Note: Descriptions are shown in the official language in which they were submitted.
CA 02247087 1998-08-26
SPECIFICATION
FLOWER ORGAN-SPECIFIC GENE AND
ITS PROMOTER SEQUENCE
TECHNICAL FIELD TO WHICH THE INVENTION BELONGS
This invention relates to a gene showing specific
expression in monocotyledon flower organs and its promoter
sequence. This invention further relates to a chitinase
acting as a defensive mechanism against pathogenic bacteria
and a chitinase gene.
PRIOR ART
There have been reported some cases of the isolation of
genes which are expressed specifically in flower organ, for
example, anther-specific genes and pistil-specific ones.
However, only a few genes specific to another have been
reported as genes which are isolated from monocotyledons and
for which the promoter sequences have been clarified.
These reports are exemplified by JP (Kohyo) HEI 6-
504910, Tsuchiya et al. Plant Mol. Biol. 26, 1737-1746, 1994,
etc. in which the nucleotide sequences of rice anther-
specific genes, their expression profiles, etc. are
indicated.
Promoters exhibiting expression specifically in flower
organ are required in order to artificially improve the
morphology of plant flower organs, in particular germ organs,
or physiological phenomena or to analyze functions of
various genes in flower organs. In monocotyledons which
represent mayor cereals, however, few genes expressed
exclusively in flower organs have been isolated hitherto.
- 1 -
CA 02247087 2000-10-04
In particular, there has been reported no promoter sequence
showing predominant expression in pistil which is the
female germ organ or lodicule which regulates flowering.
Although chitinase (EC 3.2.1.14), which seemingly acts
as a defensive mechanism against pathogenic bacteria and
fungi, can be cited as an example of genes expressed in
flower organ, most of the chitinases of plant origin
reported so far are constitutively expressed not only in
flower organs but also in roots (see, for example, Neale et
al. The Plant Cell, 2, 673-684, 1990). Exceptionally,
chitinases such as potato SK2 (Wemmer et al. Planta 194,
264-273, 1994) and tomato Chi2;l (Harikrishna et al. Plant
Molecular Biology, 30, 899-911, 1996) show style-specific
expression.
On the other hand, there have been isolated some
chitinases of monocotyledons. For example, Zhu ant Lamb
(Mol. Gen. Genet., 226, 289-2961991) isolated a chitinase
called RCH10 from rice and reported that the gene of this
enzyme was constitutively expressed in root under aseptic
conditions. Further, Zhu et al. (BIO/TECHNOLOGY, 12, 807-
812, 1994) constructed tobacco with enhanced tolerance to
pathogenic bacteria by using the above-mentioned gene
together with an alfalfa glucanase gene.
There has been no report in monocotyledons, however,
about a chitinase which is not expressed at a detectable
level in root, being expressed exclusively in flower organs.
SUMMARY OF THE INVENTION
An object of the present invention is to provide a
- 2 -
CA 02247087 2000-10-04
novel flower organ-specific promoter sequence enabling
genetic manipulations of pistil or lodicule which were
impossible in the prior art particularly in monocotyledons.
Another object of the present invention is to provide
a novel chitinase which makes it possible to impart to
plants a general resistance against pathogenic bacteria and
fungi containing chitin.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 consists of photographs showing the results of
Northern analysis on RPC175 gene.
Fig. 2 consists of photographs showing the results of
RT-PCR analysis on RPC175 gene, wherein
A . template RNA 1 ~g (200 g in stigma and ovary)
B . 1 . template RNA 1 ~g 2 . template RNA 30 ng
3 . template RNA 1 ng 4 . template RNA 30pg.
Fig. 3 consists of a photograph showing the results of
genomic Southern analysis on RPC175 gene, wherein
B:BamHI, E:EcoRI, H:HindIII, P:PstI, S:SalI, X:XhoI,
J:Tsukinohikari, I:IR24.
Fig. 4 consists of photographs showing the results of
an experiment for determining the transcription initiation
point of RPC175 gene by the primer extension method. Primer
extension reaction was carried out by using pistil or leaf
RNA as a template with the use of two primers P3FW2 and
CSFW. The sequence reaction products (G, A, T and C) were
loaded adjacently to each other. The arrows show the
extension products. Nucleotide sequences corresponding to
the products are also shown.
