Note: Descriptions are shown in the official language in which they were submitted.
CA 02244204 1998-07-27
WO 97/27207 PCT/US97/01278
-1-
"A PLANT NUCLEAR SCAFFOLD ATTACHMENT REGION WHICH INCREASES GENE
EXPRESSION"
This invention was made with Government support
under USDA research grants #91-37301-6377 and 92-37301-
7710. The Government may have certain rights to this
invention.
Field of the Invention
The present invention relates to a plant
nuclear scaffold attachment region and to methods for
increasing the expression of foreign genes in cells,
along with DNA constructs for carrying out such methods.
Backcrround of the Invention
The proteinaceous nuclear 'matrix' or
'scaffold' of cells plays a role in determining chromatin
structure. Electron micrographs show that nuclear DNA is
attached to this scaffold at intervals to produce a
series of loops (Zlatanova and Van Holde, J. Cell Sci_
103:889 (1992)). Scaffold Attachment Regions (SARs) are
AT-rich genomic DNA sequences which bind specifically to
components of the nuclear scaffold. See Boulikas, J.
Cell. Biochem. 52:14 (1993)_ These sequences are thought
to define independent chromatin domains through their
attachment to the nuclear scaffold. Both transcription
and replication are thought to occur at the nuclear
scaffold.
It has been shown that when SARs are included
on both sides of a transgene the expression level in
stably transfected cell lines may become proportional to
transgene copy number, indicating that gene activity is
independent of position in the chromosome (Bonifer et
al., EMBO J. 9:2843 (1990); McKnight et al., Proc. Natl.
Acad. Sci. USA 89:6943 (1992); Phi-Van et al., Nol. Cell.
CA 02'244204 2005-O1-07
-2-
Biol. 10:2303 (1990)). Flanking a GUS reporter gene with
yeast SARs has been reported to result in higher and less
variable transgene expression in plant ceils. Allen et
al. Plant Cell 5:603 (1993). However, variation between
different transformants was not dramatically reduced, and
high levels of expression were not seen in transformants
containing many copies of the transgene.
Summary of the Invention
In view of the foregoing, a first aspect of the
present invention is an isolated DNA molecule having a
nucleotide sequence of SEQ ID NO: 1.
A further aspect of the present invention is a
DNA construct comprising a transcription initiation
region, a structural gene, and a scaffold attachment
region of SEQ ID NO:1.
A further aspect of the present invention is a
DNA construct comprising, in the 5' to 3' direction, a
transcription initiation region, at least one structural
gene positioned downstream from the transcription
initiation region and operatively associated therewith,
and a scaffold attachment region having SEQ ID NO:1
positioned either 5' to the transcription initiation
region or 3' to the structural gene.
A further aspect of the present invention is a
plant cell containing a DNA construct as described in the
preceeding paragraph.
Further aspects of the present invention are
transformed plant cells containing a DNA construct as
described above, and recombinant plants comprising such
transformed plant cells.
A further aspect of the present invention is a
method of making transgenic plant cells with increased
CA 02f244204 2005-O1-07
-2a-
expression of foreign genes. The method includes
transforming a plant cell capable of regeneration with a
DNA construct of the present invention.
A further aspect of the present invention is a
method of making transgenic plant cells having increased
expression of foreign genes therein, the method
comprising:
providing a plant cell capable of regeneration;
and
transforming the plant cell with a DNA
construct comprising, in the 5' to 3' direction, a
transcription initiation region, at least one structural
gene positioned downstream from the transcription
initiation region and operatively associated therewith,
and a scaffold attachment region of SEQ ID NO:1
positioned either 5' to the transcription initiation
region or 3' to the structural gene.
A further aspect of the present invention is a
method of making recombinant tobacco plant cells having
increased expression of foreign genes. The method
includes transforming a tobacco plant cell with a DNA
construct according to the present invention.
A further aspect of the present invention is a
method of making a recombinant tobacco plant cells having
increased expression of foreign genes therein, the method
comprising:
providing a tobacco plant cell capable of
regeneration; and
transforming the tobacco plant cell with a DNA
construct comprising, in the 5' to 3' direction, a
transcription initiation region functional in plant
cells, at least one structural gene positioned downstream
from the transcription initiation region and operatively
CA 02244204 2005-O1-07
-2b-
associated therewith, and a scaffold attachment region of
SEQ ID NO:1 positioned either 5' to the transcription
initiation region or 3' to the structural gene.
A further aspect of the present invention is a
DNA construct comprising, in the 5' to 3' direction, a
transcription initiation region, at least one structural
gene positioned downstream from the transcription
initiation region and operatively associated therewith,
and a scaffold attachment region of SEQ ID NO:1
positioned either 5' to the transcription initiation
region or 3' to the structural gene;
which DNA construct is carried by a plant
transformation vector.
A further aspect of the present invention is a
transformed tobacco plant cell containing a heterologous
DNA construct comprising, in the 5' to 3' direction, a
transcription initiation region functional in plant
cells, at least one structural gene positioned downstream
from the transcription initiation region and operatively
associated therewith, and a scaffold attachment region of
SEQ ID NO:1 positioned either 5' to the transcription
initiation region or 3' to the structural gene.
A further aspect of the present invention is a
plant transformation vector carrying a DNA construct
which includes a transcription initiation region, a
structural gene, and a scaffold attachment region of SEQ
ID NO:1.
CA 02244204 1998-07-27
WO 97/27207 PCTIUS97I01278
-3- -
Brief Description of the Drawings
Figure 1 provides a schematic comparison of SAR
sequence motifs in the 1167 base pair tobacco SAR (RB7
SAR) of the present invention (SEQ ID NO:1) and the 838
base pair yeast SAR (ARS-1), showing A boxes (A), T boxes
(T), Drosophila topoisomerase II sites (O), ARS consensus
sequences (R), and G exclusion regions (ATC tract of 30
bp) represented by the black side bars. Local AT-rich
regions (>20 bp) are indicated by the dark hatched boxes
(regions of 95% AT) or lighter hatched boxes (90-95% AT).
Figure 2A is a schematic of the selection
plasmid pGHNCIO, where NPTII is the nptll gene from TnS,
ocs T is the polyadenylation site/terminator from
octopine synthase gene, and arrows P1 and P2 indicate the
locations of the PCR primers used in the estimation of
copy numbers.
Figure 2B is a schematic of the control
expression plasmid pGHNCI2, where CaMV 35S is the
cauliflower mosaic virus 35S promoter, GUS is the coding
region of the E. coli ~i-glucuronidase gene, nos T is the
poiyadenylation site/terminator from the nopaline
synthase (nos) gene, and arrows P1 and P2 indicate the
locations of the PCR primers used in the estimation of
copy numbers.
Figure 2C is a schematic of the (+)SAR
expression plasmid pGHNCI1, where CaMV 35S is the
cauliflower mosaic virus 35S promoter, GUS is the coding
region of the E. coli ,C3-glucuronidase gene, nos T is the
polyadenylation site/terminator from the nopaline
synthase (nos) gene, Rb7 SAR is the tobacco SAR.of SEQ ID
NO:l, and arrows P1 and P2 indicate the locations of the
PCR primers used in the estimation of copy numbers.
' Figure 3A is a restriction map showing the GATC
sites (vertical lines) for RB7 SAR(+) plasmid pGHNCI1 and
' 35 the SARI-) control plasmid pGHNCI2. A 501 base pair
probe fragment from the CaMV 35S promoter is indicated
below the restriction maps.
CA 02244204 1998-07-27
WO 97/27207 PCT/US97/01278
-4-
Figure 3B provides DNA gel blots of selected
RB7 SAR(+) lines (left panel) and a control of plasmid
pGHNCI2 (right panel), indicating DpnI, DpnII and Sau3A
digests. Arrows indicate molecular weights estimated
from 1 kb markers.
Figure 3C is a DNA gel blot of selected SARI-)
control lines showing Dpnl, DpnII and Sau3A digests.
Molecular weight estimates are indicated by arrows.
Fa.gure 4 plots GUS expression versus gene copy
number for individual cell lines, where open squares
represent RB7 SAR(+) transformants and closed triangles
represent controls.
Figure 5 is a plot of NPT protein against gene
copy number, where open squares represent RB7 SAR(+)
transformants and closed triangles represent control
lines.
Figure 6 incorporates data from Figures 4 and
5, re-plotted to compare the expression levels for each
introduced gene. Open squares represent double RB7 SAR
transformants; closed triangles represent control lines.
Detailed Descript3.on of the 2nventa.on
The present inventors have found that a SAR
(RB7 SAR) isolated from tobacco (SEQ ID N0:1) used in
conjunction with a transgene can increase average
expression pergene copy by more than 100-fold in stably
transformed cell lines. The present tobacco SAR effect
was found to be maximal at relatively low transgene copy
number-s _
The loop domain model of chromatin organization
predicts that SARs act as boundary elements, limiting the
spread of condensed chromatin structures and blocking the
influence of cis-regulatory elements in neighboring
chromatin. Thus, if variation in transgene expression is
mainly attributable to genomic position effects, the '
presence of flanking SARs should normalize expression per
gene copy and substantially reduce variability among
CA 02244204 1998-07-27
WO 97127207 PCT/LTS97l01278
_ _5_
independent transformants. Total gene expression should
then vary in direct proportion to gene copy number.
