified using antibody shift analyses, by direct
binding reactions with pure proteins, or by competition
with oligonucleotides known to bind them: TTF-1, CREB,
Pax-8, SSBP, and TSEP-1 (Y-box protein). Complexes with
two of these, TTF-1 and TSEP-1, are increased by TSH or
decreased by TSH, respectively (Figure 33). Thus, TSH by
decreasing TTF-1 will decrease class I expression by
decreasing the enhancer action of TTF-1 (Figure 41C). TSH,
by increasing TSEP-1 complex formation will increase its
suppressor function (Figure 41D) and decrease class I
expression. MMI has effects on each of these transcription
factors the same as TSH.
DETAILED DESCRIPTION OF THE lNv~N-lION
For the purpose of a more complete understanding
of the invention the following definitions are described
herein. MAmmAl includes, but is not limited to, humans
monkeys, dogs, cats, mice, rats, hamsters, cows, pigs,
horses, sheep and goats. Drug includes, but is not
limited to, MMI, MMI derivatives, CBZ, PTU, thioureylenes,
thiones and thionamides. Other candidate drugs include
aminothiazole, 1,1,3-tricyano-2-amino-1-propene,
CA 02229938 1998-02-19
WO 97/07404 PCTnUS96/13715
- 46-
phenazone, thioureas, thiourea derivatives, goitrin
derivatives, thiouracil derivatives, sulfonamides, aniline
derivatives, derivatives of perchloric acid, iodide,
thiocynanates, carbutamide, para-aminobenzoic acid, para-
aminosalicylic acid, amphenone B, resorcinol,
S phloroglucinol, and 2-4-dihydrobenzoic acid, all of which
have been noted to have goitrinogen activity and suppress
thyroid function. One skilled in the art will also
understand that other drugs may be developed by the in
vivo and in vitro assays described in examples 2 through
11. These drugs may be natural, synthetic or recombinant
in origin. By a drug capable of suppressing expression of
MHC Class I molecules we mean a drug that has the
capability of decreasing or abolishing MHC Class I cell
surface molecules on mAmmA1ian cells treated with the drug
lS relative to m~mm~l ian cells not treated with the drug.
Major histocompatibility complex (MHC) is a generic
designation meant to encompass the histocompatibility
antigen systems described in different species, including
the human leukocyte antigens (HhA). Tissue, includes, but
is not limited to, single cells, cells, whole organs and
portions thereof. Transplantation rejection includes, but
is not limited to, graft versus host disease and host
versus graft disease. Autoimmune disease includes, but is
not limited to, autoimmune dysfunctions and autoimmune
disorders.
By functional e~uivalents is meant any material
which has substantially the same activity as the material
to which it is equivalent. By way of example, material
may include, but is not limited to, nucleic acid
sequences, genes, oligonucleotides, or proteins.
This invention provides a method for treating
autoimmune disease and for preventing or treating
rejection of a tissue in a transplant recipient. More
specifically this invention relates to methods for
administering to a mAmm~1 in need of such treatment a drug
CA 02229938 1998-02-19
W O 97/07404 PCTAUS96tl3715
- 47-
or drugs capable of suppressing expression of MHC Class I
molecules.
Examples of autoimmune diseases that can be
treated by this method include, but are not limited to,
rheumatoid arthritis, psoriasis, juvenile diabetes,
primary idiopathic myxedema, systemic lupus erythematosus,
De Quervains thyroiditis, thyroiditis, autoimmune asthma,
myasthenia gravis, scleroderma, chronic hepatitis,
Addison's.disease, hypogonadism, pernicious anemia,
vitiligo, alopecia areata, ectopic dermatitis, Coeliac
disease, autoimmune enteropathy syndrome, idiopathic
thrombocytic purpura, acquired splenic atrophy, idiopathic
diabetes insipidus, infertility due to antispermatazoan
antibodies, sudden hearing loss, sensoneural hearing loss,
Sjogren's Syndrome, myositis, polymyositis, autoimmune
lS demyelinating diseases such as multiple sclerosis,
transverse myelitis, ataxic sclerosis, pemphigus,
progressive systemic sclerosis, dermatomyositis,
polyarteritis nodosa, chronic hepatitis, hemolytic anemia,
progressive systemic sclerosis, glomerular nephritis and
idiopathic facial paralysis. Preferred drugs for ~reating
autoimmune diseases by this method are MMI, MMI
derivatives, CBZ, and PTU.
In a preferred embodiment, the MHC Class I
suppressing drug MMI is administered to a m~mm~ l,
preferably a human, afflicted with an autoimmune disease.
Suitable therapeutic amounts of MMI are in range of about
0.01 mg to about 500 mg per day. A preferred dosage is
about 0.1 mg to about 100 mg per day and a more preferable
dosage is about 2.5-50 mg per day. Suitable therapeutic
amounts of CBZ are in the same range as MMI. The dosage
can be administered daily, in approximately equally
divided amounts at 8-hour intervals or with breakfast,
lunch and dinner. The preferred maintenance dose for
adult is 5-15 mg per day for periods of up to one year.
Therapy can be continuous, for example about 2.5-30 mg per
CA 02229938 1998-02-19
W 097107404 PCTAUS96/13715
- 48-
day for periods up to one year. Alternatively, therapy
can be tapered, for example, 50-100 mg per day at the
start, tapering to 5-10 mg per day within 4 to 10 weeks
according to thyroid hormone (thyroxin (T4) or
triiodothyronine (T3)) or thyroid stimulating hormone
(TSH) levels in an individual receiving such treatment.
Alternatively PTU is administered to a m~mm~l, preferably
a human, afflicted with an autoimmune disease. Suitable
therapeutic amounts of PTU may be in the range 0.1 mg-2000
mg per day. A preferred dosage for PTU is in a range ten-
fold higher than the dosage ranges described above ~orMMI. The preferred maintenance dose of MMI for children
is 0.4 mg per kg, divided into three daily doses at eight
hour intervals initially, then half the initial dose to
maintain as preferred. It is understood by one skilled in
the art that the dosage administered to a m~mm~l afflicted
with an autoimmune disease may vary depending on the
m~mm~l S age, severity of the disease and response to the
course of treatment. One skilled in the art will know the
clinical parameters to evaluate to determine proper dosage
for an afflicted m~mm~l.
In another preferred em.bodiment, MMI is
administered to a m~mm~l, preferably a human, afflicted
with systemic lupus erythematosus (SLE). A preferred
therapeutic amount is in the range of about 2.5-50 mg per
day, administered over 6-12 months, but can be
administered in discontinuous treatment periods of similar
length over a five year period or for as long as
necessary. Alternatively, MMI may be administered in
conjunction with the current therapies for SLE,
hydrocortisone and cytotoxic drugs, to suppress the
disease. SLE patients with breast cancer cannot be
readily treated with radiotherapy since they are already
immunosuppressed by the ongoing treatment for SLE. Also
SLE may be associated with unusual sensitivity to
radiation complications therefore radiotherapy exacerbates
CA 02229938 1998-02-19
WO 97/07404 PCTAUS96/13715
- 49-
the disease. It is anticipated that use of MMI to treat
SLE individuals with breast cancer will allow radiotherapy
to be administered to such individuals without
exacerbation of their condition or the radiation
complications.
In another embodiment, a MHC Class I suppressing
drug is administered to a m~mmAl, preferably a human,
afflicted with an autoimmune disease associated with the
development of thyroid autoantibodies in the sera of these
~n;m~l S.
In another embodiment, a MHC Class I suppressing
drug is administered to a m~mm~l, preferably a human,
afflicted with an autoimmune disease characterized by the
development of receptor autoantibodies. For example,
autoimmune asthma is associated with ~-adrenergic receptor
autoantibodies. Treatment with a MHC Class I suppressing
drug, preferably MMI, will alleviate the disease. Another
example of such an autoimmune disease is Myasthenia
Gravis. Myasthenia Gravis is associated with
acetylcholine receptor autoantibodies. Individuals
afflicted with myasthenia gravis have a higher frequency
of thyroid autoimmunity. Because of the structural and
functional relationship between the TSH and acetylcholine
receptors, treatment of an animal, preferably a human,
afflicted with Myasthenia Gravis with a MHC Class I
suppressing drug will help suppress the disease.
The MHC Locus in all mammalian species contains
numerous genes and is highly polymorphic. In hl~m~n~ the
HLA Complex contains the HLA-A, HLA-B and HLA-C genes
which encode Class I HLA molecules and the HLA-DR, HLA-DQ
and HLA-DP genes which encode the Class II molecules.
Different HLA molecules bind different antigens. Specific
HLA antigens have been associated with a predisposition to
a particular disease. For example, Ankylosing spondylitis
is associated with HLA-B27, rheumatoid arthritis with HLA-
DR4 and insulin-dependent diabetes mellitus with HLA-DR3
CA 02229938 1998-02-19
WO 97/07404 PCT~US96/I37lS
- 50-
and, HLA-DR4. ("Basic and Clinical Immunology" (1991)
Stites, D.P. and Terr, A.I. (eds), Appelton and Lange,
Norwalk, Connecticut/San Mateo, Cali~ornia). Although,
insulin-dependent diabetes mellitus is negatively
associated with HLA-DR2 ("Basic and Clinical Immunology"
S ~1991) Stites, D.P. and Terr, A.I. (eds), Appelton and
Lange, Norwalk, Connecticut/San Mateo, California) disease
expression has been linked to the insulin response element
-A binding protein (IRE-ABP) because of its chromosomal
base near the HLA complex genes.
Individuals who are HLA-B35 negative, a Class I
haplotype, are at low risk of developing scleroderma.
Among individuals who develop scleroderma and are HLA-B35
positive, 80% will develop thyroid autoimmune disease
and/or will develop thyroid antibodies. In addition,
lS these individuals, are particularly susceptible to human
immunodeficiency virus (HIV) infection with rapid disease
progression (Kaplan, C et al., (1990) Hum. Hered 40:290-
298; Cruse, J.M. et al., (1991) Patholoqv, 59:324-328;
Itescu, S. et al., (1991) J. of Acauired Immune Deficiencv
Svndrome 5: 37-45; Scorza, R. et al., (1988) Human
Immunoloqv 22:73-79). MHC Class I suppressing drugs
should mitigate the symptoms not only of scleroderma but
also mitigate progression of HIV, allowing for a better
prognosis for these individuals. In a preferred
embodiment the MHC Class I suppressing drug used to treat
individuals afflicted with HIV is MMI. A preferred
therapeutic amount is in the range of about 5-50 mg per
day.
In another embodiment, MMI is administered to a
A 30 m~mm~l, preferably a human, afflicted with an autoimmune
disease as an adjunct therapy in the treatment of an
autoimmune disease. For example, De Quervains thyroiditis
is currently treated with hydrocortisone or salicylates;
it is anticipated that the addition of MMI plus
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
hydrocortisone or salicylates will more efficiently
suppress the disease.
In another embodiment, MMI and thyroid hormone
are co-administered to a m~mm~l in need of such treatment
so as to compensate for suppression of thyroid hormone
S production by MMI. The thyroid hormones thyroxin (T4) or
triiodothyronine (T3) may be co-administered with MMI;
thyroxin co-administered with MMI is preferable. A
preferred dose of thyroxin is about 0.01 to 0.5 mg per day
and a more preferable dosage is about 0.1 to 0.3 mg per
day.
The method of this invention is also suitable
for preventing or treating rejection of a transplanted
tissue in a recipient m~mm~l, preferably a human.
Examples of tissues which may be transplanted include, but
are not limited to, heart, lung, kidney, bone marrow,
skin, pancreatic islet cells, thyroid, liver and all
endocrine tissues, neural tissue, muscle, fibroblast,
adipocytes, and hermatopoetic stem cells.
In a preferred embodiment, pancreatic islet
cells are isolated from a donor and treated with MMI prior
to transplantation into a recipient suffering from
diabetes. Diabetes is caused by loss of islet cells as a
result of autoimmune disease. Transplantation of islet
cells will correct such a deficiency. Islet cells may be
treated with about 0.1 to about 50 mM MMI. The islet
cells are preferably treated with about 0.1 to about 10 mm
MMI, in the form of an aqueous solution for 24 to 72 hours
or longer as necessary to suppress expression of MHC Class
I molecules on the islet cells. After transplantation the
recipient may be further treated with MMI or MMI and
hydrocortisone or MMI and lmmllnosuppressive agents.
Tumors of certain tissues can be treated by
total destruction of that tissue and associated tumor.
For example, thyroid tumors are treated with radioiodine
to destroy both normal and diseased tissue to stop the
CA 02229938 1998-02-19
WO 97/07404 PCT~US96/I3715
progression of the disease. Continuous cultures of normal
human thyroid cells are now available. In another
embodiment of this invention, these human cells could be
treated with MMI to suppress MHC Class I expression and
transplanted into a recipient in need of thyroid cells.
This technology would provide human donor cells for
transplantation on demand since cells could be maintained
in culture, treated with MMI and transplanted into a
recipient. In yet another embodiment, the nucleic acid
sequences for a Sox-4 protein or the functional equivalent
thereof, or a Y-box protein or the function equivalent
thereof may be introduced into human cells by conventional
methodology including, but not limited to, micro
injection, electroporation, viral transduction,
lipofection, calcium phophate, particle mediated gene
bombardment, gene transfer or direct injection of nucleic
acid sequences encoding the Sox-4 or a Y-box protein or
functional equivalents thereof, or any other procedures
known to one skilled in the art. Examples of vectors that
can be used to express the Sox-4 or a Y-box protein or
functional equivalents thereof include, but is not limited
to, retroviral vectors, herpes virus vectors, fowlpox
virus vectors, adeno associates virus vectors (AAV) or
plasmids. Such vectors may have tissue specific promoters
or ubiquitous promoters known to those skilled in the art.
The m~mm~l ian cells expressing the Sox-4 or Y-box proteins
or the functional equivalents thereof will have suppresed
expression of Class 1 molecules thereby preventing or
inhibiting transplantation rejection. Further, these
human cells may be from noncogeneic individuals, since
suppression of MHC Class I by MMI will reduce the
possibility that the immune system of the recipient will
recognize these cells as "nonself".
In another embodiment of this invention, whole
organs may be pretreated by perfusion with MMI to suppress
MHC Class I expression. As a drug of low molecular weight
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
MMI will readily perfuse the organ, cross blood vessel
barriers and thereby act on most or all cells in the
organ. This would reduce or avoid the need for exact
matches of donor and recipient in transplantation.
In another embodiment, post transplantation
individuals are treated with MMI and hydrocortisone.
Hydrocortisone or hydrocortisone in conjunction with other
immunosuppressive agents is currently used as a therapy
for individuals after transplantation. Hydrocortisone and
other hormones are additive with MMI in their effect on
MHC Class I levels. Thus it is anticipated pretreatment
with MMI, plus treatment with MMI and hydrocortisone or
MMI, hydrocortisone and other immunosuppressive agents
after transplantation will reinforce self tolerance.
In another embodiment of this invention, MMI is
used to pretreat cells containing a recombinant gene, so
that the cells may be transplanted into a mAmmAl ~
preferably a human in need of gene therapy. To provide
gene therapy to an individual, a genetic sequence which
encodes a desired protein is inserted into a vector and
introduced into a host cell. Examples of diseases that
may be suitable for gene therapy include, but are not
limited to sickle cell anemia, cystic fibrosis, ~-
thalassemia, hemophilia A and B, glycosyl transferase
enzyme defects, and cancer. Examples of vectors that may
be used in gene therapy include, but are not limited to,
defective retroviral, adenoviral, or other viral vectors
(Mulligan, R.C. (1993) Science Vol. 260: 926-932). The
means by which the vector carrying the gene may be
introduced into the cell include, but is not limited to,
electroporation, transduction, or transfection using DEAE-
dextran, lipofection, calcium phosphate or other
procedures known to one skilled in the art (Sambrook, J.
et al. (1989) in "Molecular Cloning. A Laboratory
Manual", Cold Spring Harbor Press, Plainview, New York).
CA 02229938 1998-02-19
W O 97/07404 PCT~US96~3715
- 54-
Examples of cells into which the vector carrying
the gene may be introduced include, but are not limited
to, continuous cultures of normal human cells, such as
human pancreatic islet or thyroid cells or continuous
cultures of normal m;lmm~l ian cells such as rat FRTL-5
cells. In a preferred embodiment, FRTL-5 rat thyroid
cells containing a recombinant gene under a thyroid
specific promoter are treated with MMI to suppre6s MHC
Class I. ~ The treated cells are transplanted into a
m~mm~l, preferably a human, and secrete factors able to
control the disease. Such cells can be maintained in
prolonged culture, in a functioning growing state and
treated with MMI or MMI with hormone supplementation to
suppress Class I. Cells carrying a variety of recombinant
genes could be readily available on demand. Elimination
of the need for autologous cells would allow a major
advance in transplantation.
In another embodiment of this invention an ln
vivo assay is used to assess the ability of a candidate
drug to suppress MHC Class I expression. In the first
step of the assay, the role of MHC Class I in a particular
autoimmune disease is evaluated by determining if the
symptoms or signs of that particular autoimmune disease
can be induced in MHC Class I-deficient mice. Lack of
inducibility of the autoimmune disease in MHC Class I-
deficient mice would suggest a role for MHC Class I inthat disease. Examples of MHC Class I-defi~ient mice
which can be used include, but are not limited to, MHC
Class I-deficient mice generated by homologous
recombination, MHC Class I-deficient mice created by
insertion of transgenes, and MHC Class I-deficient mice
created by chromosomal loss. MHC Class I-deficient mice
are also commercially available. Methods by which the
autoimmune disease can be recreated in these mice include,
but are not limited to, viral infection, induction by
antibodies and induction by chemicals or other
CA 02229938 1998-02-19
WO 97/07404 PCTtUS96tl3715
environmental agents. Alternatively, Class I-deficient
animals can be mated with spontaneous autoimmune animal
models and the resulting progeny analyzed for autoimmune
disease.
In a preferred embodiment MHC Class I deficient
mice are immunized with a human monoclonal anti-DNA
antibody bearing a major idiotype, designated 16/6Id.
(Shoenfeld, Y. et al. (1983) J. Exp. Med. 158:718-730).
In the next step of this embodiment an animal model of the
autoimmune disease is exposed to the MHC Class I
suppressing drug. Examples of autoimmune ~n; m~ 1 models
include, but are not limited to, transgenic animals,
animals generated by homologous recombination, chromosomal
loss and ~n;m~l s with naturally or spontaneously occurring
disease.
In a preferred embodiment, SLE is experimentally
induced in mice. Examples of how SLE is experimentally
induced in mice include, but are not limited to,
immunization with a monoclonal 16/6 idiotype (Shoenfeld,
Y. et al., (1983)), a monoclonal anti-16/6Id antibody
(Mendlovic, S. et al. (1989) Eur. J. Immun., 19:729-734)
and T cell lines specific for the 16/6 idiotype (Fricke,
H. et al., (1991) ImmunoloqY, 73:421-427). The strains of
mice that may be used include, but are not limited to,
Balb, 129, C3H.SW, SJL, AKR, and C3HSW. A preferred
method is immunization of mice with a human anti-DNA
monoclonal antibody, the 16/6Id antibody (Shoenfeld, Y. et
al (1983)). The immunized animals are then exposed to a
drug, preferably a MMI analog, and evaluated for
alleviation of symptoms of the disease. Parameters
evaluated in 16/6Id-treated mice include, but are not
limited to, leukopenia, proteinuria, levels of cell
surface markers on the peripheral blood lymphocytes (PBL),
and immune complex deposits in kidney. Examples of
methods for evaluating these parameters include, but are
not limited to, analyses of blood cells and sera, tissue
CA 02229938 1998-02-19
WO g7~7404 PCT/US96~13715
-- 56--
biopsies or extracts, urine analyses and analysis of
antibody production and immune activated cells. It will
be understood by those skilled in the art that
conventional methods can be used to evaluate these
parameters. Examples of conventional methods that can be
used evaluate these parameters include, but are not
limited to, cell counts, ELISAs (Heineman, W.R. et al
(1987), Methods of Biochemical Analvses 32:345-393),
quantitative protein assays (Ausubel, J. et al., ~1987) in
"Current Protocols in Molecular Biology", John Wiley and
Sons, New York), ;mml]nohistology ("Basic and Clinical
Immunology" (1991) Stites, A.P. and Terr, A.I. (eds.)
Appelton and Lange, Norwalk, Connecticut San Mateo,
California), and analysis of cell surface markers on
lymphocytes ("Basic and Clinical Immunology" (1991)
Stites, D.P. and Terr, A.I. (eds), Appelton and Lange,
Norwalk, Connecticut/San Mateo, California).
In another embodiment of this invention, another
in vivo assay is used to assess and develop drugs capable
of suppressing expression of MHC Class I molecules. In
this in vivo method a tissue to be transplanted into an
animal is pretreated with a MHC Class I suppressing drug.
Examples of tissues which can be transplanted include, but
are not limited to, thyrocytes, hepatocytes, neural
tissue, muscle, fibroblasts, adipocytes, and islet cells,
endocrine cells and tissues, thyroid, liver, skin, bone
marrow, kidney, lung and heart. In a preferred embodiment
rat thyroid FRTL-5 cells are pretreated with a MHC Class I
suppressing drug prior to transplantation in a rat or
- mouse. Examples of the means by which the tissue may be
A 30 transplanted include, but is not limited to, general
surgical procedures, intravenous and subcutaneous
injection. In a preferred embodiment rat thyroid FRTL-5
cells are subcutaneously injected into the lower back of a
rat or mouse. The pretreated transplanted tissue remains
in the recipient An;mAl for periods between 30 - 100 days.
CA 02229938 1998-02-l9
WO 97/07404 PCTrUS96/13715
Preferably the state of the transplanted tissue is
evaluated 60 days after transplantation. One skilled in
the art will understand the conventional methods available
to evaluate the transplanted tissue. In a preferred
embodiment the site of injection of the pretreated
5 transplanted FRTh-5 cells is excised from the recipient
animal. The excised tissue is evaluated microscopically
for the presence of FRTL-5 cells. In addition FRTL-5
cells are. evaluated for the ability of TSH to cause an
increase in cAMP levels and an increase in iodide uptake
which are indicative of normal FRTL-5 function. The
presence of FRTL-5 cells, that had been treated with the
candidate drug prior to transplantation, in the excised
tissue and that exhibit the increase in TSH mediated cAMP
levels or iodine uptake is predictive of the candidate
drug's usefulness for preventing or treating
transplantation rejection.
In another embodiment of this invention, in
vitro assays are used to assess and develop candidate
drugs capable of suppressing expression of MHC Class I
molecules. One in vitro assay in the present invention
relates to a method for assessing the ability of a
candidate drug to suppress expression of MHC Class I
molecules by detecting altered binding of a protein or
proteins in a m~mm~l ian cell extract, from cells treated
or not treated with the candidate drug, to a MHC Class I
regulatory nucleic acid sequence or the functional
equivalent thereof. Extracts from m~mmA~ian cells treated
with a candidate drug are combined with MHC Class I
nucleic acid regulatory sequences and the existence of
complexes between said sequences and proteins or protein
from the extract is detected. Alterations in binding of
mAmmAlian cell protein or proteins to said nucleic acid
sequences may be assessed by comparison to binding of
protein or proteins to the same MHC Class I regulatory
nucleic acid sequence in extracts from untreated cells.
CA 02229938 1998-02-19
W 097107404 PCTAUS96/1371
- 58-
Regulatory nucleic acid sequences are intended to
encompass sequences that regulate transcription of a MHC
Class I gene or the functional e~uivalents thereo~. By
- alteration we mean an enhancement or appearance of the
signal of the detected complex in treated versus untreated
S extracts or a decrease or absence of signal of the
detected complex in treated versus untreated extracts.
Protein extracts may be either nuclear or cellular
extracts; cellular extracts are preferable. Cellular or
nuclear protein extracts from m~mm~l ian cells are
generated by conventional methods (Ausuebel, J. et al.
(1987) in "Current Protocols in Molecular Biology~, John
Wiley and Sons, New York).
Examples of nucleic acid sequences that can be
used in this in vitro assay include, but i8 not limited
to, nucleic acid fragments containing regulatory sequences
of MHC Class I promoters or the functional equivalents
thereof. By way of example such fragments may include
single or double stranded oligonucleotides. Sequences
encoding the regulatory regions of the PD1 silencer
elements such as the upstream and downstream silencers may
be used in this method. In the PDl promoter the upstream
silencer is located at about -724 to about -697 base pairs
and the downstream silencer at about -127 to about -90
base pairs 5' of the PD1 start site. Also intended to be
encompassed by this invention are nucleic acid sequences
which are functionally equivalent to the two silencer
sequences of the PD1 promoter. In a preferred embodiment
the downstream silencer sequences centered on the CRE at
-107 to -lOObp or their functional equivalents are used in
A 30 the in vitro assays described herein.
Examples of additional nucleic and sequences
that may be used in the ln vitro assay include, but is not
limited to regulatory sequences of the MHC Class I
promoter encoding for enhancer regions. By way of example
sequences including the upstream and downstreams enhancers
CA 02229938 1998-02-19
W O 97/07404 PCT~US96/13715
- 59-
of the PDl MHC Class I promoter, or their functional
equivalents may be used in the in vitro assays of this
invention. In the PD1 promoter the upstream enhancer
overlaps with the upstream silencer (See Figure 9); the
downstream enhancer is 5' to the interferon response
element (Figure 16B). Examples of proteins that may form
complexes with the upstream silencer and enhancer include,
but is not limited to, Sox-4, C-jun family members, c-fos
family me~bers, NF-KB and its subunits or the functional
equivalents thereof. Examples of proteins that may form
complexes with the downstream enhancer (enhancer A)
include, but are not limited to, Sox 4, NFK-B and its
subunits, c-fos family members, Pax 8, a TTF-1 protein, a
Y-box protein, such as TSEP-1, or the functional
equivalents thereof. Candidate drugs capable of
suppressing MHC Class 1 molecules should decrease or
abolish complex formation with the upstream or downstream
enhancer sequences.
Examples of m~mm~l ian cells that can be used in
this in vitro assay include, but are not limited to,
m~mm~l ian cell thyrocytes, hepatocytes, neural tissue,
muscle, fibroblasts, adipocytes, and HELA cells. Rat
FRTL-5 thyroid cells are preferable (American Type Culture
Collection, Rockville, Maryland, ATCC-CRL 8305).
In a one embodiment, the nucleic acid sequences
used in this assay are derived from sequences homologous
to the DNA regulatory sequences of the MHC Class I gene,
PD1. In a preferred embodiment, these nucleic acid
sequences are DNA fragments 114 (bases 221 to 320 of SEQ
ID NO:1), 140 (bases 321 to 455 of SEQ ID NO:1) and 238
(bases 456 to 692 of SEQ ID NO:1), as shown in Figure 9.
The double-stranded oligonucleotides shown in Figure 10
and designated S1, S2, S3, S5-8 (SEQ ID NO:3, SEQ ID NO:4,
SEQ ID NO:10, SEQ ID NO:5-SEQ ID NO:8) may also be used or
the double-stranded oligonucleotide(K) (SEQ ID NO:38).
The K oligonucleotide (SEQ ID NO:38) is the TTF-2/Sox-4
CA 02229938 1998-02-19
WO 97/07404 P ~ AUS96/13715
- 60-
reactive element or regulatory nucleic acid sequence which
is in the thyroglobulin promoter (Santisteban, P. et al
(1992) Mol. Endocrinol:6:1310-1317) and which is related
- in sequence to the Sox-4 like binding site in the silencer
complex (Figure 10).
In a preferred embodiment the ability of a drug
to suppress expression of MHC Class I molecules is
measured by decreased or increased binding of a protein or
proteins in the extract to the above described MHC Class I
regulatory nucleic acid sequences or to single or double
stranded oligonucleotides or their functional equivalents.
By decreased binding we mean a diminution or loss of
signal or absence of signal of the detected complexes in
treated versus untreated extracts. By increased binding
we mean the appearance of or an increase of signal of the
complexes in treated versus untreated cells. By complex
we mean protein or proteins bound to the nucleic acid
sequence.
The protein or proteins which form the complex
with the nucleic acid sequences may be ubiquitously
expressed or tissue specific. Such proteins may directly
bind to the nucleic acid sequences or interact or complex
with proteins capable of binding this nucleic acid
sequences. Intended to be encompassed by this definition
are proteins capable of binding single or double stranded
nucleic acid sequences. By way of example the proteins
forming the complex in cells with the upstream silencer-
enhancer of a MHC Class I gene may comprise, but is not
limited to, the NF-KB and its subunits (p65/p50 subunits),
c-fos related proteins or family members, C-jun related
proteins or family members, a Sox-4 protein or the
functional equivalents thereof which possess the
substantially equivalent biological activity of such
proteins. (Example 8; Kieran, M., et al., (1990) Cell 62,
1007-1018; Ghosh, S., et al., (1990) Cell 62, 1019-1029;
Ryseck, R.-P., et al., (1992) Mol. Cell. Biol. 12, 674-
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 61-
684; Stein, B., Ert al., (1993) EMBO J. 12, 879-3891;
Stein, B., et al., (1993) Mol. Cell. Biol. 13, 964-3974;
Nishina, H., et al., (1990) Proc. Natl. Acad. Sci. U. S.
A 87, 3619-3623; Baldwin, A. et al., (1988) Proc. Natl
Acad. Sci. U. S. A. 85, 723-727; Fujita, T., et al.,
(1992) Genes and Develop. 6, 775-787; Giuliani, C., et al
(1995) J. Biol. Chem. 270, 11453-11462). One of skill in
the art will appreciate that a variety of factors such as
cell or tissue type will determine the exact make up of
the proteins interacting or forming the complex. By way
of example the proteins forming a complex with the
downstream silencer in cells may comprise, but i6 not
limited to, a thyroid transcription ~actor -1, (TTF-l),
Pax 8, a Y-box protein, a single stranded binding protein
(SSBP) and a cyclic AMP regulatory binding protein (CREB)
or the functional equivalents thereof which posses
substantially equivalent biological activity of such
proteins. (See Example 9, 11); Civitareale, D., et al.,
(1993) Mol. Endocrinol. 7, 1589-1595; Civitareale, D., et
al., (1989) EMBO J. , 2537-2542; Guazzi, S., et al.,
(1990) EMBO J. 9, 631-3639; Francis-Lang, H., et al.,
(1992) Mol. Cell. Biol. 12, 576-588; z~nn;ni, M., et al.,
(1992) Mol. Cell. Biol. 12, 4230-4241; Shimura, H., et
al., (1994) Mol. Endocrinol. 8, 1049-1069; Ohmori, M., et
al., (1995) EndocrinoloqY, 136, 269-282) Davis, T. L., et
al., (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 9682-9686
nnlhurgh, A. J. (1989) Nucleic Acids Res. 17, 7771-7778
Postel, E. H., et al., (1989) Mol. Cell. Biol. 9, 5123-
5133; Kolluri, R., et al., (1992) Nucleic Acids Res. 20,
111-116; Johnson, A. C., et al., (1988) Mol Cell. Biol.
8, 4174-4184; Pestov, D. G., et al., (1991) Nucleic Acids
~L~ 19, 6527-6532; Hoffman, E. K., et al., (1990) Proc.
Natl. Acad. Sci. U. S. A. 87, 2705-2709; Wolffe, A. P., et
al., (1992) New Biol. 4, 290-298; Kolluri, R., et al.,
(1991) Nucleic Acids Res. 19, 4771; Ozer, J., et al.,
(1990) J. Biol. Chem. 265, 22143-22152; Faber, M., et
CA 02229938 l998-02-l9
W ~ 97/07404 PCTAUS96~13715
- 62-
al., (1990) J. Biol. Chem. 265, 22243-22254; Petty, K. J.,
et al., G~nR~nk Accession Number M69138; Didier, D. K., et
al., (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 7322-7326;
Sakura, H., et al., (1988) Gene 73, 499-507; Spitkovsky,
D. D., et al., (1992) Nucleic Acids Res. 20, 797-803;
Sabath, D. E., et al., ~1990) J. Biol. Chem. 265, 12671-
12678; Giuliani, C., et al., (1995) J. Bi~l. Chem. 270,
11453-11462) Montminy, M. R., et al., (1986) Proc. Natl.
Acad. Sci~ U. S. A. 83, 6682-6686; Angel, P., et al.,
(1987) Mol. Cell. Biol. 7; 2256-2266; Leonard, J., et al.,
(1992) Proc. Natl. Acad. Sci. U. S. A. 89, 6247-6251;
Vallejo, M., et al., (1992) J .Biol. Chem. 267; 12868-
12875; Ieonard, J., et al., (1993) Mol. Endocrinol. 7,
1275-1283; Ikuyama, S., et al., (1992) Mol. Endocrinol. 6,
1701-1715; Habener, J. F. (1990) Mol. Endocrinol. 4, 1087-
1094).
Detection of the complexes can be carried out by
a variety of techniques known to one skilled in the art.
Detection of the complexes by signal amplification can be
achieved by several conventional labelling techniques
including radiolabels and enzymes (Sambrook, T. et al
(1989) in "Molecular Cloning, A Laboratory MAnl]~ Cold
Spring Harbor Press, Plainview, New York). Radiolabelling
kits are also commercially available. Preferred methods
of labelling the DNA ~equences are with 32p using Klenow
enzyme or polynucleotide kinase. In addition, there are
known non-radioactive techniques for signal amplification
including methods for attaching chemical moieties to
pyrimidine and purine rings (Dale, R.N.K. et al. (1973)
Proc. Natl. Acad. Sci., 70:2238-2242; Heck, R.F. (1968) S.
A 30 Am. Chem. Soc., 90: 5518-5523), methods which allow
~, detection by chemiluminescence (Barton, S.K. et al. (1992)
J. Am. Chem. Soc., 114:8736-8740) and methods utilizing
biotinylated nucleic acid probes (Johnson, T.K. et al.
(1983) Anal. Biochem., 133:126-131; Erickson, P.F. et al.
(1982) J. of Immunoloqy Methods, 51:241-249; Matthaei,
CA 02229938 1998-02-19
W 097/07404 PCT~US96/13715
- 63-
F.S. et al. (1986) Anal. Biochem., 157:123-128) and
methods which allow detection by fluorescence using
commercially available products. Non-radioactive
labelling kits are also commercially available. Methods
useful to detect complexes of protein extract bound to DNA
fragments or double-stranded oligonucleotides include
mobility-shift analysis, Southwestern, and
;mmllnoprecipitation (Sambrook, J. et al., (1989); Ausubel,
J. et al., (1987) in "Current Protocols in Molecular
Biology", John Wiley and Sons, New York). A preferred
method is gel mobility-shift analysis using a
radiolabelled double-stranded nucleic acid sequence. For
mobility shift analysis, the protein extract-oligomer
complexes can also be detected by using labelled protein
extract, wherein the cells can be metabolically labelled
with 35S, or tritiated thymidine. Alternatively,
radioiodination with l25I or non-radioactive labelling
using biotin and various fluorescent labels prior to the
preparation of the protein extract may also be used.