- 3 -
CA 02247087 2000-10-04
Fig. 5 is a model view showing the structure in the 3'
side of the promoter of RPC175 gene. The number above each
base indicates the relative location taking the location of
the most upstream transcription initiation point as + 1.
Fig. 6 is a drawing illustrating a comparison of the
restriction maps of RPC175 and RPG102, wherein thick lines
indicate the nucleotide sequences of the clones while thin
lines indicate the nucleotide sequences of the vectors;
shaded parts indicate the nucleotide sequences of introns;
the units are expressed in kbp; and Ec referrs to EcoRI, P
referrs to PstI, pBS referrs to pBluescript, and AAAA ....
referrs to polyA.
Fig. 7 is a drawing illustrating a procedure for
constructing vector for analyzing the promoter expression.
Fig. 8 is a graph showing the results of the analysis
on the expression of RPC175 promoter used in combination
with GUS. The abscissa refers to the organ tested while the
ordinate refers to the number of transformants showing GUS
expression. Dotted parts indicate the number of individuals
showing spotty GUS expression.
Fig. 9 consists of photographs showing an example of
the results of the analysis on the tissue-specific
expression of RPC175 promoter in flower organs.
Fig. 10 is a graph showing the results of the
measurement of the activity of RPC175 promoter in various
rice organs. The abscissa refers to rice organ while the
ordinate (logarithmic) refers to the GUS activity, wherein
non-transformant
- 3a -
CA 02247087 2000-10-04
transformant (R1).
Fig. 11 is an illustration showing the procedure for
constructing the vector for expressing the protein encoded
by RPC175 gene.
Fig. 12 consists of a photograph of SDS-PAGE pattern
showing the results of the experiment on the expression of
the protein encoded by RPC175 gene. The insoluble fraction
from the transformant undergone IPTG induction was purified
by Ni-NTA resin and separated by SDS-PAGE. M referrs to
marker .
Fig. 13 consists of a photograph of Western analysis
pattern showing the results of an experiment on the
solubilization of the protein encoded by RPC175. After SDS-
PAGE, bands were detected by ECL.
DETAILED DESCRIPTION OF THE INVENTION
The present inventors have conducted an extensive
search and, as a result, discovered the DNA fragment
comprising the sequence having the nucleotides of positions
1 - 1234 in the nucleotide sequence represented by SEQ ID
N0:2, a part of this sequence or a sequence derived from
these sequences by deletion, substitution, insertion or
addition of one or more nucleotides and having a promoter
activity, thus solving the above-mention problem.
Thus, in accordance with the present invention, the
above mentioned problem can be solved also by identifying a
monocotyledon flower organ-specific promoter sequence in a
rice genome library with the use of the nucleotide sequence
represented by SEQ ID NO:1 as a probe.
- 4 -
CA 02247087 2005-06-09
Furthermore, the present inventors have solved the
above-mentioned problem by the DNA sequence encoding a
chitinase comprising the nucleotides of positions i14 - 1097
in the nucleotide sequence represented by SEQ ID No:l, a
part of said sequence, or a DNA sequence having a sequence
derived from these nucleotide sequences by deletion,
substitution, insertion or addition of one or more
nucleotides and encoding a protein having biological
activity.equivalent to that of the protein encoded by a DNA
consisting of the above-mentioned nucleotide sequence, or a
sequence of chitinase consisting of the amino acid sequence
represented by SEQ ID N0:3, a part of this sequence or an
amino acid sequence of chitinase having a sequence derived
from these, amino acid sequences by deletion, substitution,
insertion or addition of one or more amino acids.
Now, the gresent invention will be described in greater
detail.
As described above, the first invention found by the
present inventor relates to a DNA comprising the sequence
having the nucleotides of position 1 - 1234 in the
nucleotide sequence represented~by SEQ ID N0:2, a part of
said sequence or a.sequence derived from these sequences by
deletion, substitution, insertion or addition of one or more
nucleotides. and having a promoter activity.