Experiments with animal cell systems have supported this
prediction. Grosveld et al. Cell 51:975 (1987); Stief et
al. Nature 341:343 (1989); Bonifer et al., EMBO J. 9:2843
(1990); McKnight et al., Proc. Natl. Acad. Sci. USA
89:6943 (1992); Phi-Van et al., Mol. Cell. Biol. 10:2303
(1990) .
Recent evidence indicates that one or more
'gene silencing' phenomena also contribute to overall
variability, especially in fungal and higher plant
systems. Assaad et al., Plant Mol. Biol. 22:1067 (1993);
Finnegan and McElroy, Bio/Technology 12:883 (1994);
Flavell, Proc. Natl. Acad. Sci USA 91:3490 (1994) . In
principle, position effects on transgene expression
reflect pre-existing features of the insertion site, such
as proximity to genomic enhancers and degree of chromatin
condensation, while gene silencing results from homology-
dependent interactions involving the transgene itself,
although chromosomal location may influence the severity
of these interactions.
While not wishing to be held to a single
theory, the present inventors propose that a portion of
the large SAR effects seen with the SARof the present
invention reflect a reduction in the severity of gene
silencing under conditions in which control transformants
are severely affected. Homology-dependent gene silencing
must be considered whenever multiple transgenes are
present. Although best known in fungi and higher plants,
silencing of multicopy insertions has recently been
reported in Drosophila as well (borer and Henikoff, Cell
77:993 (1994)).
The predominance of multicopy insertions in the
transformants reported herein may be one reason the
° 35 presently reported RB7 SAR effects vary from those
reported by laboratories using Agrobacterium vectors for
transformation. In four reports, a moderate increase in
CA 02244204 1998-07-27
WO 97/27207 PCT/LTS97/01278
expression was reported along with a decrease in
variation between transformants (Mlynarova et al., Plant
Cell 7:599 (1995); Mlynarova et al, Plant Cell 6:417
(1994); Schoffl et al., Transgenic Res. 2:93 (1993); van
der Geest et al, Plant J. 6:413 (1994)). Breyne et al.,
Plant Cell 4:463 (1992) reported a decrease in average
gene expression. Direct DNA-mediated transformation
frequently produces complex loci in which multiple
transgene copies are integrated at a single genomic site.
Interactions among homologous sequences at a single locus
are thought to increase the frequency of silencing, thus
it would be expected that the transformants reported in
the Examples herein would be more affected by silencing
than those obtained with Agro.bacterium vectors that only
occasionally produce multicopy events.
The present invention may be used to transform
cells from a variety of organisms, including plants
(i.e., vascular plants). As used herein, plants includes
both gymnosperms and angiosperms (i.e_, mon.ocots and
dicots). Transformation according to the present
invention may be used to increase expression levels of
transgenes in stably transformed cells.
The term "operatively associated," as used
herein, refers to DNA sequences on a single DNA molecule
which are associated so that the function of one is
affected by the other. Thus, a transcription initiation
region is operatively associated with a structural gene
when it is capable of affecting the expression of that
structural gene (i.e., the structural gene is under the
transcriptional control of the transcription initiation
region). The transcription initiation region is said to
be "upstream" from the structural gene, which is in turn
said to be "downstream" from the transcription initiation
region.
DNA constructs, or "expression cassettes," of
the present invention preferably include, 5' to 3' in the
direction of transcription, a first scaffold attachment
CA 02244204 1998-07-27
WO 97/27207 PCT/US97101278
_7_
region, a transcription initiation region, a structural
gene operatively associated with the transcription
initiation region, a termination sequence including a
stop signal for RNA polymerase and a polyadenylation
signal for polyadenylation (e. g., the nos terminator),
and a second scaffold attachment region. All of these
regions should be capable of operating in the cells to be
transformed. The termination region may be derived from
the same gene as the transcription initiation or promoter
region, or may be derived from a different gene. DNA
constructs of the present invention as described above
may include either a single structural gene or more than
one structural gene operatively associated with the
transcription initiation region. A particular DNA
construct of the present invention includes, 5' to 3' in
the direction of transcription, a first scaffold
attachment region, a transcription initiation region, a
first structural gene operatively associated with the
transcription initiation region, a second structural gene
operatively associated with the transcription initiation
region, a termination sequence including a stop signal
for RNA polymerase and a polyadenylation signal for
polyadenylation (e. g., the nos terminator), and a second
scaffold attachment region.
The scaffold attachment regions (or "SARs")
used to carry out the present invention have the
nucleotide sequence of SEQ ID NO: 1 provided herein (RB7
SAR). The RB7 SAR may be isolated from natural sources
or may be chemically synthesized.
SARs are known to act in an orientation-
independent manner. Poljak et al., Nucleic Acids Res.
22:4386 (1994). Genetic constructs of the present
' invention may contain RB7 SARs oriented as direct repeats
in a single orientation (~ ~), direct repeats in the
' 35 opposite orientation (~ ~), or either of two possible
indirect repeats (-~ <- or E -j) .
CA 02244204 1998-07-27
WO 97/27207 PCT/US97/OI278
_g-
The transcription initiation region, which
preferably includes the RNA polymerase binding site
(promoter), may be native to the host organism to be
transformed or may be derived from an alternative source,
where the region is functional in the host. Other
sources include the Agrobacterium T-DNA genes, such as
the transcriptional initiation regions for the
biosynthesis of nopaline, octapine, mannopine, or other
opine transcriptional initiation regions, transcriptional
initiation regions from plants, transcriptional
initiation regions from viruses (including host specific
viruses), or partially or wholly synthetic transcription
initiation regions. Transcriptional initiation and
termination regions are well known. See, e_g., dGreve,
J. Mol. Appl. Genet. 1, 499-511 (1983); Salomon et al.,
EMBO J. 3, 141-146 (1984); Garfinkel et al., Cell 27,
143-153 (1983); and Barker et al., Plant Mol. Biol. 2,
235-350 (1983).
The transcriptional initiation regions may, in
addition to the RNA polymerase binding site, include
regions which regulate transcription, where the
regulation involves, for example, chemical or physical
repression or induction (e.g., regulation based on
metabolites or light) or regulation based on cell
differentiation (such as associated with leaves, roots,
seed, or the like in plants). Thus, the transcriptional
initiation region, or the regulatory portion of such
region, is obtained from an appropriate gene which is so
regulated. For example, the 1,5-ribulose biphosphate
carboxylase gene is light-induced and may be used for
transcriptional initiation. Other genes are known which
are induced by stress, temperature, wounding, pathogen
effects, etc. '
Structural genes are those portions of genes
which comprise a DNA segment coding for a protein, '
polypeptide, or portion thereof, possibly including a
ribosome binding site and/or a translational start codon,
CA 02244204 1998-07-27
WO 97/27207 PCT/US97/01278
_g_
but lacking a transcription initiation region. The term
can also refer to introduced copies of a structural gene
where that gene is also naturally found within the cell
being transformed. The structural gene may' encode a
protein not normally found in the cell in which the gene
is introduced or in combination with the transcription
initiation region to which it is operationally
associated, in which case it is termed a heterologous
structural gene. Genes which may be operationally
associated with a transcription initiation region of the
present invention for expression in a plant species may
be derived from a chromosomal gene, cDNA, a synthetic
gene, or combinations thereof. Any structural gene may
be employed. Where plant cells are transformed, the
25 structural gene may encode an enzyme to introduce a
desired trait, such as glyphosphate resistance; a protein
such as a Bacillus thuringiensis protein (or fragment
thereof) to impart insect resistance; or a plant virus
protein or fragment thereof .to impart virus resistance.
The expression cassette may be provided in a
DNA construct which also has at least one replication
system. For convenience, it is common to have a
replication system functional in Escherichia call, such
as ColEl, pSC101, pACYC184, or the like. In this manner,
at each stage after each manipulation, the resulting
construct may be cloned, sequenced, and the correctness
of the manipulation determined. In addition, or in place
of the E. coli replication system, a broad host range
replication system may be employed, such as the
replication systems of the P-1 incompatibility plasmids,
e.g., pRK290_ In addition to the replication system,
there will frequently be at least one marker present,
which may be useful in one or more hosts, or ' different
markers for individual hosts. That is, one marker may be
employed for selection in a prokaryotic host, while
another marker may be employed for selection in a
CA 02244204 1998-07-27
WO 97/27207 PCT/LTS97/OI278
-10-
eukaryotic host, particularly a plant host_ The markers
may be protection against a biocide, such as antibiotics,
toxins, heavy metals, or the like; provide _
complementation, for example by imparting prototrophy to
an auxotrophic host; or provide a visible phenotype
through the production of a novel compound. Exemplary
genes which may be employed include neomycin
phosphotransferase (NPTII), hygromycin phosphotransferase
(HPT), chloramphenicol acetyltransferase (CAT),
nitrilase, and the gentamicin resistance gene. For plant
host selection, non-limiting examples of suitable markers
are ~-glucuronidase, providing indigo production,
luciferase, providing visible light production, NPTII,
providing kanamycin resistance or G4I8 resistance, HPT,
providing hygromycin resistance, and the mutated aroA
gene, providing glyphosate resistance-.
The various fragments comprising the various
constructs, expression cassettes, markers, and the like
may be introduced consecutively by restriction enzyme
cleavage of an appropriate replication system, and
insertion of the particular construct or fragment into
the available site. After ligation anal cloning the DNA
construct may be isolated for further manipulation. All
of these techniques are amply exemplified ir_ the
literature and find particularexemplification in
Sambrook et al., Molecular Cloning: A Laboratory Manual,
(2d Ed. 1989)(Cold Spring Harbor Laboratory, Cold Spring
Harbor, NY).