Another in vitro assay of the invention relates
to a method for assessing the ability of a drug to
suppress expression of MHC Class I by measuring the
activity of a reporter gene operably linked downstream of
a MHC Class I promoter and its regulatory sequences or the
~unctional equivalents thereof. The reporter gene
operably linked to a MHC Class I promoter and its
regulatory sequence is introduced into m~mmAlian cells,
said mAmmAlian cells are treated with the candidate drug
and the activity of the reporter gene in lysates from
treated and untreated mAmmAlian cells is measured. A
decrease of activity of the reporter gene in cell lysates
from treated versus nontreated cells is predictive of the
usefulness of the candidate drug in suppressing MHC Class
I expression.
Preferred regulatory sequences that may be
operably linked to the reporter gene are sequences
CA 02229938 1998-02-19
W ~ 971074~4 PCT~US96/13715
- 64 -
corresponding to the silencer and enhancer regions of the
MHC Class I, PD1 gene. By way of example, these sequences
may include, but are not limited to, the 114 (bases 221 to
230 of SEQ ID NO:1), 140 (bases 321 to 455 of SEQ ID
N0:1), 151 (bases 54 to 220 of SEQ ID N0:1) and 238 (bases
456 to 692 of SEQ ID NO:1) sequences or the functional
equivalents thereof, as shown in Figures 9A-9B, with their
cognate promoters. In addition sequences corresponding to
the downstream silencer region -127 to -90 bp or -127 to -
80 bp or the functional equivalents thereof may also be
used. It will be understood by one skilled in the art
that sequentially and functionally homologous regions
found in the regulatory and promoter domains of other
Class I genes may also be used and are intended to be
encompassed by the invention. Examples of reporter genes
include, but are not limited to, the chloramphenicol
acetyltransferase (CAT) gene, the ~-galactosidase gene,
the luciferase gene and human growth hormone (hGH)
(Sambrook, J. et al. (1989); Ausubel, F. et al. (1987) in
"Current Protocols in Molecular Biology" Supplement 14,
section 9.6 (1990); John Wiley and Sons, New York).
Examples of m~mm~l ian cells that can be used in this in
vitro assay include, but are not limited to, m~mm~l ian
cell thyrocytes, hepatocytes, neural tissue, muscle,
fibroblasts, adipocytes, and HEhA cells. The means by
2~ which the regulatory sequence operably linked to the
reporter gene may be introduced into cells are the same as
those described above. In a preferred embodiment the CAT
gene is operably linked to one of the above mentioned PDI
sequences and introduced into FRTL-5 cells.
It is understood by one skilled in the art that
the ability of a candidate drug to suppress expression of
MHC Class I molecules can also be assessed by comparing
levels of cellular mRNA in m~mm~l ians cells treated with
the candidate drug versus cells not treated with the
candidate drug. Examples of methods for determining
SUBSTITUTE St~EET (RULE 26)
CA 02229938 1998-02-19
WO 97/07404 PCTrUS96/13715
- 65-
cellular mRNA levels include, but is not limited to
Northern blotting (Alwine, J.C. et al. (1977) Proc. Natl.
Acad. Sci., 74:5350-5354), dot and slot hybridization
(Kafatos, F.C. et al. (1979) Nucleic Acids Res., 7:1541-
1522), filter hybridization (Hollander, M.C. et al. (1990)
Biotechniques; 9:174-179), RNase protection (Sambrook, J.
et al. (1989) in "Molecular Cloning, A Laboratory ~An~
Cold Spring Harbor Press, Plainview, NY), polymerase chain
reaction ~Watson, J.D. et al.) (1992) in "Recombinant DNA"
Second Edition, W.H. Freeman and Company, New York) and
nuclear run-off assays (Ausubel, F. et al. (1989) in
"Current Protocols in Molecular Biology" Supplement 9
(1990); John Wiley and Sons, New York). Conventional
methodology known to those skilled in the art can be used
to assess the mRNA levels or rate of transcription of a
given gene (Sambrook, J. et al. (1989) in "Molecular
Cloning, A Laboratory Manual", Cold Spring Harbor Press,
Plainview, NY).
In yet another in vitro assay the ability of a
candidate drug to suppress MHC Class I expression is
evaluated by assessing a drug' B ability to alter the
expression of one or more of the proteins capable of
modulating MHC Class I expression or their corresponding
RNA. By way of example such proteins may include, but are
not limited to, a Sox-4 protein or the functional
equivalent thereof, TTF-1 thyroid transcription factor or
the functional equivalent thereof, a single stranded
binding protein (SSBP) such as SSBP or the functional
equivalent thereof, and a Y-box protein or the functional
equivalent thereof. In a preferred embodiment the levels
of expression of the mRNA for the Sox-4 protein and a Y-
box protein, designated TSEP-l described herein are
assessed in cells exposed to the candidate drug.
Preferably rat FRTL-5 cells are used. Conventional
methodology may be used to assess the rate of
transcription of these genes or the levels of the mRNA for
CA 02229938 1998-02-19
W O g7~74~4 - PCTAUS96/13715
- 66-
these genes present in a cell (Ausubel, F. et al. (1989)
in "Current Protocols in Molecular Biology" (1987); John
Wiley and Sons, New York). Examples of such methods
include, but are not limited to, Northern Blot Analysis,
or Polymerase Chain Reaction (PCR). A drug capable of
suppressing MHC Class I expression should also suppress or
decrease SSBP messenger RNA (mRNA), Sox-4 mRNA, or TTF-1
mRNA levels. Alternatively the level of the Sox 4 or TTF-
1 protein.may be evaluated as an indicator of the
therapeutic potential of a candidate drug. A drug capable
of suppressing MHC Class I molecules should decrease the
levels of SSBP or TTF-1 protein. Evaluation of protein
levels may be assessed by conventional methodology known
to those skilled in the art including, but not limited to,
Western Blot Analysis, ELISA (Ausubel et al., (1987) in
"Current Protocols in Molecular Biology", John Wiley and
Sons, New York, New York; Sambrook et al. (1989) in
"Molecular Cloning. A Laboratory Manual", Cold Spring
Harbor Press, Plainview, New York). Alternatively, the
levels of expression of the RNA or proteins of a Y-box
protein or the functional equivalent thereof may be
evaluated for the therapeutic potential for candidate
drug. The RNA or protein levels of Y-box protein should
increase if a drug is capable of suppressing MHC Class I
molecules. Conventional methodology known to those
skilled in the art or described herein may be used in this
assay.
In yet another embodiment the therapeutic
potential of a candidate drug ability to MHC Class I may
be evaluated by the ability of the drug to evaluate the
oxidation/reduction state of proteins capable of
modulating Class I expression. By way of example such
protein may be SSBP, a TTF-1 protein, Y-Box proteins such
as TSEP-1, a Pax8 protein, a CREB protein, NF-~B and its
subunits, fos family members or the functional equivalents
thereof. By way of example the effect of the drug on
CA 02229938 1998-02-19
WO 97/07404 PCT~US96/13715
- 67-
enzymes within a cell capable of modulating or altering
the oxidation/reduction state of a protein capable of also
modulating MHC Class I expression may be assessed.
Alternatively, the activity of the enzymes responsible for
modulating the oxidation/reduction state of the proteins
capable of modulating MHC Class I can be assessed.
Examples of such enzymes include, but are not limited to,
thioredoxin, superoxide dismutase or the functional
equivalen~s thereof. By way of example, assays that may
be used in this method included, but not limited to, the
assays described in Noiva, R. (1994) Protein Expr. Purif.
5, 1-13; Tonissen, K. et al., (1993) J. Biol. Chem. 268,
22485-22489; Hayashi, T., et al., (1993) J. Biol. Chem.
268, 11380-11388; Okamato, T., et al., (1992) Int.
Immunol. 4, 811-819, herein incorporated by reference.
The present invention also provides nucleic acid
sequence~ which encode proteins capable of modulating MHC
Class I expression. In particular, this invention
provides nucleic and amino acid sequences for a Sox-4
protein (Example 8) and a Y-box protein designated TSEP-1
(Example 11).
The nucleic acid sequence for the Sox-4 protein
shown in Figure 20, and the nucleic acid sequence for the
Y-Box protein, designated ~SEP-1, shown in Figure 38
represent preferred embodiments of the invention. It is,
however, understood by one skilled in the art that due to
the degeneracy of the genetic code variations in the cDNA
sequence shown in Figures 20 and 38 will still result in a
DNA sequence capable of encoding the Sox-4 or TSEP-1
respectively protein. Such DNA sequences are therefore
functionally equivalent to the sequence set forth in
Figure 20 and 28 and are intended to be encompassed within
the present invention. Further, a person of skill in the
art will understand that there are naturally occurring
allelic variations in a given species of the nucleic acid
3S sequences shown in Figures 20 and 28, and that these
CA 02229938 1998-02-19
W O 97107404 PCTrUS96113715
- 68-
variations are also intended to be encompassed by the
present invention.
The predicted Sox-4 protein is about 53
r kilodaltons and the predicted TSEP-l protein is about 42
kilodaltons (kd). This invention further includes protein
or peptides or analogs thereof having substantially the
same function as the Sox-4 or TSEP-l proteins. Such
proteins or polypeptides include, but are not limited to,
a fragment of the protein, or a substitution, addition or
deletion mutant of the Sox-4 or TSEP-l protein. This
invention also encompasses proteins or peptides that are
substantially homologous to these proteins.
The term "analog" includes any polypeptide
having an amino acid residue sequence substantially
identical to the Sox-4 or TSEP-l sequences specifically
shown herein Figures 20 and 38 in which one or more
residues have been conservatively substituted with a
functionally similar residue and which displays the
functional aspects of the Sox-4 or TSEP-l protein antigen
as described herein. Examples of conservative
substitutions include the substitution of one non-polar
(hydrophobic) residue, such as isoleucine, valine,
leucine, or methionine, for another, the substitution of
one polar (hydrophilic) residue for another such as
between arginine and lysine, between glutamine and
asparagine, between glycine and serine, the substitution
of one basic residue such as lysine, arginine or histidine
for another, or the substitution of one acidic residue,
such as aspartic acid or glutamic acid for another.
Intended to be included in this invention, are
conservatively substituted variations of the Sox-4 and
TSEP-l proteins described herein. The phrase
"conservative substitution" also includes the use of a
chemically derivatized residue in place of a non-
derivatized residue. "Chemical derivative" refers to a
subject polypeptide having one or more residues chemically
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 69-
derivatized by reaction of a functional side group.
Examples of such derivatized molecules include for
example, those molecules in which free amino groups have
been derivatized to form amine hydrochlorides, p-toluene
sulfonyl groups, carbobenzoxy groups, t-butyloxycarbonyl
groups, chloroacetyl groups or formyl groups. Free
carboxyl groups may be derivatized to form salts, methyl
and ethyl esters or other types of esters or hydrazides.
Free hydrQxyl groups may be derivatized to form 0-acyl or
0-alkyl derivatives. The imidazole nitrogen of histidine
may be derivatized to form N-im-benzylhistidine. Also
included as chemical derivatives are those proteins or
peptides which contain one or more naturally-occurring
amino acid derivatives of the twenty standard amino acids.
For examples: 4-hydroxyproline may be substituted for
proline; 5-hydroxylysine may be substituted for lysine; 3-
methylhistidine may be substituted for histidine;
homoserine may be substituted for serine; and ornithine
may be substituted for lysine. Proteins or polypeptides of
the present invention also include any polypeptide having
one or more additions and/or deletions of residues
relative to the sequence of a polypeptide whose sequence
is encoded in the DNA for the Sox-4 or TSEP-1 protein, so
long as the requisite activity is maintained.
This invention also provides a recombinant DNA
molecule comprising all or part of the Sox-4 nucleic acid
sequence and a vector or all or part of the TSEP-1 nucleic
acid sequence and a vector. Expression vectors suitable
for use in the present invention comprise at least one
expression control element operationally linked to the
nucleic acid sequence. The expression control elements
are inserted in the vector to control and regulate the
expression of the nucleic acid sequence. Examples of
expression control elements include, but are not limited t
to, lac system, operator and promoter regions of phage
lambda, yeast promoters, and promoters derived from
CA 02229938 1998-02-19
WO 97/07404 P~fUS96fl371S
- 70-
polyoma, adenovirus, retrovirus or SV40. Additional
preferred or required operational elements include, but
are not limited to, leader sequence, termination codons,
r polyadenylation signals and any other sequences necessary
or preferred for the appropriate transcription and
subsequent translation of the nucleic acid sequence in the
host system. It will be understood by one skilled in the
art the correct combination of required or preferred
expression control elements will depend on the host system
chosen. It will further be understood that the expression
vector should contain additional elements necessary for
the transfer and subsequent replication of the expression
vector containing the nucleic acid sequence in the host
system. Examples of such elements include, but are not
limited to, origins of replication and selectable markers.
It will further be understood by one skilled in the art
that such vectors are easily constructed using
conventional methods (Ausubel et al., (1987) in "Current
Protocols in Molecular Biology", John Wiley and Sons, New
York, New York) or commercially available.
Another aspect of this invention relates to a
host organism into which recombinant expression vector
containing all or part of the Sox-4 nucleic acid sequence
or TSEP-1 nucleic acid ~equence or combination thereof,
has been inserted. The host cells transformed with the
expression vectors of this invention include eukaryotes,
such as animal, plant, insect and yeast cells and
prokaryotes, such as E. coli. The means by which the
vector carrying the gene may be introduced into the cell
include, but are not limited to, microinjection,
~ 30 electroporation, transduction, or transfection using DEAE-
r dextran, lipofection, calcium phosphate or other
procedures known to one skilled in the art (Sambrook et
al. (1989) in "Molecular Cloning. A Laboratory Manual",
Cold Spring Harbor Press, Plainview, New York).
CA 02229938 1998-02-19
WO 97/07404 PCTAJS96113715
- 71-
In a preferred embodiment, eukaryotic expression
vectors that function in eukaryotic cells are used.
Examples of such vectors include, but are not limited to,
retroviral vectors, vaccinia virus vectors, adenovirus
vectors, herpes virus vector, fowl pox virus vector,
S bacterial expression vectors, plasmids, such as pcDNA3
(Invitrogen, San Diego, CA) or the baculovirus transfer
vectors. Preferred eukaryotic cell lines include, but are
not limited to, thyroid cells such as FRTL-5 or FRT cells,
COS cells, CHO cells, HeLa cells, NIH/3T3 cells, or BRL
cells. In a particularly preferred embodiment the
recombinant expression vector is introduced into m~mm~lian
cells, such as FRTL-5 NIH/3T3, COS, or CHO, to ensure
proper processing and modification of the recombinant
proteins.
In one embodiment the expressed recombinant
TSEP-l or Sox-4 proteins may be detected by methods known
in the art which include Coomassie blue staining and
Western blotting using antibodies specific for the TSEP-l
or Sox-4 proteins.
In a further embodiment, the recombinant protein
expressed by the host cells can be obtained as a crude
lysate or can be purified by standard protein purification
procedures known in the art which may include differential
precipitation, molecular sieve chromatography, ion-
exchange chromatography, isoelectric focusing, gel
electrophoresis, affinity, and immunoaffinity
chromatography and the like. (Ausubel et. al., (1987) in
"Current Protocols in Molecular Biology" John Wiley and
Sons, New York, New York). In the case of ;mmllnoaffinity
chromatography, the recom.binant protein may be purified by
passage through a column containing a resin which has
bound thereto antibodies specific for the Sox-4 or TSEP-l
proteins (Ausubel et. al., (1987) in "Current Protocols in
Molecular Biology" John Wiley and Sons, New York, New
York).
CA 02229938 l998-02-l9
W O 97107~4 - PCT~US96n3715
- 72-
The nucleic acid sequences or portions thereof,
of this invention are useful as probes for the detection
of expression of the Sox-4 or TSEP-1 gene in biological
samples. Examples of samples include, but are not limited
to, tissues cells, homogenates, extracts, biopsies, fine
needle aspirates or tissue slices. Therefore, another
aspect of the present invention relates to a bioassay for
detecting messenger RNA encoding either the Sox-4 or TSEP-
1 proteins in a biological sample comprising the steps of
contacting all or part of the nucleic acid sequence of
this invention with said biological sample under
conditions allowing a complex to form between said nucleic
acid sequence and said messenger RNA, detecting said
complexes and, determining the level of said messenger
RNA. RNA can be isolated as whole cell RNA or as poly(A)+
RNA by conventional methodology.
In another embodiment, combinations of
oligonucleotide pairs based on the Sox-4 or TSEP-1
sequence in Figures 20 and 38 are used in a Polymerase
Chain Reaction (PCR) as primers to detect Sox-4 or TSEP-1
mRNA respectively. These primers can also be used in a
method following the reverse transcriptase - Polymerase
Chain Reaction (RT-PCR) process for amplifying selected
RNA nucleic acid sequences as detailed in Ausubel et al.,
(eds) (1987) In "Current Protocols in Molecular Biology"
Chapter 15, John Wiley and Sons, New York, New York. The
oligonucleotides can be synthesized by automated
instruments sold by a variety of manufacturers or can be
commercia commercially prepared based upon the nucleic
acid sequence of this invention. One skilled in the art
will know how to select PCR primers based on the Sox-4 or
TSEP-1 nucleic acid sequence for amplifying Sox-4 or TSEP-
1 respectively RNA in a sample.
In yet another embodiment of this invention all
or parts thereof of the Sox-4 or TSEP-1 nucleic acid
sequence can be used to generate transgenic ~n; m~ 1 S .
CA 02229938 1998-02-19
W O 97/07404 PCT~US96/13715
Preferably the Sox-4 or TSEP-1 gene is introduced into an
animal or an ancestor of the animal at an embryonic stage,
preferably at the one cell stage and generally not later
than about the eight cell stage. There are several means
by which transgenic animals carrying a Sox-4 or TSEP-1
gene can be made. One method involves the use of
retroviruses carrying all or part of the cell sequence.
The retroviruses containing the transgene are introduced
into the embryonic ~n; m~l by transfection. Another method
involves directly injecting the transgene into the embryo.
Yet another method employs the embryonic stem cell method
or homologous recombination method known to workers in the
field. Examples of ~n~ m~l S into which the transgene can
be introduced include, but is not limited to, primates,
mice, rats or other rodents. Such transgenic animals may
be useful as biological models for the study of
autoimmunity, transplantation rejection or cancer and to
evaluate diagnostic or therapeutic methods for
autoimmunity, cancer or transplantation rejection.
This invention further comprises an antibody or
antibodies reactive with either the Sox-4 or TSEP-1 the
protein or peptides having the amino acid sequence defined
in Figures 20 and 38 or a unique portion thereof. In this
embodiment of the invention the antibodies are monoclonal
or polyclonal in origin. Sox-4 or TSEP-1 protein or
peptides used to generate the antibodies may be from
natural or recombinant sources or generated by chemical
synthesis. Natural Sox-4 or TSEP-1 proteins can be
isolated from m~mm~l ian biological samples such as rat
thyroid. The natural proteins may be isolated by the same
methods described above for recombinant proteins.
Recombinant Sox-4 or TSEP-1 proteins or peptides may be
produced and purified by conventional methods. Synthetic
Sox-4 or TSEP-1 peptides may be custom ordered or
commercially made based on the predicted amino acid
sequences of the respective proteins provided the present
CA 02229938 l998-02-l9
WO ~ 74~4 PCT~US96/137~5
- 74-
invention or synthesized by methods known to one skilled
in the art (Merrifield, R.B. (1963) J. Amer. Soc.
85:2149). If the peptide is too short to be antigenic, it
may be conjugated to a carrier molecule to enhance the
antigenicity of the peptide. Examples of carrier
S molecules, include, but are not limited to, human albumin,
bovine albumin and keyhole limpet hemo-cyanin ("Basic and
Clinical Immunology" (1991) Stites, D.P. and Terr A.I.
(eds) Appleton and Lange, Norwalk Connecticut, San Mateo,
California).
Exemplary antibody molecules for use in the
detection me~thods of the present invention are intact
immunoglobulin molecules, substantially intact
immunoglobulin molecules or those portion~ of an
immunoglobulin molecule that contain the antigen binding
site, including those portions of immunoglobulin molecules
known in the art as F(ab), F(ab'); F(ab )2 and F(v).
Polyclonal or monoclonal antibodies may be produced by
methods known in the art. (Kohler and Milstein (1975)
Nature 256, 495-497; Campbell "Monoclonal Antibody
Technology, the Production and Characterization of Rodent
and Human Hybridomas" in Burdon et al. (eds.) (1985)
"Laboratory Techniques in Biochemistry and Molecular
Biology," Volume 13, Elsevier Science Publishers,
Amsterdam). The antibodies or antigen binding fragments
may also be produced by genetic engineering. The
technology for expression of both heavy and light chain
genes in E. coli is the subject of the PCT patent
applications: publication number WO 901443, WO 901443 and
WO 9014424 and in Huse et al. (1989) Science 246:1275-
1281.
The antibodies of this invention may react withnative or denatured Sox-4 or TSEP-1 protein or peptides or
analogs thereof. The specific immunoassay in which the
antibodies are to be used will dictate which antibodies
are desirable. Antibodies may be raised against the
CA 02229938 1998-02-19
WO 97/07404 PCTrUS96/13715
either the Sox-4 or TSEP-1 protein or portions thereof or
against synthetic peptides homologous to either the Sox-4
or TSEP-1 amino acid sequence.
In one embodiment the antibodies of this
invention are used in immunoassays to detect either Sox-4
S or TSEP-1 proteins in biological samples. In this method
the antibodies of the present invention are contacted with
a biological sample and the ~ormation of a complex between
either the TSEP-1 or Sox-4 protein and antibody is
detected. Imml~no~Rsays of the present invention may be
radioimmunoassay, Western blot assay, ;~ml~nofluorescent
assay, enzyme immunoassay, chemiluminescent assay,
immunohistochemical assay and the like (In "Principles and
Practice of Immunoassay" (1991) Christopher P. Price and
David J. Neoman (eds), Stockton Press, New York, New York;
Ausubel et al. (eds) (1987) in "Current Protocols in
Molecular Biology" John Wiley and Sons, New York, New
York). St~n~rd techniques known in the art for ELISA are
described in Methods in Immunodiaqnosis, 2nd Edition, Rose
and Bigazzi, eds., John Wiley and Sons, New York 1980 and
Campbell et al., Methods of Immunoloqy, W.A. Benjamin,
Inc., 1964, both of which are incorporated herein by
reference.
The MHC Class I suppressing drugs which are
administered according to this invention may be
administered as a sterile pharmaceutical composition
further comprising a biologically acceptable carrier
including, but not limited to, saline, buffer, dextrose,
ethanol and water.
The MHC Class I suppressing drugs which are
administered may be administered alone or in combination
with other drugs, hormones, or antibodies. Examples of
drugs include, but are not limited to, MHC Class I
suppressing drugs, ;mm~nosuppressive drugs, cytotoxic
drugs and anti-inflammatory drugs. Examples of hormones
include, but are not limited to, corticosteroids, steroids
CA 02229938 1998-02-19
W O 97~74U4 PCTnUS96rl37IS
- 76-
and steroid derivative~, estrogens, androgens, growth
factors such as insulin-like growth Factor I, glycoprotein
hormones, cytokines and lymphokines. Examples of
antibodies include, but are not limited to, antibodies
directed against MHC Class I antigens, antibodies directed
S against MHC Class II antigens and antibodies against
infectious antigens.
Means of administering the MHC Class I
suppressi~g drugs include, but are not limited to, oral,
sublingual, intravenous, intraperitoneal, percutaneous,
intranasal, intrathecal, subcutaneous, intracutaneous, or
enteral. Local administration to the afflicted site may
be accomplished through means known in the art, including,
but not limited to, topical application, injection,
infusion and implantation of a porous device in which the
MHC Class I suppressing drugs are contained.
A preferred means of administering the MHC Class
I suppressing drugs in the treatment of autoimmune
diseases and transplantation rejection is oral. A
preferred means of pretreating tissues to be transplanted
is by perfusion in vitro with an aqueous solution.
All books, articles, or patents referenced
herein are incorporated by reference. The following
examples illustrate various aspects of the invention but
are no way intended to limit the scope thereof.
Exam~le 1
Lack of Induction of Experimental
5LE in MHC-Class I-Deficient Mice
Induction of Experimental SLE in Mice
Systemic lupus erythematosus (SLE) is an
autoimmune disease characterized by the presence of an
array of autoantibodies, among these are anti-DNA, anti-
nuclear antigen, and anti-RNP antibodies (Talal, N. et al.
(1977) Autoimmunity: Genetic, Immunology Virology and
Clinical Aspects; Academic Press, NY). Progression of the
disease in humans is correlated with leukopenia,
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
proteinuria, and immune complex deposits in the kidney and
other organs. An experimental model of SLE can be induced
in mice by ;mmlln;zation with a human monoclonal anti-DNA
antibody expressing a common idiotype, designated 16/6Id.
Following a single immunization and subsequent boost with
S the 16/6Id, mice produce antibodies to the 16/6Id, to DNA,
and to nuclear antigens. After a period of 4-6 months,
the ;mmlln;zed mice develop leukopenia and proteinuria, and
immune complexes are observed in their kidneys (Mendlovic,
S. et al, (1988) Proc. Natl. Acad. Sci. U.S.A., 85:2260-
2264). This experimental model closely parallels the
human disease with respect to the production of
autoantibodies and to its clinical manifestations.
Several other laboratories have used these antibodies to
induce SLE in mice. The immunological basis ~or disease
induction in 16/6Id-;mm~ln;zed mice is not known. Mice
lacking cell-surface MHC class I molecules have been
generated by inactivating the gene for ~2 microglobulin,
which is required for the proper assembly and cell surface
expression of the class I molecule (Zijlstra, M. et al.,
(1990) Nature, 344:742-746; Koller, B. et al., (1990)
5cience, 248:1227-1230; mice were provided by B. Koller).
These Class I-deficient mice also fail to develop the CD4-
CD8+ T cell subset. Class I-deficient mice generally are
healthy and capable of generating antibody responses and
surviving various viral infections; however, they are
more sensitive to intracellular parasites than their
normal littermates. To determine whether class I
molecules play any role in the induction or propagation of
experimental SLE, class I-de~icient mice were tested for
their ability to develop this disease.
Mice (groups of 4-6; strain 129-class I
deficient) were immunized intradermally into the hind
footpads with 1 ug of affinity purified human monoclonal
16/6Id in complete Freund's adjuvant (CFA; Difco, Detroit,
MI) and boosted 3 weeks later with l ug of 16/6Id in
CA 02229938 1998-02-l9
W O 97~7404 PCTAUS96/13715
- 78-
phosphate-buffered saline (PBS) (Mendlovic, S. et al,
(1988) Proc. Natl. Acad. Sci. U.S.A., 85:2260-2264).
Immunization of strain 129-Class I-deficient mice with
; chicken ovalbumin (Grade v. sigma Chem. Co. St. Louis, MO)
was at 20ug and followed the same regimen as 16/6Id.
Analysi s of An ti -1 6/6Id and An ti -DNA
Antibodies In Cla~3~ I-Deficient Anim~ 7B
In Class I+ control strain 129 mice (Jackson
Labs, Bar ~arbor, Maine), anti-16/6Id and anti-DNA
responses were detected in the sera by ELISA. ELISAs were
performed using 16/6Id and anti-16/6Id as described
(Mendlovic, S. et al., (1988), Proc. Natl. Acad. Sci.
(USA) 85:2260-2264; Heineman, W.R. et al (1987) Methods
Of Biochemical Analysis 32:345-393). Anti-16/6Id and
anti-DNA responses were detected within 10 days post-boost
and persisted for at least 6 months; results are shown
from animals 10 weeks after the boost (Figure lA and lB).
Sera from 16/6Id-;mmlln;zed animals did not contain
significant anti-human ;mmllnoglobulin reactivity. Class
I-deficient mice ;mmlln;zed with the 16/6Id developed anti-
16/6Id antibodies at the same time as, and with titers not
significantly different from, the control strain 129 mice
(Figure lA). In contrast, sera of the Class I-deficient
mice did not contain significant anti-DNA antibody (Figure
lB); no significant anti-DNA response was detected in the
class I-deficient animals for up to at least 6 months.
During this time, anti-16/6Id titers remained high in the
sera of both class I-deficient and control strain 129
animals. Furthermore, anti-nuclear antigen antibodies
were not detected in sera of class I-deficient ~nlm~l S,
; 30 but were found in sera of 16/6Id-immunized strain 129
animals. (Figure lC). The class I-deficient mice were
not generally poor responders to antigen, as immunization
with ovalbumin elicited an antibody response not markedly
different from that of normal mice (Figure lD).
CA 02229938 1998-02-19
WO 97/07404 PCTAUS96/1371S
It has previously been reported that C57BL/6
mice are non-responders to the 16/6Id (Mendlovic, S. et
al., (1990) Immunoloqy, 69:228-236). Since the C57BL/6
mice failed to generate anti-16/6Id antibodies, this non-
response is distinct from that of the class I-deficient
S mice which made anti-16/6Id antibodies, but no anti-DNA or
anti-nuclear antigen antibodies. Furthermore, C57B~/6 X
Class I-deficient F1 mice responded normally to the
16/6Id.
Respon~~e of Class I-Deficient Anim~7s to
0 Tmm77nization With Monoclonal Anti- 16/6Id Antibody
The development of anti-DNA antibodies in normal
mice immunized with 16/6Id is correlated with the
generation of anti-anti-16/6Id antibodies (Mendlovic, S.
et al., (1988) Proc. Natl. Acad. Sci. U.S.A. 85:718-730);
immunization with anti-16/6Id triggers antibodies to DNA
and nuclear extract, and experimental SLE (Mendlovic, S.,
et al., (1989) Eur. J. Immunol, 19:2260-2264). The
failure of Class I-deficient mice to develop anti-DNA
antibodies in response to immunization with 16/6Id raised
the possibility that they do not respond to anti-16/6Id.
This possibility was assessed by immunizing class I-
deficient mice with murine monoclonal anti-16/6Id.
Mice (groups of 6) were ;mml~nlzed in the hind
foot pads with 20 ~g of monoclonal, anti-16/6Id lA3-2
(Mendlovic, S. et al., (1989) Eur. J. Immunol, 19:729-734)
in CFA and boosted 3 weeks later with the same amount of
monoclonal antibody in PBS. Mice injected with a control
anti-Id antibody (Mendlovic, S. et al. (1989) Eur. J.
Immunol 19:729-734) did not develop a response. Although
the control strain 129 mice all responded to the anti-16/6
idiotype, the class I-deficient mice did not respond at
all (Figures 2A-2D). Thus, class I-deficient mice are
capable of responding to ovalbumin and 16/6Id, but they t
are defective in their response to anti-16/6Id antibody
(Figures lA-lD and 2A-2D).
CA 02229938 1998-02-19
W O 97/07404 PCTfiUS96~1371
- 80-
Analysis of Leukopenia, Proteinuria and
Immune Complex Disease in Normal and
Class I-Deficient Mice Tmm7~nized with 16/6Id
Immunization of control 129 mice with 16/6Id not
only elicited an extended antibody response, but also
induces leukopenia, proteinuria, and immune complex
disease in the kidney (Table 1, Fig. 3A). Since Class I-
deficient mice did not mount the full range of antibody
responses following 16/6Id lmmlln;zation, their
susceptibility to these clinical manifestations of disease
was monitored. Whole blood was collected from the tail
vein of the mice into heparin diluted 1:10 in PBS,
followed by a 1:10 dilution in 1~ acetic acid in distilled
water to lyse the red blood cells. Leukocytes were then
microscopically counted in a hemocytometer using
conventional methods. Protein levels in urine were
measured by conventional colormetric assays on Ames 2855
Uristix (Miles, Inc.). None of the Class I-deficient mice
showed any evidence of either leukopenia or proteinuria
(Table I). Assessment of immune complex disease in the
kidney of control and Class I-deficient ~nimAls was
determined by immunohistology using frozen kidney
sections, 5 ~m thick, fixed and stained with FITC-
conjugated goat antimouse IgG as previously described
(gamma chain specific: Sigma Immunochemicals St. Louis,
M0.; Fricke H. et al. (1991) Immunoloqy, 73:42-427).
Immune complex deposits were readily detected in the
kidneys of 16/6Id-immunized control mice; no such deposits
were found in the kidneys of class I-deficient animals
(Figure 3B). Taken together, these data indicate that
class I-deficient mice do not develop experimental SLE.
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 81-
Table 1
Class I-Deficient Mice Immunized With 16/6Id
Do Not Develop Clinical Manifestations of SLE
Animals Treatment Leukoc~te Counts Proteinuria
(#/mm3) (mg/dL)
Experiment #1:
129 None 5500+250 Negative
129 16/6Id 3150+50 100
Class I- None 5500+250 Negative
deficient
Class I- 16/6Id 5530+250 Trace
deficient
Class I- Ovalbumin 5130+155 Negative
deficient
Experiment #2:
129 None 5500+3000 Negative
129 16/6Id 2680+135 30-100
Class I- None 5500+250 Negative
deficient
Class I- 16/6Id 4480+193 Negative-
deficient Trace
Class I- Ovalbumin 4033+88 Negative
deficient
Le~end to Table 1. Five or six months after
lmml~nlzation, blood was drawn from class I-deficient and
control 129 mice. Leukocyte counts were performed on each
individual animal. The results represent the mean+SEM.
The leukocyte counts of the 16/6Id immunized class I-
deficient and control 129 ~n;m~l S are significantly
different (pc0.002); those of the class I-deficient mice
immunized with 16/6Id or ovalbumin are not significantly
different (pc0.2), and fall within the normal range.
Protein in the urine was measured using an Ames 2855
Uristix (Miles, Inc.); normal mice were negative.
CA 02229938 1998-02-19
W O 97/07404 PCT~US96/13715
- 82-
Example 2
MMI as a Therapeutic Druq in SLE Mice
As described in Example 1, to induce
c experimental SLE, Balb/c mice were immunized intradermally
with human monoclonal anti-DNA antibody, 16/6Id, in
5 complete Freund's adjuvant and boosted 3 weeks later with
16/6 Id in saline. Anti-16/6Id antibodies could be
detected in all mice within two weeks of the boost (Figure
4A). After two weeks, mice were treated with a
subcutaneous injection of MMI in pellet form, which
10 results in a 30 day release of the drug. The pellet in
these experiments contained 15 mg MMI (O.5 mg released per
day; Innovative Research of America, Toledo, Ohio).