Vectors which may be used to transform plant
tissue with DNA constructs of the present invention
include non-Agrohacterium vectors, particularly ballistic
vectors, as well as vectors suitable for DNA-mediated
transformation.
Microparticles carrying a DNA construct of the
present invention, which microparticles are suitable for
the ballistic transformation of a cell, are also useful
for transforming cells according to the present
CA 02244204 2005-O1-07
-11-
invention. The microparticle is propelled into a cell to
produce a transformed cell. Where the transformed cell
is a plant cell, a plant may be regenerated from the
transformed cell according to techniques known in the
art. Any suitable ballistic cell transformation
methodology and apparatus can be used in practicing the
present invention. Exemplary apparatus and procedures
are disclosed in Stomp et al., U.S. Patent No. 5,122,466;
and Sanford and Wolf, U.S. Patent No. 4,945,050. When
using ballistic transformation procedures, the expression
cassette may be incorporated into a plasmid capable of
replicating in the cell to be transformed. Examples of
microparticles suitable for use in such systems include 1
to 5 ~m gold spheres. The DNA construct may be deposited
on the microparticle by any suitable technique, such as
by precipitation.
Agrobacterium tumefaciens mediated
transformation methods, as are known in the art, may also
be used to transform plant tissue with DNA constructs of
the present invention.
Plant species may be transformed with the DNA
construct of the present invention by the DNA-mediated
transformation of plant cell protoplasts and subsequent
regeneration of the plant from the transformed
protoplasts in accordance with procedures well known in
the art.
Any plant tissue capable of subsequent clonal
propagation, whether by organogenesis or embryogenesis,
may be transformed with a vector of the present
invention. The term "organogenesis," as used herein,
means a process by which shoots and roots are developed
sequentially from meristematic centers; the term
"embryogenesis," as used herein, means a process by which
CA 02244204 2005-O1-07
-lla-
shoots and roots develop together in a concertea fashion
(not sequentially) , whether from somatic cells or
CA 02244204 1998-07-27
WO 97/27207 PCT/US97/01278
-12-
gametes. The particular tissue chosen will vary
depending on the clonal propagation systems available
for, and best suited to, the particular species being
transformed. Exemplary tissue targets include leaf
disks, pollen, embryos, cotyledons, hypocotyls,
megagametophytes, callus tissue, existing meristematic
tissue (e. g., apical meristems, axillary buds, and root
meristems), and induced meristem tissue (e.g.,'cotyledon
meristem and hypocotyl meristem).
Plants of the present invention may take a
variety of forms. The plants may be chimeras of
transformed cells and non-transformed cells; the plants
may be clonal transformants (e. g., all cells transformed
to contain the expression cassette); the plants may
comprise grafts of transformed and untransformed tissues
(e.g., a transformed root stock grafted to an
untransformed scion in citrus species). The transformed
plants may be propagated by a variety of means, such as
by clonal propagation or classical breeding techniques.
For example, first generation (or T1) transformed plants
may be selfed to give homozygous second generation (or
T2) transformed plants, and the T2 plants further
propagated through classical breeding techniques. A
dominant selectable marker (such as npt II) can be
associated with the expression cassette to assist in
breeding.
Plants which may be employed in practicing the
present invention include (but are not limited to)
tobacco (Nicotiana tabacum), rapeseed (Brassica napus),
potato (Solanum tuberosum), soybean (glycine max),
peanuts (Arachis hypogaea), cotton (Gossypium hirsutum),
sweet potato (Tpomoea batatus), cassava (Manihot
esculenta), coffee (Cofea spp.}, coconut (Cocos
nucifera), pineapple (Ananas comosus), citrus trees
(Citrus spp.), cocoa (Theobroma cacao), tea (Camellia
sinensis), banana (Musa spp.), avocado (Persea
americana), fig (Ficus casica), guava (Psidium guajava),
CA 02244204 1998-07-27
WO 97/27207 PCT/US97101278
-13 -
mango (Mangifera indica), olive (Olea europaea), papaya
(Carica papaya), cashew (Anacardium occidentale),
macadamia (Macadamia integrifolia), almond (Prunes
amygdalus), sugar beets (Beta vulgaris), corn (Zea mays),
wheat, oats, rye, barley, rice, vegetables, ornamentals,
and conifers. Vegetables include tomatoes (Lycopersicon
esculentum) , lettuce (e.g. , Lactuea sativa) , green beans
(Phaseolus vulgaris), lima beans (Phaseolus Iimensis),
peas (Pisum spp.) and members of the genus Cucumis such
as cucumber (C. sativus), cantaloupe (C. cantalupensis),
and musk melon (C. melo). Ornamentals include azalea
(Rhododendron spp.), hydrangea (Macrophylla hydrangea),
hibiscus (Hibiscus rosasanensis), roses (Rosa spp.),
tulips (Tulipa spp.), daffodils (Narcissus spp.),
petunias (Petunia hybrida), carnation (dianthus
caryophyllus), poinsettia (Euphorbia pulcherima), and
chrysanthemum. Gymnosperms which may be employed to
variy i ng -~h° p Sent -- ~~'l~i~~'l~~~i1 -~~~1~~-~o111fCr5
V ut L11G r a
1
including pines such as loblolly pine (Pines taeda),
slash pine (Pines elliotii), ponderosa pine (Pines
ponderosa), lodgepole pine (Pines contorta), and Monterey
pine (Pines radiata); Douglas-fir (Pseudotsuga
menziesii); Western hemlock (Tsuga canadensis); Sitka
spruce (Picea glauca); redwood (Sequoia sempervirens);
true firs such as salver fir (Abies amabilis) and balsam
fir (Abies balsamea); and cedars such as Western red
cedar (Thuja plicata) and Alaska yellow-cedar
(Chamaecyparis nootJcatensis) .
- The examples which follow are set forth to
illustrate the present invention, and are not to be
construed as limiting thereof.
' EXAMPLE 1
METHODS
1. Plasmid Constructs
A GUS reporter plasmid was made by using a
Klenow filled-in blunt-ended 1.1 kb ClaI/ScaI SAR
CA 02244204 2005-O1-07
-14-
fragment (SEQ ID NO:1) from pRB7-6 (Hall et al., Proc.
Natl. Acad. Sci. USA 88:9320 (1991)), which was inserted
into Klenow filled-in blunt-ended XbaI site in
pBluescriptT"' II SK+ (Stratagene), resulting in plasmid
pGHNCl. Similarly, the l.lkb ClaI/ScaI SAR fragment (SEQ
ID N0:1) was also inserted into the Klenow filled-in
blunt-ended XhoI site in pBluescript II SK+ (Stratagene)
resulting in pGHNC4. The l.lkb ApaI/HindIII fragment
from pGHNC4 was then inserted into the ApaI/HindIII sites
of pGHNCl to give pGHNC5. The 2.8 kb HindIII/EcoRI
fragment from pBI221 (Clonetech), containing the 35S
promoter/GUS reading frame/Nos terminator, was inserted
into the HindIII/EcoRI sites of pGHNC5 or pBluescript II
SK+ to yield pGHNCll (+SARs) or pGHNCI2 (-SARs),
respectively.
The selection plasmid (pGHNCIO) was created by
ligating the HindIII/EcoRI fragment containing the nos
promoter/NPT II reading frame/Ocs terminator from pUCNKl
(Herrera-Estrella et al., IN: Gelvin et al. (Eds.), Plant
Molecular Biology Manual, Kluwer Academic Publishers,
Dordrecht, The Netherlands, pp. 1-22 (1988)) into the
Hind III/EcoRI sites of pBluescript II SK+.
2. Microprojectile Transformation
The Nicotiana tabacum cell line NT-1 was
obtained from G. An, Washington State University.
Suspension cultures were grown in a medium containing
Murashige and Skoog salts (GIBCO Laboratories, Grand
Island, NY) supplemented with 100 mg/L inositol, 1 mg/L
thiamine HC1, 180 mg/L KHzP04, 30 g/L sucrose, and 2 mg/L
2,4-dichlorophenoxyacetic acid. The pH was adjusted to
5.7 before autoclaving. Cells were subcultured once per
week by adding 3 ml of inoculum to 100 ml of fresh medium
CA 02244204 2005-O1-07
-14a-
in 500 ml Erlenmeyer flasks. The flasks were placed on a
rotary shaker at 125 rpm and 27'C with a light intensity
of 47 ~,mol m zsec-1.
CA 02244204 1998-07-27
WO 97/27207 PCTIUS97/01278
-15-
Four-day-old cells, in early log phase, were
transformed by microprojectile bombardment. Aliquots of
50 ml were centrifuged and the pellet resuspended in
fresh culture medium at a concentration of 0.1 g/ml.
Aliquots of 0.5 ml were spread as monolayers onto sterile
lens paper which had been placed on culture medium
solidified with 0.8% agar in_60 mm petri plates. Plated
cells were kept at 23°C for 3h prior to bombardment.
Microprojectile bombardment was carried out with a DuPont
PDS-1000 Particle Accelerator using a normal rupture disk
valve of 1500 psi with the sample positioned 5.5 cm from
the launch assembly.
Each batch of cells was co-transformed with a
mixture of "expression" and "selection" plasmids . A ,Ci
glucuronidase (GUS) gene driven by the CaMV 35S promoter
(Benfey and Chua, Science 244:174 (1989)} was used to
measure expression, while a neomycin phosphotransferase
gene (nptl2) driven by the nopaline synthase promoter
(Depicker et al., 1982) was used to select for cells
which had stably integrated exogenous DNA. All plasmids
were amplified in Escherichia co~i strain DHScx and
isolated using a Quiagen plasmid maxiprep kit (Quiagen,
Inc. Chatsworth, CA). Co-transformation mixtures
contained a 4:1 molar ratio of GUS reporter plasmid to
nptll selection plasmid. Therefore, each 500 ng SAR
transformation mixture consisted of 432 ng pGHNCll and 68
ng pGHNCIO, whereas control mixtures contained 314 ng
pGHNCI2 and 68 ng pGHNCIO. Each DNA preparation (in 5 /.c.L
TE buffer) was mixed and precipitated with 50 /r.L of 2.5M
3 0 CaCl2 and 2-0 /.~.L of 0 . 1M spermidine onto 1 . 0 /~.m gold
microprojectiles.
After bombardment, the petri plates were sealed
with parafilm and incubated for 24 h at 27°C under
constant light. Using the lens paper, cells were then
transferred to fresh plates containing medium
supplemented with 100 ~cg per ml kanamycin_ Isolated
kanamycin resistant microcalli began to appear in
CA 02244204 2005-O1-07
-16-
approximately 3 weeks, at which time they were
transferred to fresh plates containing kanamycin medium.
After 1 week's growth on plates, a suspension culture was
started for each callus by inoculating 1 ml broth
supplemented with 50 ~,g kanamycin per ml. Once
established, the suspension cultures were transferred
weekly using 3~ (v/v) inocula in 5 ml broth supplemented
with 50 ~,g per ml kanamycin.
3. Gene Copy Number Analysis
DNA was isolated as previously described (Allen
et al., Plant Cell 5:603 (1993)). Estimates of GUS and
nptll gene copy number were obtained for all cell lines
by quantitative polymerase chain reaction (PCR)
procedure, and confirmed for representative lines by
genomic Southern analysis. The PCR procedure for GUS
gene copy number analysis used primers located in the
CaMV35S promoter (5'-TCAAGATGCC TCTGCCGACA-3') (SEQ ID
N0:2) and in the translated region of the GUS gene (5'-
TCACGGGTTG GGGTTTCTAC-3') (SEQ ID N0:3) and for nptll
gene copy analysis used primers located in the nos
promoter (5'-GGAACTGACA GAACCGCAAC-3') (SEQ ID N0:4) and
in the translated region of the nptll gene (5'-GGACAGGTCG
GTCTTGACAA-3') (SEQ ID N0:5). A Hot Start PCR procedure
using AmpliWaxT"" beads (Perkin Elmer) was used according
to the manufacturer's instructions. The lower reaction
mixture (25 ~,L) contained 0.8 mM dNTPs, 6 mM MgCl2, 0.4 mM
of each oligonucleotide primer, 50 mM KC1, 10 mM Tris-HC1
(pH 8.8). The upper reaction mixture (75 ~,1) contained
50 mM KC1, 10 mM Tris-HC1. (pH 8.8), 2.5U Tag Polymerase,
and 100 ng genomic DNA in 10 ~.1 TE. Each cycle consisted
of 2 min at 94'C, 2.5 min at 50'C, and 3 min at ?2'C.
CA 02244204 2005-O1-07
-16a-
Reactions were terminated following a final extension
step of 7 min at 72'C.
PCR was limited to eighteen cycles for both the
GUS and nptll copy number analysis to avoid substrate
exhaustion, and amplification products were visualized by
CA 02244204 1998-07-27
WO 97!27207 PCTIUS97/01278
-17-
blotting and hybridization with 32P-labeled DNA probe.
Reconstruction standards were prepared by serially
diluting DNA from the pGHNCI1 (+SARs) into wild-type NT-1
genomic DNA so as to introduce between 1 and 150 GUS
genes per 1C (5 pg) equivalent of tobacco DNA
(Arumuganathan and Earle, 1991). PCR reactions were done
simultaneously for standards and unknowns. Similarly,
the nptll reconstruction standards were prepared by
serially diluting DNA from the pGHNCIO into wild-type NT-
1 genomic DNA so as to introduce between 1 and 40 nptll
genes per 1C. Hybridization signals were quantified on
an Ambis radioanalytical scanner (Ambis, San Diego, CA),
and a final copy number estimates were calculated using
linear regression analysis_
4. DNA Gel Blot Analysis
Southern analysis was done as described by
Murray et al_ Plant Mol. Biol. Rep. 10:173 (1992).
Agarose gels were stained with 0.5 mg/ml ethidium bromide
and photographed. The top 1/3 of the gels were treated
with 0.25N HCl~ for 10 minutes. The gels were then
incubated twice for 15 minutes in 150 mM NaOH.3mM EDTA,
and twice for 15 minutes in 150mM NaPO~ pH 7.4, and
blotted to Genescreen Plus (New England Nuclear) by the
method of Southern (Sambrook et al., Molecular Cloning:
A Laboratory Manual, (2d Ed. 1989} Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY}.1989) using 25 mM
sodium pyrophosphate. The membranes were blocked by
incubating in 2% SDS, 0.5% BSA, 1mM EDTA, 1mM 1,10-
phenanthroline and hybridized in 100 mM NaP04 pH 7.8, 20mM
Na pyrophosphate, 5mM EDTA, 1mM 1,10-phenanthroline, 0.1%
SDS, 10 % dextran sulfate, 500 ~,cg/ml heparin sulfate, 50
~.cg/ml yeast RNA, 50 /.cg/ml herring sperm DNA. Probes were
prepared with the Random Prime DNA Labeling kit from
United States Biochemical Co. Washing conditions
included one wash at room temperature with 2X SSC, 0.5%
SDS for 5 minutes, one wash at room temperature with 2X
CA 02244204 2005-O1-07
-18-
SSC, 0.1% SDS for 15 minutes, two washes at room
temperature with O.1X SSC, 0.5% SDS for 15 minutes, and
two washes at 37'C with O.1X SSC, 0.5% SDS for 30
minutes.
5. NPTII and GUS assays
For NPTII protein assays cells were ground in
liquid nitrogen and suspended in 100 JCL of 0.25M TrisCl,
pH 7.8. The mixture was centrifuged and the supernatant
was used for ELISA analysis using an NPTII ELISA kit (5'-
>3') according to the instructions of the manufacturer.
For GUS fluorometric analysis, frozen cells
were ground in liquid nitrogen as described for the NPTII
and DNA extraction. Approximately 50 mg of the resulting
powder was resuspended in 600 ~1 of GUS extraction buffer
containing 50mM NaP04, pH 7.0, 10 mM ~i-mercaptoethanol, 10
mM Na2EDTA, 0.1% sodium lauryl sarcosine (w/v), and 0.1%
Triton X-1001"" (w/v) and sonicated twice for 10 sec. The
extract was clarified by treatment with insoluble
polyvinyl polypyrrolidone and centrifuged. GUS activity
was determined by means of the fluorometric assay
described by Jefferson, Plant Mol. Biol. Rep. 5:387
(1987); Jefferson et al., EMBO J. 6:3901 (1987), using
methylumbelliferone glucuronide (MUG) as substrate.
Total protein was measured using the BioRad Protein assay
kit (BioRad Laboratories, Melville, N.Y.) and GUS
specific activity reported as nmols 4-methyl
umbelliferone (4-MU) formed ~min-1~mg protein-1 from the
initial velocity of the reaction.
6. Transient Expression
Protoplasts for electroporation were prepared
from 4-day-old NT-1 suspension cultures by a procedure
CA 02244204 2005-O1-07
-18a-
similar to that of Hall et al., Proc. Natl. Acad. Sci.
USA 88:9320 (1991). Cells from 100 ml of culture were
harvested by centrifugation (300 X g for 2 min), washed
twice in 100 ml of 0.4M mannitol, and resuspended in an
CA 02244204 1998-07-27
WO 97/27207 PCT/LJS97/01278
-19-
equal volume of protoplasting solution containing 0.4M
mannitol, 20mM MES, pH 5.5, 1% cellulase (Onozuka RS) and
0.1°s pectolyase Y23 (Onozuka). They were then incubated
at 25°C for 30-60 min with shaking at 150 rpm. The
resulting protoplasts were washed twice in protoplast
buffer containing 0.4M mannitol by centrifuging at 300 X
g for 5 min in a Beckman GPR centrifuge equipped with
GH3.7 rotor. A protoplast concentration of 4 X 106 per ml
was obtained by diluting the mixture with 0.4M mannitol.
The resulting suspension was then diluted by adding an
equal volume of 2X electroporation buffer to a final
concentration of 2 X 106 protoplasts per ml. The 2X
electroporation buffer contained 273mM NaCl, 5.36mM KCl,
2 . 94 mM KH2P04 , 15 . 5mM Na2HP04 , 0 . 4M mannitol , pH 6 . 5 .
Each electroporation used 80 fcg sheared E.coli
carrier DNA and 20 ~.g of the plasmid DNA mixture to be
tested. One ml of protoplast was added to the
electroporation cuvette (BRL), mixed with 100 ~.L DNA
mixture in TE buffer, and left on ice fo.r 5 min.