Treatment was repeated 30 days later. Several groups of
16/6Id ;mmlln;zed mice were evaluated: mice treated with
15 MMI alone, with MMI plus thyroxine (1.5 mg/pellet, 30 day
release, Innovative Research of America, Toledo, Ohio) to
prevent hypothyroidism, or with a MMI placebo (Innovative
Research of America, Toledo, Ohio). In addition, normal
mice that had not been imml~n;zed with 16/6Id were treated
20 with an identical drug regimen. Mice were bled at regular
intervals and monitored by various parameters. Serum was
assayed for the presence of anti-16/6Id antibodies and
anti-DNA antibodies by ELISA, as described in Example 1.
Peripheral blood cells were counted and analyzed for
expression of various cell surface markers, including MHC
class I and class II, by flow cytometry using labelled
specific antibodies which are commercially available. In
addition, protein in the urine was measured as described
in Example 1. Finally, after 6 months, mice were
sacrificed and kidneys analyzed for immune complex
deposits. Immunohistology was performed as described in
Example 1.
.
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 83-
Effect of MMI on the fo~nation
of anti-16/6Id and anti-DNA Antibodies
Within two weeks of the 16/6Id boost, both anti-
16/6Id and anti-DNA antibodies were detected in all of the
immunized mice (Figures 4A-4B). In untreated, control
S mice, the anti-16/6Id antibody titers increased for 4-8
weeks post boost and the anti-DNA antibody titers
increased for four weeks post boost; both persisted for
the durati~n of the experiment. MMI treatment of 16/6Id
;mmllntzed mice resulted in a small but reproducible
decrease in the level of anti-16/6Id antibody titre over
the 4 month post treatment period (Table II-A, Figure 4C).
Anti-DNA antibody titers were markedly lower in MMI-
treated than untreated 16/6Id immunized ~nim~l S (Table II-
B; Figure 4D). Treatment with thyroxine (T4), together
with MMI, partially reversed the decrease in anti-16/6Id
antibody titers (Table II; Figure 4C) but did not
significantly affect anti-DNA antibody titers (Table 2;
Figure 4D). Placebo alone caused a modest inhibition in
antibody titers, but never as much as that of MMI. Taken
together, these data demonstrate that MMI treatment caused
a decreased generation of anti-DNA antibodies.
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 84 -
O m
ID
~ 3 ~ ~
oIn CD O O
~ ~ ~ . .
o o , o o
m
~D
~D
o ~ o o
~ ~ ~ . .
,~ o o , o o
.
m
a) 0 ~
3 o ~ o 0 o o o m
a~ ~ o ~ o o o o
ID
3 o 0 ~ ~ ~D
H ~ ~1 0 0 0 1 1 1 ---I
a)
a ~D
a m
~ ~D ~D
~D ~ ~ ~
~ 3 o ~ ~ 0 o o o
O ~ ~ o o o o o o D
.~ ~I
a
~ m
~ 3
~ ~ ~1 o o , o o , ~
-rl X
.11 ~T
~: o ~ 0 o o
~ ~ . . . -,
~ o ~ o o ,o ~ ' a-
.. ~
7 ~ ~ ~ 0 0 ~S
H H H E~ H a E~ a ~
+ U~ C~ +
k ~~ H ~ H ~ l~ H
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 85 -
Om
a)
o o o o
~ ~ .
.,~ o o , o
.~
~ ,.
S
o.,~ o
~ ~ ~ .
o o , o o
.
m
3 o ~ ~ ~ o .~ .~ m
~,
o o o o o o
m
Q
3 o .
H~ ~ ~ ~ ~
~ _
a ~ ~ ~ ~ 0
., 3 o .~ .~ ~ o o o
~r .~ o o o o o o 1)
C
~ 3 o ~ ~ o ~ C
~ ~ .~ o o , o o , ~-
I
, o .
o .~ ~ ~ I o ~ ' ~U
a
+ + o o
H H H E~ H a E~ a ~,
~D ~ ~ + ~D ~ +
~ ~ H H 1~ H H 11
CA 02229938 1998-02-19
WO 97/07404 P~AUS96~13715
- 86-
Effect of MMI on the development
of leukopenia and proteinuria
A characteristic feature of this SLE model, is
that mice treated with the 16/6Id antibody develop
leukopenia as a function of time and as one of the
clinical manifestations of the developing disease.
tFigure 5). Mice ;mml~n;zed with 16/6Id and treated with
MMI did not develop leukopenia (Figure 5). The effect of
MMI was not prevented by simultaneous treatment with
thyroxine (Figure 5) nor was it duplicated by placebo
treatment. The protective effect of MMI persisted at
least 4 months after MMI treatment was discontinued.
Furthermore, proteinuria, which is a clinical
manifestation in 16/6Id ;mml~nized mice, was prevented by
MMI treatment.
Effect of MMI on the development
of immune complexes in the kidney
After 4-6 months, mice immunized with 16/6Id
developed immune complex deposits in the kidney which are
associated with death due to renal failure (Figure 6,
left). Kidneys were isolated from mice five months after
MMI treatment ended, frozen and stained as described in
Example 1. The pattern of immune complexes observed in
the kidneys of 16/6Id ;mmlln;zed animals was similar to
that in human kidneys derived from SLE patients (Figure
6A). MMI treatment of 16/6Id ;mml~n;zed mice markedly
reduced the development of kidney lesions (Figure 6B).
The effect of MMI is not prevented by simultaneous
treatment with thyroxine nor was it duplicated by placebo
treatment. The effect is evident for at least five months
after MMI treatment.
Effect of MMI on lymphocyte populations during
the course of the experimental disea~e
Y Although MMI has been used extensively in the
treatment of autoimmune thyroid disease, its effect on
various lymphocyte populations and cell surface expression
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
of MXC antigens has not been assessed previously. Since
MMI has been shown to repress MHC class I transcription in
vitro (Saji et al., 1992b) and because of its ability to
mitigate the onset of experimental SLE, its effect on
lymphocytes in vivo was evaluated.
According to the method described in Ehrlich, R.
et al. (1989) Immunoqenetics 30:18-26, peripheral blood
lymphocytes (PBL) from 16/6Id-;mmlln;zed mice, either MMI
treated or not, were analyzed by flow cytometry for the
proportion of T cells and B cells after MMI treatment . T
cells were identified by their expression of the cell
surface marker, Thyl, and B cells by their expression of
B220 or MHC class II as detected by specific antibodies to
these markers. Antibodies against these MHC Class I and
MHC Class II surface markers, as well as others, are
commercially available (Pharmingen, Boehringer - M~nnh~im;
Erlich, R. et al. (1989) Immunoqenetics 30:18-26). PBL
from 16/6Id immunized mice consistently contained 15-20~ B
cells and 25-30~ T cells (Figure 7A). The rem~;n~er being
neither B cells nor T cells and are termed null cells
(Figure 7A). This distribution did not vary markedly over
the course of 6 months. Whereas MMI treatment had little
or no effect on the proportion of T cells, it markedly
reduced the fraction of B cells in the PBL (Figure 7A).
There was a concomitant increase in the fraction of
unstained cells. These changes in cell populations were
most marked immediately after MMI treatment, but persisted
for up to 2 months after MMI treatment had been
discontinued. Thyroxine treatment, in conjunction with
MMI, tended to partially reverse these effects.
The levels of MHC cell surface expression of the
T and B cell populations were assessed by two-color flow
cytometry (Ehrlich, R. et al. (1989)). PBL from 16/6Id
treated ~n;m~1s did not express levels of MHC class I or
class II significantly differently from non-immunized
controls. MMI treatment resulted in a decrease in MHC
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 88-
class I expression on the surfaces of both T cells and B
cells (Figures 7B, 7C). In addition, MHC class II levels
on B cells were also reduced (Figure 7D). These effects
were most pronounced at early times after the 16/6Id boost
and within one week after MMI treatment. As assessed by
flow cytometry ~Ehrlich, R. et al. (1989)), other cell
surface markers were not affected by MMI.
Example 3
. MMI as a Therapeutic Drug in NZB Mice
NZBxNZWF1 mice (Jackson Labs, Bar Harbor, Maine)
spontaneously develop SLE (Steinberg, A.D. et al. (1990)
Immunoloqical Reviews 118:129-163; "Cellular and Molecular
Immunology" (eds.) Abbas, Lichtman and Ruber (1992), page
360). These mice also spontaneously develop kidney
lesions and produce anti-DNA autoantibodies.
NZBxNZWFI mice at six weeks of age, at which
time there are no SLE symptoms, were started on MMI
therapy. One 30 day MMI pellet (15 mg MMI) was injected
subcutaneously every month as described in Example 1.
Anti DNA antibodies in the serum were titered by ELISA
monthly, as described in Example 1 and Example 2. As
shown in Figure 8, MMI markedly decreased the anti-DNA
titer after two months in this spontaneous disease model
as in the 16/6Id model (Examples 1 and 2; Figs. lA-lD, 2A-
2D and 4A-4D). The effect of MMI on anti-DNA antibodies~5 was even more pronounced three months after treatment.
Exam~le 4
MMI as a Treatment for SLE in Humans
For treating humans suffering from SLE MMI is
administered orally. Initially in a dose of up to 100 mg
per day. This can be followed by a step-wise program, to
50 mg for up to 20 days, 40 mg for up to 20 days, 35 mg
for up to 30 to 60 days, decreasing progressively to 5 mg
- 30 mg per day. A maintenance dose of 5 mg - 10 mg per
day for up to 1 year or longer can also be used. TSH
levels can be monitored to assess the therapeutic levels
CA 02229938 1998-02-19
W O 97/07404 PCT~US96/13715
- 89-
of MMI required for the SLE patient. When TSH levels
increase significantly above the normal range, MMI dosage
can be decreased to the next dose level. Alternatively,
thyroid hormone levels can be used to determine dosage
changes of MMI. A significant decrease from the normal
range can be used as an indication to lower dosage. Since
patients can be treated with thyroid hormone (T4 or T3)
plus MMI to maintain a euthyroid state, the TSH level is a
better index. The same parameters may be assessed in
children.
Patients can be monitored for alleviation of
clinical signs and symptoms of active disease.
Specifically monitored parameters can include,
autoantibodies, particularly DNA antibodies, PBL cell
surface markers, leukopenia, proteinuria,
hyperimmunoglobulinemia and levels of immune complexes in
the kidney by punch biopsy.
Exam~le 5
In Vitro Treatment Of FRTL-5 With Meth; m~ ~ole
For Transplantation Into Wistar Rats or Balb/c Mice
Rat FRTL-5 (American Type Culture Collection,
Rockville, MD; CRL 8305; US 4,609,622; US 4,608, 341)
cells were grown to near confluency in complete 6H medium
and then exposed, or not, to methimazole, 5 mM, for 72
hours in the presence of the normal complete 6H medium
(Saji et al. (1992b). Cells from 4 plates were then
harvested by trypsinization as per cell transfer,
scraping, or with cold HBSS (Hanks Balanced Saline
Solution) plus EDTA, 2mM. Cells were centrifuged as for
splitting cells, resuspended in complete medium,
recentrifuged and suspended in 0.1 to 0.2 ml medium.
Cells were then injected subcutaneously, in the lower
back, into normal Balb/c mice (NIH; Jackson Labs, Bar
Harbor, Maine) or Wistar rats (NIH; Jackson Labs, Bar r
Harbor, Maine). Sixty days later, cells from the site of
injection were isolated by surgical excision of the entire
CA 02229938 1998-02-19
WO g7~07404 P ~ ~US96~13715
-- 90--
implantation site and exposed to a mixture of collagenase
trypsin, and chicken serum (CTC; Kohn, L.D. et al. U.S.
Patent No. 4,609,622 Ambesi-Impiombato U.S. Patent No.
- 4,608,341; Kohn, L.D. and W.A. Valente, FRTL-5 Today,
(eds) F.S. Ambesi-Impiombato and H. Perrild (1989):244-
273)) to isolate individual cells, then plated in Petri
dishes in normal 6H medium. Thyroid cell presence was
evaluated microscopically; however, in all cases cells
were cultured to confluency, subcultured in 24 well plates
in 6H medium, then maintained 5 days without TSH before
measuring TSH-induced iodide uptake or TSH-induced cAMP
levels (Kohn et al., U.S. Patent No. 4,604,622). The
increase induced by TSH was compared to control cells not
treated with TSH. Thyroid cells (FRTL-5) were found only
in cultures from the site o~ injection in which cells were
pretreated with MMI (Table III). The cultures containing
these thyroid cells also exhibited TSH-increased cAMP
levels and TSH increased iodide uptake (Table III). In
contrast, cultures from the site o~ injection in which the
FRTL-5 cells had not been pretreated with MMI contained
only fibroblast cells (Table III). In addition, no TSH
increased cAMP levels or TSH increased iodide update were
observed. These results show that pretreatment of FRTL-5
cells with MMI prevents rejection after transplantation.
Simultaneously cultured FRTL-5 cells were positive
controls. Four animals were in each group. The
experiment was repeated with similar results.
~ 30
~.
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
TABLE III
No MMI Plus 5n~M M MI
Balb/c mice
Mi~v3~y Fi~ l~L~o~y Thyroid cells plus fibrobl~ts
S TSH iui~ d cAMP No Yes (8 t 3 fold)
TSH ill.,lC~ iodide No Yes (5 + 1.5 fold)
uptake
Wistar rats
Mi~l~s~ Fi~l~bl~t~o~y Thyroid cells plus rl~lo~
TSH h~ d cAMP No Yes (10 ~ 3 fold)
TSH ihl~l~3~ iodide No Yes (6 ~ 1 fold)
uptake
In a second experiment, two animals each were
given cells which had been treated with 0.2~ serum and 3H
(no insulin, hydrocortisone, TSH) for 6 days plus or minus
MMI for 72 hours. As evaluated by microscopy no animal
had thyroid cells after 60 days and none had a TSH
response in either assay. This would be expected since
MMI action appears to require serum and since class I is
maximally expressed under these conditions, in vitro, in
the absence of serum, insulin, hydrocortisone and TSH
(Saji et al. (1992(b)).
In a third experiment, FRT rat thyroid cells, a
line of cells with no TSH receptor mRNA and no thyroid
function (Ambesi-Impiombato F.S., Coon H.G. (1979) Int Rev
Cytol SU~P1. 10:163-171; Akamizu T, et al., (1990) Proc.
Natl. Acad. Sci. USA, 87:5677-5681), were permanently
transfected with human TSHR cDNA using a neomycin
selection procedure (Van Sande J. et al., (1990) Mol.
Cell. Endocrinol, 74:Rl-R6). The transfected FRT thyroid
cells were treated with, as were the FRTL-5 cells, 5 mM
MMI for 72 hours and transplanted into the backs of Balb/c
mice as described above. Sixty days later cells were
isolated and shown to have a TSH-increased cAMP response
as described above. Control cells with trans~ected TSHR
CA 02229938 1998-02-19
WO 97/07404 PCTnJS96113715
- 92-
cDNA which were not treated with MMI or control FRT cells
with no TSHR cDNA, when similarly implanted and evaluated,
did not exhibit a TSH-increased cAMP level. This
indicates that a transfected gene can survive the MMI
procedure to transplant cells.
Example 6
Assessment of the Effect of MMI on
MHC-Class I Expression bY Gel Shift Assay
.
Ma terial~~
Purified bovine TSH was from the NIH program
(NIDDK-bTSH-I-l, 30U/mg) or was prepared as described
previously (Kohn, L.D. and Winand, R.J. (1975) J. Biol.
Chem., 250:6503-6508). Insulin, hydrocortisone, human
transferrin, somatostatin, glycyl-L-histodyl-L-lysine
acetate were from (Sigma Chemical Co. St. Louis, MO).
[125I] cAMP radio;mmllnoassay kits, [a!-32P] dCTP (3000
Ci/mmol) and [32p] UTP (3000 Ci/mmol) were from Du Pont/New
England Nuclear (Boston, MA).
Cell Cul ture
FRTL-5 rat thyroid cells (Kohn LD. et al., US
Patent no. 4,609,622; Ambesi-Impiombato ES., US Patent no.
4,608,341) are grown as described. These cells do not
proliferate in the absence of TSH, yet remain viable for
prolonged periods in its absence. Their doubling time was
approximately 36 i 6 hours; and, after 6 days in medium
with no TSH (5H) and 5.0~ serum, lxlO-I~ mol/L TSH elevated
iodide uptake 8-10 fold and thymidine incorporation > 10
fold. Cells were diploid, between their 5th and 25th
~ 30 passage in most experiments, and were routinely grown in
- Coon's modified F12 medium supplemented with 5~ calf
serum, 1 mmol/L nonessential amino acids (GIBCO) and a
mixture of 6 hormones (6H medium): TSH (lX10-l~ mol/L),
insulin (10 mg/L), hydrocortisone l(nmol/L), human
transferrin (5 mg/L), somatostatin (10 ~g/L) and glycyl-L-
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 93-
histidyl-L-lysine acetate (10 ~g/L) (Kohn, L.D. et al.
U.S. Patent No. 4,609,622; Ambesi-Impiombato, E.S. U.S.
Patent No. 4,608,341). They were passaged every 7-10 days
and provided fresh media every 2 or 3 days. In individual
experiments, cells were shifted to medium with no TSH
(5H), to medium with neither TSH and or insulin (4H), or
to medium with no TSH, no insulin, and no hydrocortisone
(3H) plus either 5~ or 0.2~ serum for 4-6 days before use.
Cell extracts
Cells were grown in 6H medium with 5~ calf serum
medium for 6-7 days to 70-80~ confluence, then shifted to
5H medium with 5~ calf serum for 5 days. TSH (lxlO-10 M)
and/or MMI (5mM) were added as appropriate for 40-44
hours. Cells were then harvested and extracts were made
by a modification of a method of Dignam, J. et al. (1983)
Methods in EnzYmoloqY, 101:582-598. In brief, cells were
harvested by scraping after being washed twice with cold
phosphate-buffer saline (PBS). Subsequently they were
pelleted, washed in cold PBS and then pelleted again. The
pellet was resuspended in Dignam buffer C (20 mM Hepes
buffer at pH 7.9, 1.5 mM MgCl2, 0.42 M NaCl, 25~ glycerol,
0.5mM dithiotreitol, 0.5 mM phenylmethylsulfonylfluoride,
1 ~g/ml leupeptin, 1 ~g/ml pepstatin). The final NaCl
concentration was adjusted on the basis of cell pellet
volume to 0.42 M and cells were lysed by repeated cycles
of freezing and thawing. Extracts were then centrifuged
at 10,000 xg at 4~C for 20 min. The supernatant was
recovered, aliquoted and stored at -70~C.
Gel Mobili ty Shif t Assay
Binding reactions were performed in a volume of
20 ~1 for 30 min at room temperature. The typical
reaction mixture contains 1.5 fmol of 32p DNA, 3 ~g of cell
extracts, 3~g of poly (dI-dC) in 10 mM Tris-Cl (pH 7.9), 1
mM MgCl2, 1 mM dithiothreitol, 1 mM EDTA, and 5~ glycerol.
Unlabeled competitor (a 100- to 1000-fold excess of
double-stranded oligonucleotides or 200-fold excess of PD1
CA 02229938 1998-02-19
W O 97/07404 P~AUS96/1371
- 94-
promoter ~ragments) was added to the appropriate control
binding reactions 20 min before the 32p to insure
speci~icity. After incubation, reaction mixtures were
- subjected to electrophoresis in 4~ polyacrylamide gels for
90-120 min at 160 V in 0.5x TBE (Sambrook, J., et al.,
(1989) then dried and autoradiographed. Probes were
labeled by Klenow enzyme (In Vitro labeling kit,
Amersham), following manufacturer instructions, and then
purified through G-50 columns ~5 Prime~3 Prime).
Positive and negative regulatory (enhancer or
silencer regions, respectively) elements have been
identified in the promoter of the swine MHC class I gene,
PD1 (Singer and Maguire (1990)). The activity of these
enhancers and silencer regions is mediated by trans-acting
factors (Singer and Maguire (1990) Cirt. Rev. Immunol.
10:235-257). Two regulatory domains have been identified
in the 5' flanking region of the PD1 gene. One regulatory
domain is between approximately -1 and -300 bp from the
transcriptional start site. This region contains an
interferon response element and a major enhancer, as well
a site homologous to a cyclic AMP response element (CRE)
element. Studies using gel mobility shift assays have
demonstrated that TSH/CAMP-induced or modified proteins
interact with this region and can regulate transcription
initiation (Saji et al. (1992a)). Another complex
regulatory region, showing overlapping silencer and
enhancer activity, has been mapped between -690 and -769
base pairs upstream of the promoter (Weissman, J.D. and
Singer, D.S. (1991) Mol. Cell. Biol. 11:4217-4227). The
enhancer and silencer elements are linked to tissue
specific expression and tissue specific levels of the
Class I gene (Weissman, J.D. and Singer, D.S. (1991)).
The Saji et al (1992b) study showed reduced
- expression of MHC Class I gene in rat FRTL-5 cells treated
with MMI. This study also showed that the effect of MMI
in MHC Class I expression was at the level of
CA 02229938 1998-02-19
W O 97/07404 - PCTrUS96/13715
- 95 -
transcription. The FRTh-5 thyroid cell ~ystem is
therefore a good system to identify the regulatory DNA
sequence elements and trans-acting factors involved in the
MMI effect. PD1 Gel shift mobility assays were per~ormed
using the 5' flanking region of the PDl gene and cell
extracts from FRTL-5 cells treated with MMI, TSH and MMI
plus TSH.
Figures 9A-9B shows the sequence of the PD1
promoter with the 151 (bases 54 to 220 of SBQ ID NO:1),
114 (bases 221 to 320 of SEQ ID NO:1), 140 (bases 321 to
455 of SEQ ID NO:1) and 238 (bases 456 to 692 of SEQ ID
NO:1) regions of the 5' portion of the PD1 promoter (SEQ
ID N0:1) designated as indicated (Weismann, J.D. and
Singer, D.S. (1991)). Figure 10 shows the silencer and
enhancer regions of the 140 region (SEQ ID NO:2) with
oligonucleotides used to map the region for the activity
of the gel shifts. The silencer region of relevance is
noted by the opposite arrows separated by a TTF-2 like,
insulin-sensitive element. Figure 11 shows the alignment
of the 114 (SEQ ID NO:36), 140 (SEQ ID N0:37), and the 105
(SEQ ID NO:35) region of the 238 region of the PDl
promoter to show sequence homology. The silencer region
is indicated by arrows separated by TTF-2 like region.
These fragments were derived from the PD1 promoter of the
PDI Class I MHC gene (Singer D.S. et al. (1982) Proc.
Natl. Acad. Sci. USA, 79:1403-1407).
Figures 12A-12D show gel shifts using the
radiolabelled 140 (bases 321 to 455 of SEQ ID NO:1)
(Figures 12A and 12D), 114 (bases 221 to 320 of SEQ ID
NO:1) (Figure 12B) and 151 (bases 54 to 220 of SEQ ID
N0:1) (Figure 12C) fragments noted in Figure 9. The
complex affected by MMI is denoted A. In Figure 12A, 12B
and 12C, lane 4 shows the complex formed between the
silencer region (see Figure 10 and below) and cell
extracts from FRTL-5 rat thyroid cells maintained in the
presence of 5H medium (no TSH) plus 5~ serum. The effect
SUBS 111 UTE SHEET (RULE 26)
CA 02229938 1998-02-19
W 097~7404 PCTAUS961I37IS
- 96-
of the addition o~ 5 mM MMI for 24 hours prior to extract
preparation from cells maintained in 5H medium is shown in
lane 5 of Figures 12 A-D. The effect of the addition of
lxlO-I~ TSH for 24 hours prior to extract preparation from
cells maintained in 5H medium is shown in lane 6 in
S Figures 12 A-C. The effect of the addition of 5 mM MMI
plus lxlO-I~ TSH for 24 hours prior to extract preparation
from cells maintained in 5H medium is noted in lane 7 in
Figure 12A and 12B. The effect of the addition of lxlO-I~M
TSH for 7 days before extracts were prepared (6H, MMI-) is
noted in lane 3 in Figure 12A-C. The effect of the
addition of lxlO-I~M TSH plus 5mM MMI for 24 hours before
extracts were prepared (6H, MM1+) is noted in lane 2 in
each case. Lane 1 in Figures 12 A-C contains the
radiolabelled probe alone. The ability of 200-fold excess
concentration of unlabeled 151 fragment (bases 54 to 220
of SEQ ID NO:1) to compete A complex formation with the
151 radiolabelled fragment (bases 54 to 220 of SEQ ID
NO:1) is shown in lane c, Figure 12C. Competition to
inhibit MMI-sensitive A complex formation by 200-fold
higher concentrations of unlabeled 105 (bases 588 to 692
of SEQ ID NO:1) (lane a, Figure 12C), 140 (bases 321 to
455 of SEQ ID NO:1) (lane b, Figure 12C) and 114 (bases
221 to 320 of SEQ ID NO:1) (lane d, Figure 12D) are noted
showing that the A complex formed with each complex is the
same. In panel D, lane e shows the basal A complex formed
between the silencer region (see Figure 10 and below) and
cell extracts from FRTh-5 rat thyroid cells maintained in
the presence of a 3H medium plus 0.2~ calf serum. In
contrast to cells maintained in the 5H plus 5~ serum case
(Figure 12(A)), MMI (lane f), TSH (lane g) or both
together (lane h) added to cells for 24 hours does not
significantly affect A complex formation in 3H medium
- (Figure 12D). 3H medium has no insulin as well as no TSH.
The ability of 200-fold excess concentration of unlabeled
105 (bases 588 to 692 of SEQ ID NO:1) (lane i) to inhibit
CA 02229938 1998-02-19
WO 97/07404 PCTrUS96/13715
formation of the MMI-insensitive A complex in 3H medium
shows that same complex appears to be involved, but the
absence of insulin and/or serum in 3H medium prevents the
TSH and MMI inhibitory effect. The lack of A complex
formation in the absence of the 3H cell extracts is noted
in lane j.
Figure 14(A) shows gel shifts using the
radiolabelled 238 fragment (bases 456 to 692 of SEQ ID
NO:1) noted in Figure 9 and cell extracts from FRTL-5 rat
thyroid cells maintained in the presence of a 5H hormone
mixture (no TSH) plus 5~ serum (5H Basal) Lane 2). The
complex affected by MMI is denoted A; inhibition of the
formation of this complex by cellular extracts from FRTL-5
cells treated for 24 hours with 5 mM MMI plus lxlO-IqM TSH
is noted in lane 14. The 238 construct (bases 456 to 692
of SEQ ID NO:1) encompasses the 105 construct (bases 588
to 692 of SEQ ID NO:1) (see Figure 9); complex A forms
with the 105 portion (bases 588 to 692 of SEQ ID NO:l) of
the 238 (bases 456 to 692) construct as evidenced by the
ability of a 200-fold excess concentration of unlabeled
105 (bases 588 to 692 of SEQ ID NO:l) over radiolabelled
238 (bases 456 to 692 of SEQ ID NO:l) to inhibit complex A
formation (lane 3). The A complex in lane 2 is formed
between the silencer region (see Figure 10 and above) and
is the same as that formed with the 114 (bases 221 to 320
of SEQ ID NO:l), 140 (bases 321 to 455 of SEQ ID NO:l),
and 151 (bases 54 to 220 of SEQ ID NO:l) constructs (Fig.
12) as evidenced by the following. First, a 200-fold
higher concentration of unlabeled 114 (bases 221 to 320 of
SEQ ID NO:l) (lane 4) and 140 (bases 321 to 455 of SEQ ID
NO:l) (lane 5), compared to radiolabelled 238 (bases 456
to 692 of SEQ ID NO:l), inhibited A complex formation; a
200-fold higher concentration of 151 (bases 54 to 220 of
SEQ ID NO:l) was a partial inhibitor (lane 6). Second, a
1000-fold concentration of double stranded oligonucleotide
with the sequence of the silencer region (S2 (SEQ ID NO: 4)
CA 02229938 1998-02-19
WO 97/07404 PCTAUS96/13715
- 98-
in Figure 10), relative to radiolabelled 238, inhibited A
complex formation; the same concentration of double-
stranded oligonucleotide mimicking the sequence of the
enhancer element (E1 (SEQ ID NO:20) in Figure 10) had no
effect on A complex formation. Oligonucleotides with
S modifications of the silencer sequence (Sl (SEQ ID NO:3),
S3 (SEQ ID NO:10), S6 (SEQ ID NO:6), S7 (SEQ ID NO:7), and
S8 (SEQ ID NO:8) in Figure 10) were partial inhibitors at
the 1000-fold concentration (lanes 9-13). The inhibition
by Sl (SEQ ID NO:3) (lane 12) suggested that mutation of
only one of the end repeats denoted by the arrows in
Figure 10 is enough to decrease inhibition; the partial
inhibition by S8 (SEQ ID NO:8) (lane 10) suggested that
the element which resembles the sequence reactive with
TTF-2 in the thyroglobulin promoter (Santisteban, P., et
al., and Mol. Endocrinol. 6:1310-1317, 1992) and that is
between the inverted repeats (Figure 10) is also important
in formation of the A complex. This conclusion is
supported by the result in lane 7. The presence of a 1000-
fold concentration of the K oligonucleotide (SEQ ID NO:38)
which mimics the sequence of the thyroid transcription
factor-2 (TTF-2)-reactive element in the thyroglobulin
promoter (Santisteban, P. et al., Mol. Endocrinol. 6:1310-
1317, 1992) enhanced A complex formation and by the result
in lane 15 which showed that a 1000-fold higher
concentration of unlabeled oligonucleotide K (SEQ ID
NO:38) was able to reverse the MMI/TSH action. Thus,
decreased formation of the MMI-sensitive A complex
requires TTF-2 and insulin, consistent with the data in
Figure 12D. The K oligonucleotide (SEQ ID NO:38) "ties
up" insulin-induced TTF-2 which results in increased
complex formation and loss of the MMI effect, i.e. there
iB a requirement for insulin.
~ Figure 14(B) further demonstrates the importance
of TTF-2 to the MMI action and provides an additional
means to assay the MMI effect. Figure 14(B) shows gel
CA 02229938 1998-02-19
W O 97/07404 PCTfUS96/13715
_ 99_
shifts using the radiolabelled K oligonucleotide
(TGACTAGCAGAGAAAACAAAGTGA) (SEQ ID NO:38) and cell
extracts from FRTL-5 rat thyroid cells maintained in the
presence of a 5H hormone mixture (no TSH) plus 5~ serum
(5H Basal) (Lane 16). The upper FRTL-5 cell protein/DNA
S complex formed is inhibited by treating cells for 24 hours
with 5 mM MMI (lane 17), with lxlO-10 TSH (lane 18) and
with 5 mM MMI plus lxlO-I~M TSH (lane 19). The TTF-2 upper
protein/DNA complex is therefore necessary for MMI action
and important in A complex formation noted in Figure 14A.
Inhibition of its formation is a means to assay the MMI
effect and supports the insulin-dependency of MMI action.
The complexes detected below the A complex in
Figures 12 A-D and Figure 14 A-B are believed to be
enhancer complexes (uppermost bands below the A complex)
or nonspecific complex. The intense signal at the bottom
of the autoradiographs in Figures 12 A-D and Figure 14 A-B
was unbound probe.
Taken together these results suggest that
inhibition of complex formation can be used as an
indicator of MMI or other drugs to down regulate MHC
Class I transcription.
The A complex is believed to be composed of
different proteins. The different proteins are important
in determining the level of tissue specific complexes
between tissues. TSH induced the formation of a new
thyroid specific complex in the -200 to -1 region of the
PD1 promoter. This complex was also increased by 5 mm MMI
and involved a TTF-2-like transcription factor. This
complex was increased as the A complex decreases. Its
formation was associated with TATAA box activity. We
propose this thyroid specific protein/DNA complex
dominates the tissue-specific silencer/enhancer complex
(Figure 10) and decreases gene expression by decreasing
the initiation of transcription of the Class I gene.
CA 02229938 1998-02-19
W 097/~74~4 PCTAUS96/13715
- 100-
Example 7
Assessment of the Effect of MMI on
MHC Class I Expression bY CAT AssaY
- Pla~mid construction, DNA probes and ol igonucl eotides
The full length PD1 promoter, PDl CAT construct
S pH(-38), inserted into the multicloning site of pSV3CAT,
has been previously described (Erhlich, R. et al. (1989)
Immunoqenetics 30:18-26). Sequential deletion mutants of
the full l~ngth PD1 promoter, inserted into the
multicloning site of pSV3CAT, have been previously
described (Singer and Weismann (1991); Saji et al (1992a);
Saji et al. (1992b)). Briefly, a nested series of 5~
deletions of the upstream regulator region of the PD1 gene
were generated by Bal31 digestion; the series 5' termini
ranged from -1012 base pairs to -68 base pairs; all had a
common 3' boundary at +15 base pairs. The deletion series
was also cloned into the pSV3CAT reporter construct to
assess promoter activities (Singer and Weisman (1991);
Maguire, J. et al. (1992) Mol. Cell. Biol 12:3078-3086).
Figure 13 shows transfection data with
chloramphenicol acetyltransferase (CAT) chimeras showing
that MMI inhibits full length PD1 promoter activity.
Rat FRTL-5 thyroid cells were put in fresh 6H
medium containing 5~ calf serum 12 hours before
transfection by the electroporation method described
previously (Saji et al 1992 b). In brief, FRTL-5 cells
were grown to 80~ confluence, harvested, washed, and
suspended at 1.5x107 cells/ml in 0.8 ml electroporation
buffer (272 mM sucrose, 7 mM sodium phosphate at pH 7.4,
and 1 mM MgCl2). Twenty ~g of the full length CAT
construct were added with 5 ~g pSVGH. Cells were then
pulsed (330 volts, capacitance 25 ~FD), plated
(approximately 6X106 cell/dish), and cultured for 12 hours
~ in 6H medium containing 5~ calf serum medium. At that
time, cells were placed in 5H medium plus 5~ calf serum
(control), 5H medium plus 5~ calf serum plus 5 mM MMI
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 101-
(MMI+), 6H medium plU5 5~ calf serum (TSH+), or 6H medium
plus 5~ calf serum plus 5 mM MMI (MMI/TSH). After 40
hours they are harvested. Cell viability was
approximately 80~. Medium was taken for hGH
radio;mml~noassay to monitor transfection efficiency.
S (Nichols Institute, San Juan Capistrano, CA) and cells
were harvested for CAT assays which used 20-50 ~g cell
lysate in a final volume of 130 ~l. Incubation was at
37~C for 2.or 4 hours; acetylated chloramphenicol was
separated by thin layer chromatography (TLC) and positive
spots on TLC plates were cut out and quantitated in a
scintillation spectrometer. Data are expressed as the
ratio of CAT activity to GH activity. The full length PD1
promoter includes the 151 (bases 54 to 220 of SEQ ID
NO:1), 114 (bases 221 to 320 of SEQ ID NO:1), 140 (bases
321 to 455 of SEQ ID NO:1), and 238 (bases 456 to 692 of
SEQ ID NO:1) regions (Fig. 9). As shown in Figure 13
treatment with MMI ( ~ ), TSH and MMI ( ~ ) and
TSH (~ ) decrease CAT activity relative to the control
( _ ). CAT activity of the chimeric CAT constructs of
the sequential deletion mutants can also be used on CAT
assays to assay the effect of MMI on Class I promoter
activity. CAT activity is, therefore, another way to
assay the effect of MMI on class-I promoter activity and
can be used for evaluating other agents able to mimic MMI
in therapeutic actions related to treatment of autoimmune
disease or transplantation therapy.