Electroporation was done in a BRL Cell-Porator at 250V
and 1180 /.cF. Cuvettes were placed on ice for 15 min
immediately after treatment. Aliquots (400 /.cl) of
electroporated protoplasts were then transferred to 60 mm
Petri plates containing 4 ml of culture medium with 0.4M
mannitol. After incubation for various time periods,
protoplasts were collected by centrifugation at 300 X g
for 5 min. at 4°C. Each pellet was suspended in 600 E.~.l
GUS extraction buffer, and GUS activity was assayed by
the fluorogenic procedure described above.
7. Isolation of Plant Nuclear Scaffold and Bindinct Assavs
Nuclei and nuclear scaffolds from NT-1 cells
were isolated as previously described (Hall et al., Proc.
Nat1_ Acad. Sci. USA 88:9320 (1991); Hall and Spiker, IN:
Gelvin et al. (Eds), Plant Molecular Biology Manual,
Kluwer Academic Publishers, Dordrecht, pp. 1-12 (1994)).
The resulting nuclear halos were washed 2 times with
CA 02244204 1998-07-27
WO 97!27207 PCT/US97/01278
-20-
Digestion/Binding Buffer (D/BB, pH 6.5) which contains
70mM NaCI; 20mM Tris, pH 8.0; 20mM KC1; O.lo digitonin;
1e thiodiglycol; 50mM spermine; 125 mM spermidine with
0.5mM PMSF and 2 ~.g ml-1 aprotinin (Hall et al., 1991;
Hall and Spiker, 1994). The halos were then washed again
in the same buffer containing lOmM MgCla. The halos were
then diluted to 4 X 106 ml-' in D/BB containing 0.5mM PMSF;
2 /.r,g ml-1 aprotinin; lOmM phenanthroline; and lOmM MgCl2;
and digested with 500 units ml-1 of the various
restriction enzymes (New England Biolabs) at 37°C for 1h.
Fresh enzymes were then added and the incubation was
continued for an additional lh. Aliquots (100 /.cl)
containing scaffolds representing approximately 8 X 105
nuclei were centrifuged at 2600 X g, the supernatant was
removed, and the scaffold pellets resuspended in D/BB
containing 0.5mM PMSF; 2 /.cg ml'1 aprotinin, and lOmM MgCla.
For binding assays, four fcmoles of 32P end
labeled fragments previously digested with restriction
enzymes (New England Biolabs), were added to the 100 j.cl
scaffold aliquot along with appropriate competitor DNA
and incubated at 37°C for 3h with frequent mixings. The
scaffold aliquots were centrifuged at 2600 X g and the
pellet (containing scaffold-bound DNA fragments) and the
supernatant containing non-binding fragments were
separated. The pellet fraction was washed in.200 ~.l of
D/BB with lOmM MgCl2, re suspended in 100 E.cl TE buffer
(representing 1000) containing 0.5o SDS with 0.5 mg mi-1
proteinase K, and incubated at room temperature
overnight. Equal fractions (usually 200) of pellet and
supernatant fractions were separated on a to agarose gel
in TAE buffer (Sambrook et al., 1989). The gel was
treated with 7~ trichloroacetic acid for 20 min and dried
onto filter paper followed by exposure to X-ray film.
CA 02244204 1998-07-27
WO 97/27207 PCTJUS97/OI278
-21-
EXAMPLE 2 '
SAR Motifs and Predicted Scaffold Binding Activit~r
SARs are highly variable in sequence, however,
several loosely defined SAR-related consensus elements or
motifs have been identified from sequence comparisons in
yeast and animal systems (Dickinson et al., Cell 70:631
(1992); Gasser et al., Int. Rev. Cytol. 119:57 (1989);
Gasser and Laemmli, EMBO J. 5:511 {1986); Mielke et al.,
Biochem. 29:7475 {1990))_ F=CURE 1 shows the
distribution of some of these motifs in the 1186 base
pair tobacco RB7 SAR (SEQ ID NO:1), and in an 838 base
pair yeast SAR sequence (ARS-1, Allen et al., Plant Cell
5:603 (1993)).
In FIGURE 1, A boxes {A} were scored as an 8/10
or better match with the consensus sequence AATAAAYAAA,
where Y=pyrimidine. T boxes (T) were scored as~a 9/10 or
better match with the consensus TTWTWTTWTT, where W = A
or T. Drosophila topoisomerase II sites (O) were scored
as a 13/15 or better match with the consensus GTNWAYATTN
ATNNG. ARS consensus sequences {WTTTATATTTW) are
indicated by (R}. G exclusion regions (ATC tracts of 30
base pairs ) are represented by black side bars . Local
AT-rich regions (>20 bp) are indicated by the dark
hatched boxes (regions of 95% AT) or lighter hatched
boxes (90-95o AT) .
The yeast SAR contains several A boxes and T
boxes. In addition, there is one ARS consensus element,
two G-exclusion regions or ATC tracts of 30 bp, and a 20
by tract containing 90o A+T. The plant SAR (SEQ ID N0:1)
contains a much higher density of A and T box motifs, AT-
rich tracts, and G-exclusion regions, as well' as three
elements with homology to the Drosophila topoisomerase II
consensus sequence. A systematic study of randomly
cloned plant SARs (unpublished data) has not revealed a
close correlation between any one of these motifs and
binding activity in an in vitro assay. However, binding
activity does correlate loosely with the total number or
CA 02244204 1998-07-27
WO 97!27207 PCT/US97/O1Z78
-22-
overall density of SAR-related motifs. From this
analysis and the data summarized in FIGURE l, it was
predicted that a SAR of SEQ ID NO:l should bind to
scaffold preparations much more strongly than the yeast
SAR ( ARS - I ) .
EXAMPLE 3 '
Scaffold Binding Activit~r
The RB7 SAR (SEQ ID NO:1) consistently showed
a The binding activity of the tobacco RB7 SAR (SEQ ID
N0:1) was compared to that of the ARS-1 SAR. End-labeled
restriction fragments from plasmids containing the SAR
sequences to be tested were mixed with tobacco nuclear
scaffold preparations in the presence of restricted plant
genomic DNA as nonspecific competitor. Plasmid pGA-1
contained the yeast SAR (ARS-1) and TRP1, and was
digested with EcoRI and HINDIII. Plasmid pB7-5 Sca/Cla
contained the RB7 tobacco SAR of SEQ ID N0:1, and was
digested with SpeI and XhoI. After incubation with
tobacco nuclear scaffold preparations under binding
conditions, bound and unbound DNA fragments were
separated by centrifugation, and DNA was purified prior
to gel analysis.
Equal percentages (20%) of the pellet and
supernatant from each reaction using plasmid pGA-1, as
well as an equivalent aliquot of the unfractionated
probe, were run on adjacent lanes of an agarose gel and
visualized by autoradiography (results not shown). This
same -procedure was replicated using a 10-fold lower
percentage (2%) of the total and supernatant fractions
loaded on the gel (results not shown) . A low level of
binding by the yeast SAR was discernible in the gels
using 20% of the fractions, although a large portion of
the total signal was observed in the supernatant fraction
when equal fractions were compared (results not shown).
In the more sensitive assay, it was clear that the yeast
fragment bound while the TRP1 and vector fragments did
CA 02244204 1998-07-27
WO 97/27207 PCT/US97/01278
-23-
not, confirming the specificity of theassociation
between the SAR DNA and the isolated scaffold (results
not shown) .
Similar autoradiography gels were prepared for
plasmid pB7-6 Sca/Cla, containing the RB7 tobacco SAR of
SEQ ID NO:l (results not shown). In contrast to the
results obtained using the yeast SAR, above, a much
larger portion of the tobacco RB7 SAR probe associated
with the scaffold fraction (results not shown).
The possibility that elements other than known
SARs might contribute to scaffold binding of the
constructs used in expression assays was tested.
Scaffold binding assays similar to those described above
were conducted on restriction digests designed to
separate fragments containing the CaMV 35S promoter, the
GUS gene, and the nos polyadenylation signal from the
control plasmid, pGHNCI2. These binding assays gave
uniformly negative results, even when the gel lanes were
heavily overloaded with material from the pellet fraction
(data not shown).
These results indicate that the RB7 SAR (SEQ ID
N0:1) has a higher binding activity than that of the
yeast SAR (ARS-1).
EXAMPLE 4
RB7 SAR Increases Average Expression Levels
Earl-ier studies (Allen et al., Plant Cell 5:603
(1993)) showed that flanking a GUS reporter gene with two
copies of a yeast SAR element (ARS-1) increased average
GUS expression by 12-fold in stably transformed cell
lines. In the present Example, the same cell line was
transformed with constructs similar to those of Allen et
al. , 1993, but using the RB7 SAR (SEQ ID NO:l) . A co-
transformation protocol was used to avoid physical
linkage between the assayable and selectable markers
(Allen et al., 1993). The constructs used are shown in
FIGURES 2A, 2B and 2C.
CA 02244204 1998-07-27
WO 97127207 PCT/US97/01278
-24-
Transformation was achieved by mixing the
appropriate reporter test plasmid and the selection
plasmid, co-precipitating them onto microprojectiles, and
bombarding plates of tobacco suspension culture cells as
described previously (Allen et al., 1993). Kanamycin-
resistant (Kmr) microcalli were selected and each callus
was used to start an independent suspension culture cell
line, as described in Example 1. Histochemical staining
of segments from the original microcalli showed that the
staining intensity was much greater in cell lines
transformed with SAR plasmids (data not shown) . After
three weeks of growth, with weekly transfers, suspension
cells were harvested. DNA was extracted from each cell
line for Southern analysis and quantitative PCR assays,
and portions of the same cell population were used to
measure extractable GUS activity and NPT protein levels,
as described in Example ~. Transgene copy number
estimates and expression data are summarized in TABLES 1
and 2.