Exam~le 8
Identification Of Transcription Factors
Which Regulate The Upstream Silencer/Enhancer
And The Effect Of MMI/TSH On These Factors
Ma teri al s and Me thods
Materials. TSH and other hormones are the same
as in Example 6. MMI and insulin were from the Sigma
Chemical Co. (St. Louis, MO); rabbit polyclonal antibodies
against the p50 and p65 subunits of NF-KB, c-fos family
CA 02229938 1998-02-19
WO 97/07404 PCTrUS96/13715
- 102-
members, and c-jun/AP1 were from Santa Cruz Biotechnology,
Inc. (Santa Cruz, CA). [~_32p] deoxy-CTP (3000 Ci/mmol) and
[l4C]chloramphenicol (50 mCi/mmol) were purchased from
DuPont-New England Nuclear (Boston, MA); [~y_32p] ATP (6000
Ci/mmol) was from Amersham (Arlington Height, IL). Calf
serum was a heat-treated, mycoplasma free product from
GIBCO Laboratories Life Technologies, Inc. (Grand Island,
NY). The source of all other materials was the Sigma
Chemical C~., unless otherwise noted.
Cell Cul ture. FRTL-5 rat thyroid cells
(Interthyr Research Foundation, Baltimore, MD; ATCC No.
CRL 8305) were a fresh subclone (F1) with all the
properties previously detailed (Example 6; Saji, M., et
al., (1992a)). Fresh medium was added every 2 or 3 days
and cells were passaged every 7-10 days. In individual
experiments, cells were shifted to medium with no TSH (5H
medium) or with no TSH, no insulin, plus 0.2~ serum (4H
medium) for 6 to 8 days; other agents were added as noted.
Pla6mid conBtructionl DNA probes and oligonucleotides.
The full length PDI promoter ch;mera encoding 1100 bp of
the 5' flanking region of the MHC class I PD1 swine
promoter, linked to a chloramphenicol acetyl-transferase
(CAT) reporter gene, has been described as have chimeras
with sequential deletion mutants of the -1100 bp class I
sequence (See Example 7); Weissman, J. D. and Singer, D.
S. (1991) Mol. Cell. Biol. 11, 4217-4227; Giuliani, C.,
et al., (1994) J. Biol. Chem. 270, 11453-11462; Ehrlich,
R., et al., (1988) Mol. Cell Biol. 8, 695-703; Maguire,
J. E., et al., (1992) Mol. Cell. Biol. 12, 3078-3086;
Howcroft, T. K., et al., (1993) EMBO J. 12, 3163-3169).
~ 30 The series 5' termini ranged from - 1100 to -89 bp; all
- had a common boundary at +15 bp. The numbering of
different chimeras is determined from +1, the start of
~ transcription, and extends to the numbered nucleotide
(Guiliani, C. et al. (1995) J. Biol. Chem. 270:1453-11462
herein incorporated by reference. The start of
CA 02229938 1998-02-19
W O 97/07404 PCT~US96/13715
- 103-
transcription is nucleotide 1091 in Figure 9. After
addition of XbaI linkers, the PD1 fragments were subcloned
into the XbAI/Hind III sites of PSV3CAT, which has a
multicloning site at the NdeI site in pSVOCAT. Other CAT
constructs were created by polymerase chain reaction using
100 pmol each of an appropriate forward primer with a
BamHI site on the 5'-end and an antisense reverse primer
of the PD1 sequence from -13 to +1 bp of the transcription
start site which had a HindIII site on the 3'-end.
Mutants of p(-127)CAT and p(-89)CAT were created by
0 two-step, recombinant PCR methods (Saiki, R. K., et al
(1988) Science 239, 487-491; Higuchi, R. (1990) In: PCR
Protocols: A Guide to Methods and Applications (Innis, M.
A., Gelfand D. H., Sninsky, J. I., and White T.J. eds)
Academic Press, Inc., San Diego, 177-183). In the first
step, two PCR products that overlap the sequence were
created, both of which contain the same mutation
introduced as part of the PCR primers. The second step
PCR was per~ormed using these overlapped PCR products as
template and DNA sequence of the 5' or 3'-end of the final
products as primer. The PCR products were inserted into
the multicloning site of pSV3CAT as above or
pCAT-enhancer-less and pCAT control vectors purchased from
Promega (Madison, WI). In the case of the pCAT vector,
the CRE-like sequence and its mutants were created with a
BamHI site on both ends of the primers. The pSV0-based
constructs containing the CAT gene downstream of different
lengths of the 5'-flanking region of the swine class I
(PD1) gene which were used herein are termed p(-1100)CAT,
p(-400)CAT, p(-294)CAT, p(-203)CAT, p(-127)CAT, and
p(-89)CAT; numbered from the nucleotide at the 5'-end to
+1 bp, the start of transcription.
DNA probes for the PD1 promoter regions used
herein were obtained as previously reported (in Example 6;
Weissman, J. D. and Singer, D. S. (1991) Mol. Cell. Biol.
3S 11, 4217-4227; Giuliani, C., et al., (1994) J. Biol. Chem.
CA 02229938 l998-02-l9
W 097l07404 PCrAUSs6~37I5
- 104-
270:11453-11462; Ehrlich, R., et al., (1988) Mol. Cell
Biol. 8, 695-703; Maguire, J. E., et al., (1992) Mol.
Cell. Biol. 12, 3078-3086; Howcroft, T. K., et al., ~1993)
~l~IBO J. 12, 3163-3169). Double-stranded oligonucleotides
containing the sequences of the silencer and enhancer
S which control constitutive MHC cla~qs I levels in different
tissues, and oligonucleotides with mutations of these
sites, were those described (Weissman, J. D. and Singer,
D. S. (1991) Mol. Cell. Biol. ll, 4217-4227). Similarly,
double-stranded oligonucleotides containing the sequence
of the insulin responsive elements (IREs) of the
thyroglobulin (TG) and TSH receptor (TSHR) promoters,
oligo K and TIF, respectively, were synthesized as
described (Santisteban, P., et al., (1992) Mol.
Endocrinol. 6, 1310-1317; Shimura, Y., et al., (1994) J.
Biol. Chem. 269, 31908-31914). Oligo K or oligo TIF were
also ~nn~l ed and inserted in pUCl9 plasmids for
transfection experiments. Briefly, pUCl9 plasmids were
linearized with XbaI, dephosphorylated with alkaline
phosphatase, and ligated to the blunt-ended
oligonucleotides using T4 DNA ligase.
After purification, plasmids were sequenced
(Sanger, F., et al., (1977) Proc. Natl. Acad. Sci. U. S.
A. 74, 5463-5467) to insure directional fidelity and
confirm copy number. All plasmid preparations were twice
purified by CsCl gradient centrifugation (Davis, L. G., et
al., (1986) Basic Methods in Molecular Biology. Elsevier,
New York, 93-98).
Transfection
FRTL-5 cells stably transfected with class I
promoter-CAT ch-m~ras have been described (Giuliani, C.,
et al., (1995) J. Biol. Chem. 270:11453-11462). To test
the effect of TSH or MMI, cells were grown to 70-80~
confluency in 6H medium, then maintained without TSH (5H
medium) for 5 days, at which time they were exposed to
lxlO-10 M TSH or 5 mM MMI for 40 hours before CAT activity
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 105-
was measured. Transient transfections using the same
class I-CAT chimeras were performed by electroporation
(Ikuyama, S., et al., (1992) Mol. Endocrinol. 6, 793-804;
Ikuyama, S., et al., (1992) Mol. Endocrinol. 6, 1701-1715)
using one of two procedures. FRTL-5 cells maintained in
6H medium were transfected and 12 hours later were treated
one of three ways: 5 mM MMI was added with fresh 6H
medium; 6H medium was replaced by fresh 5H medium; or
cells were.maintained in fresh 6H medium. Alternatively,
FRTL-5 cells were maintained without TSH (5H) for 5 days
and were returned to medium with TSH (6H) for 12 hours
before transfection. They were then plated for 12 hours
in 6H and the medium then changed to 5H medium plus or
minus 5 mM MMI and plus or minus TSH as noted.
For electroporation (Gene Pulser, BioRad,
Richmo~, CA), the procedure was the same as in Example 7.
and as described (Ikuyama, S., et al., (1992) Mol.
Endocrinol. 6, 793-804; Ikuyama, S., et al., (1992) Mol.
Endocrinol. 6, 1701-1715) with the following exceptions.
Either 20 ~g p(-llOO)CAT or equivalent molar amounts of
the deletion mutants or pSVOCAT (negative control) were
used; these amounts were determined in preliminary
experiments which optimized transfection conditions as a
function of plasmid concentration. After 36-44 hours,
cells were harvested and CAT activity measured (Ikuyama,
S., et al., (1992) Mol. Endocrinol. 6, 793-804; Ikuyama,
S., et al., (1992) Mol. Endocrinol. 6, 1701-1715; Gorman,
C. M., et al., (1982) Mol. Cell Biol. 2, 1044-1051) using
20 ~g cell lysate and an incubation at 37~C for 4 hours.
Acetylated chloramphenicol was separated by thin layer
chromatography and autoradiographed; positive spots were
excised and quantitated in a scintillation spectrometer.
A DEAE-dextran procedure (Lopata, M. A., et al.,
(1984) Nucleic Acids Res. 12, 5707-5717) was used to
cotransfect 20 ~g each of chimeric class I promoter-CAT
constructs and pUC19 plasmids with or without oligo K,
CA 02229938 l998-02-l9
W O 97/07404 PCTrUS96/I37I5
- 106-
oligo TIF, or their respective mutants. Cells were grown
to 80~ confluency in 6H medium, shifted to 5H medium 12
hours before transfection, washed twice with phosphate
- buffered saline, pH 7.4 (PBS), and incubated 1 hour with 5
ml serum-free 5H medium containing the plasmid DNA plus
250 ~g DEAE-dextran (5 Prime-3 Prime, Inc.). Cells were
then exposed to 10~ dimethylsulfoxide in PBS for 3 min.,
washed twice in PBS, cultured in 5H medium for 12 hours,
then maintained therein another 36 hours with or without
MMI or TSH as noted. CAT assays were performed as above.
(See also Example 7).
Efficiency of transfection was determined by
cotransfection with 5 ~g pRSVLuc, kindly provided by Dr.
S. Subramani, U. of CA, LaJolla. CAT values, mean ~ S.E.
of 3 experiments, are normalized to luciferase activity
and protein using the Promega assay system and a Monolight
2010 luminometer. Cell viability was approximately 80~ in
all experiments.
Extracts. Cell extracts were made by a
modification of a described method (Dignam, J., et al.,
(1983) Nucleic Acids Res. 11, 1475-1489) as described in
Example 6 with the following additions or exceptions. In
same experiments cells were grown in 6H medium until 80
confluent and then maintained in 5H medium (-TSH) with 5
calf serum or 4H medium (-TSH, -insulin) with only 0.2~
serum for 7 days. Experiments were initiated by exposing
cells to lxlO-10M TSH or 5 mM MMI. Pelleting was by
centrifugation at 500g, after being washed twice in cold
PBS, ph 7.4. The pellet was resuspended in 2 volumes of
Dignam buffer C (Dignam, J., et al., (1983) Nucleic Acids
Res. 11, 1475-1489; see Example 6) and the final NaCl
concentration was adjusted on the basis of cell pellet
volume to 0.42 M. Cells were lysed by repeated cycles of
freezing and thawing. The extracts were centrifuged at
35,000 rpm (lOO,OOOxg) and at 4~C for 20 min. The
supernatant was recovered, aliquoted, and stored at -70~C.
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 107-
To perform gel mobility shift or Western blot
assays using nuclear extracts and involving multiple
experimental points, i.g. experiments performed as a
function of time, a rapid and efficient technique for
extraction of nuclear proteins from one or two culture
dishes was used. The method modifies a method to isolate
hemopoietic cell nuclei (Bunce, C.M., et al. (1988) Anal.
Biochem. 175, 67-73) then extracts proteins from the
nuclei with a high salt buffer (Henninghausen, h., et al.
(1987) Methods in EnzymoloqY 152, 721-735). In this
procedure all samples and reagents are kept on ice. For
centrifugation a microcentrifuge is used with its maximum
speed setting. Buffer A and Buffer B contain 0.5 mM DTT,
0.5 mM pMSF, 2ng/ml pepstatin A and 2 ng/ml Leupeptin.
Typically, 5 X 105 or more cells are washed with 10 ml of
Dulbecco's modified phosphate buffered saline without Mg2
and Ca2+ (DPBS), pH 7.4, scraped and collected in a
microcentrifuge tube with 1 ml of DPBS. Cells are
pelleted by centrifugation for 30 seconds at room
temperature, resuspended in five volumes of 0.3M sucrose,
2~ Tween 40 in Buffer A (10 mM HEPES-KOH, pH 7.9, 10 mM
KC1, 1.5 mM MgCl2, 0.1 mM EDTA) frozen in dry ice-ethanol,
and kept at -80~C, if desired, for further analysis. The
cells are thawed in a 37~C water bath and, using a
micropipet with a yellow tip, pipetted 50 to 100 times
(depending on the number of cells or volume of the
samples) to release nuclei. Samples are overlayed on 1 ml
of 1.5 M sucrose in Buffer A and centrifuged for 10
minutes at 4~C. Nuclei are pelleted to the bottom of the
tube, cytoplasmic organelles and cell membrane debris are
located in the intermediate phase. The nuclear pellets
are washed with 1 ml of Buffer A by centrifugation for 30
seconds, and then resuspended in 10 ml of Buffer B (20 mM
HEPES KOH, pH 7.9, 420 mM NaC1, 1.5 mM MgCl2, 0,2 mM EDTA,
25~ glycerol). Samples are placed on ice for 20 minutes
with occasional vortexing, followed by centrifugation for
CA 02229938 l998-02-l9
W O97107404 PCT~US96rl3715
- 108-
20 minutes at 4~C. The supernatant fraction, containing
nuclear protein is aliquoted and stored a -70~C. Optimal
pipetting to disrupt the cell membrane and release nuclei
before sucrose centrifugation is important to get good
results. Before and after this sucrose centrifugation,
the purity of nuclei and/or distribution o~ other cellular
components is able to be determined by observing samples
under a phase contrast microscope with trypan blue
staining. .
Electrophoretic Gel mobility Shift As6ays (EMSA)
PD1 promoter probes were obtained by restriction
enzyme digestion as previously reported (Examples 6 and 7;
Weissman, J. D. and Singer, D. S. (1991) Mol. Cell. Biol.
11, 4217-4227; Giuliani, C., et al., (1995) J. Biol. Chem.
270:11453-11462; Ehrlich, R., et al., (1988) Mol. Cell
Biol. 8, 695-703; Maguire, J. E., et al., (1992) Mol.
Cell. Biol. 12, 3078-3086; Howcroft, T. K., et al., (1993)
EMBO J. 12, 3163-3169) and were purified from 2 ~ agarose
gels using a QIAEX extraction kit (Quiagen, Chatsworth,
CA). They were labeled with [a!-32P] dCTP using Klenow,
whereas oligo K was radiolabeled with [~y_32p] ATP using T4
kinase. Radiolabeled probes were purified by
electrophoresis on an 8~ native polyacrylamide gel for 1-2
hours at 120 V (Sambrook, J., Fritsch, E. F., and
Maniatis, T. (1989) Molecular cloning: a laboratory
manual, Second Edition, Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, New York). Binding reactions
with cell extracts were carried out in a volume of 20 ~l
for 30 min at room temperature; reaction mixtures
contained 1.5 fmol O~ [32p] DNA, 3 ~g cell extract, and 3.0
~g poly(dI-dC) in 10 mM Tris-Cl (pH 7.9), 1 mM MgCl2, 1 mM
dithiothreitol, 1 mM ethylenediamine tetraacetic acid
(EDTA), 5~ glycerol, and KCl as indicated in some
experiments. Where indicated, unlabeled double-stranded
oligonucleotides were added to the binding reaction as
competitors and incubated with the extract for 20 min
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 109--
prior the addition of labeled DNA. Similarly, in
supershift experiments using antisera, extracts were
incubated in the same buffer containing either immune or
normal rabbit serum at room temperature for 20 min before
adding labeled DNA. Following incubations, reaction mixes
were subjected to electrophoresis on 4 or 5 ~ native
polyacrylamide gels for 1-2 hours, at 160 V, in 0.5xTBE,
and at room temperature. Gels were dried and
autoradiographed.
Transcription ExtenE;ion Assays. In vitro
10 transcription extension (run-on) assays were performed as
described (Saji, M., Moriarty, et al., (1992) J. Clin.
Endocrinol. Metab. 75, 871-878; Isozaki, O., et al.,
(1989) Mol. Endocrinol. 3, 1681-1692). Aliquots of the
purified [32p] UTP-radiolabeled nuclear RNA were hybridized
15 with excess amounts of the class I, TG, and $-actin cDNA
inserts or control pSG5 (Stratagene) or pBR322 (New
England Biolabs) plasmid DNA immobilized on nylon
membranes.
Sox-4 Cloning And Recombinant Sox-4 Protein
To clone rat Sox-4, a ~gtll FRTL-5 thyroid cell
cDNA expression library (Akamizu, T., et al., (1990) Proc.
Natl. Acad. Sci. U. S. A. 87, 5677-5681) was screened by a
modification of the Southwestern blotting procedure
(Vinson, C. R., et al., (1988) Genes Dev. 2, 801-806 )
using a polymerized oligonucleotide with 8 repeats of the
thyroglobulin insulin response element (oligonucleotide K;
TGACTAGTAGAGAAAACA~AGTGA). In the primary screen, the
library was plated at a density of 40,000 plaque-forming
units/143 cm2. After 4 h at 42~C, the plates were overlaid
with nitrocellulose filters that had been soaked in 10 mM
isopropyl B-D-thiogalactopyranoside (IPTG) and were then
incubated for 12 h at 37~C. The nitrocellulose filters
were removed from the culture plates and allowed to air
dry for 15 min at room temperature. Dried filters, with
bound protein, were denatured by platform shaking for 10
CA 02229938 1998-02-19
WO 97/07404 - PCT~US96/1371
- 110-
min at 4~C in binding buffer (10 mM Tris-HCl, pH 7.6, 200
mM KCl, 5 mM MgCl2, 1 mM EDTA, 1 mM dithiothreitol)
containing 6 M guanidine hydrochloride. After repeating
- this step, the denaturing solution was diluted with an
, equal volume of binding buffer without guanidine
hydrochloride and the shaking continued for 5 minute at
4~C. Filters were subjected to 4 consecutive 5 minute
washings, each with a two-fold dilution of the guanidine
hydrochloride, two 5 min washes with unsupplemented
binding buffer, and then transferred to a blocking
solution containing 5~ Carnation non-fat dry milk in
binding buffer. After gentle shaking for 30 min, the
filters were exposed to 1x106 cpm 32P-labeled DNA probe in
binding buffer containing 50 ~g/ml poly(dI-dC), 20 ~g/ml
denatured calf thymus DNA, 0.62 mM ZnS04, and 0.25~ dry
lS milk for 1 hour at room temperature. Subsequently, filters
were washed 3 times for 10 minute in binding buffer
containing 0.25~ dry milk at 4 ~C before autoradiography.
The probe used for screening was generated by
concatenating the annealed and phosphorylated
oligonucleotide with T4 ligase. Ligated products were
isolated by agarose gel electrophoresis, and cloned into
the blunt-ended XbaI site of the pCAT-Promoter plasmid
(Promega, Madison, WI). As needed, the DNA fragment
containing eight repeats of oligo K was isolated from a
stock plasmid, nick-translated, and used as a probe for
screening. The cloned cDNA was ligated to the EcoRI site
of PUC19, and sequenced as described (Isozaki, O., et al.,
(1989) Mol. Endocrinol. 3, 1681-1692 41). Sequence
alignments and comparisons were performed using PC-GENE
and GENE WORKS software (IntelliGenetics, Mountain View,
CA).
To obtain purified recombinant protein, a NcoI-
EcoRI fragment (-1 to 1411 bp) of rat SOX-4 cDNA was
ligated between the NcoI and EcoRI sites of pET30a(+)
(Novagen, Madison, WI). The recombinant protein, whose N-
CA 02229938 1998-02-19
WO 97/07404 PCT~US96/13715
- 111-
terminus was fused to a consecutive stretch of 6 histidine
residue, was produced in the bacterial strain BL21(DE3). A
single colony was inoculated in 50 ml LB medium containing
30 ~g/ml kanamycin and incubated with shaking at 37 C. At
0.6 OD~, isopropyl-~-D-thiogalactopyranoside (IPTG) was
added to 1 mM. After 3 h of induction by 1 mM IPTG, cells
were collected by centrifugation (5,000xg, 5 min, 4 C),
resuspended in 4 ml ice-cold binding buffer (5 mM
imidazole,Ø5 M NaCl, 20 mM Tris-HCl, pH 7.9), then
sonicated until no longer viscous. Affinity purified
protein was obtained using Ni2+ charged resin (Novagen,
Madison, WI). Cell extracts were centrifuged (39,000xg, 20
min, 4 C); the supernatant was applied to His-Bind columns
containing resin-immobilized Ni2+; and the columns were
washed with 25 ml binding buffer. Unbound proteins were
lS removed with 15 ml wash buffer; Sox-4 was recovered with
15 ml elute buffer containing imidazole. The His-Bind
column contained 5 ml resin and was washed, sequentially,
with 7.5 ml deionized water, 12.5 ml charge buffer (50 mM
NiS04) and 12.5 ml binding buffer. After addition of a
1/3rd volume of Strip Buffer, the eluted fraction was
dialyzed against 20 mM HEPES-KOH, pH 7.9, 100 mM KCl, 0.1
mM EDTA, 20 ~ glycerol, 0.5 mM dithiothreitol (DTT), 0.5
mM phenylmethylsulfonyl fluoride (PMSF), 2 ~g/ml
leupeptin, and 2 ~g/ml pepstatin A, then concentrated in a
Centricon 10 (Amicon, Beverly, MA) for use in
electrophoretic mobility shift assays (EMSA).
Other Procedures and Statistical Significance
Protein concentration was determined by
Bradford's method (BioRad) and used recrystallized bovine
serum albumin as the standard. All experiment were
repeated at least three times with different batches of
cells. Values are the mean ~ S.E. unless otherwise noted.
Significance between values was determined using two-way
analysis of variance; values were significant if P values
were <0.05.
-
CA 02229938 1998-02-19
W 097107404 PCTnJS96/13715
- 112-
Resul ts
In run-on assays, MMI and TSH treatment of
FRTL-5 thyroid cells, maintained in medium containing
insulin (5H) plus 5~ serum, independently and additively
decrease the transcription rate of class I genes (Figure
15A; consistent with Figure 13 in Example 7). The ability
of MMI and TSH to decrease class I transcription requires
the presence of the insulin and/or serum in the medium.
Thus, MMI and TSH, alone or together, lose their ability
to decrease class I transcription rates when ~xAm;neA
using nuclei from cells maintained 7 days without insulin
and with only 0.2~ calf serum in the medium (Figure 15B).
These data suggested that the transcriptional suppression
of class I by MMI not only involves factors which are
additively and independently regulated by TSH, but also
factors regulated by insulin and/or components of the
serum. The TSH action can be duplicated by stimulating
TSH receptor autoantibodies in Graves' IgG preparations
(data not shown).
At the same concentrations which are mAx;mAlly
effective in run-on assays tFigure 15A), MMI and TSH
independently and additively decrease the activity of a
chloramphenicol acetyltransferase (CAT) chimera containing
1100 bp of class I 5'-flanking region, p(-llOO)CAT, which
had been transfected transiently into FRTL-5 thyroid cells
(Figures 16 And 16B). Thus, MMI and TSH additively and
independently regulate exogenous as well as endogenous
class I promoter activity in the thyrocytes. The TSH
action can again be duplicated by stimulating TSH receptor
autoantibodies in Graves' IgG preparations.
To further localize the regulatory elements
where MMI might act, MMI's effect on a series of 5'
deletion constructs of the 1100 bp class I swine
promoter-CAT chimeras stably (Table IV) or transiently
(Figures 16A-16B) transfected into FRTL-5 cells. As shown
in thyroid as well as nonthyroid cells (Figures 16A; Table
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 113-
IV; Weissman, J. D. and Singer, D. S. (1991) Mol. Cell.
Biol. 11, 4217-4227; Giuliani, C., et al., (1995) J. Biol.
Chem. 270:1453-11462; Ehrlich, R., et al., (1988) Mol.
Cell Biol. 8, 695-703; Maguire, J. E., et al., (1992) Mol.
Cell. Biol. 12, 3078-3086; Howcroft, T. K., et al., (1993)
EMBO J. 12, 3163-3169), 5'-deletions between -1100, -400,
-294, and -203 bp increased class I promoter activity,
indicating the presence of a series of negative regulatory
elements between -1100 to -203 bp (Figure 16A). Deletion
to -127 bp decreased, whereas truncation to -89 bp
increased promoter activity (Figure 16A). These data are
consistent with the existence of Enhancer A in the
interval -203 to -127 bp (Ting and Baldwin (1993) Current
Opinion in Immunol. 5:8-16) and a constitutive silencer
between -127 and -89 bp (Example 9). MMI and TSH
additively decreased exogenous promoter activity in all
the chimeras tested (Table IV, Fig. 16A). Since activity
persisted in a chimera within 89 bp of initiation of
transcription, the function of elements below -89 bp were
affected by both agents. These data did not, however,
exclude the possibility that MMI/TSH regulated the
activity of proteins which interacted with upstream
elements and that their function was linked to elements
within -89 bp of the start of transcription. This
possibility was supported by two observations.
CA 02229938 1998-02-19
W O 97~07404 PCTAUS96/13715
- 114-
T ~ LE IV
E$fect of 5 mM MMI or 1x101~ TSH on the ~y~OUS
promoter activity in FRTL-5 cell~ ~tably tran fe~ted with
chimeric CAT con~tructs of the 5'-deletion mutants of the
swine class I promoter. The CAT activity of each chimera
with no treatment is set at the control value to which the
offQct o~ treatment is c~ _~ed (% of control).
~H I ~ NO T~TM~T + TSH (lxlO-l~) ~MMI (5 mM)
CONTROL
~ of Control~ of Control
p(-1100) 100 60 i 7 63 i 8
p(-400) 100 67 i 6 75 i 7
p(-294) 100 73 i 5 78 i 5
p(-203) 100 50 i 5 54 i 7
p(-127) 100 50 i 7 55 i 4
15 p(-89) 100 63 ~ 6 68 i 5
pSV0 100 100 i 7 110 i 7
Fiqure Leqend for Table IV. FRTL-5 cells were grown to
near confluency in 6H medium (plus TSH) and were
maintained in 5H medium ~no TSH) for 7 days before being
treated with TSH or MMI for 40 hours. Control cells were
those maintained in 5H medium for the same 40 hours. CAT
activity was measured as described (Example 7; Example 8,
Materials and Methods). The MMI or TSH treatment
decreased CAT activity significantly (P~0.05 or 0.01) in
cells transfected with all the CAT plasmids except the
pSV0 control. Figure 16B notes the structure of each
chimeric CAT construct used.
-
CA 02229938 1998-02-19
W O 97t07404 PCT~US96/13715
- 115-
First, the additive effect of MMI and TSH
decreased the exogenous class I promoter activity of
p(-llOO)CAT to levels of the pSV0 control (Fig. 16A).
This paralleled their additive ability to decrease class I
RNA levels (Saji et al. (1992b) J. Clin. Endocrin.
S Metabol. 75:871-878), complex formation with Class I
promoter sequences (Example 6), and run-on assays (Figure
15) to comparable minimal levels. Deletion to -400 bp
eliminated the additive ability of both agents to decrease
promoter activity toward that of the pSV0 controli
however, this phenomenon returned in the p(-127)CAT
chimera, after deletion of the region between -203 and
-127 bp, and was lost again in the -89 bp CAT chimera.
MAX1 m~l ly additive TSH/MMI activity on the exogenous
promoter, which matched m~;m~ TSH/MMI-induced decreases
in endogenous class I gene expression, appeared,
therefore, to be associated with the activity of the
silencer elements lost in the deletions between -1100 to
-400 bp and -127 to -89 bp.
Second, as shown in Example 9, the function of
the silencer between -127 to -89 bp depends on an octomer
sequence, -107 to -100 bp (Figure 9), with homology to
known cAMP-response elements (CREs). (Figure 9) (Saji,
M., et al., 1992 a, 1992b; Montminy, M. R., et al., (1986)
Proc. Natl. Acad. Sci. U. S. A. 83, 6682-6686; Angel, P.,
et al., (1987) Mol. Cell. Biol. 7; 2256-2266; Leonard, J.,
et al., (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 6247-
6251; Vallejo, M., et al., (1992) J .Biol. Chem. 267;
12868-12875; Leonard, J., et al., (1993) Mol. Endocrinol.
7, 1275-1283; Ikuyama, S., et al., (1992) Mol. Endocrinol.
6, 1701-1715; Habener, J. F. (1990) Mol. Endocrinol. 4,
1087-1094). Additionally, it is shown in Example 9 that
TSH/cAMP treatment of FRTL-5 cells induces the appearance
of new protein/DNA complex with the CRE-like element of
the 38 bp silencer, whose formation is prevented by
elements within the class I promoter region between -89 to
CA 02229938 1998-02-19
WO 97/07404 PCT~US96rI37IS
- 116-
+1 bp (Example 9). Two of the proteins interacting with
the downstream silencer, a thyroid transcription factor-1
and a Y-box protein, designated TSEP-1 (TSHR suppressor
element protein-l), also interact with elements within +89
to +1 bp (See Figure 43). These data suggested TSH/MMI
might, in fact, modulate the activity of factors
interacting with the downstream silencer, as well as
elements below -89 bp.
~In the remainder of Example 8, the ability of
MMI/TSH to additively and independently modulate the
activity of the upstream silencer between -724 to -697 bp
is characterized. In Example 9, the ability of MMI/TSH to
modulate the activity of the downstream silencer (-127 to
-89 bp) is shown. In addition, it is shown they are
interactive, that the MMI/TSH action on each requires
factors regulated by insulin and/or serum, albeit
different factors, and that the MMI/TSH effect on the
downstream silencer is functionally dominant. (Example 8,
9,10 and 11).
The silencer element between -724 and -697 bp
has been shown to function together with an overlapping
enhancer element to regulate constitutive levels of class
I expression in different tissues (Example 6; Weissman, J.
D. and Singer, D. S. (1991) Mol. Cell. Biol. 11,
4217-4227). By comparison to extracts from control FRTL-5
cells maintained in 5H medium alone (Fig. 12A, lane 4, 5H
Basal), treatment of the cells with MMI and TSH (Fig. 12A,
lanes 5 and 6, respectively) for 24 hours decreased the
formation of a protein/DNA complex (arrow A) with a class
I promoter fragment including residues between -770 and
-636 bp. This fragment is termed the 140 Fragment
(Figures 9 and 11) and it includes both the upstream
silencer and its overlapping enhancer (Figure 10). The
MMI/TSH effect was additive (Fig. 12A, lane 7). Moreover,
TSH treatment of cells for 6 days caused a greater
decrease (Fig. 12A, lane 3) than TSH treatment for 24
CA 02229938 1998-02-19
W O 97/07404 PCTAUS96/1371
- 117-
hours (Fig. 12A, lane 6); but MMI treatment for 24 hours
was still additive (Fig. 12A, lane 2 vs 3).
The TSH/MMI-induced decrease in complex
formation with the 140 Fragment required insulin/serum,
consistent with the functional requirement for
insulin/serum on TSH or MMI action in run on assays (Figs.
15A-15B). Thus, TSH and MMI treatment of FRTL-5 cells did
not decrease formation of the A complex in FRTL-5 cells
maintaine~ in medium without insulin and plus only 0.2~
serum (Fig. 12D). Formation of the complex was specific,
as evidenced by self competition with a 200-fold excess of
the unlabeled 140 Fragment.
The 140 Fragment encompasses both a silencer and
an overlapping enhancer (Fig. 10). The MMI/TSH sensitive
complex at the top of the gel (Figs. 12A-12D, complex A)
lS appeared to be the silencer, based on its mobility and the
prominence of the complex (Example 6; Weissman, J. D. and
Singer, D. S. (1991) Mol. Cell. Biol. 11, 4217-4227).
Thus, the silencer complex migrates near the top of gels
(Weissman, J. D. and Singer, D. S. (1991) Mol. Cell. Biol.
11, 4217-4227); further, the high levels of silencer and
low levels of enhancer complex are consistent with the low
levels of class I expression found in thyroid cells (Saji,
M., Moriarty, et al., (1992) J. Clin. Endocrinol. Metab.
75, 871-878; Saji, M., et al., (1992) Proc. Natl. Acad.
~ci. U. S. A. 89, 1944-1948; Weissman, J. D. and Singer,
D. S. (1991) Mol. Cell. Biol. 11, 4217-4227). The
converse is true in tissues with high levels of
expression, i.e. lymphocytes (Weissman, J. D. and Singer,
D. S. (1991) Mol. Cell. Biol. 11, 4217-4227). To
unequivocally establish that the MMI/TSH effect was on the
silencer complex, we evaluated its formation in the ~
presence of oligonucleotides able to inhibit formation of
the silencer complex (Fig. 17A, S2 and S6), only the
enhancer complex (Fig 17A, E9), or neither (Fig. 17A, S3)
(Weissman, J. D. and Singer, D. S. (1991) Mol. Cell. Biol.
CA 02229938 1998-02-19
W O 97~07404 P ~ ~US96t~3715
- 118-
11, 4217-4227). As evidenced by inhibition by S2 and S6
but not S3 or E9 (Fig. 17A, lanes 2 and 4 vs 1, 3, and 5),
complex a, whose formation is decreased by MMI and TSH
(Fig. 17A), is the silencer. Complex b is the enhancer,
as evidenced by its inhibition by E9 in the absence of an
S E9 effect on the silencer (Fig. 17A, lane 5).
Using unlabeled fragments from the class I
promoter encompassing these related sequences, Fragment
105 (-503-to -399 bp), Fragment 114 (-870 to -770 bp), as
well as Fragment 151 (-1036 to -871 bp), it was found that
each was able to inhibit the formation of the silencer
complex formed with the radiolabeled 140 Fragment (Fig.