TABLES 1 and 2 also show the mean level of GUS
gene expression; measured as GUS enzyme activity, for the
KMr lines. Control GUS activities averaged 8 nmol 4-MU
~min-'-~mg protein''-, well within the range of 1 to 54 nmol
4-MU ~min-'-~mg protein= commonly obtained for tobacco
tissue transformed with similar constructs in
Agrobacterium vectors (Frisch et al., Plant J_ 7:503
(1995); Hobbs et al., Plant Mol. Biol. 21:17 (1993);
Jefferson et al., EMBO J. 6:3901 (1987)}. When Rb7 SARs
were ~.ncluded on both sides of the reporter gene, GUS
activities averaged approximately 60-fold greater than
for the control construct lacking SARs. This effect on
expression is approximately five-fold greater than that
of the yeast SAR previously reported (Allen et al.,
1993 ) .
TABLES 1 and 2 also show a comparison of
average copy numbers for the GUS and nptll genes. These
data were obtained with a quantitative PCR procedure
CA 02244204 1998-07-27
WO 97127207 PCT/US97/01278
-25-
(Allen et .al., 1993). In each case, amplification was
carried out with primers corresponding to sequences in
the promoter and coding regions, as described in Example
1. Appropriate PCR products were quantitated by counting
the radioactivity hybridized to the amplified bands, and
gene copy numbers were estimated by comparing the
resulting signals with a standard curve obtained in
parallel for each experiment. In cell lines transformed
with the construct flanked by SARS, the average 35S::GUS
gene copy number was reduced by approximately two-fold
compared to cell lines transformed with the control
construct. This result is similar to that obtained in a
previous study using the yeast SAR (Allen et al., 1993).
The fact that SAR-containing lines have fewer copies of
the GUS gene means that the average RB7 SAR effect on
expression per gene copy is even greater than the 60-fold
increase in overall expression. As shown in TABLES 1 and
2, lines transformed with the RB7 SAR construct average
nearly 140-fold more GUS enzyme activity per gene copy
than lines transformed with the same construct lacking
SARS.
CA 02244204 1998-07-27
WO 97/27207 PCTIITS97/01278
-26-
TABLE 1
NptII
Plasmid Cell GUS Gene GUS Gene NptII
Line Copy No.a ActivitybCopy No.a protein'
Control 12-11 1 0.9 2 nd~
(-) SARS
12-9 1 2.5 2 42.9
12-46 1 0.9 2 18.4
12-48 2 1.4 2 nd
I2-2 2 17.0 3 82.8
12-13 4 0.8 3 34.6
I2-23 4 0.3 3 37.5
12-1 5 0.5 3 nd
12-40 6 1.6 4 .108.5
12-36 11 1.2 3 63.6
12-25 12 48.4 8 50.0
12-10 29 0.7 4 80.4
I2-37 33 7.8 3 70.2
I2-I8 63 0.2 34 86.5
12-34 73 I3.0 14 76.4
12-41 77 33.5 10 46.1
Mean 20.2 8.2 6.2 6I.4
(+/- +/- 6.8 +/- 3.5 +/- 2.1 +/- 7.1
SE)
Standard 27 14 8.I 25.5
Deviation
Coeff. I.3 1.7 1.3 0.4
of
Variation
Gene copy numbers for GUS and Npt I I and expressi on 1 evel s for the
individual transgenic tobacco lines derived from co-transformations of
selection plasmid with control plasmid (-SAR).
a = Samples were analyzed for GUS and NptII gene copy number
PCR assay (Example 1).
b = Samples were analyzed for GUS specific activity by
fluorometric assay (Example 1).
c = The same samples used for GUS and gene copy numbers were
analyzed for NptII protein by ELISA (Example 1).
d = not determined
Coefficient of l7ariation = standard deviation/mean.
CA 02244204 1998-07-27
WO 97/27207 PCT/LTS97l01278
-27-
TABLE 2
NptII
Plasmid Cell GUS Gene GUS Gene NptII
Line Co y No.a ActivitybCopy No.a protein'
' (+) SARS 11-36 1 0.8 2 2
Il-13 1 15.8 2 35.2
11-8 1 818.0 2 121.3
11-12 2 3.8 3 12.1
11-19 3 732.0 3 17.3
11-43 3 3109.0 4 53.9
11-1 5 341.0 3 40.2
lI-2 7 110.0 4 19.5
11-51 7 1241.0 8 124
lI-37 8 1006.0 5 90.9
11-7 9 189.0 3 46.6
11-41 10 113.0 3 24.8
11-38 I4 348.0 5 65.5
11-18 15 378.0 28 117
11-39 16 7.6 12 272.9
11-23 20 4.6 3 49.5
11-44 31 67.0 25 33.4
Mean 9 499 +/- 6.8 66.2
(+i- SE) +/- 2.0 188.2 +/- 1.9 +/- 15.9
Standard 8.1 776 - 7.8 65.7
Deviation
Coeff. 0.9 1.6 l.I 1.0
of
Variation
ene copy m ers r U and pt I and xpression ve s for he
i nu o N e e t of
s ndividual ansgenictobacco es derivedrom co-transformations
tr smid lin f
election wit h plasmid AR.
pla +S
a = Samples were analyzed for GUS and NptII gene copy number
PCR assay (Example 1).
b = Samples were analyzed for GUS specific activity by
- fluorometric assay (Example 1).
c = The same samples used for GUS and gene copy numbers were
analyzed for NptII protein by ELISA (Example 1).
Coefficient of Variation = standard deviation/mean.
CA 02244204 1998-07-27
WO 97/27207 PCT/US97/01278
-28-
EXAMPLE 5
Transient Expression
To distinguish effects that depend on
chromosomal integration from general transcriptional
enhancer activity, SAR constructs were tested in a ,
transient expression system. Such assays are widely used
in studies of transcriptional enhancers. Transiently
transfected DNA is poorly organized into nucleosomes
(Archer et al_, Science 255:1573 (1992); Weintraub Cell
42:705 (1985)) and the fact that only a small minority of
expressing cells go on to become stably transformed
suggests that most transient expression occurs without
chromosomal integration (Christou, Plant J. 2:275 (1992);
Davey et al., Plant Mol. Biol. 13:273 (1989); Paszkowski
et al., EMBD J. 3:2717 (1984); Saul and Potrykus,
Develop. Genet_ 11:176 (1990}). When the plant SAR
plasmid (pGHNCll) was electroporated into NT-1
protoplasts prior to GUS assay 20 hours later, an
approximately three-fold increase in GtIS gene expression
was observed, from 2.7 to 7.2 nmol - min-1 - mg protein'1,
as compared to those transfected with the control plasmid
lacking SARs. These results are in sharp contrast to the
nearly 60-fold increase :in overall expression, or the
nearly 140-fold increase in expression per gene copy in
stably transformed cell lines as reported in Example 5.
The effect of the RB7 element in stably transformed lines
thus was 20-50 times greater than its effect in'transient
transcription assays. These results indicate that the
RB7 element is not simply acting as a transcriptional
enhancer.
EXAMPLE 6
Intec;ration Patterns
Direct gene transfer procedures can result in
complex integration patterns (Christou Plant J. 2:275
(1992); Koziel et al., Bio/Technology 11:194 (1993);
Mittlesten Scheid et al. MoI. Gen. Geriet. 228:104 (1991) ;
CA 02244204 1998-07-27
WO 97/27207 PCT/ITS97/01278
-29-
Paszkowski et al., EMBO J. 3:2717 (1984); Tomes et al.
Plant Mol. biol. 14:261. (1990); Wan and Lemaux, Plant
. Physiol. 104:37 (1994}). Therefore, multiple cell lines
transformed with either the control expression plasmid
(pGHNCI.2) or the RB7 SAR(+) expression plasmid (pGHNCIl)
were compared by DNA gel blot analysis (according to
Example 1) following digestion of isolated genomic DNA
with EcoRI and HindIII, which cut on either side of the
35S::GUS::nos cassette (see FIGURE 2).
Genomic DNA (10 fig) was digested with
HindIII/EcoRI was fractionated on a 0.85% agarose gel.
The DNA was blotted to nylon membranes and probed as
described in Example 1. Gel lanes contained 10 ~.~.g
HindIII/EcoRI digested genomic DNA from the respective
cell lines transformed with the SAR(+) or (-)SAR control
plasmids. Also probed were copy number reconstruction
gel lanes, containing 10 /.cg of non-transformed (control)
genomic DNA spiked with the equivalent of 40, 20, 10, 5,
1 and 0 copies of the 2.8 kb 35S::GUS::nos T per 1C
equivalent.
When probed with sequences from the 35S
promoter, digests of the parent plasmids yielded a single
band of 2.8 kb (data not shown). After integration into
genomic DNA, complex hybridization patterns were
observed, indicating extensive rearrangement during the
integration process. Integration patterns for the
control construct were somewhat more complex, on average,
than those for the SAR plasmid. However, this difference
may reflect the lower average copy number in the SAR
lines {see above). There was no obvious difference in
the complexity of integration patterns for SAR and
control lines with similar copy numbers.