17B, lanes 7 to 9 vs 6). Moreover, treatment of FRTL-5
cells with MMI and TSH, alone or together, inhibited the
formation of a complex with identical mobility and in a
lS manner similar to the silencer in the 140 Fragment, when
each of these fragments were incubated with extracts from
cells maintained in the presence of insulin and serum
(Fig. 12B, lanes 1-7, compared to Fig. 12A, lanes 1-7) but
not their absence (Fig. 12D). These results suggest that
the silencer element exists at multiple loci between -1100
and -399 bp but that each is similarly modulated by
TSH/MMI. This is consistent with the progressive increase
in activity by 5' deletions of the class I promoter
between -1100 and -294 bp and the progressive loss of the
ability of MMI/TSH to decrease class I promoter activity
to the levels of the pSV0 control. (Figure 16A)
Enhancer A of the Class I 5'-flanking sequence,
-190 to -180 bp. is upstream of the interferon response
element and CRE (Figure 16B). It is important for
interferon action to increase Class I Levels and
; hydrocortisone actions to decrease them (Giuliani, C. et
al. (1995) J. Biol. Chem. 270:11453-11462). A protein
complex with enhancer A in thyroid cells is salt modulated
termed Mod-1, the complex is regulated by hydrocortisone,
insulin/serum, or interferon and includes the p50 subunit
CA 02229938 1998-02-19
W O 97/07404 PCTAUS96/13715
- 119-
of NF-KB and fra-2 (Giuliani, C., et al., (1995) J. Biol.
Chem. 270:11453-11462). The silencer and enhancer
complexes formed with the 140 Fragment and FRTL-5 cell
extracts are salt sensitive (Fig. 18A). Thus, with
increasing salt, it was noted that the silencer was
composed of two separate protein/DNA complexes, both of
which were modulated by TSH/MMI (data not shown). Using
higher salt concentrations (100 ~M KCL) in the shift
assays, we could show that the lower complex appeared to
be an adduct with the p65 subunit of NF-KB, as evidenced
by the ability of an antisera to it, but not the p50
subunit of NF-KB, to supershift the lower complex to the
level of, or a slightly higher level than, the upper
complex (Fig. 18B, solid and dashed lines, respectively).
The upper complex appears to be an adduct with a c-fos
family member or a related protein (Fig. 18C). Thus,
antisera reactive with c-fos family members caused a
supershift (Fig. 18C, lanes 2 and 4), but not antisera
specific for fra-1, fra-2, fosB, c-jun, or junB (Fig. 18C,
lanes 5-9) nor a control normal serum (Fig. 18C, lane 3).
These results, for the first time, identify protein
components of the upstream silencer complex and support a
relationship between it and Enhancer A.
The observation that MMI and TSH decreased,
rather than increased, formation of the silencer complex
was surprising, since the opposite might have been
expected in association with increased silencer activity.
An explanation for this and its role in MMI/TSH action on
class I levels emerged from the following experiments.
First, it was determined that the insulin/serum
sensitivity of the MMI/TSH effect on the upstream silencer
was related to a protein interacting with the insulin
response element (IRE) of the thyroglobulin (TG) promoter,
rather the insulin response element of the TSHR. Thus, in
vitro, addition of oligo K, the oligonucleotide with the
sequence of the TG-insulin response element, was able to
CA 02229938 1998-02-19
W O 97/07404 rCTAUS96~137
- 120-
inhibit the decrease in complex formation with the
upstream silencer evident in extracts from MMI/TSH-treated
cells (Fig. 14A, lane 7 and 15). In contrast, oligo TIF
; of the TSHR insulin response element had no effect on
complex formation by the upstream silencer (data not
shown).
Second, it was determined that MMI/TSH action on
the upstream silencer complex directly involved the
protein interacting with the TG insulin response element.
Thus, when oligo K itself was used as a radiolabeled
probe, 2 ma~or protein complexes were formed with cell
extracts from FRTL-5 cells under the conditions employed
(Fig. 14B, lane 16). Both were specific for oligo K as
evidenced by competition using a 250-fold excess of
unlabeled oligonucleotide, but not by a 250-fold excess of
a mutant form of oligo K (Santisteban, P., et al., (1992)
Mol. Endocrinol. 6, 1310-1317; Aza-Blanc, P., et al.,
(1993) Mol. Endo~rinol. 7, 1297-1306) or 250-fold excess
of oligo TIF (data not shown). More importantly,
treatment of cells with MMI or TSH for 24 hours decreased
the formation of the upper protein complex with oligo K
and inhibited complex formation in an additive manner
(Fig. 14B, lanes 17-19 vs 4, arrow A). The additive
effect of MMI was evident in cells exposed to TSH (6H
medium) for 6 days, exactly as in the case of the silencer
complexes in the 140 Fragment. Further, the TSH/MMI
modulated complex with oligo K required the presence of
insulin/serum to form. Thus the complex was not present
in extracts from cells maintained with no insulin and 0.2
serum (4H medium) and TSH/MMI had no apparent effect in
the absence of formation of this complex.
- Third, the protein binding the TG insulin
response element and the silencer in the 140 Fragment of
the class I promoter was required for upstream silencer
activity, as well as the ability of MMI to decrease
complex formation. Thus, cotransfection of a plasmid
CA 02229938 l998-02-l9
W 097/07404 PCTrUS96/13715
- 121-
containing oligo K and the p(-llOO)CAT ch;mera of the
class I promoter into FRTL-5 cells significantly increased
promoter activity (Fig. l9A, oligo K1 and oligo K2). The
increase was not duplicated by cotransfections with a
mutant of oligo K (Fig. l9A, oligo KM), which loses its
S ability to compete for oligo K complexes with FRTL-5 cell
extracts (Santisteban, P., et al., (1992) Mol. Endocrinol.
6, 1310-1317; Shimura, Y., et al., (1994) J. Biol. Chem.
269, 31908-31914; Aza-Blanc, P., et al., (1993) Mol.
li~nt~ocrinol~ 7, 1297-1306). The effect of oligo K was not
duplicated when the p(-127) CAT c~;m~ra was used (Fig.
l9B), consistent with the interpretation this effect was
one involving the upstream not the downstream silencer.
Thus, Lemo~dl of the insulin-induced protein, by binding
it to oligo K which had been transfected into the cells,
functionally attenuated or eliminated silencer activity
and resulted in the expression of enhancer activity.
Last, although the insulin-induced protein
interacting with oligo K is necessary for silencer
activity (Fig. 19) and the ability of MMI/TSH action to
decrease silencer complex formation (Figure 14), its role
in the MMI-decreased class I gene expression is dominated
by the action of the insulin-induced protein interacting
with the downstream silencer and the TSHR insulin response
element. Thus, whereas oligo TIF cotransfection will be
shown to cause a loss in the MMI effect on the p(-llOO)CAT
promoter chimera (Example 9), cotransfection with oligo K
did not prevent the MMI decrease in p(-llOO)CAT activity
(Table V).
CA 02229938 1998-02-19
w o 97~7404 PCT~US96/13715
- 122-
o
TABLE V
Effect of oligo K cotransfection on the
ability of MMI/TSH to decrea~e Cla~s I
promoter activity of the p(-llOO)CAT Chim~ra
CAT A~L1V1-1 Y (% of Control)
COTRANSFECTION NO MMI I MMI
NONE 100 (Control) 54 ~ 8**
+ OLIGO rl 155 i 7* 72 i 12~*
+ OLIGO K2 214 ~ 10* 87 i 11~*
+ OLIGO RM 87 i 9 50 i 6**
*Significant increase in activity, P~0.05 or better.
**Significant decrease in activity, P<0.05 or better, by
comparison to activity in the absence of MMI.
Fiqure Leqend for Table V. Using a DEAE-Dextran
procedure, FRT~-5 cells grown in 5H medium plus 5~ calf
serum were cotransfected with p(-llOO)CAT, as in Figure
16A, and 20 or 40 ~g of a plasmid containing the oligo K
oligonucleotide (Oligo K1 and Oligo K2, respectively) or
40 ~g of a plasmid cont~;n'ng oligo KM, a mutated form of
oligo K described previously (Santisteban, P., et al.,
(1992) Mol. Endocrinol. 6, 1310-1317; Aza-Blanc, P., et
al., (1993) Mol. Endocrino. 7., 1297-1306; Shimura, Y., et
al., (1994) J. Biol. Chem. 269, 31908-31914) and used in
Figure 19. Cells were maintained in medium with or without
5 mM MMI. CAT activity was measured 36 h later and
conversion rates normalized to growth hormone levels; the
activity of the control transfection with the p(-llOO)CAT
and the vector into which the oligoK sequences were
inserted was assigned a value of 100~. Differences in the
CAT activity of cells cotransfected with Oligo K or its
mutant were compared to the control values. Values are
the mean i S.E. of three different experiments, each
performed in duplicate.
The sum of these data suggested the following.
The upstream silencer is decreased and it appears it must
be disengaged to allow the downstream silencer to be
engaged and functionally dominant. The p65 and c-fos
complexes formed with the upstream silencer element
exhibit silencer function only when they also interact
with the insulin-induced protein able to bind to oligo K.
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 123
TSH/MMI action decrease upstream silencer complex
formation by its action on the insulin-induced protein.
Decreased upstream silencer complex formation is presumed
to be associated with a 1088 of upstream silencer
activity, but this may be a necessary accompaniment to
MMI/TSH action on the downstream silencer, whose
MMI/TSH-induced activity dominates. Thus, progressive
deletions of the upstream silencer sites result in the
attenuation of downstream silencer activity, whose
dominance returns when all upstream silencer sites are
deleted (Fig. 16A; Table IV).
The clone obtained and characterized herein
which is the insulin-induced protein interacting with the
upstream silencer and the TG-insulin response element,
support the above hypothesis. These studies additionally
show that the upstream enhancer, as well as the silencer,
interacts with the TG-insulin response element reactive
factor, which we designated as Sox-4.
A clone containing 1422 nucleotides whose open
reading frame encodes a 442 amino acid residue protein
with a molecular weight of 53,040 was obtained (Fig. 20A-
20B). The protein is 98~ similar to mouse Sox-4 (Van de
Wetering et al. EMBO. Journal (1993) 12:3847-3854) and
similar to human Sox-4 (Farr C.J. et al. (1993) M~mm~lian
Genome 4:577-584). Mouse Sox-4 was cloned as a SRY
related gene from T-lymphocytes which was responsible for
transcriptional transactivation and can bind a sequence
AACAAAG. Its function is not known (Van de Watering M. et
al. (1993) EMBO J. 12:3847-3854). Rat and mouse Sox-4 are
32 residues smaller than human Sox-4 (Farr et al. (1993)
M~mm~1ian Genome 577-584). All of the extra residues in
human Sox-4 and most of the different residues in mouse
Sox-4 cluster within one region of the protein and are
primarily glycine and alanine residues. It is not clear
that this insert region in human Sox-4 is a neutral spacer
region (Farr et al, (1993) M~mm~lian Genome 577-584),
SUBSIllul~ S~ QIUIE 2~)
CA 02229938 1998-02-19
W O g7107404 PCTrUS96113715
- 124-
since both mouse and human Sox-4 differences cluster in
this region. The Sox-4 proteins are members of the HMG
(high mobility group) class of transcriptional regulators,
which bind DNA in a sequence specific fashion and include
SRY, which regulates genes determining testicular
development, TCF-1~, which regulates genes important in T
cell development, and IRE-~3P (insulin response element A
binding protein), which regulates genes subject to
positive and negative regulation by insulin that appear to
play a role in mediating the tissue specific effect of
insulin on transcription of a diverse group of genes in
lipogenic tissues (Al~n~r-Bridges M. et al. (1990) J.
Cell. Biochem. 48:129-135). The common features of all
three Sox-4 proteins include the HMG box (Figure 20, bold)
and a serine-rich carboxy terminal tail with multiple
putative casein kinase and histone kinase phosphorylation
sites (Van de Wetering et al. (1993) EMBO Journal 12:3847-
3854; Farr et al (1993) Mammalian Genome 577-584). The HMG
box is a domain defined by its sequence similarity to HMG-
1 and related proteins that associate with chromatin and
are important in the structural organization of DNA. In
the HMG class of transcriptional regulators, such as Sox-
4, the HMG box exhibits sequence-specific DNA binding to
the minor groove of DNA and induces a strong bend in the
DNA helix (Van de Wetering et al. (1993) EMBO Journal 12:
3847-3854i Farr et al. (1993) M~mm~lian Genome 577-584;
Ferrari et al. EMBO J. 11:4497-4506).
The Sox-4 recombinant protein described and
characterized herein, can bind to oligo K, the TG insulin
response element, or to a related oligonucleotide
(Santisteban, P., et al., (1992) Mol. Endocrinol. 6, 1310-
; 1317; Francis-Lang, H., et al., (1992) Mol. Cell Biol. 12,
576-588; Aza Blanc, P., et al., (1993) Mol. Endocrinol. 7,
1297-1306), oligo Z, which mimics the sequence of the
related insulin response element on the thyroid peroxidase
promoter (Fig. 21). Consistent with data reported in
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 125-
competition studies, Sox-4 does not bind to the mutant of
oligo K which loses its ability to interact with TTF-2,
the presumptive binding factor which interacts with the TG
insulin response element tFig. 21) (Santisteban, P., et
al., (1992) Mol. Endocrinol. 6, 1310-1317; Francis-Lang,
S H., et al., (1992) Mol. Cell Biol. 12, 576-588; Aza Blanc,
P., et al., (1993) Mol. Endocrinol. 7, 1297-1306). The
binding to the oligo Z mutant is also decreased,
consistent with its decreased ability to compete for the
TPO insulin response element in EMSA studies. Sox-4 binds
weakly with oligo C of the TG promoter (Fig. 21), which
mimics a site near the thyroglobulin (TG) or thyroid
peroxidase (TPO) insulin response element that recognizes
two different transcription factors: thyroid transcription
factor 1 and Pax-8 (Santisteban, P., et al., (1992) Mol.
Endocrinol. 6, 1310-1317; Francis-Lang, H., et al., (1992)
~ol. Cell Biol. 12, 576-588; Aza Blanc, P., et al., (1993)
Mol. Endocrinol. 7, 1297-1306; Civitareale, D., et al.,
(1993) Mol. Endocrinol. 7, 1589-1595; Civitareale, D., et
al., (1989) EMBO J. , 2537-2542; Guazzi, S., et al.,
(1990) EMBO J. 9, 631-3639; Francis-Lang, H., et al.,
(1992) Mol. Cell. Biol. 12, 576-588; ~nn;n;, M., et al.,
(1992) Mol. Cell. Biol. 12, 4230-4241; Shimura, H., et
al., (1994) Mol. Endocrinol. 8, 1049-1069; Ohmori, M., et
al., (1995) Endocrinoloqy, 136, 269-282). These data are
consistent with the oligonucleotide binding specificity
ascribed to TTF-2, and alone might suggest Sox-4 is TTF-2.
However, although Sox-4 can footprint the region
of insulin response element region of the TG promoter in
DNAase-I protection experiments, the footprint is far more
extensive than the TG insulin response element site
ascribed to TTF-2 in FRTL-5 cell extracts. There is
protection of the TG insulin response element, but the
protection extends to the oligo C site which can bind TTF-
1 and Pax-8 and to the oligo A region. This broad
footprint is beyond that predicted in previous studies
CA 02229938 1998-02-19
W O 97107404 P ~ nUS96n37I~
- 126-
defining TTF-2 (Santisteban, P. et al. (1992) Mol.
Endocrinol. 6:1310-1317; Aza Blanc, P., et al. (1993) Mol.
~n docrinol. 7, 1227-1306).
Northern analyses also do not fit a pattern
consistent with Sox-4 being TTF-2. TTF-2 is a thyroid-
S specific transcription factor according to previousreports (Santisteban, P. et al. (1992) Mol. Endocrinol.
6:1310-1317i Aza Blanc, P. et al. (1993) Mol. Endocrinol.
7, 1297-1306); Civitareale, D., et al., (1993) Mol.
Endocrinol. 7, 1589-1595; Civitareale, D., et al., (1989)
EMBO J., 2537-2542; Guazzi, S., et al., (1990) EMBO J. 9,
631-3639; Francis-Lang, H., et al., (1992) Mol. Cell.
Biol. 12, 576-588; ~nn;n;, M., et al., (1992) Mol. Cell.
Biol. 12, 4230-4241; Shimura, H., et al., (1994) Mol.
Endocrinol. 8, 1049-1069; Ohmori, M., et al., (1995)
Endocrinology, 136, 269-282). Thus, Northern analyses of
Sox-4 with rat tissues confirm previous data with mouse or
human Sox-4 (Farr, C. J., et al., (1993) M~mm~lian Genome
4, 577-584; van de Wetering, M., et al., (1993) EMBO J.
12, 3847-3854), i.e. they show Sox-4 is a ubiquitously
expressed gene (Fig. 22A). Northern analyses further
indicate that, although Sox-4 can be increased by insulin
(Fig. 22B), as predicted for TTF-2 (Santisteban, P., et
al., (1992) Mol. Endocrinol. 6, 1310-1317; Francis-Lang,
H., et al., (1992) Mol. Cell Biol. 12, 576-588; Aza Blanc,
P., et al., (1993) Mol. Endocrinol. 7, 1297-1306)., the
increase requires more than 24 hours of insulin/serum
treatment of FRTL-5 cells; the insulin-induced increase in
oligo K complex formation with TTF-2 is, in contrast,
already evident at 24 hours (Santisteban, P., et al.,
(1992) Mol. Endocrinol. 6, 1310-1317; Francis-Lang, H., et
; al., (1992) Mol. Cell Biol. 12, 576-588; Aza Blanc, P., et
al., (1993) Mol. Endocrinol. 7, 1297-1306). Complex
formation with TTF-2 is increased in extracts from cells
treated with insulin or TSH after being maintained several
days in 4H medium containing 0.2~ serum, i.e. without
CA 02229938 1998-02-19
W O 97/07404 PCT~US96/13715
- 127-
insulin, insulin-like growth factors, or TSH (Santisteban,
P., et al., (1992) Mol. Endocrinol. 6, 1310-1317; Francis-
Lang, H., et al., (1992) Mol. Cell Biol. 12, 576-588; Aza
Blanc, P., et al., (1993) Mol. Endocrinol. 7, 1297-1306).
This is true for Sox-4 (Fig. 22B). However, in the
presence of insulin or serum, i.e. in a cell in 5H medium
plus 5~ serum, TTF-2 complex formation is not changed
(Santisteban, P., et al., (1992) Mol. Endocrinol. 6, 1310-
1317; Francis-Lang, H., et al., (1992) Mol. Cell Biol. 12,
576-588; Aza Blanc, P., et al., (1993) Mol. Endocrinol. 7,
1297-1306). In contrast, Sox-4 RNA levels are
dramatically decreased by TSH in cells in 5H medium plus
TSH for 1 week (Figure 22B, lane 6). Northern analyses do
not, therefore, fit a pattern of RNA expression that might
be expected for TTF-2 based on previous studies.
Overexpression of Sox-4 in FRT cells does not
alter TG-CAT activity, whereas TTF-1 has been shown to
have effects in cotransfection experiments. (Shimura, H.
et al. (1994) Mol. Endocrin. 8, 1049-1069) Further, in
FRTL-5 cells maintained in 6H plus 5~ calf serum, where
Sox-4 RNA levels are vanishingly low and where Sox-4/DNA
complex formation is very low (Figure 22B), overexpression
of Sox-4 can slightly increase TG-CAT activity on the full
length promoter but has no effect on p.(-170) where the
TG-IRE site is located (Table VI).
The properties of the Sox-4 protein identified
herein do not fit several properties predicted for TTF-2
and is not TTF-2. Sox-4 is instead a component of the MHC
class I upstream silencer/enhancer complex and regulates
class 1 expression in the thyroid and other tissues.
Insulin increases complex formation with the
upstream silencer and oligo K. In the presence of
insulin, TSH decreases the upstream silencer complex (Fig.
12 and 14A) and decreases complex formation with oligo K.
The basis for this is the ability of TSH to decrease Sox-4
RNA levels in the presence of insulin (Fig. 22B). The
CA 02229938 1998-02-19
W O 97/07404 PCT~US96113715
- 128-
basis for MMI action in Sox-4 is not an effect of MMI to
decrease Sox-4 mRNA in the presence of insulin but altered
thioredoxin activity (Table VII). Thus, Sox-4 activity
may involve regulation by MMI through its action as a free
radical scavenger (Wilson, R. et al. (1988) Clin.
Endocrin. 28:389-397; Wienzel, N. et al. (1984) J. Clin.
Endocrinol Metab. 58:62-69).
The silencer component regulated by Sox 4 is the
p65 subunit of NF-kB (Fig. 18). Thus, antisera to Sox-4
supershifts the p65 upstream silencer complex (Fig. 23)
decreasing silencer complex formation. The antisera also
eliminates formation of the ~nhAncer complex, which is
composed of c-jun as evidenced by the ability of c-jun to
form a similarly sized complex with the 140 fragment in
the presence of Sox-4 or FRTL-5 cell extracts and an
antisera to c-jun to inhibit enhancer complex formation
(data not shown). Sox-4, therefore, is important in the
formation of both the silencer and enhancer.
Sox-4 footprints a region overlapping both the
~nh~ncer and silencer (Fig. 24) and can suppress class I
expression when a cDNA encoding Sox-4 is cotransfected
with class I promoter-CAT chimeras (Table VI). This
effect is specific since there is either no effect of the
Sox-4 when cotransfected with thyroglobulin promoter-CAT
chimeras or an increase in TG-CAT activity (Table VI).
The oligo K reactive protein important for class
I regulation of the upstream silencer/enhancer is Sox-4.
Sox-4 is a suppressor of class I as evidenced in
cotransfection studies. In oligonucleotide (oligo K)
transfection studies, oligo K which reacts with Sox-4,
increases class I by blocking Sox-4 interactions with the
~' silencer, rendering it nonfunctional, and increasing
enhancer complex formation. TSH decreases Sox-4 mRNA
levels and silencer complex formation, therefore one means
to assess its action on Sox-4 is to evaluate Sox-4 by
Northern analysis in addition to measuring silencer
CA 02229938 l998-02-l9
W 097/07404 PCT~US96/13715
- 129-
complex formation. (Example 6). Another mechanism of
measuring MMI action is to measure the increase Sox-4
activity modulated by effect of MMI on the actions of
enzymes important in oxidation-reduction states of
transcription factors, such as thioredoxin (Table VII) or
superoxide dismutase (Wilson, R. et al. (1988) Clin.
~n~ncrinoloqy 28:389-397) via its free radical scavenging
effect. These enzymes can regulate the oxidation-
reduction-states of cysteines transcription factors
thereby modulating their activity. (Allen, J.F. ( 1993)
FEBS Lett. 332, 203-207; Storz, G., et al., (1990) Science
248, 189-194; Toledano, M.B., et al., (1994) Cell 78, 897-
909; Galang, C.K. et al., (1993) Mol. Cell. Biol. 13,
4609-4617; Pognonec, P., et al., (1992) J. Biol. Chem.
267, 24563-24567; Rigoni, P., et al., (1993) Biochim.
Biophys. Acta 1173, 141-146; Gehring, W.J. (1994) Annu.
Rev. Biochem 63; 478-526).
CA 02229938 1998-02-19
W O 97/07404 P ~ AUS96/I3715
- 130-
TABLE Vl
Effect of Sox-4 on the Activity of class I-CAT c' ~ or TG-CAT ~ ~ when
cotransfected into FRTL 5 thyroid cells ~ ~ -' in SH medium plus S% serum
,~
Class I CONTROL + Sox-4 RATIO TG-CAT RATIO
CAT G ~ ion Rate C~ iul- (+ Sox-4/ Chimera (+ Sox-4/
S C' ~ ~ (% pSVO Rate no Sox-4) no Sox-4)
Control) (9~ pSVO
Control)
pSVO 1 0 1.0 ~0.2 1.0 P(-828) 2.0
p(-llOO) S.O il 2.5 t0.8 0.5 p(-688) 2.7
P( 400) 22.5 i2 10.2 ~1.3 0.45 p(-206) 1.0
p(-203) 28.4 i2.9 10 i0-9 0.35 p(-170)' 1.2
p(-168) 23 i 1.8 6.2 i 1.1 0.27
p(-127) 4.1 i 1.2 3.2 i 0.9 0.78
p(-127NP) 8.9 i 1.3 3.S i 0.8 0.39
1~ CRE
p(~8) 3.6 il-0 3.S i 1.0 0.97
CRE
Bold values indicate ~;g.~ .I su~ iull by So~c 4 (P<0.05 or better).
Bo~ ond i ' ' v~ues l ~ E~ ~; ~ - l1 ~ .~1, -- .. _.. 1
' This clone contains oligo K site which is the insulin response element of the TG ~.uu-~t~.
P., et al., (1992) Mol. F....l~ ~;--- 1 6, 1310-1317; Francis-Lang, H., et al., (1992)
Mol. Cell Biol. 12, S76-S88; Aza Blanc, P., et al., (1993) Mol. F..~. ~ ;--nl 7, 1297-1306).
Fiqure Leqend for Table VI. FRTL-5 cells were
grown to near confluency in 6H medium (plus TSH) then were
maintained in 5H medium (no TSH) for 7 days before being
transfected with the noted chimeras, as described in
Examples 7 and 8 and Figure 16A, using DEAE Dextran.
Control cells were transfected with vector alone. CAT
activity was measured as described (Example 7; Example 8,
Materials and Methods). The absence of an ef~ect on p(-
127), but a significant effect on p(-127NP)CRE, is
consistent with the data in Figure l9C vs 19B.
,.
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 131-
o
TABLE VII
Effect of MMI on the activity of class I-CAT chimeras or
on thiors~Y; n activity when Sox-4 is cotran~fected into
FRTL-5 thyroid cells maint~ ~9A in 5H medium plu~ 5
~er-m.
s
Class I ~'~TM~ CHIMERA THIOREDOXIN TH~OREDOXIN
CAT A~ vl~ A~; llVl-l-Y A~ vll~ A~;~1V1~Y
Ch~mera NO MMI PLUS MMI PLUS Sox-4 PLUS MMI
RATIO RATIO NO MMI ~% of
(+ Sox-4/ (~ Sox-4/ (% of CONTROL)
no Sox-4) no Sox-4) CONTROL)
pSVo 1.0 1.0 i0.2 1.0 2.6
p(-1100) 0.5 0.15 1.0 2.9
p(-400) 0.45 0.2 1.0 3.2
Bold values indicate significant suppression by Sox-4 plus
IS MMI more than Sox-4 without MMI (P~0.05).
Bold and underlined values indicate no significant effect
by transfection.
Bold and italicized value~ indicate significant effect by
MMI.
Fiqure Leqend for Table VII. FRTL-5 cells grown
to near confluency in 6H medium (plus TSH) then maintained
in 5H medium (no TSH) for 7 days before being transfected
with a control plasmid or a plasmid containing Sox-4 DNA.
Cells were then treated with or without 5mM MMI for 40
hours. CAT activity was measured as described (Example 7;
Bxample 8, Materials and Methods). The MMI treatment
decreased CAT activity of Sox-4 transfectants further than
in cells transfected with control vector (Pc0.05). Figure
16B notes the structure of each chimeric CAT construct
used.
CA 02229938 1998-02-19
W O 97/07404 PC~AUS96/137IS
- 132-
Exam~le 9
Identification of a Downstream Silencer
and its Role in Hormone
; and MMI Reduction o~ Class I Levels
Materials and Methods
SMaterial s . TSH, hormones, and other materials
are the same as in Examples 6 and 8.
Cell cul ture. FRT~-5 rat thyroid cells
(Interthy~ Research Foundation, Baltimore, MD; ATCC No.
CRL 8305) were a fresh subclone (Fl) that had all
l0propertie8 previously detailed (Saji, M., et al. (1992a);
Saji, M., et al. (1992b); Kohn, L.D., et al. (1992)
Intern. Rev. Immunol. 9, 135-165; Kohn, L.D., et al.
(1995) In: Vitamins and Hormones (Litwack, G., ed.)
Academic Press, San Diego 50, 287-384; Ikuyama, S., et al.
l5(1992) Mol. Endocrinol. 6, 793-804; Ikuyama, S., et al.
(1992) Mol. Endocrinol. 6, 1701-1715; Shimura, H., et al.
(1994) Mol. Endocrinol. 8, 1049-1069; Ohmori, M., et al.
(1995) Endocrinology, 136, 269-282; .~;ml~ra, H., et al.
(1995) Mol. Endocrinol. 9, 527-539; ~;mllra, Y., et al.
20(1994) J. Biol. Chem. 269, 31908-31914; Kohn, L.D., et al.
(1986) Sept. 2, U.S. Patent 4,609,622) (Examples 6 and
8). In different experiments, as noted, cells were
maintained in 5h medium which contains no TSH or 3H medium
which contains no TSH, insulin, or hydrocortisone.
Construction of MHC class I promoter-CAT
chimeric plasmids. Construction of the CAT chimeras of the
PD1 swine 5'-flanking sequences, p(-1100)CAT, p(-549)CAT,
p(-400)CAT, p(-203)CAT, and p(-127)CAT has been described
(Examples 6, 7, 8; Ehrlich, R., et al. (1988) Mol. Cell
30Biol. 8, 695-703; Weissman, J.D. and Singer, D.S. (1991)
t~ Mol. Cell. Biol. 11, 4217-4227; Maguire, J.E., et al.
(1992) Mol. Cell. Biol. 12, 3078-3086; Howcroft, T.K., et
al. (1993) EMBO J. 12, 3163-3169; Giuliani, C., et al.
(1994) J. Biol. Chem. 270:11453-11462) (Examples 7 and 8).
Plasmid pSVGH, constructed to evaluate
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 133-
transfection efficiency (Ikuyama, S., et al. (1992) Mol.
Endocrinol. 6, 1701-1715), was a BamHI-EcoRI fragment
encoding the human growth hormone (hGH) gene, isolated
from pOGH (Nichols Institute, San Juan Capistrano, CA) and
inserted into the BamHI-XbaI site of the pSG5 expression
vector (Stratagene, La Jolla, CA).
Transi en t expressi on analysi s - Transient
transfections using FRTL-5 cells have been described
previously (Ikuyama, S., et al. (1992) Mol. Endocrinol. 6,
1701-1715; Shimura, H., et al. (1994) Mol. Endocrinol. 8,
1049-1069; Ohmori, M., et al. (1995) Endocrinology, 136,
269-282; Shimura, H., et al. (1995) Mol. Endocrinol. 9,
527-539; Shimura, Y., et al. (1994) J. Biol. Chem. 269,
31908-31914; Giuliani, C., et al. (1995) J. Biol. Chem.
270:11453-11462. Examples 7 and 8).
CAT assays were performed as described (Ikuyama,
S., et al. (1992) Mol. Endocrinol. 6, 1701-1715; Shimura,
H., et al. (1994) Mol. Endocrinol. 8, 1049-1069; Ohmori,
M., et al. (1995) Endocrinology, 136, 269-282; Shimura,
H., et al. (1995) Mol. Endocrinol. 9, 527-539; Shimura,
Y., et al. (1994) J. Biol. Chem. 269, 31908-31914;
Giuliani, C., et al. (1994) J. Biol. Chem. 270:11453-
11462. Gorman, C.M., et al. (1982) Mol. Cell Biol. 2,
1044-1051, Examples 7 and 8) using 10-30 ~g cell lysate in
a final volume of 130 ~l. Incubation was at 37~ for 4
hours with acetylCoA supplementation (20 ~l of a 3.5 mg/ml
solution) after 2 h.
Cellular extracts. Cell extracts were made by a
modification of the method of Dignam et al. (Dignam, J.,
et al. (1983) Nucleic Acids Res. 11, 1475-1489; Examples 6
and 8). Nuclear extracts also used were made with the
procedure in Example 8.
El ec trophore ti c mobi 1 i ty shi f t assay~ (EMSA)
Oligonucleotides used for EMSA were synthesized or were
purified from 2 ~ agarose gel using QIEAX (Quiagen,
Chatsworth, CA) following restriction enzyme treatment of
CA 02229938 1998-02-19
W O g7107404 P ~ AUS96/I37I5
- 134-
the ~h;m~ic CAT constructs described above (Examples 6
and 8).
Electrophoretic mobility shift assays were
performed basically as previously described (Ikuyama, S.,
et al. (1992) Mol. Endocrinol. 6, 1701-1715; Shimura, H.,
et al. (1994) Mol. Endocrinol. 8, 1049-1069; Ohmori, M.,
et al. (1995) Endocrinoloqy, 136, 269-282; Shimura, H., et
al. (1995) Mol. Endocrinol. 9, 527-539; Shimura, Y., et
al. (1994) J. Biol. Chem. 269, 31908-31914; Giuliani, C.,
et al. (1995) J. Biol. Chem. 270:11453-11462;
Hennighausen, L. and Lubon, H. (1987) Methods EnzYmol.
152, 721-735, Examples 6, 8, 10 and 11).
In experiments using CREB and other antiserum,
extracts were incubated in the same buffer containing
antiserum or normal rabbit serum at 20~ for 1 h before
being processed as above.
Footprinting Using the 1, 10 -Phenanthroline-
Copper Ion Procedure. Footprinting, using
1,10-phenanthroline-copper ion, was carried out
essentially as described by Kuwabara and Sigman (Kuwabara,
M. D. and Sigman, D. S. (1987) Biochemistry 26,
7234-7238). After scaling-up the EMSA using an
end-labelled fragment, Frl68, comprising -168 through -1
bp of the PD1 promoter, the gel was immersed in 200 ml of
50 mM Tris-HCl, pH 8.0 and 20 ml each of the following
solutions were added: 2 mM 1,10-orthophenanthroline
containing 0.45 mM CuSO4 and 58 mM 3-mercaptopropionic
acid. After 15 min at room temperature, 20 ml of 28 mM
2,9-dimethylorthophenanthroline was added to quench the
reaction; and, after 2 min, the gel was rinsed extensively
in distilled H2O and autoradiographed for 40 min at 4~C
~' until the retarded bands were visible. Bands with
protein/DNA complexes of interest were excised and eluted
overnight at 37~C in 0.5 M ammonium acetate containing
0.1~ sodium dodecyl sulfate (SDS) and 10 mM magnesium
acetate. The eluted DNA with was precipitated with
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 135-
ethanol and resuspended in distilled H2O. Equal numbers
of counts of each sample were dried, resuspended in 98 ~
formamide cGntaining 10 mM EDTA, 0.025~ bromophenol blue,
and 0.025~ xylene cyanol, and separated on an 8
sequencing gel along with G+A and C+T Maxam-Gilbert
sequence reactions (Maxam, A. M. and Gilbert, W. (1980)
Methods EnzYmol. 65, 499-560) performed u8 ing the same
probe. Autoradiography was at -80 C overnight.