Intact 2 . 8 Kb fragments containing the 35S : : GUS
gene were observed in most transformants, suggesting that
most cell lines contained some non-rearranged gene
copies. However, approximately 20 - 300 of the recovered
lines lacked the 2.8 Kb band indicative of intact
CA 02244204 1998-07-27
WO 97!27207 PCT/LTS97/OI278
-30-
35S::GUS genes. Generally this band was missing from
lines with low overall copy numbers and with few, if any,
bands with an intensity equal to or greater than the
single copy reconstruction standard. Expression levels
were generally very low; most ofthese lines likely
contained genes with rearrangements- in the promoter
region that reduced or eliminated their activity. One
exception was the SAR line 37 (11-37), for which PCR
analysis gave an estimate of eight copies and Southern
analysis showed several high molecular weight bands of
multicopy intensity. This cell line also had high GUS
expression (TABLE 2), indicating that in this instance
the rearrangement did not dramatically affect gene
function.
Gel blots of unrestricted DNA samples were also
probed (data not shown). Samples were selected to
represent a variety of copy numbers and expression
levels. Undigested DNA (5 ~cg) from cell lines, selected
to include a wide range of gene copy numbers and
expression levels, was fractionated on a 0.6a agarose gel
and analyzed with a 501 by CaMV35S probe_ The position
of high molecular weight chromosomal DNA was determined
by ethidium bromide staining. The positions of
undigested plasmid (pGHNCI1 and pGNHCI2) were determined.
Also probed were lanes representing 30, 10, 3 and 1
copies of the CaMV 35S::GUS::nos T per 1C, spiked in 5 ,ug
of non-transformed genomic DNA.
In each case, all detectable GUS sequences
migrated with high molecular weight chromosomal DNA,
ruling out the possibility that they were maintained on
extrachromosomal elements similar in size to the plasmids
used in transformation. Similar results were obtained
for lines with low and high overall copy numbers.
Chen et al., Plant J. 5:429 (1994) reported
that transgenes in wheat cell lines subjected to direct
DNA transfer may sometimes contain N-6-methyladenine,
raising the possibility that transformation of an
CA 02244204 1998-07-27
WO 97/27207 PCT/US97J01278
-31-
endophyte, such as a mycoplasma-like organism; occurred
simultaneously with transformation of the wheat cells.
To exclude this possibility, a methylation analysis was
carried out.
High molecular weight DNA from cell lines
selected to include a variety of GUS gene copy numbers
and expression levels was prepared and digested with the
isoschizomers DpnI, DpnII, or Sau3A. DpnI requires N-6-
adenine-- methylation; DpnII is inhibited by adenine
methylation; Sau3A is unaffected by N-6-adenine
methylation but inhibited by cytosine methylation.
FTGURE 3A is a restriction map showing the GATC sites
(vertical lines) for SAR (+) plasmid pGHNCll and the SAR (-
control plasmid pGHNCI2. The 501 base pair probe
fragment from the CaMV~35S promoter is indicated below
the restriction maps. FIGURE 3B is a DNA gel blot of
selected SAR(+) lines showing DpnI, DpnII and Sau3A
digests. Molecular weights are estimated (arrows) from
1 kb markers (BRL). The control digest of plasmid
pGHNCI2 which was produced from a Dam methylase (+) E.
col.i strain is shown in the right panel. F2GURE 3C is a
DNA gel blot of selected SARI-) control lines showing
DpnI, DpnII and Sau3A digests. Molecular weight
estimates are shown by arrows to the left of the panel.
DpnI, which requires N-6-adenine methylation
for activity, does not cut transgene DNA but does
completely digest the same sequence in E. coli plasmid
DNA used for transformation. DpnII, an isoschizomer that
differs from DpnI in that it is inhibited by adenine
methylation, does not cut the plasmid DNA, but
extensively cleaves transgene sequences in all tested
cell lines. Another GATC-cleaving isoschizomer, Sau3A
completely digests plasmid DNA, but shows only partial
activity on transgene DNA. This enzyme is inhibited by
cytosine methylation at the C residue in the GATC target
sequence. In plant DNA, cytosine methylation occurs
preferentially to CG and CXG sites in plant DNA
CA 02244204 1998-07-27
WO 97/27207 PCTlUS97/01278
-32-
(Gruenbaum et al., Nature 292:860 (1981)), although some
methylation of cytosines also occurs in non-symmetrical
positions (Meyer et al., Embo J. 13:2084 (1994)).
Failure of Sau3A to fully cleave transgene DNA is thus
consistent with the presence of cytosine methylation at
some of the GATC sites in the transgene. Taken together,
these data indicate that adenine methylation. has been
lost and a plant-specific pattern of cytosine methylation
has been established during replication of the transgene
in the transformed cell lines.
EXAMPLE 7
Cony Numbers and Exs~ression Levels
GUS specific activity as nmols 4-MU produced
~min-1~mg protein-1 was determined by fluorimetry, and gene
copy number was determined by the PCR procedure, for
multiple transgenic cell lines eight weeks after
transformation, as described in Example 1.
FIGURE 4 plots GUS expression versus gene copy
number for individual cell lines (open squares .-- RB7
SAR(+) transformants; closed triangles =-control lines).
The largest RB7 SAR effects were obtained in cell lines
with smaller numbers of transgenes (about 20 or fewer
copies per cell), and expression of both SAR and control
constructs was low in lines with high copy numbers.
Although the overall degree of stimulation was much
greater for the plant SAR, the relationship to transgene
copy number was quite similar to that previously observed
in experiments with a weaker SAR from the yeast ARS-1
element (Allen et al., Plant Cell 5:603 (1993)).
Increased expression of the yeast SAR construct was seen
in transformants carrying as many as 30-40 copies of the ,
transgene. In the present Example, the effects of the
RB7 SAR were most evident in lines carrying fewer than
about 20 copies.
Three cell lines (11-12, 11-13, and Il-36)
containing the SAR construct at low copy number also
CA 02244204 1998-07-27
WO 97/27207 PCT/US97/01278
-33-
showed low GUS expression, apparent exceptions to the
general rule that low copy numbers are associated with
high expression (TABLE 2). These lines were among those
lacking the intact 2.8 Kb 35S::GUS::nos T band (see
Example 7), and thus may contain only rearranged
transgene sequences. These data have only a small effect
on the overall data analysis, however. Eliminating data
from the SAR and control lines lacking the 2.8 Kb band
provides an average GUS activity of 574 nmols 4-MU ~min-
=~mg protein-1 for lines containing the SAR construct as
compared to 10 _ 4 nmols 4-MU ~min-'-~mg protein'1 for control
lines, a 55-fold difference. Corresponding values for
the entire data set were 499 and 8.2 nmols 4-MT7 ~min-I~mg
protein-1, a 61-fold difference.
EXAMPLE 8
Effects of Co-Transformation on ExQression
of Selection Gene
In the present data, the Rb7 SAR of SEQ ID NO:1
increased expression to a greater degree when low numbers
of the transgene were present and, when higher numbers of
the transgene are present, expression of both SAR and
control constructs fell. to low values. These data
indicate that the present SARs were not acting as
transcriptional insulators, and/or that variation from
sources other than chromosomal position effects dominates
transgene expression.
To determine whether co-transformat.i.on with a
SAR-containing reporter plasmid resulted in increased
expression of the nptT1 gene on the selection plasmid,
the NPT protein levels in extracts of the same cell
suspensions were measured using an ELISA assay. As shown
in TABLE 2, co-transformation with the SAR-containing
vector had no effect (1.1-fold) on average NPT protein
abundance for all cell lines . NPTI I protein (pg/~.~.g total
protein) was determined by ELISA, and gene copy number
was determined by the PCR procedure for the transgenic
CA 02244204 1998-07-27
WO 97/27207 PCTJLTS97/01278
-34-
cell lines used for GUS analysis (see F2GURE 4). F2GURE
is a plot of NPT protein against gene copy number
(SAR(+) transformants - open squares; control lines
closed triangles), showing that NPT2I expression was
5 unaffected by co-transformation with the SAR constructs.
NPTII protein levels vary widely in different
transformants, up to about 100 pg/ug cellular protein.
The GUS and NPTII expression data from F=CURES 4 and 5
were re-plotted to compare the expression levels for each
introduced gene (FIGURE 6). Open squares represent
double SAR transformants; closed triangles represent
control lines. Plotting GUS activity against NPT protein
level showed that there is only a weak correlation
between NPTII and GUS expression. Nearly all the NPT
values for SAR lines fall within the range of variation
seen for control lines.
These results indicate that even though co-
transformation often results in integration at the same
genetic locus (Christou and Swain, Theo~. Appl. Genet.
79:337 (1990); Christou et al., Proc. Natl. ~lcad_ Sci.
USA 86:7500 (1989); McCabe et al., Bio/Technology 6:923
(1988); Christou, Plant J. 2:275 (I992); Saul and
Potrykus, Develop_ Genet. 11:176 (1990)), genes on co-
transformed plasmids can be substantially independent in
their expression. If the reporter and selection plasmids
were integrated in a closely interspersed array, SA.Rs on
the GUS reporter construct might have also stimulated
nptll gene expression. The lack of any such effect
implies that the two plasmids normally do not integrate
in a closely interspersed pattern, or that intervening
plasmid sequences prevent the SARs from affecting other
genes at the same chromosomal site. .
CA 02244204 1998-07-27
WO 97/27207 PCTJUS97/01278
-35-
EXAMPLE 9
Recreneration of Transformed Nicotiana
Using the same RB7 SAR constructs as used for
suspension cell transformation experiments (Example 1.),
Nicotiana tabaczzm has been transformed using
microprojectile bombardment (see Example 1), and
transformed plants have been regenerated.