RESULTS
The CRE- 1 ike Sequence Be tween -10 7 and -10 0 bp
Functions a~ a Constitutive Silencer Element. MHC class I
gene transcription in thyroid cells is repressed by TSH,
through its cAMP signal (Saji, M., et al. (1992a) Saji,
M., et al. (1992b). One of these studies (Saji, M., et
al. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 1944-1948)
mapped the TSH response to within 127 bp of initiation of
transcription. ~m; n~tion of the sequence in this DNA
segment (Figure 9) revealed the presence of an 8 bp
sequence (-107 to -100 bp) with homology to characterized
CREs (Montminy, M.R., et al. H. (1986) Proc. Natl. Acad.
Sci. U. S. A. 83, 6682-6686; Habener, J.F. (1990) Mol.
~ndQcrinol. 4, 1087-1094). To determine whether this CRE-
like element functions to regulate class I promoter
activity, a set of derivative constructs was generated
from a parental construct containing 127 bp of 5' flanking
sequence p(-127CAT). In one derivative, the 8 bp CRE-like
sequence was simply deleted; in the other, a
nonpalindromic mutation of the CRE octamer was substituted
for the CRE-like sequence. Both constructs displayed
increased promoter activity, relative to the parental
construct, when transfected into FRTL-5 cells maintained
in 3H medium plus 5~ calf serum (Fig. 25A) or 5H medium '.
plus 5~ calf serum (data not shown).
The ability of the CRE-like element to silence a
heterologous promoter was assessed by introducing a 38 bp
DNA segment, spanning -127 to -90 bp, downstream of an
CA 02229938 1998-02-19
W O 97/074~4 PCTAUS96~3715
- 136-
SV40 m;n;m~l promoter (Ibuyama S. et al. (1992) Mal.
Endocrinol., 6:1701-1715; Shimura H., et al, (1994) Mol.
Endocrinol, 8:1049-1069; Ohmori M. et al. (1995)
~ocrinoloqy, 136:269-282; Shimura Y., et al. (1994) J.
Biol. Chem., 269:31909-31914) (Fig. 25B). When placed in
a 5' to 3' orientation, a single copy of this DNA segment
was able to significantly reduce SV40 promoter activity;
and the magnitude of the effect increased with the number
of copies-of the 38 bp segment inserted (Fig. 25B). When
placed in a 3' to 5' orientation, two copies of this DNA
segment were able to significantly reduce SV40 promoter
activity. Derivatives of the 38 bp segment, containing
either a deletion or nonpalindromic mutation of the CRE-
like element, had no significant effect on SV40 promoter
activity (Fig. 25B). These data (Fig. 25B) were obtained
in cells maintained in 3H medium plus 5~ calf serum; the
same results were obtained with cells maintained in 5H
medium plus 5~ calf serum (data not shown).
From these data, it wa~ concluded that the 8 bp
CRF-like site is important in FRTL-5 rat thyroid cells for
the function of a constitutive silencer located in a 38 bp
fragment of the class I 5'-flanking region, -127 to -90 bp
from the start of transcription. In addition, we conclude
that expression of the silencer activity related to the
CRE-like site is unaffected by the presence or absence of
hydrocortisone; we have separately (Giuliani, C., et al.
(1995) J. Biol. Chem. 270:11453-11462) located the
hydrocortisone action to suppress class I gene expression
in FRTL-5 cells to a different element, Enhancer A, -180
to -170 bp from the start of transcription.
TSH or Forskolin Treatment of FRTL-5 Thyroid
~e Cells Induce~ a Novel Protein/DNA Complex Whose Formation,
Like Silencer Activity, Depends on the CRE-like Site.
Because TSH/forskolin treatment of FRTL-5 cells results in
reduced transcription from the class I promoter (Saji, M.,
et al. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,
CA 02229938 1998-02-19
WO 97/07404 PCTrUS96/13715
- 137-
1944-1948; Saji, M., et al. (1992) J. Clin. Endocrinol.
Metab. 75, 871-878), it was of interest to determine
whether TSH/forskolin altered or induced the formation of
any novel protein/DNA complexes with the region containing
the CRE-dependent silencer activity. A DNA fragment
extending from -168 bp to +1 bp (Frl68; Fig. 26A) was used
in gel mobility shift assays with extracts derived from
FRTL-5 cells cultured with or without lxlO-I~ M TSH for 48
hours (Fig. 26B). A multiplicity of protein/DNA complexes
were formed with either extract. The protein/DNA
complexes A to D were common to both extracts, were not
altered by TSH treatment of the cells, and appeared to
derive from protein interactions with DNA sequences
located between -89 and +1. This was suggested by the
fact that 100-fold excess of unlabeled fragment 127
(Frl27), -127 to +1 bp, could compete for these complexes,
whereas the CRE-like silencer element extending from -127
(Figure 26B, lanes 6 and 7) to -90 bp, termed CRE-l, had
no effect on these protein/DNA complexes (Fig. 26B, lanes
4 and 8). The complex labeled E appears to be non-
specific, since it is not eliminated by any competitor DNA
fragment. It was notable, however, that TSH treatment of
the FRTL-5 cells induced the formation of two novel
complexes, F and G (Fig. 26B, lane 5 vs lane 1). As
evidenced by the following, their formation was specific
2~ and required the CRE-like site important for silencer
activity.
Formation of the TSH-induced F and G complexes
could be prevented not only by unlabeled DNA fragments
extending from -168 to +1 or from -127 to +1 bp (Fig. 26B,
+TSH, lanes 6 and 7 vs 5), but also by the -127 to -90 bp
fragment containing the CRE-like site, termed CRE-l (Fig.
26B, +TSH, lane 8 vs 5). In addition, as illustrated in
studies with the G complex, DNA footprint analyses of the
TSH-induced complexes, using a procedure involving
l/lo-phenanthroline-copper ions, identified a protected
CA 02229938 1998-02-19
W O 97/07404 PCTnUS96/l371
- 138-
region bounded by two strong hypersensitive sites, -131 to
-95 bp. The CRE-like site, -107 to -100 bp, lies within
this protected region and is demarcated by a less
~ prominent hypersensitive band at -110 bp and the prominent
site at -95 bp. A hypersensitive site at -103 bp in the
middle of the CRE-like site was also observed. Similar
data were obtained with complex F. These data established
that the TSH-induced F and G complexes involved the 38 bp
region which has silencer activity that is dependent on
the CRE-like site. These data do not, however, restrict
the downstream silencer region to this 38bp segment; the
silencer activity of this segment can extend to 10
nucleotides in the 3' direction to -80 bp of the PDI class
I 5' flanking region. Thus a 48 bp segment -127 to -80
bp, duplicates all activity of the 38 bp silencer in this
and subsequent experiments and its activity is CRE
dependent.
Forskolin (10 ~M) could substitute for TSH to
induce the formation of the F and G complexes and the
formation of both was prevented by the -127 to -90 bp
CRE-1 DNA fragment with the CRE-like site. Moreover,
using extracts from forskolin- as well as TSH-treated
cells (data not shown), we showed that their formation was
also prevented by the -127 to -90 bp fragment, wherein a
consensus CRE sequence was substituted for the CRE-like
sequence, but not by derivative oligonucleotides from
which the CRE-like element had been removed, either by
deletion (ACRE) or a nonpalindromic (NP-CRE) substitution.
The region of the 38 bp silencer 5' to the CRE was not
able to inhibit formation of the TSH/cAMP-induced complex
nor was a shortened form of CRE-1, termed CRE-2, with only
6 base pairs on either side of the CRE octamer. These
data established that the TSH-induced formation of the
novel F and G complexes is mediated by the cAMP signal of
TSH, exactly as is TSH-induced suppression of class I RNA
levels (Saji, M., et al. (1992) Proc. Natl. Acad. Sci. U.
CA 02229938 1998-02-19
WO 97/07404 PCTAUS96/13715
- 139-
S. A. 89, 1944-1948; Saji, M., et al. (1992) J. Clin.
~ndocrinol. Metab. 75, 871-878), and that formation of the
TSH/cAMP-induced complexes requires the CRE-like sequence
important for silencer activity. They additionally
suggest that sequences flanking the CRE-like site might be L
involved in complex formation, consistent with the
extended DNA footprint and studies of complexes with other
CRE sites (Montminy, M.R., et al. H. (1986) Proc. Natl.
Acad. Sci.. U. S. A. 83, 6682-6686; Habener, J.F. (1990)
Mol. Endocrinol. 4, 1087-1094; Ikuyama, S., et al. (1992)
MQ1. Endocrinol. 6, 1701-1715).
Similar EMSA data were obtained using
radiolabeled Frl27, -127 to +1 bp, with extracts derived
from FRT~-5 cells incubated with or without TSH. As with
Frl68, extracts from either TSH-treated or untreated cells
generated a series of complexes, all of which could be
competed by unlabeled Frl27 or Frl68. Once again, TSH or
forskolin induced the appearance of a novel protein/DNA
complex. The TSH-induced complex could be specifically
competed by unlabeled CRE-1, the 38 bp DNA fragment
extending from -127 to -90 bp. In contrast, derivative
oligonucleotides from which the CRE-like element had been
removed, either by deletion (~CRE) or substitution (NP
CRE), were unable to compete for or form the TSH-induced
band. A derivative into which a consensus canonical CRE-
site was introduced (CON-CRE) was as efficient in
competition as the native sequence (CRE-1). A DNA
fragment containing only sequences 5' of the CRE-like
element, from -127 to -108 bp, could not compete ~or the
TSH-induced band.
MMI and TSH Induce the Formation of a Protein
Complex with the CRE-like Sequence of the 38 bp Downstream
Silencer, -127 to -89 bp; Its Formation and Function
Depends on a Protein Interacting With the Insulin Response
Element of the TSH Receptor (TSHR) In the above results
(Figure 26), we used electrophoretic mobility shift assays
CA 02229938 1998-02-19
W 097/07404 PCTAUS96n3715
- 140-
(EMSA) and radiolabeled DNA fragments extending from -168
or -127 bp to +1 bp to identify a TSH/cAMP-increased
protein/DNA complex interacting with the CRE site of the
38 bp silencer. Treatment of the FRTL-5 cells with 5 mM
MMI (Fig. 27A, lane 2 vs 1, arrow), as well as TSH (Fig.
27A, lane 5 vs 1, arrow), induced the formation of a
similarly sized protein DNA complex with the radiolabeled
168 bp fragment. Treatment with TSH plus MMI increased
formation.of the protein DNA/complex more than either
treatment alone (Fig. 27A, lane 4 vs 2 or 5); in 7
experiments, when increases were quantitated
densitometrically, the ratio of the complexes induced by
TSH, MMI, or both was, respectively, 1 i 0.2, 0.8 i 0-3,
and 2.2 i 0-3-
The ability of FRTL-5 cell extracts to form the
TSH-induced complex with the radiolabeled 168 bp fragment
is prevented by an unlabeled oligonucleotide with the 38
bp sequence of the silencer element, -127 bp to -90 bp
(Figure 26B), but not by an oligonucleotide with the
CRE-like site within the silencer deleted or with the
CRE-like element replaced by a nonpalindromic mutation.
The complex induced by MMI is also prevented by a 250-fold
excess of the unlabeled 38 bp silencer, termed CRE-1 (Fig.
27B, lane 3 vs 2) but not by the same amount of silencer
oligonucleotide with a nonpalindromic substitution of the
CRE-like site (Fig. 27B, lane 4 vs 2). Thus, formation of
the MMI- as well as the TSH-increased silencer complex
requires an intact CRE-like sequence.
Formation of the protein/DNA complex induced by
MMI, TSH, or both involve an insulin/serum-sensitive
~ 30 factor. Thus, a 200-fold excess of an oligonucleotide
f having the sequence of the insulin-responsive element
(IRE) of the TSHR, oligo TIF (TSH receptor
insulin-response factor) (Shimura, Y., et al., (1994) J.
Biol. Chem. 269, 31908-31914), was able to prevent the
formation of the complex induced by MMI (Fig. 27A, lane 3
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/137~5
- 141-
v8 2), TSH (Fig. 27A, lane 9 vs 5) and MMI plus TSH (Fig.
27A, lane 8 vs 4) when added to the binding mixture in
vitro. The effect of oligo TIF was specific, since an
oligonucleotide having the sequence of the insulin
response element of the TG promoter, oligo K (Santisteban,
P., et al., (1992) Mol. Endocrinol. 6, 1310-1317), did not
prevent the formation of the complex induced by TSH (Fig.
27A, lane 7 vs 5 and 9) or by MMI plus TSH (Fig. 27A, lane
6 vs 4 and.8). The lack of involvement of Sox-4, the
protein reactive with oligo K, in the TSH-induced or MMI-
induced complex is consistent with the dominance of the
downstream CRE-containing silencer. However, if the CRE
is deleted or mutated, Sox-4 can act downstream as
evidenced in Figure l9C by the ability of oligo K to
increase CAT activity of p(-127NP) CAT. This reflects the
presence of two Sox-4 reactive sites, one between the
interferon response element of approximately -161bp and
the downstream silencer at -127bp, the other between -89
and -68bp. These are expressed only when the CRE, -107 to
-lOObp, is mutated or deleted (Figure l9C and Table VI).
The same data were evident using the -127 to +1
bp fragment. Thus, 5 mM MMI treatment of the cells
induced the formation of a complex when fragment 127 was
substituted as the radiolabeled probe. The complex had
the same mobility as the TSH-induced complex. MMI plus
TSH additively increased the formation of the complex; and
oligo TIF added in vitro, but not oligo K, prevented
MMI/TSH-induced complex formation. Formation of the
TSH/MMI-induced complex was prevented by including a
250-fold excess of the unlabeled 38 bp silencer, CRE-1, in
the incubation. Finally, MMI-treated extracts did not
form the new complex when the radiolabeled 127 bp fragment
had a nonpalindromic substitution of the CRE-like site,
indicating the CRE-like octamer is necessary to form the
MMI-induced complex.
CA 02229938 1998-02-19
W O 97/07404 PCTAUS96/1371
- 142-
The TSHR insulin response element, -220 to -188
bp, has been found to have two regions able to form
protein/DNA complexes with FRTL-5 cell extracts (Shimura,
~ Y., et al., (1994) J. Biol. Chem. 269, 31908-31914).
Proteins interacting with the more 3' region (Fig. 28C,
black bar) are associated with insulin responsiveness,
since a mutant of this region, mutant 1 (Fig. 28C), loses
insulin responsiveness after CAT chimeras of the minimal
TSHR promo~er are transfected into FRTL-5 cells. Mutant
1, also looses Y-box protein reactivity (Example 11).
Proteins interacting with the 5' region (Fig. 28C, cross
hatched area) are single strand binding proteins; mutation
of this region, as in mutant 2 (Fig. 28C), retain insulin
responsiveness but lose their ability to bind the single
strand binding proteins (Shimura, Y., et al., (1994) J.
Biol. Chem. 269, 31908-31914). The swine class I
promoter-CAT ch;me~a was transfected into FRTL-5 cells
with a plasmid cont~;n;ng an oligonucleotide with the
se~uence of one or the other oligo TIF mutants or oligo K
and half of each set of transfected cells was treated with
MMI. Cotransfection of the TIF mutant 2 oligonucleotide
with p(-127)CAT resulted in a significant (P<0.01) loss
in MMI-decreased promoter activity (Fig. 28B) but no
significant change in basal or constitutive activity.
There was no effect on MMI activity in cells cotransfected
with the plasmid containing oligo K, the TG insulin
response element, as will be evident below. It was also
not duplicated by cotransfection with the plasmid
containing oligo TIF mutant 1 (data not shown).
Cotransfection of the plasmid containing oligo TIF mutant
2 eliminated the MMI-induced decrease evident in the
p(-llOO)CAT chimera (Fig. 28A), suggesting its effect on
the downstream silencer is a dominant effect on MMI action
to decrease promoter activity. The ability of oligo TIF
to increase the basal activity of p(-llOO)CAT without MMI
(Fig. 28A) may reflect the interactive relationship the
CA 02229938 1998-02-19
W O 97/07404 PCT~US96/13715
- 143-
downstream silencer and the enhancer associated with the
upstream silencer, which will be described below.
(Example 10)
When the oligo TIF mutant 2 is transfected into
cells, it binds the insulin responsive factor important in
S the formation of the MMI/TSH-induced protein DNA complex
with the downstream silencer. It thereby prevents the
MMI/TSH-induced decrease in class I promoter activity.
The inability of oligo K or oligo TIF mutant 1 to prevent
the MMI-induced decrease in promoter activity insures that
the effect is specific for the factor interacting with the
TSHR insulin response element and that it is the
insulin-sensitive factor and/or the Y-box protein, TSEP-1,
rather than the single strand binding protein (SSBP) which
can interact with the oligo TIF sequence (See Example 11).
These data support the conclusion that MMI and TSH
independently and additively induce the formation of a
protein complex with a 38 bp silencer element between
-127 and -89 bp and that formation of the complex in each
case requires the presence of the CRE-like site within the
silencer. Its formation requires, in addition, an
insulin/serum-responsive factor which also interacts with
the insulin response element in the TSHR mlnimAl promoter.
Formation of the MMI/TSH-increased complex with the
silencer (Figs. 26 and 27) is functionally associated with
the MMI/TSH effect on class I gene expression (Fig. 28).
The 38 bp Class I Region Cont~ining the
CRE-dependent Silencer Element Forms Complexes with
Multiple Proteins, Some of Which are Involved in
cAMP-induced Negative Regulation of TS~R. To characterize
proteins capable of interacting with the 38 bp silencer
element, a double-stranded oligonucleotide spanning the
segment -127 to -90 bp was radiolabeled and used in gel
shift assays with FRTL-5 cell extracts (Fig. 29). Four
sets of complexes were observed (A-D), all of which
appeared to be specific, since their formation was
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96113715
- 144-
prevented by competition with unlabeled probe (Fig. 29A,
lanes 3-6 vs 2), albeit with different affinities. Like
the TSH/MMI-induced complex with Frl68 (Figs. 26 and 27)
a or Frl27, formation of all the complexes was dependent on
the CRE-like element. Thus, their formation was not
S inhibited by the 38 bp silencer in which the CRE was
deleted (Fig. 29A, ACRE-1, lanes 7-9, ~s 2) or mutated to
its nonpalindromic form.
One of the protein/DNA complexes formed with the
38 bp silencer in the A region was inhibited by an
oligonucleotide, 5'-AGAGATTGCCTGACGTCAGAGAGCTAG-3' from
Promega, which contains a consensus CRE (underlined) but
9-10 otherwise unrelated flanking nucleotides from the
somatostatin CRE (Fig. 29A, lanes 10-12 ~s 2). The same
complex could be super-shifted (Fig. 29B, lane 4) with
antibody to CRE binding protein-327 (CREB) (Waeber, G., et
al. (1991) Mol. Endocrinol. 5, 1418-1430) but not (Fig.
29B, lanes 1-3) by anti-CREB2, anti-mXBP, or
anti-activating transcription factor-2 (ATF2-BR). One
protein interacting with the CRE-like site in the 38 bp
silencer, -127 to -90 bp can, therefore, be identified as
CREB (Montminy, M.R., et al. H. (1986) Proc. Natl. Acad.
Sci. U. S. A. 83, 6682-6686; Habener, J.F. (1990) Mol.
Endocrinol. 4, 1087-1094; Waeber, G., et al. (1991) Mol.
Endocrinol. 5, 1418-1430; Hoeffler, J.P., et al. (1988)
Science 242, 1430-1433; Deutch, P.J., et al. (1988) J.
Biol. Chem. 263, 18466-18472) or an immunologically
related CRE binding protein.
Two of the double strand binding proteins in the
A and B complexes in Figure 29A, in addition to CREB, are
thyroid transcription factor-1 (TTF-1) and Pax-8. TTF-1
f is a thyroid-specific transcription factor important for
full expression of the TSHR in FRTL-5 thyroid cells
(Shimura, H., et al. (1994) Mol. Endocrinol. 8, 1049-1069;
Ohmori, M., et al. (1995) Endocrinology, 136, 269-282;
Shimura, H., et al. (1995) Mol. Endocrinol. 9, 527-539;
CA 02229938 1998-02-19
WO 97/07404 PCTrUS96/13715
- 145-
Civitareale, D., et al. (1993) Mol. Endocrinol. 7,
1589-1595). TTF-1 and Pax-8 are necessary for
thyroid-specific expression of the thyroglobulin and
thyroid peroxidase genes (Civitareale, D., et al. (1989)
EMBO J. 8, 2537-2542; Guazzi, S., et al. (1990) EMBO J. 9,
631-3639; Francis-Lang H, et al. (1992) Mol Cell Biol
12:576-588; Kikkawa, F., et al. (1990) Mol. Cell. Biol.
10, 6216-6224; Mizuno, K., et al. (1991) Mol. Cell. Biol.
11, 4927-4933; Lazzaro, D., et al. (1991) Development 113,
1093-1104; ~nn;n;, M., et al. (1992) Mol. Cell. Biol. 12,
4230-4241). TTF-1 is a homeodomain-containing,
DNA-binding protein which is expressed from the onset of
thyroid differentiation (Civitareale, D., et al. (1989)
EMBO J. 8, 2537-2542; Guazzi, S., et al. (1990) EMBO J. 9,
631-3639; Francis-Lang H, et al. (1992) Mol. Cell. Biol.
12:576-588; Lazzaro, D., et al. (1991) Development 113,
1093-1104). Pax-8 i8 a paired domain-containing protein
which binds to a sequence overlapping one of the TTF-1
recognition sites in the thyroglobulin and thyroid
peroxidase genes and is also involved in thyroid
differentiation (~nn; n;, M., et al. (1992) Mol. Cell.
Biol. 12, 4230-4241). The B complex in Figure 29A formed
with the 38 bp class I silencer comprises a protein/DNA
adduct with TTF-1; the A complex in Figure 29A involves a
Pax-8 adduct in addition to CREB. This is evidenced as
follows.
Formation of the B complex in Figure 29A with
the 38 bp class I silencer is inhibited by an
oligonucleotide with the sequence of the TTF-1 binding
element from the TSHR [Fig. 30B, lane 5 (TSHR oligo TTF-1)
vs 2], but not by a mutant form of the oligonucleotide
which loses its reactivity with TTF-1 (Fig. 30B, lane 6 vs
2). The TSHR TTF-1 binding site does not interact with
Pax-8 (Shimura, H., et al. (1994) Mol. Endocrinol. 8,
1049-1069; Ohmori, M., et al. (1995) Endocrinoloqy, 136,
269-282; Shimura, H., et al. (1995) Mol. Endocrinol. 9,
CA 02229938 1998-02-19
W O 97/074U4 PCTAUS96~37IS
- 146-
527-539; Civitareale, D., et al. (1993) Mol. Endocrinol.
7, 1589-1595). The same data were obtained in the
presence of 3 (Fig. 30B) or 0.5 ~g poly dI-dC. The
se~uences of each oligonucleotide are noted in Figure 30C;
their characteristics, their specificity for TTF-1, and
their inability to bind Pax-8 have been separately
detailed (Shimura, H., et al. (1994) Mol. Endocrinol. 8,
1049-1069; Ohmori, M., et al. (1995) Endocrinolo~y, 136,
269-282; .~h;ml7ra, H., et al. (1995) Mol. Endocrinol. 9,
527-539; Shimura, Y., et al. (1994) J. Biol. Chem. 269,
31908-31914).
The oligonucleotide which mimics the site on the
thyroglobulin promoter ,which interacts with TTF-1 or Pax-8
is termed oligo C (Civitareale, D., et al. (1989) EMBO J.
8, 2537-2542; Guazzi, S., et al. (1990) EMBO J. 9,
631-3639; Francis-Lang H, et al. (1992) Mol. Cell. Biol.
12:576-588). The sequences of oligo C and a mutant of
oligo C which has been shown to no longer act with TTF-1
or Pax-8 (Civitareale, D., et al. (1989) EMBO J. 8,
2537-2542; Guazzi, S., et al. (1990) EMBO J. 9, 631-3639;
Francis-Lang H, et al. (1992) Mol. Cell. Biol. 12:576-588)
are noted in Figure 30C. As would be expected, since it
interacts with TTF-1, oligo C can prevent formation of the
B complex in Figure 29A in either 3 or 0.5 ~g poly dI-dC
[Fig. 30B or 30A, lane 4 (TG oligo C) vs 2]. The oligo C
mutant (TG oligo C Mut.) does not, in contrast, prevent
formation of the B complex (Fig. 30A, lane 5 vs 2; Fig.
8B, lane 3 vs 2). This is consistent with the data above
which shows that complex B involves TTF-1, as evidenced
with the TSHR oligonucleotide which is specific for TTF-1.
Of interest, however, a portion of the A complex in Figure
29A is inhibited by oligo C (Figs. 30A or 30B, lane 4 vs
2), but not by its mutant (Fig. 30A, lane 5 vs 2; Fig.
30B, lane 3 vs 2), nor by the TSHR oligonucleotide
reactive only with TTF-1 (Fig. 3OB, lane 5 vs 4 or 2).
This indicates that a portion of the A complex in Figure
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 147-
29A represents a CRE-dependent interaction between Pax-8
and the 38 bp silencer, in addition to CREB.
Two other proteins interacting with the 38 bp t
CRE-1 oligonucleotide in a CRE-dependent manner are (a) a
single strand binding protein (SSBP) which binds to the
S noncoding strand of the TSHR promoter, immediately 5' and
contiguous with the TTF-1 site (Shimura, H., et al. (1995)
MQ1~ Endocrinol. 9, 527-539) and (b) a Y-box protein,
TSEP-1 (TSHR suppressor element protein-1), which binds to
the coding strand of the TSHR at site identified by the
existence of a decanucleotide tandem repeat, -163 to -141
bp in the minimal TSHR promoter (Example 11). This was
evidenced when the following possibilities were evaluated:
(a) that the decreased appearance of the C complex (Figure
29A) in the presence of higher concentrations of
poly(dI-dC) (Figure 30B) in the binding assays reflected a
less stringent sequence-specific binding reaction
exhibited by single-strand binding proteins and (b) that
both SSBP and TSEP-1 were involved.
First, formation of the C, but not the A and B
complexes of Figure 29A, with the double-stranded 38 bp
silencer termed CRE-1 was decreased by including either
the coding or noncoding strand of CRE-1 as an unlabeled
competitor in the binding reaction (Figure 31, lanes 2 and
3 vs 1, respectively). This suggested that the C
complexes involved the binding of proteins which could
also bind single strand DNA. Second, a single stranded
oligonucleotide including the SSBP binding site on the
TSHR noncoding strand, -194 to -169 bp (Figure 31C) and
one including the TSEP-1 binding site, -177 to -138 bp, on
the coding strand of the TSHR (Fig. 9C), each inhibited
the formation of the C complexes with the double-stranded
38 bp class I CRE-1 silencer element, -127 to -90 bp
(Figure 3lB, lanes 3, 4 and 6, 7, vs 2 and 5,
respectively). These data suggested that the single
strand binding proteins interacting with the 38 bp
CA 02229938 1998-02-19
W O 97/07404 PCT~US96/13715
- 148-
silencer in a CRE-dependent manner included two proteins
important for TSH/cAMP-induced suppression of the TSHR, in
addition to TTF-1.
~ Third, in competition studies using the coding
and noncoding strands of the 38 bp CRE-1 silencer as
radiolabeled probes (Fig. 32), TSEP-1, a Y-box protein
which interacts with three sites on the TSHR (Figure 32A,
bottom), inhibits formation of a specific protein/DNA
complex with the strand coding of CRE-1 (Figure 32A).
Each TSHR Y-box binding site contains a CCTC motif
(Example 11). Mutations of this motif (Mut. 2) result in
a loss or decrease in TSEP-1 binding to the TSHR and
decreased TSEP-1 suppression activity by comparison to
wild type sequence or another mutation (Mut. 1) not
involving the CCTC motif (Figure 32A, bottom). Using the
CRE-1 coding strand as radiolabeled probe, formation of a
major protein complex at the top of the gel was prevented
or reduced by including an excess of wild type or Mut. 1
oligonucleotide (Figure 32A, lane 2 vs lanes 3 -4, 6-7, and
9-10, respectively) but not Mut. 2 oligonucleotide (Figure
32A, lane 2 vs lanes 5, 8, and 11, respectively). The
SSBP binding domain on the TSHR (Figure 32B, bottom, dark
bar) is S' and contiguous with the TTF-1 binding domain on
the noncoding strand of the TSHR; mutation of two G
nucleotides (Figure 32B, bottom, underlined) results in
the decreased SSBP binding to the single strand
oligonucleotide containing the TSHR SSBP site but not
decreased TTF-1 binding to the double strand
oligonucleotide with the same mutation (Shimura, H., et
al. (1994) Mol. Endocrinol. 8, 1049-1069; Ohmori, M., et
al. (1995) EndocrinoloqY, 136, 269-282). Using the CRE-1
noncoding strand as radiolabeled probe, formation of a
major protein complex was reduced by including an excess
of wild type, single strand oligo able to bind SSBP
(Figure 32B, lane 2 vs lanes 3 and 5) but much less so by
CA 02229938 1998-02-19
WO 97/07404 PCTrUS96/13715
- 149-
the mutated SSBP oligonucleotide (Figure 32B, lane 2 vs
lanes 4 and 6).
The 38 bp CRE-1 region of the class I
5'-flanking region, -127 to -90 bp, which exhibits
CRE-dependent silencer activity and which is involved in
the formation of novel TSH/cAMP-induced protein complexes
that are also CRE-dependent, interacts with a multiplicity
of proteins in a CRE-dependent manner. Five of these
proteins can be identified herein, CREB, TTF-1, Pax-8,
TSEP-1, and SSBP. Four interact with the TSHR minimal
promoter in FRTL-5 thyrocytes: CREB, TTF-1, TSEP-1, and
SSBP. Three are known to be important for
TSH/cAMP-induced negative regulation of the TSHR in FRTL-5
thyroid cells: TTF-1, SSBP, and TSEP-1 (Ikuyama, S., et
al. (1992) Mol. Endocrinol. 6, 793-804; Ikuyama, S., et
al. (1992) Mol. Endocrinol. 6, 1701-1715; Shimura, H., et
al. (1994) Mol. Endocrinol. 8, 1049-1069; Ohmori, M., et
al. (1995) EndocrinoloqY, 136, 269-282; Shimura, H., et
al. (1995) Mol. Endocrinol. 9, 527-539; Shimura, Y., et
al. (1994) J. Biol. Chem. 269, 31908-31914; Example 11).
One, TSEP-1, is a Y-box protein. A human Y-box protein,
YB-1, also interacts with the MHC class II promoter and is
important for TSH/cAMP-induced suppression of class II
genes in lymphocytes (Ivashkiv, L.B. et al. (1991) J. Ex~.
Med. 174, 1583-1592; Vilen, B.J., et al. (1992) J. Biol.
Ch~m. 267, 23728-23734; Brown, A.M., et al. (1993) J.
Biol. Chem. 268, 26328-26333; Ivashkiv, L.B., et al.
(1994) Immunopharmacology 27, 67-77; Ting, J.P., et al.
(1994) J. Exp. Med. 179, 1605-1611; Wright, K.L., et al.
(1994) EMBO J. 13, 4042-4053; MacDonald, G.H., et al.
(1995) J. Biol. Chem. 270, 3527-3533).
TSH Modulation of the Multiplicity of Proteins
Interacting with the CRE-dependent 38 bp Class I Silencer
Element. TSH/forskolin-treatment of FRTL-5 thyroid cells
for 12 to 18 hours causes a maximal decrease in class I
RNA levels (Saji, M., et al. (1992a) Proc. Natl. Acad.
CA 02229938 l998-02-l9
WO 97/07404 P~AUS96~137
- 150-
Sci. U. S. A. 89, 1944-1948; Saji, M., et al. (1992b) J.
Clin. Endocrinol. Metab. 75, 871-878). Extracts from
cells treated with TSH for this period alter the amount
and composition of the protein/DNA complexes formed with
the 38 bp silencer region whose activity and binding
depends on the CRE (Figure 33). Thus, TSH treatment
results in markedly ~lm;n;shed formation of the A and B
complexes in Figure 29A but increased formation of the C
complexes .(Figure 33, lane 4 vs lane 2). In the A
complex, TSH significantly decreases the CREB interaction,
as evidenced by a diminished ability of anti-CREB-327 to
supershift the A complex. The TTF-1 B complex is also
decreased significantly. The simultaneous decrease of
both is of interest since the CRE binding proteins and
homeodomain proteins are known to act synergistically in
the TSHR (Shimura, H., et al. (1994) Mol. Endocrinol. 8,
1049-1069) and somatostatin receptor (Leonard, J., et al.
(1992) Proc. Natl. Acad. Sci. U. S. A. 89, 6247-6251;
Vallejo, M., et al. (1992) J. Biol. Chem. 267,
12868-12875; Leonard, J., et al. (1993) Mol. Endocrinol.
7, 1275-1283).
The addition of anti-CREB-327 in vitro mimics
the TSH-treatment in vivo to similarly increase C complex
formation (Fig. 33, lane 3 vs 2 by comparison to lane 4 vs
2) but does not, by comparison, change A or B complex
formation. This shows the increase in C complex induced
by TSH may reflect the decrease in TTF-1 and its synergism
with CREB.
TSH treatment decreases SSBP interactions with
the TSHR in parallel with decreased TTF-1 binding to the
TSHR (Shimura, H., et al. (1995) Mol. Endocrinol. 9,
527-539); it does not decrease TSEP-1 binding to the TSHR
(Example 11). This would suggest the apparent increase in
C complex formation induced by TSH or anti-CREB-327 does
not reflect an increase in the SSBP complex.
CA 02229938 1998-02-l9
W O 97/07404 PCT~US96/13715
- 151-
Since, therefore, TSEP-1 might be the protein
which exhibited a relative increase in the CRE-dependent
interaction with the 38 bp silencer, it was determined
whether it was an important component of the TSH-induced
increase in the novel complexes with FR168 or Frl27. An
oligonucleotide was able to bind TSEP-1, but not one
binding SSBP, TTF-1, CREB, or Pax-8 could decrease the
formation of the TSH-increased complex with FR168 (Fig.
34A), the~hy confirming this possibility. The TSEP-1
binding oligo used in this experiment is from the
insulin-sensitive element of the minimal TSHR promoter,
-220 to -188 bp (Figure 32B).
Since the CRE-like site has been shown to be a
critical component of a constitutive silencer (This
Example; Figures 25A-B)and to participate in the formation
of TSH-induced complexes (This Example, Figures 26A-B,
27A-B), it was of interest to determine its role in
negative regulation of class I gene expression by TSH/cAMP
or MMI. FRTL-5 cells transiently transfected with the
pCAT promoter constructs containing one two 38 bp DNA
segments, spanning -127 to -90 bp, downstream of an SV40
minimal promoter. As noted earlier (Fig. 25B), when
placed in a 5' to 3' orientation, a single copy of this
DNA segment was able to significantly reduce SV40 promoter
activity and the magnitude of the effect increased with
the number of copies of the 38 bp segment inserted (Figure
35B, C). Forskolin treatment of transfected cells
resulted in an additional decrease in promoter activity
(P~0.05) when a single copy was present, but not if two
copies were present (Figure 35B). The forskolin activity
is duplicated by treating cells with lxlO-1~ TSH or 5mM
MMI (data not shown). This indicated that TSH/cAMP and
MMI could increase the activity of the silencer.
When FRTL-5 cells were transiently transfected
with the series of 5' deletion constructs of the class I
promoter ligated to CAT, all of which share a common 3'
CA 02229938 1998-02-19
W 097/07404 PCTAUS96/1371
- 152-
terminus but differ in the length of upstream sequences
(Figure 16A, Figure 35A), TSH was still able to decrease
the promoter activity of p(-89)CAT (Figure 16A, 35A), from
- which the 38 bp silencer region containing the CRE, -107
to -100 bp is deleted. Therefore, despite the fact that
the CRE-like element functions as a constitutive silencer,
i8 required for the formation of TSH-induced protein/DNA
complexes, and exhibits TSH/cAMP responsiveness in the
pCAT promoter construct, other elements downstream of -89
bp are involved in cAMP repression of a class I promoter
activity.
To test whether any DNA sequences within 89 bp
of transcription initiation might be related to the 38 bp
CRF-1 silencer and the formation of the TSH-induced
protein/DNA complex by Frl68. The ability of the -89 to
+1 bp fragment (Fr89) to compete for the TSH-induced
complex formed by Frl68 was tested. As shown in Figure
36, lanes 3 and 4 vs lane 11, this 90 bp fragment could
compete for the formation of the TSH-induced band as could
FR127 (Figure 36, lane 2) or CRE-1 (Figure 36, lane 1).
The precise residues in the 90 bp fragment that compete
for complex formation have not yet been identified nor is
it clear which factor exhibiting CRE dependent binding to
the 38 bp silencer region binds to the 90 bp fragment.
TSEP-1 is a Y-box (Example 11), which binds to
CRE-1 and is involved in the formation of the TSH-induced
band with Frl68, as evidenced by competition with
oligonucleotides binding TSEP-1 from the TSHR Y-box
protein is known to interact at multiple sites of the MHC
class I 5~-flanking region including sequence within -89
~ 30 bp of the Class 1 promoter (Example 11).
Exam~le 10
Coordinate Regulation of the Upstream
Silencer/Enhancer and Downstream Silencer
As noted in Figure l9A-C, cotransfection of
oligo K with the p(-127)CAT ch'mera had no effect on
CA 02229938 1998-02-19
W O 97tO7404 PCTrUS96113715
- 153-
activity. However, oligo K had a profound stimulatory
effect on promoter activity when cotransfected with
p(-127NP)CAT, the nonpalindromic CRE mutation of
p(-127) CAT (Figure l9C). These data suggested that the
protein interacting with oligo K (Sox-4, Figure 20) and
important for upstream silencer function was able to
interact downstream, but its interaction was only evident
when the downstream silencer was inactivated. Removal of
the insulin-induced protein which is reactive with the
upstream silencer results in the expression of an
enhancer activity normally negated in p(127) CAT chimera by
the presence of the functional downstream silencer. There
is, therefore, coordination between the upstream and
downstream regions; the downstream silencer is,
nevertheless, functionally dominant and suppresses an
enhancer activity associated with the oligo K reactive
protein. (Sox 4; Figure 20)
Coordination between the upstream and downstream
promoter is also evidenced in EMSA. Thus, high
concentrations of the unlabeled 140 Fragment prevented
formation of the MMI or MMI/TSH-induced complex with the
CRE of the downstream silencer, when the 168 bp construct
was the radiolabeled probe (Figure 37A, lane 2 vs 1 and
3). One site on the 140 Fragment which interacts with
proteins involved in the formation of the downstream
silencer complex increased by TSH/MMI appears to be the
enhancer element. Thus, oligo E9, which inhibits
formation of only the enhancer complex of the 140 Fragment
(Figure 17), inhibits formation of protein/DNA complexes
formed by the downstream 38 bp silencer (Figure 37B, lane
8). Inhibition appears to be specific, since
oligonucleotides with AP-1 or Oct-1 consensus sequences do
not similarly inhibit complex formation with the
downstream silencer (Figure 37B, lanes 6 and 7), nor does
the Promega CRE oligonucleotide which represents the
somatostatin CRE sequence (Figure 37B, lane 7). Moreover,
CA 02229938 1998-02-19
W O 97~07404 PC~nUS96~3715
- 154-
the oligonucleotide with the sequence of the unlabeled 38
bp silencer (Figure 37B, lane 3, CRE-l) prevents formation
of all the complexes inhibited by E9.
There appears, therefore, to be an interaction
involving proteins binding to the upstream enhancer and
the downstream silencer, particularly those important in
negative regulation of the downstream silencer and TSHR.
Example 11
T-SEP-l, A Y-box Protein Is An Important
Regulator Of MHC Class I, Its Activity
Is TSH And MMI Requlated
Materials and Methods
Cloning of TSEP-1 - A ~gtll FRTL-5 thyroid cell
cDNA expression library (Akamizu, T., et al. (1990) Proc.
Natl. Acad. Sci. U. S. A. 87, 5677-5681) was screened by
Southwestern blotting (Vinson, C. R., et al. (1988) Genes
Dev. 2, 801-806) using the 32P-labeled coding strand
oligonucleotide, ssTR2(+) (Shimura, H. et al. (1993) J.
Biol. Chem. 268, 24125-24137.), which includes both
decanucleotides of the tandem repeat (TR) sequence in the
TSHR m;n;m~l promoter, -162 to -140 bp. The procedure was
otherwise the same as for cloning Sox-4 in Example 8.
Cells - Buffalo rat liver cells (BRL 3A, ATCC
CRL 1442) were grown in Coon's modified Ham's F-12
supplemented with 5 ~ fetal calf serum (Biofluids,
Rockville, MD?. FRTL-5 (ATCC CRL 8305) and FRT rat
thyroid cells were in the same medium (Ikuyama, S., et al.
(1992) Mol. Endocrinol. 6, 793-804; Ikuyama, S., et al.
(1992) Mol. Endocrinol. 6, 1701-1715; Shimura, H., et al.
(1993) J. Biol. Chem. 268, 24125-24137; Shimura, H., et
al. (1994) Mol. Endocrinol. 8, 1049-1069; Shimura, Y., et
al. (1994) J. Biol. Chem. 269, 31908-31914;
Ambesi-Impiombato, F. S. (1986) Fast-growing thyroid cell
strain. U.S. Patent 4, 608, 341; Ambesi-Impiombato, F. S.
and Coon, H. G. (1979) Int. Rev. Cytol. (Suppl.) 10,
163-171; Examples 6, 7 and 8).
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 155-
Protein production in E. coli - Recombinant
protein was produced using the pET system (Novagen,
Madison, WI). TSEP-1 cDNA insert was ligated to the EcoRI
site of the expression vector, pET-30(+), allowing the
His-Tag sequence to be linked to its N-terminus. After
transformation using E. coli BL21 (DE3), the procedure
described in Example 8 for Sox-4 was followed.
EMSA - Assays used synthetic single- or
double-stranded oligonucleotides, end-labeled with
[~y_32p] ATP and T4 polynucleotide kinase, then purified on 8
~ native polyacrylamide gels (Ikuyama, S., et al. (1992)
Mol. Endocrinol. 6, 1701-1715; Shimura, H., et al. (1993)
J. Biol. Chem. 268, 24125-24137; Shimura, H., et al.
(1994) Mol. Endocrinol. 8, 1049-1069; Shimura, Y., et al.
(1994) J. Biol. Chem. 269, 31908-31914); Examples 6 and
8). One ~g FRTL-5 nuclear extract or 50 ng recombinant
TSEP-1 were incubated with or without unlabeled competitor
oligonucleotides as described in Examples 6 and 8.
DNA-protein complexes were separated on 5 ~ native
polyacrylamide gels.
Nuclear extracts were prepared as previously
described (Ikuyama, S., et al. (1992) Mol. Endocrinol. 6,
1701-1715; Shimura, H., et al. (1993) J. Biol. Chem. 268,
24125-24137; Shimura, H., et al. (1994) Mol. Endocrinol.
8, 1049-1069; Shimura, Y., et al. (1994) J. Biol. Chem.
2~ 269, 31908-31914, or by the procedure described in Example
8. For large scale preparations, FRTL-5 extracts were
derived from cells grown to near confluency in 6H medium
then maintained in 5H medium (-TSH), for 7 days. Cells
were harvested by scraping, washed with Dulbecco's
modified PBS without Mg++Ca++ (DPBS), pH 7.4, and, after
centrifugation at 500xg, suspended in 5 pellet volumes of
0.3 M sucrose containing 2 ~ Tween-40, 10 mM HEPES-KOH, pH
7.9, 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EGTA, 0.5 mM DTT, 0.5
mM PMSF, 2 ~g/ml leupeptin, and 2 ~g/ml pepstatin A.
After freezing, thawing, and gentle homogenization, nuclei
CA 02229938 1998-02-19
W O 97/07404 ~US96fl37
- 156-
were isolated by centrifuging at 25,000xg on a 1.5 mM
D sucrose cushion containing the same buffer and lysed in 10
mM EGTA, 10 ~ glycerol, 0.5 mM DTT, 0.5 mM PMSF, 2 ~g/ml
- leupeptin, and 2 ~g/ml pepstatin A. After centrifugation
at 100,000xg for 1 h, the supernatant was dialyzed for use
in gel mobility shift analyses.
Resul ts
The 5'-decanucleotide in a tandem repeat (TR),
-162 to -1~0 bp, of the TSH receptor (TSHR) promoter is in
a CT-rich, S1 nuclease-sensitive region of the promoter
(Ikuyama S., et al., (1992) Mol. Endocrinol., 6, 793-803;
Ikuyama, S., et al., (1992) Mol. Endocrinol., 6, 1701-
1715; Shimura, H., et al., (1993) J. Biol. Chem., 268,
24125-24137). A nonthyroid-specific factor binds the
coding strand of the 5'-decanucleotide and decreases TSHR
gene expression by suppressing the constitutive enhancer
activity of the cAMP response element (CRE), -139 to -132
bp (Shimura, H., et al., (1993) J. Biol. Chem., 268,
24125-24137). A cDNA encoding the single-strand
DNA-binding protein interacting with the 5'-decanucleotide
(Figure 38A-B) and termed TSEP-1 has been cloned herein.
Thus, clone 40 (Figure 38A), 1405 bp, encoded a protein
with an open reading frame of 322 amino acids (Figure
38B). Sequence comparisons revealed that the protein
encoded by the open reading frame was similar to a rat
liver protein which was not characterized as a suppressor,
but, rather as an enhancer: enhancer factor 1A~ EFlA
(Ozer, J., et al., (1990) J. Biol. Chem., 265, 22143-
22152; Faber, M., et al., (1990) J. Biol. Chem., 265,
22243-22254) or rat CBBF/CDS (Petty, K.J., et al., GenBank
Accession Number M69138). EFIA was identified by its
ability to interact with the Rous sarcoma virus long
terminal repeat enhancer and promoter at two inverted
CCAAT box motifs. (Ozer, J., et al., (1990) J. Biol.
Chem., 265, 22143-22152; Faber M., et al., (1990) J. Biol.
Chem., 265, 22243-22254). Rat CBBP/CDS was cloned as a
CA 02229938 1998-02-19
WO 97/07404 PCT~US96/13715
- 157-
protein whose binding was necessary for constitutive
expression of the malic enzyme gene in the liver. TSEP-1 ~-
is approximately 95~ identical to three human Y-box
proteins. One is YB-1, a protein isolated from a
lymphoblastoid cell line as a binding factor to the major
histocompatibility complex class II inverted CCAAT motif,
termed the Y-box, from which the family derives its name
(Didier, D.K., et al., (1988) Proc. Natl. Acad. Sci.
U.S.A., 85, 7322-7326). The second is DbpB, a protein
nearly identical in sequence to YB-1 and cloned by its
ability to bind inverted CCAAT motifs in the EGFR enhancer
and the human c-erbB-2 enhancer (Sakura, H., et al. (1988)
Gene, 73, 499-507). The third, either related to or
identical to DbpB NSEP-1 (~;nn;hurgh, A.J. (1989) Nucleic
Acid Res. 17, 7771-7778; Kolluri, R., et al., (1992)
Nucleic Acid Res., 20, 111-116; Wolffe, A.P., (1992) New
Biol., 4, 290-298; Kolluri, R., et al., (1991) Nucleic
Acids Res. 19, 4771) which was cloned for its ability to
bind CT-rich, nuclease sensitive, single strand binding
elements of c-myc, EGFR, and Ki-ras.
These data indicated that the clone encoded a
protein that is a member of the Y-box family of proteins
(Wolffe, A.P., (1992) New Biol., 4, 290-298). One member
of this family, human NSEP-1, has been previously cloned
based on its ability to bind to single strand, CT-rich, S1
nuclease-sensitive promoter regions, similar to that
associated with the 5'-decanucleotide of the TR. However,
with the exception of human YB-1, which is a suppressor of
MHC Class II genes (Ivashkiv, L.B., et al., (1991) J. Ex~.
Med., 174, 1583-1582; Ivashkiv, L.B., et al., (1994)
Immunopharmacoloqy, 27, 67-77; Vilen, B.J., et al., (1992)
J. Biol. Chem., 267, 23728-23734; Brown, A.M., et al.,
(1993) J. Biol. Chem., 268, 26328-26333; Ting, J.P-Y, et
al., (1994) J. Ex~. Med., 179, 1605-1611; Wright, K.L., et
al., (1994) EMBO J., 13, 4042-4053; MacDonald, G.H., et
al., (1995) J. Biol. Chem., 270, 3527-353; Benoist, C., et
CA 02229938 1998-02-19
W 097107404 PCTAUS96/13715
- 158
al., (1990) Annu. Rev. Immuno., 8, 681-715; Didier, D.K.,
et al., (1988) Proc. Natl. Acad. Sci. U.S.A., 85, 7322-
7326), Y-box proteins are associated with enhancer rather
than suppressor activity. By cotransfection with
promoter-chloramphenicol acetyltransferase (CAT) chimeras
containing the intact TR sequence, or inactivating
mutations of each decanucleotide therein, we show that the
protein regulates the function of the 5'-, but not the
3~-decanucleotide. (Figure 39A-39C).
This was determined when the cloned cDNA
(Figures 38B-38B') was inserted into an expression vector,
pRcCMV-TSEP-1, and was tested for its ability to decrease
TSHR gene transcription by cotransfection with TSHR CAT
chimeras containing the intact TR sequence, pTRCAT5'-177,
or mutations of the 3', 5', or both decanucleotides
(Figure 39A), pTRCAT5'-177mtl, pTRCAT5'-177mt2, and
pTRCAT5'-177mtl+2, respectively (Shimura, H. et al.,
(1993) J. Biol. Chem. 268, 24125-24137). Mutation of each
decanucleotide in the TR results in significantly higher
CAT activity than exhibited by pTRCAT5'-177 (Figures 39B
and 39C); mutation of both results in an additive increase
in promoter activity (Figures, 39B and 39C), to levels
comparable to pTRCAT5'-146, containing the CRE but not the
TR (Ikuyama, S., et al., (1992) Mol. Endocrinol. 6, 1701-
1715; Shimura, H., et al., (1993) J. Biol. Chem. 268,
24125-24137). Each decanucleotide acts, therefore, as a
suppressor element. In 4 experiments, cotransfection of
pRcCMV-TSEP-l with pTRCAT5'-177, which contains both the
5'-and 3~-decanucleotides of the TR in their wild type
form, decreased CAT activity (Figures 39B and 39C) to
~ 30 levels 50 i 7~ those of cotransfections ~ith the pRc/CMV
control vector. There was no effect of the pRcCMV-TSEP-l
expression vector or pRc/CMV on p8CAT, the vector used to
construct pTRCAT5'-177. The Y-box protein that had been
cloned was, therefore, a suppressor of the TSHR. More
importantly, however, cotransfection of pRcCMV-TSEP-l
SUBSTITUTE SHEET (RULE 26)
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 159-
significantly (P~0.01) decreased pTRCAT5'-177mtl activity,
which has an intact 5'-decanucleotide sequence; the mean
decrease in 4 experiments was to 45 + 5~ of control
values. Cotransfection had no significant effect on the
activity of pTRCAT5'-177mt2, which has the mutated 5'-
S decanucleotide sequence (Figures 38B and 39C). Further,
cotransfection of pRcCMV-TSEP-1 with pTRCAT5'-177mtl+2,
which has both the 5'-and 3'-decanucleotides of TR
sequence mutated (Figure 39A), does not decrease CAT
activity, the same as cotransfections with pRc/CMV
(Figures 39B and 39C). These data indicated that the Y-
box protein family member encoded by the cDNA in Figure 38
suppresses TSHR gene expression by interacting with the
5'-but not the 3'-decanucleotide of the TR site and has
the functional suppressor characteristics predicted for
TSEP-1, despite its role as an enhancer in the liver.
Using oligonucleotides with the same mutations,
we show that the recombinant protein, termed TSEP-1 (TSHR
suppressor element protein-1), forms a specific
protein-DNA complex with the coding strand of the 5'-TR
sequence, but not with noncoding or double strand DNA
sequence.
Thus, confirming the functional data, the
recombinant Y-box protein encoded by the full length clone
in Figure 38 was shown to specifically bind the coding
sequence of the 5'-decanucleotide of the TR. Recombinant
His-tagged protein, produced in E. coli and affinity
purified, is approximately 45 kDA by SDS-polyacrylamide
gel electrophoresis (data not shown), consistent with the
42 kDa size of a Y-box protein (Spitkovsky, D.D., et al.,
(1992) Nucleic Acids Re~. 20, 797-803) plus the His tag.
In EMSA with 32P-labeled single-and double-stranded probes, t
the recombinant protein was bound by the coding strand of
the TR, ssTR2(+), the single-stranded oligonucleotide used
as the probe for cloning. It did not, however, bind to
oligonucleotides representing the noncoding [ssTR2(-)] or
CA 02229938 1998-02-19
W O971~74~4 PCTnUS96/13715
- 160-
double strand (dsTR2) of the TR. Further, the recombinant
protein did not bind to single- or double-stranded TRlCRE
probes, ssTRlCRE(+), ssTRlCRE(-), and dsTRlCRE, which
contain the 3'-decanucleotide of the TR in a functional
form (Ikuyoma, S. et al. (1992) Mol. Endocrinol. 6, 1701-
1715; Shimura, H. et al. (1993) J. Biol. Chem. 268, 24125-
24137) together with the CRE-like sequence of the TSHR
promoter. These data support the conclusion that the
member of.the Y-box family encoded by the clone in Figure
38 acts a~ a suppressor of TSHR gene expression by
interacting with the coding strand of the 5'-but not the
3'-decanucleotide of the TR.
Northern analyses indicate TSEP-1 is not
thyroid-specific and is not TSH or insulin regulated.
Thus, Northern analyses, using the radiolabeled insert
from Clone 31 (Figure 38A) as a probe, revealed a 1.5 kb
transcript in RNA preparations from rat FRTL-5 cells, as
well as buffalo rat liver (BRL) cells and nonfunctional
rat thyroid FRT cells. The mRNA size is, therefore, the
same as that identified in the liver by rt CBBF/CDS
(Petty, K.J., et al. GenBank Accession Number M69138 31).
These data are consistent with our previous observation
(Shimura, H., et al. (1993) J. Biol. Chem., 268:24125-
24137) that the protein binding the 5'-decanucleotide was
present in BRL cells and was not, therefore, thyroid-
specific; they are consistent with the identification of
TSEP-1 as a Y-box protein. Poly (A)+ RNA preparations
from FRTL-5 rat thyroid cells maintained in the presence
or absence of TSH had no significant difference in Y-box
transcript levels. Removal of insulin/serum from the cell
medium also did not change Y-box mRNA levels.
TSEP-1 is, therefore, a Y-box protein 95~
identical both to human YB-1, which binds the Y-box of the
major histocompatibility (MHC) class II gene and to human
NSEP-1 (nuclease sensitive element protein 1), which binds
single strand, CT-rich, nuclease-sensitive elements of
CA 02229938 l998-02-l9
WO 97/07404 PCTrUS96/13715
- 161-
genes that, like the TSHR, have GC rich promoters: c-myc,
the epidermal growth factor receptor, the insulin
receptor, and Ki-ras (Ikuyama, S., et al., (1992) Mol.
F:n~tcrinol. 6, 793-803).
TSEP-l binds two other sites in the minimal TSHR
promoter in a single strand-specific fashion. One is
associated with the insulin-response element of the
minimal TSHR promoter and is not in an overtly CT-rich
region. The other is located on the 3' end of the S-box
of the TSHR, -120 to -113 bp, and is in a CT-rich area;
TSEP-l is a functional suppressor at each of these 2 sites
(Figure 40A-C).
EMSA and oligonucleotide competition assays were
used to determine other sites on the TSHR where TSEP-l
might interact. The formation of a protein/DNA complex
between radiolabeled ssTR2(+) and nuclear extracts from
FRTL-5 cells is prevented by the homologous unlabeled
oligonucleotide, evidencing its specificity. Moving
downstream, unlabeled TRlCRE, -153 to -114 bp, single or
double strand, coding or noncoding, did not prevent
complex formation when radiolabeled ssTR2(+) was used as
probe (data not shown). However, an unlabeled single-
stranded oligonucleotide which represents the coding
strand sequence of the TSHR from -131 to -100 bp, termed
s8S(+), was an effective inhibitor of radiolabeled
ssTR2(+) complex formation. Unlabeled oligonucleotide,
ssS(-), the noncoding strand counterpart of ssS(+), did
not inhibit its formation nor did a double strand
oligonucleotide encompassing this region of the TSHR.
Moving upstream, formation of the protein-DNA
complex with radiolabeled ssTR2(+) was not inhibited by
coding, noncoding, or double strand oligonucleotides
representing the TSHR sequence between -194 and -169 bp.
This region contains the thyroid transcription factor-l
(TTF-l) site and a single strand binding protein (SSBP)
element on the noncoding strand, 5'- and contiguous with
CA 02229938 1998-02-19
W O 97/07404 PCT~US96fl37IS
- 162-
the TTF-1 site; both of which are linked to maximal
expression of the TSHR and TSH-cAMP-decreased TSHR gene
expression (Shimura, H., et al., (1994) Mol. Endocrinol.,
- 8, 1049-1069; Ohmori, M., et al., (1995) EndocrinoloqY,
136, 269-282; Shimura, H., et al., (1995) Mol.
Endocrinol., 9, 527-539). However, an oligonucleotide
with the sequence of the noncoding but not the coding
strand of the TSHR insulin response element, -220 to -188
bp (oligo.TIF), was an effective inhibitor of ssTR2(+)
complex formation. The double strand oligonucleotide was
also not a competitor.
These data suggested there were two additional
Y-box protein binding sites in the TSHR, both of which
exhibited single strand specificity. One is below the
CRE, between -131 and -100 bp. The other is in the region
of the insulin response element, -220 to -188 bp. To
confirm this, establish their functional role, and
localize the sites, the following experiments were
performed.
First, oligonucleotide competition using
20 oligonucleotides containing these other sites as the
radiolabeled probe was performed. Thus, the noncoding
strand oligonucleotide representative of the region
between -220 to -188 bp [oligo ssTIF(-)] was used as the
radiolabeled probe and showed that a major protein-DNA
complex was formed, whose mobility was identical to the
ssTR2(+) complex formed with the same thyroid cell
extracts. In addition, it was shown that its formation
was prevented by the unlabeled coding strand of both TR2
[ssTR2(+)] and the S region [ssS(+)], but not their
counterpart noncoding strands, ssTR2(-) or ssS(-). The
same results were obtained in competition experiments
using ssS(+) as the radiolabeled probe and unlabeled
ssTR2(+) or ssTIF(-)i unlabeled ssTR2(-) or ssTIF(+) were
again not competitors (data not shown). Thus, converse
competition experiments confirmed the existence of these
CA 02229938 1998-02-19
WO 97/07404 PCTAJS96/13715
- 163
sites, their binding specificity, and their ability to
form complexes of identical size, using the same cell
extract.
Second, using radiolabeled oligonucleotides, we
showed by direct binding that recombinant Y-box protein
formed a complex with radiolabeled ssS(+) and ssTIF(-),
but not radiolabeled 8sS(-) or ssTIF(+). Also, neither
radiolabeled double strand oligonucleotide, dsS or dsTIF,
formed a complex with TSEP-1 protein. Thus, direct
binding experiments with recombinant protein established
that these were single strand, Y-box protein binding
sites. In addition, they demonstrated that complex
formation could be enhanced if the recombinant protein was
preincubated with the catalytic subunit of protein kinase
A plus ATP before adding radiolabeled probe. The PKA
effect was duplicated with ssS(+), ssTR2(+) or ssTIF(-) as
radiolabeled probes (data not shown). The effect was lost
when the enzyme was boiled before use and was reversed by
exposure to potato acid phosphatase but not albumin, the
same as reported for TTF-1 (Shimura, H., et al., (1994)
Mol. Endocrinol., 8, 1049-1069; Ohmori, M., et al., (1995)
Endocrinology, 136, 269-282).
Third, cotransfection experiments with pRcCMV-
TSEP-1 showed that both sites functioned as suppressor
elements (Figure 40A-A'-40D-D'). Cotransfection with
pTRCAT5'-220 into FRTL-5 cells can significantly (p<0.05)
decrease CAT activity by comparison to cotransfection with
control vectors alone (Figure 40A-A'). These data do not,
however, prove that the region between -220 and -188 bp is
a functional Y-box suppressor site, since this construct
contains all three Y-box binding sites. To show this we
cotransfected pRcCMV-TSEP-1 or the pRcCMV control with
SV40-linked promoter constructs containing one or two
copies of the insulin response element of the TSHR (Figure
40D). In each case cotransfection of the vector encoding
the Y-box protein significantly suppressed promoter
SUBil~Ult SllEr ~RUIE 2~)
CA 02229938 1998-02-19
W O 97~07404 PCT~US96~3715
- 164-
activity (P~0.02) by comparison to cotransfection of
pRcCMV. Cotransfection of pRcCMV-TSEP-1 into FRTL-5
(Figure 40B) or FRT (Figure 40C) cells reduced (PcO.05)
- the activity of pTRCAT5'-146 and pTRCAT5'-131, which have
only the downstream Y-box protein binding site between -
131 and -100 bp. In contrast, cotransfection had no
effect on the activity of pTRCAT5'-90 or the p8CAT control
which have no Y-box protein binding sites.
The inability of Y-box cotransfections to
suppress pTRCAT5'-177mtl+2, but its ability to suppress
pTRCAT5'-146 or pTRCAT5'-131, with the TR deleted, shows
that the downstream S-box site is nonfunctional in the
presence of a TR until after the y-box protein binds to
the 5' decanucleotide. Y-box protein binding to the 5'
decanucleotide may, therefore, be a primary regulatory
event and that the other Y-box protein binding sites,
associated with the S-box and insulin response element,
might become more available in a single strand, triplex
DNA configuration, which the Y-box protein, NSEP-1, is
suggested to promote after it binds to S1-nuclease
sensitive, CT-rich regions on genes with GC-rich promoters
(Kolluri, R., et al., (1992) Nucleic Acids Res. 20, 111-
116).
Mutational analysis indicates that a conserved
CCTC sequence in each TSEP-1 site is important for TSEP-1
binding and function. To better define the binding site
for the Y-box protein in each locus, mutations were
introduced into different portions of the ssS(+) or
ssTIF(-) oligonucleotides. The ssS(+) mtl oligonucleotide
contains mutations in the 5' half of ssS(+), whereas the
ssS(+)mt2 contains mutations in the 3'-half (Figures 32
and 34). The ssTIF(-)mtl has mutations in the 5'-third of
the wild type ssTIF(-), whereas the ssTIF(-)mt2 is mutated
in the middle portion of the ssTIF(-) (Figures 32 and 34).
When radiolabeled and used as a probe, each mtl
oligonucleotide formed a complex with the recombinant Y-
CA 02229938 1998-02-19
WO 97/07404 PCTAJS96/13715
- 165-
box protein, which was identical in migration to that
formed by the radiolabeled wild type probe. In contrast,
a radiolabeled oligonucleotide with the mt2 mutations of
both ssS(+) and ssTIF(-) lost the ability to form protein-
DNA complexes with recombinant Y-box protein. The
unlabeled mt2 mutant oligonucleotides also lost the
ability to prevent complex formation between the
radiolabeled wild type oligonucleotide and recombinant Y-
box protein (data not shown).
Alignment of the ssTR2(+) sequence with the
ssS(+) and ssTIF(-) regions where mutation resulted in a
loss of Y-box protein binding identifies a conserved CCTC
element in all locations. Mutation of the CCTC sequence
in each site to GTAG resulted in a marked decrease in
recombinant Y-box protein binding as evaluated by EMSA.
These data indicate that a CCTC motif within each Y-box
protein binding site, i.e. the 5' decanucleotide, the
insulin response element region, and the S-box region of
the TSHR, is critical for the single strand binding
activity of the Y-box protein.
The S-box of the rat TSHR was so named because
it has only a one base mismatch with the S-box of the
murine A~ class II MHC gene and because, together with the
X and Y-boxes, it is important in repression of
constitutive class II gene expression. The functionally
important consensus sequence of all class II S-boxes is
CCTC/T. In sum, TSEP-1 is a Y-box protein suppressing
constitutive TSHR gene expression by interacting with
single-strand DNA binding sites in the rat TSHR promoter,
one of which is the 5'-decanucleotide of the TR and is in
a S1 nuclease-sensitive, CT-rich region of the TSHR
minimal promoter. Another appears to be related to a site
in the MHC class II promoter, which is involved in
repression of that gene.
Expression of MHC class I is regulated during
development and varies in different tissues (Ting, J. P-Y,
CA 02229938 1998-02-19
W o 97~U74~4 PCTAUS96tl371
- 166-
et al., (1993) Current O~inion in Immunoloqy 5, 8-16); its
precise regulation is crucial for the control of the
immune response, since abnormally high levels are
associated with autoimmune thyroid disease (ATD) and
diabetes (Todd, I., et al., (1986) Annals N.Y. Acad. Sci.,
475, 241-249). TTF-1 is a homeodomain protein which
regulates thyroid development and the expression of genes
associated with thyroid-specific function, i.e. the TSH
receptor (TSHR) and thyroglobulin (TG) (Guazzi, S., et
al., (1990) EM~30 J. 9, 631-3639; Francis-Lang, H. et al.,
(19g2) Mol. Cell. Biol. 12, 576-588; Z~nnlnl, M., et al.,
(1992) Mol. Cell. Biol. 12, 4230-4241; Shimura, H., et al.
(1994) MQ1. Endocrinol. 8, 1049-1069; Ohmori, M., et al.,
(1995) Endocrinoloqv, 136, 269-282; Kohn, L.D., et al.,
(1995) Vitamins and Hormones 50, 287-384). Its RNA levels
are downregulated by TSH in thyroid cells. (Shimura, H.,
et al., (1994) Mol. Endocrinol. 8, 1049-1069; Ohmori, M.
et al., (1995) Endocrinoloqy 136, 269-282). A downstream
38 bp silencer, -127 to -89 bp in the MHC class I
promoter, whose function depends on a cyclic AMP response
element (CRE), -107 to -100 bp, and whose activity is
regulated by TSH or methimazole (MMI) (Example 9) has been
identified. Using gel shift assays (EMSA), it was shown
that a protein/DNA complex formed by this silencer
involves TTF-1, since it is present in rat thyroid, but
not liver cells, and since its formation is inhibited by
unlabeled oligonucleotides mimicking the TTF-1 binding
sites on the TSHR and TG promoters (Figure 30). Using
EMSA, recombinant TTF-1, and oligonucleotides mimicking
-127 to -104 bp and -105 to -80 bp of the class I
~ 30 promoter, we identify two TTF-l binding sites downstream
and upstream of the CRE (Figure 41A); one is
TTF-l-specific/ the other can also interact with Pax-8.
~ TTF-l and CRE binding protein, CREB, footprint the region
between -120 to -89 bp and -113 to -95 bp, respectively;
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 167-
the overlapping footprints shows that TTF-l and CREB
binding is mutually competitive.
Overexpression of TTF-l in rat thyroid cells
increases the activity of a class I-reporter gene ch~me~a
containing the TTF-l sites and the CRE, p(-209)CAT or p(-
127)CAT (Figure 41C), but not the activity of a chimerawithout them, p(- 6 8)CAT, nor a chimera with a
nonpalindromic CRE mutation, p(-209NPCRE). In contrast,
overexpression of TSEP-l or Y-box cDNA decreases Class I
promoter activity (Figure 41C). When TSH decreases class
I levels, it coordinately decreases TTF-l complex
formation with the silencer and increases complex
formation with 2 Y-box protein (TSEP-l) suppressor sites,
one near each TTF-l element (Figure 41A). MMI will also
decrease TTF-l mRNA levels (Table VIII); MMI will also
reverse the ability of interferon to decrease TSEP-l RNA
levels (Table IX). TSEP-l is a suppressor of class I
activity when cotransfected with class I promoter-reporter
gene ch,meras (Figure 41C). Using gel shift assays and
oligonucleotide competitors from the TSHR gene, we
identify 2 TSEP-l sites on the coding strand of the class
I promoter, surrounding the CRE. One is 3' to the CRE and
within the 48 bp silencer; the other is upstream, between
the insulin response element and CRE. The TSEP-l sites
are in each case associated with thyroid transcription
factor-l (TTF-l) elements. Mutation data indicate
TTF-l/TSEP-l binding to their respective sites is mutually
exclusive. Interferon (IFN) increases class I expression
in thyroid cells; MMI reverses this (M. Saji et al.,
(1992b)). IFN decreases TSEP-l RNA levels (Table IX) and
complex formation with this region of the class I promoter
(data not shown); MMI reverses this (Table IX). In sum,
TSEP-l is a negative regulator of MHC class I and TSHR
gene expression.
CA 02229938 l998-02-l9
W 097/07404 PCTAUS96/13715
- 168-
TABLE VIII
Effect of MMI on TTF-l RNA levels
TREATMENT TTF-1 RNA LEVEL
(~ of Control with no treatment)
NONE l00
MMI 5 mM 32~
Fiqure Leqend for Table VIII. FRTL-5 thyroid cells were
maintained-in medium without TSH for 6 days after being
grown to 80~ confluency. At the start of the experiment,
cells were exposed to fresh medium with or without 5 mM
MMI. After 24 hours, cells were harvested, RNA isolated,
and Northern analyses performed using the cDNA for TTF-l
as described (Shimura, H., et al., (1994) Mol. Endocrinol.