Approximately 50 plants have been recovered
from Double RB7 SAR transformation (SAR+); approximately
30 plants have been recovered from control transformation
(lacking SARs). Primary transformants (mature TQ plants)
were analyzed using Gus histochemical staining and using
a PCR assay for the 35S GUS transgene. Preliminary data
from the primary transformants indicates that:
(a) transformation with the_ SAR+ plasmid
results in increased numbers of transformants;
(b) both SAR+ and control primary transformants
have equal numbers of plants which contain 35S-GUS genes
(as determined by quantitative PCR. assay) but which have
no Gus expression (i.e., gene silencing in the primary
transformants);
(c) there does not appear to be a difference in
the number of transformants that stain positive for Gus;
measurements of Gus activity are in progress to determine
whether there is an effect on absolute differences in the
magnitude of Gus expression between the two. types of
transformants. A comparison of Gus staining patterns
suggests that the SAR-transformed plants are less subject
to variegated expression in leaf punches.
Backcrosses of the experimental transformants
to a wild-type Nicatiana (Petite havana) parent have been
made. Tnitial data suggests that BC1 plants containing
SAR-less transgene experience gene silencing 5-fold more
than the BC1 plants from the SAR-containing transformants
(data not shown). These results indicate that SARs may
stabilize gene expression in future generations.
CA 02244204 1998-07-27
W~ 97/27207 PCT/US97/01278
-36-
EXAMPLE 10
Acarrobacterium tumefaciens mediated
transformation of Brassica nanus ~ ,
Rapeseed (canola) cells were transformed using
Agrobacterium tumefaciens mediated transformation. ,
Agrobacterium tumefaciens strains Z707S and LBA4404 were
used. As shown in Table 3; each of the two strains of
Agrobacterium was used to transform cells with a
construct comprising two structural genes (Ubl/Hpt and
35S/GUS genes) and having either two flanking RB7 SARs or
having no SARs. Regenerated plants were obtained. Table
3 summarizes the data obtained during transformation and
regeneration, as well as GUS expression data from To
plants.
Effect on transformation efficiency: The 27075
strain of Agrobacterium is normally more efficient at
transforming rapeseed than the LBA4404 strain (see SAR-
less control plasmid results in Table 3; ~42 vs. 2
hygromycin resistant calli for Z707S and LBA4404,
respectively). When SARs flank the transgene no effect
is seen on the number of hygromycin resistant calli from
the Z707S strain (42 for the SAR-less Z707S control and
41 for SAR+ Z707S). However, the less efficient LBA4404
strain yields significantly more hygromycin resistant
calli when SARs are present (2 vs. 15). These results
indicate that SARs may have a beneficial effect on
Agrobacterium mediated transformation of crop plants that
have previously proved refractory to Agrobacterium
transformation.
Effect on reportersene expression: The Ta SAR+
rapeseed plants yielded a 33-fold higher average GUS
expression compared to the SAR-less control plants. The
highest GUS expressing SAR+ plant was 27-fold higher than
the highest SAR-less plant. Southern blot analysis of
these plants show them to contain high gene copy numbers
(data not shown). This was surprising since
Agrobacterium normally inserts only a few gene copies.
CA 02244204 1998-07-27
WO 97/27207 PCT/US97/OI278
-37-
This effect appears not to be due to the SARs, since both
SAR+ and SAR-less constructs were high copy number.
These data show:
(a) the SAR effect is amenable to Agrobacterium
transformation;
(b) the SAR effect occurs in regenerated
transgenic plants;
(c) SARs can exhibit their effect when flanking
two genes (in the present case the Hpt selectable marker
and the GUS reporter gene).
(d) RB7 SARs work in plant species other than
tobacco.
The foregoing examples are illustrative of the
present invention, and are not to be construed as
I5 limiting thereof. The invention is described by the
following claims, with equivalents of the claims to be
included therein.
CA 02244204 1998-07-27
WO 97/27207 PCTfUS97/01278
-38-
N /~ -r ! -r- I
P~ ~ N
~I iQ ~ ~
' J
, 1 1
O ~ ~
C!~ O
\ ~
'Z ~ 111 ~ N i~ ~ 1 CS l
~ M C
\ , M ~ N
\.,
-.-I U7 r-I c,t ~
(t~ ~
~ C7 ~ N
-r-I -r-t
~. \
M N
~ ~
~M
C7
'LS
..
..
L11 Cl~ 1.)
O
N O N O
O
o ~z o
~
-O .t1 \ ~ N L~ N O d~ ~r
~
z z
M ~ o o s '
s s
r CO
W ~ N
~ U Wa ~
,.. ,-i -
rt -.-
-7 -i
r-i M rl
~
~i
N
O
O
O
r- Wi rd -~a
r-I(LS ri (Lj
4-1 l~ r-1 C~ r-i
p U S2, U p.,
~-1
~
- -rt
r~ ca
O ~ of U N
O
O t-~ U~ U7
4-I
C7~ o cCS O O O
~ is
~
~ w r-I -ri a
cd ~.,
r~
~ ~ ~
L~ R.' U~ ~ U~
.t~ .tJ
N W 4--t N -rfN -~-i
4-J 4-a
O -7 O i-a 3-1
J..W O
J-1
N 'LS1~
f.7.~ f~,
~ a ~, ~ ~n
~a a~ x x
m ~ v cu o a~ o
.u .u 5., a~ a~
E E E a~ ~
-rr -~ w cn v~
m ~ ~
w u~
z ~~ x~
~
CA 02244204 1999-O1-27
39
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: North Carolina State University
(ii) TITLE OF INVENTION: A PLANT NUCLEAR SCAFFOLD ATTACHMENT
WHICH INCREASES GENE EXPRESSION
(iii) NUMBER OF SEQUENCES: 5
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Patricia A. Rae; Sim & McBurney
(B) STREET: 330 University Avenue, 6th Floor
(C) CITY: Toronto
(D) STATE: Ontario
(E) COUNTRY: CANADA
(F) ZIP: M5G 1R7
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: 2244204
(B) FILING DATE: January 24, 1997
(C) CLASSIFICATION:
(viii) PATENT AGENT INFORMATION:
(A) NAME: Rae, Patricia A.
(B) REFERENCE NUMBER: 9399-87 PAR
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 416-595-1155
(B) TELEFAX: 416-595-1163
(2) INFORMATION FOR SEQ ID N0:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1167 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE
DESCRIPTION:
SEQ ID
N0:1:
CGATTAAAAATCCCAATTATATTTGGTCTAATTTAGTTTGGTATTGAGTAAAACAAATTC 60
GAACCAAACCAAAATATAAATATATAGTTTTTATATATATGCCTTTAAGACTTTTTATAG 120
AATTTTCTTTAAAAAATATCTAGAAATATTTGCGACTCTTCTGGCATGTAATATTTCGTT 180
AAATATGAAGTGCTCCATTTTTATTAACTTTAAATAATTGGTTGTACGATCACTTTCTTA 240
TCAAGTGTTACTAAAATGCGTCAATCTCTTTGTTCTTCCATATTCATATGTCAAAATCTA 300
TCAAAATTCTTATATATCTTTTTCGAATTTGAAGTGAAATTTCGATAATTTAAAATTAAA 360
CA 02244204 1999-O1-27
TAGAACATAT CATTATTTAG GTATCATATTGATTTTTATA CTTAATTACTAAATTTGGTT420
AACTTTGAAA GTGTACATCA ACGAAAAATTAGTCAAACGA CTAAAATAAATAAATATCAT480
GTGTTATTAA GAAAATTCTC CTATAAGAATATTTTAATAG ATCATATGTTTGTAAAAAAA540
ATTAATTTTT ACTAACACAT ATATTTACTTATCAAAAATT TGACAAAGTAAGATTAAAAT600
AATATTCATC TAACAAAAAA AAAACCAGAAAATGCTGAAA ACCCGGCAAAACCGAACCAA660
TCCAAACCGA TATAGTTGGT TTGGTTTGATTTTGATATAA ACCGAACCAACTCGGTCCAT720
TTGCACCCCT AATCATAATA GCTTTAATATTTCAAGATAT TATTAAGTTAACGTTGTCAA780
TATCCTGGAA ATTTTGCAAA ATGAATCAAGCCTATATGGC TGTAATATGAATTTAAAAGC840
AGCTCGATGT GGTGGTAATA TGTAATTTACTTGATTCTAA AAAAATATCCCAAGTATTAA900
TAATTTCTGC TAGGAAGAAG GTTAGCTACGATTTACAGCA AAGCCAGAATACAAAGAACC960
ATAAAGTGAT TGAAGCTCGA AATATACGAAGGAACAAATA TTTTTAAAAAAATACGCAAT1020
GACTTGGAAC AAAAGAAAGT GATATATTTTTTGTTCTTAA ACAAGCATCCCCTCTAAAGA1080
ATGGCAGTTT TCCTTTGCAT GTAACTATTATGCTCCCTTC GTTACAAAAATTTTGGACTA1140
CTATTGGGAA CTTCTTCTGA AAATAGT 1167
(2) INFORMATION FOR SEQ
ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pai rs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: singl e
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
TCAAGATGCC TCTGCCGACA 20
(2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
TCACGGGTTG GGGTTTCTAC 20
(2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
CA 02244204 1999-O1-27
41
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:
GGAACTGACA GAACCGCAAC 20
(2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:5:
GGACAGGTCG GTCTTGACAA 20