8:1049-1069; Ohmori, M., et al., (l995) Endocrinoloqy
136:269-282). Quantitation was by densitometry; the TTF-l
level with no cell treatment was set at l00~.
TABLE IX
Effect of MMI on interferon-induced decreases in TSEP-l
(Y-box) RNA levels
TREATMENT TSEP-l RNA LEVEL
(~ of Control with no treatment)
NONE l00
MMI 5 mM l00~ i 7
~y INTERFERON 29 i 9
l00 Units
~y INTERFERON l0 6 i 10
l00 Units
Plus MMI 5 mM
Figure Legend for Table IX. FRTL-5 thyroid cells were
maintained in medium without TSH for 6 days after being
grown to 80~ confluency. At the start of the experiment,
cells were exposed to fresh medium with or without
interferon and/or 5mM MMI. After 24 hours, cells were
harvested, RNA isolated, and Northern analyses performed
using the clone 40 insert (Figure 38). Analyses were
performed as in Table VIII (Shimura, H., et al., (1994)
Mol. Endocrinol. 8: 1049-1069; Ohmori, M., et al., (l995)
Endocrinology 136:269-282). Quantitation was by
densitometry; the TESP-l level in cells with no cell
treatment was set at l00~.
CA 02229938 1998-02-19
W O 97/07404 PC~r~US96113715
- 169-
In sum, TTF-l is a positive regulator of MHC
class I gene expression in thyroid cells by its action on
a downstream 38 bp silencer. TSH and MMI decrease class
I expression by decreasing TTF-l RNA and protein levels,
thereby decreasing TTF-l positive regulation. TTF-l and
class I expression are, therefore, normally coregulated by
TSH and MMI.
TTF-l interactions with this silencer are
normally coordinated with TSEP-l. TSEP-l normally
suppresses MHC class I, and suppression is eliminated by
interferon. TSEP-l binding, activity and suppression can
be returned to normal by MMI. Thus, the downstream
silencer is a region of tissue-specific control, normally
regulated by TSEP-l/TTF-l, subject to abnormal regulation
in autoimmune thyroid disease, and a site of action for
MMI.
Although the present invention has been
described in some detail by way of illustration and
example for purposes of clarity of underst~n~;ng, it will
be obvious that certain changes and modifications may be
practiced within the scope of the appended claims.
CA 02229938 1998-02-19
W O 97/07404 P ~ AUS96/I3715
- 170-
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: THE GOVERNMENT OF THE UNl'l'~
STATES OF AMERICA AS REPRESENTED BY THE
SECRETARY, DEPARTMENT OF HEALTH AND HUMAN
SERVICES
(ii) TITLE OF lNVh'N'l'lON: METHODS OF ASSESSING MHC
CLASS I EXPRESSION AND PROTEINS CAPABLE OF
MODUhATING I EXPRESSION
(iii) NUMBER OF SEQUENCES: 66
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: MORGAN ~ FINNEGAN, L.L.P.
(B) STREET: 345 PARK AVENUE
(C) CITY: NEW YORK
(D) STATE: NEW YORK
(E) COUNTRY: USA
(F) ZIP: 10154
(v) COM~Ul~ READABLE FORM:
(A) MEDIUM TYPE: FLOPPY DISK
(B) COM~Ul~: IBM PC COMPATIBLE
(C) OPERATING SY~ M: PC-DOS/MS-DOS
(D) SOFTWARE: ASCII
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: TO BE ASSIGNED
(B) FILING DATE: 21 AUG 1996
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 08/503,525
(B) FILING DATE: 21-AUG-1995
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 08/480,525
(B) FILING DATE: 07-JUN-1995
(C) ChASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 08/073,830
(B) FILING DATE: 07-JUN-1993
.' (C) CLASSIFICATION:
- (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: FEILER, WILLIAM S.
(B) REGISTRATION NUMBER: 26,728
(C) REFERENCE/DOCKET NUMBER: 2026-4066PC5
CA 02229938 l998-02-l9
W 097/07404 PCTrUS96/13715
- 171-
o
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (212) 758-4800
(B) TELEFAX: (212) 751-6849
(2) INFORMATION FOR SEQ ID NO: 1: J
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1419
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
. (D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:
AAGCTTATCT TTCCTAATTA CCATTCTTCA ATCCATACTT 40
TAATAGTATT GTCTCTGAGG ACGTAGGAAG TACATATGAA 80
ACACTCCTGC TACCTTCCAA AGTACTGTGT CCCAAGGAAA 120
ATCATTCTGT GAGCTGCACT AGCCTCTTTT TCATGGAATA 160
CAACCTTTAC TGGAAAGAAT GAATGACACT GGAAGATCTA 200
TATAACTTAG TGAAACAATG TATTCGGTCT TAAAACTCTT 2 40
ACATTAGTAT AAGCAACAGT CAATGTGCAA GCCAGGCTTT 2 80
TAATTTAACA GAATAGGAAA CACGGAGTAT ACTGATTCAG 320
GTCCACATTC AAAATAACCT TTGAGAAATT ACCATTATGA 3 60
TAGCATCCAA AATTATCTGA AAAGGTTATT AAAAATACAT 400
GTCCTACATG TGTGCGGGGC TTTTACATTT CATAGATGTC 4 40
AGCCACCAAA AGGACTCAGC ACAGAAGCAG ACATAAACCT 480
CCAGTGGTTT TCCCATGAGC CAGACAGCAG AGAGACTTGC 5 20
CATAGAGTAA AATGTAAAAA GCTCCACTCT TCACACTACA 560
GTGTTTCTTA TGCGAAATAA TTGTTTTCAT ATGAAATGCA 600
TGGATTATTT ATATCTTCTA AAAATTTGAT GAAATTTTAA 6 40
ACTATTATTT CTAGTATAGA AAATATCCAC TGACGTATCA 680
ACACAAACAT ATCTTAGAGG TCTTCACTAA TTTGTAAAAC 720
TGTAGGAATA TTCTCACTAA AAGGTTTGGA AATCGCTGGG 7 60
CA 02229938 l998-02-l9
W 097/07404 PCT~US96n3715
- 172-
o
TACACAGCCC CTGGGCCACT GGAGGCACTG GAGACACTGT 800
GACAAAGAGC TTTCTGAAGA GCAGCAGGGC AGAGTCCCAG 840
CTCCGCAGCC AGGCGTGGCT CTCAGGGTCT CAGGCTCCAG 8 80
GGCGGAGTCT GGGCGGGGAG GCGCGGTGGT GGGGAGTCCC 920
CGTGTCCCCA GTTTCACTTC TCCGTCTCGC AAC~ G960
GGACCGTCCT GCCCGGACAC TCGTGACGCG ACCCCACTTC 1000
TCTCTCCTAT TGCGTGTCCG GTTTCTGGAG AAGCCAATCG 1040
GCGCCACTGC GGTTCCCGGT TCTAAACTCT CCACCCACCC 10 80
GGCTCTGCTC AGCTTCTCCC CAGACTCCGA GGCTGAGGAT 1120
C ATG GGG CCT GGA GCC CTC TTC CTG CTG CTG TCG 1154
Met Gly Pro Gly Ala Leu Phe Leu Leu Leu Ser
1 5 10
GGA ACC TTG GCC CTG ACC GGC ACC AAG GCG GGT 1187
Gly Thr Leu Ala Leu Thr Gly Thr Lys Ala Gly
15 20
GAGTGCGGGA TCGGGAACAA GGCCGCTGCG GGGAGGAGCT 1227
GAGGCACCGC CTGGGAGTCG GGTGGGGGCA GGACCCACGG 1267
GGAAGGTGCG ACTCTGCTGT CCCGGCCCAG ACCCGCCACC 1307
TCACCCCGTC CTGTCCTGTC CCTCCCTTGC TTCCTGCTCC 1347
TCTGCTTTTC CCCCCTAAAC CCGGGGCCCG TCTCCGACCT 1387
CCACCCCTTT CCCGCCTCCC GAGCCCCGAG CT 1419
(2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 99
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
GGTCCACATT CAAAATAACC TTTGAGAAAT TACCATAATG 40
ATAGCATCCA AAATTATCTG A~AAGGTTAT TAAAAATACA 80
-
CA 02229938 1998-02-19
WO 97/07404 PCTrUS96/13715
- 173-
o
TGTCCTACAT GTGTGCGGG 99
(2) INFORMATION FOR SEQ ID NO: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
CGCGAATGAT AGCATCCAAA ATTATCTGAA AAGGTTAGCG 40
C 41
(2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
GGCCAAAATT ATCTGAAAAG GTTATTAAAA ATACATGTCG 40
G 41
(2) INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 34
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
GGCCAAAATT ATCTGAAAAG GTTATTAAAA GCGC 34
(2) INFORMATION FOR SEQ ID NO: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 34
(B) TYPE: NUCLEIC ACID
CA 02229938 l998-02-l9
W O 97/07404 PCTrUS96rl37~5
- 174-
o
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
_ (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
~ GGCCTGGTAA TTTCTCAAAG GTTATTAAAA GCGC 34
s
(2) INFORMATION FOR SEQ ID NO: 7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 34
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DO~3LE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:
GGCCAAAATT ATCTGAAACT CGCGTTTTGA GCGC 3 4
(2) INFORMATION FOR SEQ ID NO: 8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 34
(B) TYPE: NUChEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
GGCCAAAATT ATTCTCATAG GGTATTA~AA GCGC 34
(2) INFORMATION FOR SEQ ID NO: 9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
CTCAAAAGGT TATTAAAAAT GTGGC 25
(2) INFORMATION FOR SEQ ID NO: 10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 31
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
CA 02229938 1998-02-19
W O 97/07404 PCTAUS96/13715
- 175-
o
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
CGCGTTAAAA ATACATGTCC TACATGTGTG C 31
(2) INFORMATION FOR SEQ ID NO: 11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 42
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:ll:
CGCGATGGTA ATTTCTCAAA GGTTATTTTG AATGTGGTCC 40
GG 42
(2) INFORMATION FOR SEQ ID NO: 12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
GCGCAAAGGT TATTTTGAAT GTGGACCGG 29
(2) INFORMATION FOR SEQ ID NO: 13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
GCGCAAAGGT TCGGTTGAAT GTGGACCGG 29
(2) INFORMATION FOR SEQ ID NO: 14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29
CA 02229938 l998-02-l9
W ~ 97~74~4 PCT~US96/1371
- 176-
o
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
GCGCA~AGTG GATTTTGAAT GTGGACCGG 29
(2) INFORMATION FOR SEQ ID NO: 15:
(i) . SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
GCGCTCCTGT TCGGTTGAAT GTGGACCGG 29
(2) INFORMATION FOR SEQ ID NO: 16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 16:
GGCCAAAGGT TATTTTGAAA CTGGC 25
(2) INFORMATION FOR SEQ ID NO: 17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17:
GGCCTGGTAA ATCTGAAAAG GTCGTTTTGA GCG 33
(2) INFORMATION FOR SEQ ID NO: 18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30
(B) TYPE: NUCLEIC ACID
CA 02229938 1998-02-19
WO 97/07404 PCTrUS96/13715
- 177-
o
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
CTTACACACG ATGTGCATAT TAGGACATCT 30
(2) INFORMATION FOR SEQ ID NO: 19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l9:
GTAGGACATG TA'll"l"ll'AAT AACCTTTTCA GATAATTTT 39
(2) INFORMATION FOR SEQ ID NO: 20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 40
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:
GGTCCACATT CAAAATAACC TTTGAGAAAT TACCATCGCG 40
(2) INFORMATION FOR SEQ ID NO: 21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21:
GGTCCACATT CAAAATAACC TTTGCGC 2 7
(2) INFORMATION FOR SEQ ID NO: 22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
CA 02229938 1998-02-19
W O 97/07404 PCT~US96/13715
- 178-
o
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCB DESCRIPTION: SEQ ID NO:22:
c
GGTCCACATT CAAAATCCAC TTTGCGC 27
(2) INFORMATION FOR SEQ ID NO: 23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:
GCCACATTTT TAATAACCTT TTGAG 25
(2) INFORMATION FOR SEQ ID NO: 24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26
(B) TYPE: NUCLEIC ACID
~ (C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
GTCCACATTC AAAATAACAG GAGCGC 26
(2) INFORMATION FOR SEQ ID NO: 25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 42
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:
CCGGACATGT AlllllAATA ACCTTTTCAG ATAATTTTGG 40
CC 42
;
- (2) INFORMATION FOR SEQ ID NO: 26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 34
(B) TYPE: NUCLEIC ACID
CA 02229938 1998-02-19
W O 97/07404 PCTrUS96/13715
- 179-
o
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:
GCG~l"lll'AA TAACCTTTTC AGATAATTTT GGCC 34
(2) INFORMATION FOR SEQ ID NO: 27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 34
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:
GCG~llllAA TAACCTTTGA GA~ATTACCA GGCC 34
(2) INFORMATION FOR SEQ ID NO: 28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 34
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:
GCG~llll'AA TACCCTATGA GAATA~TTTT GGCC 34
(2) INFORMATION FOR SEQ ID NO: 29:
2 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:
CGCGTTCAAA ATAACCTTTG GCC 23
(2) INFORMATION FOR SEQ ID NO: 30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
CA 02229938 l998-02-l9
W 097~74~4 P~nus96n37r5
- 180-
o
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:
GGTCCACATT CAACCGAACC TTTGCGC 27
(2) INFORMATION FOR SEQ ID NO: 31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:
GGTCCACATT CAACCGAACA GGAGCGC 27
(2) INFORMATION FOR SEQ ID NO: 32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:
GCCAGTTTCA AAATAACCTT TGGCC 25
(2) INFORMATION FOR SEQ ID NO: 33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:
GTAGGACATG TATTTTTAAC GCG 23
; (2) INFORMATION FOR SEQ ID NO: 34:
- (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 34
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
CA 02229938 1998-02-19
W O 97/07404 PC~rrJS96113715
- 18 1-
o
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:
GCGCTCAAAA CGCGAGTTTC AGATAATTTT GGCC 34
(2) INFORMATION FOR SEQ ID NO: 35:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 106
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:
CATATGAAAT GCATGGATTA TTTATATCTT CTAAAAATTT 40
GATGAAATTT TAAACTATTA TTTCTAGTAT AGAAAATATC 80
CACTGACGTA TCAACACAAA CATATC 106
(2) INFORMATION FOR SEQ ID NO: 36:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 109
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:
TGAAACAATG TATTCGGTCT AAAACTCTTA CATTAGTATA 40
AGCAACAGTC AATGTGCAAG CCAGGCTTTT AATTTAACAG 80
AATAGGAAAC ACGGAGTATA CTGATTCAG 109
(2) INFORMATION FOR SEQ ID NO: 37:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 135
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:
GTCCACATTC AAAATAACCT TTGAGAAATT ACCATAATGA 40
TAGCATCCAA AATTATCTGA AAAGGTTATT AAAAATACAT 80
CA 02229938 1998-02-19
W O 97/07404 PCT~US96/13715
- 182-
o
GTCCTACATG TGTGCGGGGC TTTTACATTT CATAGATGTC 120
AGCCACCAAA AGGAC 135
(2) INFORMATION FOR SEQ ID NO: 38:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:
TGACTAGCAG AGAAAACAAA GTGA 24
(2) INFORMATION FOR SEQ ID NO: 39:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1422
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:
AAAGCCGGGC CATGGTACAA CAGACCAACA ACGCCGAGAA 40
CACGGAGGCT TTGCTGGCTG GGGAGAGCTC AGACTCGGGC 80
GGCGGCCTGG AGCTGGGCAT CGCGTCCTCC CCGACGCCCG 120
GCTCCACGGC GTCCACGGGT GGCAAGGCGG ACGACCCTAG 160
CTGGTGCAAG ACGCCCAGTG GCCACATCAA GCGGCCCATG 200
AACGCCTTTA TGGTGTGGTC GCAGATCGAG CGGCGCAAGA 240
TCATGGAGCA GTCGCCCGAC ATGCACAACG CCGAGATCTC 280
CAAGCGGCTG GGCAAACGCT GGAAGCTGCT CAAGGACAGC 320
GACAAGATCC CGTTCATCCA GGAGGCGGAG CGGCTGCGCC 360
TCAAGCACAT GGCTGACTAC CCTGACTACA AGTACCGGCC 400
GCGAAAGAAG GTGAAGTCGG GCAACACGGG CGCGGGATCG 440
GCGGCCACAG CCAAACCTGG GGAGAAGGGC GACAAGGTCG 480
CA 02229938 l998-02-l9
~V097/07404 PCTrUS96/13715
- 183-
o
GCGGCGGCAG CGGCCACGCG GGAAGCGGCC ACGCGGGGGG 520
TGGCGCGGGC GGCAGCTCCA AGCCCGCGCC CAAGAAGAGC 560
TGCGGCCCCA AGGTGGCGGG CAGCTCGGTC GGCAAGCCCC 600
ACGCCAAGTT CGTCCCGGCG GGCGGCGGTA AGGCGGCTGC 6 40
ATCGTTCTCT CCGGAGCAGG CCGCCCTGCT GCCCCTGGGG 6 80
GAGCCCGCGG CCGTCTACAA GGTGCGGACT CCCAGCGCGG 720
CCACCCCGGC CGCCTCCTCC TCGCCGTCCA GCGCGCTGGC 760
CACCCCCGCC AAACACCCTG CCGACAAGAA GGTGAAGCGC 800
GTTTACCTGT TCGGAAGCCT GGGCGCTTCG GCATCCCCGG 840
TCGGGGGCCT GGGAGCGAGC GCTGACCCCA GCGATCCACT 880
GGGGTTATAC GAAGATGGGG GCCCGGGATG CTCGCCCGAT 9 20
GGCCGGAGTC TGAGCGGCCG TAGCAGCGCA GCATCATCGC 960
CCGCCGCCAG CCGATCGCCC GCTGACCACC GCGGCTACGC 1000
CAGCCTACGT GCAGCCTCGC CCGCCCCGTC CAGCGCGCCC 10 40
TCGCACGCGT CCTCGTCGCT CTCCTCATCC TCCTCCTCTT 1080
CCTCGGGCTC TTCTTCGTCC GATGATGAGT TCGAAGATGA 1120
CCTGCTCGAC CTGAACCCCA TCTCAAACTT TGAGAGCATG 1160
TCCCTGGGCA GTTTCAGCTC CTCATCCGCT CTTGATCGGG 1200
ACCTGGATTT TAACTTCGAA CCCGGCTCAG GCTCCCACTT 1240
CGAGTTCCCG GACTATTGCA CGCCCGAGGT GAGCGAGATG 1280
ATCTCGGGAG ATTGGCTGGA GTCCAGCATC TCTAACCTGG 1320
TCTTCACCTA CTGAAGGGAG CGCGGGCCGG GGAGAAGGAG 13 60
GGCCAAGAGG CAGGAGAGGA GAGAGGAAGA CAA~ AACAA 1400
AACAAAACAA AAATCGGAAT TC 1422
(2) INFORMATION FOR SEQ ID NO: 40:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 440
CA 02229938 l998-02-l9
W O 97107404 ~CTAUS96/1371S
- 184-
o
(B) TYPE: AMINO ACID
(C) STRANDEDNESS: UNKNOWN
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:
5Met Val Gln Gln Thr Asn Asn Ala Glu Asn Thr Glu
1 5 10
Ala Leu Leu Ala Gly Glu Ser Ser Asp Ser Gly Ala
15 20
Gly Leu Glu Leu Gly Ile Ala Ser Ser Pro Thr Pro
25 . 30 35
Gly Ser Thr Ala Ser Thr Gly Gly Lys Ala Asp Asp
40 45
10Pro Ser Trp Cys Lys Thr Pro Ser Gly His Ile Lys
50 55 60
Arg Pro Met Asn Ala Phe Met Val Trp Ser Gln Ile
65 70
Glu Arg Arg Lys Ile Met Glu Gln Ser Pro Asp Met
75 80
His Asn Ala Glu Ile Ser Lys Arg Leu Gly Lys Arg
85 90 95
15Trp Lys Leu Leu Lys Asp Ser Asp Lys Ile Pro Phe
100 105
Ile Gln Glu Ala Glu Arg Leu Arg Leu Lys His Met
110 115 120
Ala Asp Tyr Pro Asp Tyr Lys Tyr Arg Pro Arg Lys
125 130
Lys Val Lys Ser Gly Asn Thr Gly Ala Gly Ser Ala
135 140
Ala Thr Ala Lys Pro Gly Glu Lys Gly Asp Lys Val
145 150 155
Gly Gly Gly Ser Gly His Ala Gly Ser Gly His Ala
160 165
Gly Gly Gly Ala Gly Gly Ser Ser Lys Pro Ala Pro
170 175 180
25Lys Lys Ser Cys Gly Pro Lys Val Ala Gly Ser Ser
185 190
Val Gly Lys Pro His Ala Lys Phe Val Pro Ala Gly
195 200
Gly Gly Lys Ala Ala Ala Ser Phe Ser Pro Glu Gln
205 210 215
Ala Ala Leu Leu Pro Leu Gly Glu Pro Ala Ala Val
220 225
30Tyr Lys Val Arg Thr Pro Ser Ala Ala Thr Pro Ala
230 235 240
~-Ala Ser Ser Ser Pro Ser Ser Ala Leu Ala Thr Pro
245 250
Ala Lys His Pro Ala Asp Lys Lys Val Lys Arg Val
255 260
Tyr Leu Phe Gly Ser Leu Gly Ala Ser Ala Ser Pro
265 270 275
CA 02229938 1998-02-19
WO 97/07404 PCTtUS96tl3715
- 185-
o
Val Gly Gly Leu Gly Ala Ser Ala Asp Pro Ser Asp
280 285
Pro Leu Gly Leu Tyr Glu Asp Gly Gly Pro Gly Cys
290 295 300
Ser Pro Asp Gly Arg Ser Leu Ser Gly Arg Ser Ser
305 310
Ala Ala Ser Ser Pro Ala Ala Ser Arg Ser Pro Ala
315 320
Asp His Arg Gly Tyr Ala Ser Leu Arg Ala Ala Ser
325 330 335
Pro Ala Pro Ser Ser Ala Pro Ser His Ala Ser Ser
. 340 345
Ser Leu Ser Ser Ser Ser Ser Ser Ser Ser Gly Ser
350 355 360~0 Ser Ser Ser Asp Asp Glu Phe Glu Asp Asp Leu Leu
365 370
Asp Leu Asn Pro Ser Ser Asn Phe Glu Ser Met Ser
375 380
Leu Gly Ser Phe Ser Ser Ser Ser Ala Leu Asp Arg
385 390 395
Asp Leu Asp Phe Asn Phe Glu Pro Gly Ser Gly Ser
400 405
His Phe Glu Phe Pro Asp Tyr Cys Thr Pro Glu Val
410 415 420
Ser Glu Met Ile Ser Gly Asp Trp Leu Glu Ser Ser
425 430
Ile Ser Asn Leu Val Phe Thr Tyr
435 440
(2) INFORMATION FOR SEQ ID NO: 41:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1512
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOU.3LE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:
GAATTCCGGT CTCACTGGTC TACCTTGCTC TCCTGCACCC 40
TGGTTGTCAG CACCCACCAT CACACCCGGG AGGAGCCGCA 80
GCCGTCGCCG CCGGCCCCAG TCACCATCAC CGCAACCATG 120
AGCAGCGAGG CCGAGACCCA GCAGCCGCCC GCCGCCCCCG 160
CCGCCGCCCT CAGCGCCGCC GACACCAAGC CCGGCTCCAC 200
GGGCAGCGGC GCGGGTAGTG GCGGCCCGGG CGGCCTCACA 240
TCGGCGGCGC CCGCCGGCGG GGACAAGAAG GTCATCGCAA 280
CA 02229938 1998-02-19
W 0971074~4 PCTAUS96/13715
- 186-
o
CGAAGGTTTT GGGAACAGTA AAATGGTTCA ATGTAAGGAA 320
CGGATACGGT TTCATCAACA GGAATGACAC CAAGGAAGAC 360
GTATTTGTAC ACCAGACGGC CATAAAGAAG AATAACCCCA 400
GGAAGTACCT TCGCAGTGTA GGAGATGGAG AGACTGTGGA 440
GTTTGATGTT GTTGAAGGAG AAAAGGGTGC GGAGGCAGCT 480
AATGTTACAG GCCCTGGTGG AGTTCCAGTT CAAGGCAGTA 520
AATACGCAGC AGACCGTAAC CATTATAGGC GCTATCCACG 560
TCGTAGGGGT CCTCCACGCA ATTACCAGCA AAATTACCAG 600
AATAGTGAGA GTGGGGAAAA GAATGAAGGA TCGGAAAGCG 6 40
CTCCTGAAGG CCAGGCCCAA CAACGCCGGC CCTATCGCAG 6 80
CCGAAGGTTC CCACCTTACT ACATGCGGAG GCCCTATGCG 720
CGTCGACCAC AGTATTCCAA CCCCCCTGTG CAAGGAGAAG 760
TGATGGAGGG TGCTGACAAC CAGGGTGCAG GAGAGCAAGG 800
TAGACCAGTG AGACAGAATA TGTATCGGGG TTACAGACCA 8 40
CGATTCCGCA GGGGCCCTCC TCGCCCAAGA CAGCCTAGAG 880
AGGATGGCAA TGAAGAGGAC AAAGAAAATC AAGGAGATGA 920
GACCCAAGGT CAGCAGCCAC CTCAACGTCG GTATCGCCGC 960
AACTTCAATT ACCGACGCAG ACGCCCAGAG AACCCTAAAC ' 1000
CACAAGATGG CAAAGAGACA AAAGCAGCCG ATCCACCAGC 1040
TGAGAATTCG TCCGCTCCCG AGGCTGAGCA GGGCGGGGCT 1080
GAGTAAATGC CGGCTTACCA TCTCTACCAT CATCCGGTTT 1120
GGTCATCCAA CAAGAAGAAA TGAATATGAA ATTCCAGCAA 1160
TAAGAAATGA ACAAAGATTG GAGCTGAAGA CCTTAAGTGC 1200
TTG~lllll'G CCCGTTGACC AGATCCACTA GAACTGTCTG 1240
CATTATCTAT GCAGCATGGG ~~ "lATTA TTTTTACCTA 1280
AAGATGTCTC TTTTTGGTAA TGACAAACGT ~'l"l"l"l"l"l'AAG 1320
CA 02229938 1998-02-19
W O 97/07404 PCTAUS96/13715
- 187-
o
AAAAAAAAAA AGGCCTGGTT TTTCTCAATA CACCTTTAAC 1360
G~lllllAAA TTGTTTCATA TCTGGTCAAG TTGAGATTTT 1400
TAAGAACTTC AlllllAATT TGTAATAAAG TTTACAACTT 1440
GAllllllCA A~AAAGTCAA CAAACTGCAA GCACCTGTTA 1480
ATAAAGGTCT TAAATAATAA A~AACGGAAT TC 1512
(2) INFORMATION FOR SEQ ID NO: 42:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 322
(B) TYPE: AMINO ACID
(C) STR~NDEDNESS: UNKNOWN
(D) TOPOLOGY: UNK~OWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:
Met Ser Ser Glu Ala Glu Thr Gln Gln Pro Pro Ala
1 5 10
Ala Pro Ala Ala Ala Leu Ser Ala Ala Asp Thr Lys
Pro Gly Ser Thr Gly Ser Gly Ala Gly Ser Gly Gly
Pro Gly Gly Leu Thr Ser Ala Ala Pro Ala Gly Gly
45~0 Asp LYB Lys Val Ile Ala Thr Lys Val Leu Gly Thr
Val Lys Trp Phe Asn Val Arg Asn Gly Tyr Gly Phe
Ile Asn Arg Asn Asp Thr Lys Glu Asp Val Phe Val
His Gln Thr Ala Ile Lys Lys Asn Asn Pro Arg Lys
95~5 Tyr Leu Arg Ser Val Gly Asp Gly Glu Thr Val Glu
100 105
Phe Asp Val Val Glu Gly Glu Lys Gly Ala Glu Ala
110 115 120
Ala Asn Val Thr Gly Pro Gly Gly Val Pro Val Gln
125 130
Gly Ser Lys Tyr Ala Ala Asp Arg Asn His Tyr Arg
135 140
Arg Tyr Pro Arg Arg Arg Gly Pro Pro Arg Asn Tyr
145 150 155
Gln Gln Asn Tyr Gln Asn Ser Glu Ser Gly Glu LYB
160 165
Asn Glu Gly Ser Glu Ser Ala Pro Glu Gly Gln Ala
170 175 180
Gln Gln Arg Arg Pro Tyr Arg Arg Arg Arg Phe Pro
185 190
CA 02229938 l998-02-l9
W 097/07404 P~AUS96~t37tS
- 188-
o
Pro Tyr Tyr Met Arg Arg Pro Tyr Ala Arg Arg Pro
195 200
Gln Tyr Ser Asn Pro Pro Val Gln Gly Glu Val Met
205 210 215
Glu Gly Ala Asp Asn Gln Gly Ala Gly Glu Gln Gly
220 225
Arg Pro Val Arg Gln Asn Met Tyr Arg Gly Tyr Arg
230 235 240
Pro Arg Phe Arg Arg Gly Pro Pro Arg Gln Arg Gln
245 250
Pro Arg Glu Asp Gly A~n Glu Glu Asp Lys Glu Asn
255 260
Gln Gly Asp Glu Thr Gln Gly Gln Gln Pro Pro Gln
265 270 275
10 Arg Arg Tyr Arg Arg Asn Phe Asn Tyr Arg Arg Arg
~ 280 285
Arg Pro Glu Asn Pro Lys Pro Gln Asp Gly Lys Glu
290 295 300
Thr Lys Ala Ala Asp Pro Pro Ala Glu Asn Ser Ser
305 310
Ala Pro Glu Ala Glu Gln Gly Gly Ala Glu
315 320
(2) INFORMATION FOR SEQ ID NO: 43:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:
CTTGTTTGGA GAGTTGCCTA GGCAAGCGG 29
( 2) INFORMATION FOR SEQ ID NO: 44:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29
(B) TYPE: NUChEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:
CTTGTTTGGG GCATTGCCTA GGGAAGCGG 29
(2) INFORMATION FOR SEQ ID NO: 45:
(i) SEQUENCE CHARACTERISTICS:
CA 02229938 1998-02-l9
WO 97/07404 PCTrUS96/1371
- 189-
o
(A) LENGTH: 29
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNK~OWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:
CTTATGTAGA GAGTTGCCTA GGCAAGCGG 29
(2) INFORMATION FOR SEQ ID NO: 46:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:
AAGCGGAGCA CTTGAGAGCC TCTCC 25
(2) INFORMATION FOR SEQ ID NO: 47:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:
AAGCGAAACG CCAGTGCGAC TCTCC 25
(2) INFORMATION FOR SEQ ID NO: 48:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:
CACTGCCCAG TCAAGTGTTC TTG 23
(2) INFORMATION FOR SEQ ID NO: 49:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22
CA 02229938 1998-02-19
W 097J07404 P ~ ~US96/I3715
- 190-
o
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:
CACTGCCCAG ATTCTGTTCT TG 22
(2) INFORMATION FOR SEQ ID NO: 50:
(i) . SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:
GTTCGCCTCG TGAACTCTCG GAGAGG 26
(2) INFORMATION FOR SEQ ID NO: 51:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 47
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:
AGCCTCTCCT TCCCCCTTCC CCCTCTCCAG CGTGCTCTCC 40
AGCGATG 47
(2) INFORMATION FOR SEQ ID NO: 52:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:52:
AGCCTCTCCT TCCCCCTCTC CAGCGTGCTC TCCAGCGATG 40
AGGTCA 46
(2) INFORMATION FOR SEQ ID NO: 53:
CA 02229938 1998-02-19
WO 97/07404 PCT~US96/13715
- 191-
o
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46
(B) TYPE: NUCLEIC ACID <
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:53:
AGCCTCTCCT TCCCCCTCTC CAGCGTGTTC ACCTGTGATG 40
AGGTCA . 46
(2) INFORMATION FOR SEQ ID NO: 54:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNK~OWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:54:
AGCCTCTCCT TCCCCCACTG CATCTTGCTC TCCAGCGATG 40
AGGTCA 46
(2) INFORMATION FOR SEQ ID NO: 55:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:55:
CAGCCCCTTG GAGCCCTCCT CCTTCCTCCC TT 32
(2) INFORMATION FOR SEQ ID NO: 56:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE .
(D) TOPOLOGY: UNK~OWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:56:
CAGCCGCTAG TAGGCCTCCT CCTTCCTCCC TT 32
CA 02229938 1998-02-19
w o 97~07404 P ~ AUS96~13715
- 192-
o
(2) INFORMATION FOR SEQ ID NO: 57:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNK~OWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:57:
CAGCCCCTTG GAGCCCTCCA CGTTGCTCCC TT 32
(2) INFORMATION FOR SEQ ID NO: 58:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:58:
GAACAAACCT ACCTCTCAAC GGATCCGTTC GCC 33
(2) INFORMATION FOR SEQ ID NO: 59:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:59:
GAATACATCT ACCTCTCAAC GGATCCGTTC GCC 33
(2) INFORMATION FOR SEQ ID NO: 60:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3 2
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:60:
GAACAAACCC AGTTCCAACG GATCCCTTCG CC 32
CA 02229938 1998-02-19
W O 97/07404 PCTAUS96/13715
- 193-
o
(2) INFORMATION FOR SEQ ID NO: 61:
(i) SEQ~N~'~ CHARACTERISTICS:
(A) LENGTH: 26
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBhE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:61:
GTTCGCCTCG TGAACTCTCG GAGAGG 26
(2) INFORMATION FOR SEQ ID NO: 62:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:62:
~ GTTCACCTCC TGAACTCTCG GAGAGG 26
(2) INFORMATION FOR SEQ ID NO: 63:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:63:
AGCCTCTCCT TCCCCCTCTC CAGCGTGTTC ACCTGTGATG 40
AGGTCA 46
(2) INFORMATION FOR SEQ ID NO: 64:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNK~OWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:64:
CA 02229938 1998-02-19
WO 97/07404 PC~r~US96~13715
- 194-
o
AGCCTCTCCT TCCCCCACTG CATCTTGCTC TCCAGCGATG 40
AGGTCA 46
r
(2) INFORMATION FOR SEQ ID NO: 65:
(i) SEQ~N~: CHARACTERISTICS:
(A) LENGTH: 46
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
. (D) TOPOLOGY: uNK~OWN
(xi) SEQ~ DESCRIPTION: SEQ ID NO:65:
AGCCTCTCCT TCCCCCACTG CATCTTGTTC ACCTGTGATG 40
AGGTCA 46
(2) INFORMATION FOR SEQ ID NO: 66:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 46
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: DOUBLE
(D) TOPOLOGY: UNKNOWN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:66:
AGCCTCTCCT TCCCCCTCTC CAGCGTGCTC TCCAGCGATG 40
AGGTCA 46