More specifically, the invention relates to an isolated
DNA fragment comprising the sequence from positions 1 to
1234 in the nucleotide sequence of SEQ ID N0:2, or a part of
said fragment having a flower organ-specific promoter
activity found within SEQ ID N0:2.
5
CA 02247087 2004-O1-30
The promoter sequence of the present invention, namely,
the sequence comprising the nucleotides of positions 1 -
1234 in the nucleotide sequence represented by SEQ ID N0:2
has no substantial homology to any known promoter sequence.
5a
Thus, this sequence is considered to be novel. This
CA 02247087 1998-08-26
sequence can be isolated from a natural monocotyledonous
plant in accordance with the method described in, for
example, Example 2 as will be given hereinafter.
The DNA fragment of the present invention has a
promoter activity specific to flower organs. The term
"flower organ-specific promoter activity" as used herein
means that the expression of the promoter activity the DNA
fragment of the present invention in flower organs (anther,
filament, pistil and lodicule), in particular in flowering
period, is more prominent than in other organs (at least
leaf, root, callus, germinating seed, immature seed and
palea and lemma). It has been confirmed that the DNA
fragment Of t_h_P prE?~P_n_t i _n_~rPnti nn i ~ fl nwar ~rg~n-cpe~if~.~.
in monocotyledons and there is a possibility that it may be
flower organ-specific in other plants too.
The nucleotide sequence represented by SEQ ID N0:2 has
the following characteristics among others.
1. It has 3 transcription initiation points at intervals
of several nucleotides and these points are all A (adenine)
following TC. Specifically, the transcription initiation
points are the adenines (A) at positions 1122, 1125 and 1129.
2. There is a TATA box-like sequence (5'-TATATAA-3')
(Corden et al. Science 209, 1406-1414, 1980) 30 by upstream
of the most upstream transcription initiation point.
3. There are 2 ATG sequences in the same reading frame,
each being located 77 by and 113 by downstream of the most
upstream transcription initiation point.
4. A termination codon (TGA) is located 21 by upstream of
- 6 -
CA 02247087 1998-08-26
the most upstream ATG (the first ATG). Moreover, there are
two poly A signal-like sequences(5'-AATAAA-3') (Heidecker
and Messing, Annu. Rev. Plant Physiol. 37, 439-466, 1986) in
the terminator region. The term "terminator region" herein
referrs to the region which is downstream of the termination
codon.
A SnaBI cleavage site is found between positions 1135
and 1140 while a PstI cleavage site exists between positions
1223 and 1228. The region following position 1235 is the
structural gene. region.
It has been found in accordance with the present
invention that the promoter is located in the region
upstream of the structural gene, i.e., in the region
comprising the nucleotides of positions 1 - 1234 in the
nucleotide sequence represented by SEQ ID N0:2. However,
sequences comprising a part of this region are also included
in the present invention, so long as they have a similar
promoter activity.
For example, the regions of positions 1 - 1228 and 1 -
1140 have the flower organ-specific promoter activity, as
will be described in the examples given hereinafter. Thus,
these sequences are included in the present invention. Also,
it is expected that the region of positions 1 -1121 has a
similar promoter activity, since a transcription initiation
point is located at position 1122 as described above.
Further, it should be noted that the promoter sequence
contains an EcoRI site at nucleotide positions 1 - 6 by
chance, which enabled us to determine the promoter sequence
_ 7 _
CA 02247087 1998-08-26
starting from this site. Therefore, it is well anticipated
that a sequence starting from a nucleotide some what
downstream will have the promoter activity. This is so
because a number of reports indicate that the tissue- or
time-specificity or inducibility of most plant promoters is
substantially contained in the region of 0.3 to 0.4 kb which
precedes the transcription initiation point. In the
promoter of type II glutelin gene of rice, for example, the
tissue- and time-specific expression is fully achieved
exclusively by the 441 by fragment before the transcription
initiation point (Takaiwa et al. Plant Mol. Biol. 16:49-58,
1991). In the promoter of self-incompatibility-related gene
SLG13 of Brassia oleracea, the 411 by region before the
transcription initiation point directs the expression in
pistil and pollen (Dzelzkalns et al. The Plant Cell 5:855-
863, 1993). In the promoter of anionic peroxidase gene of
tomato, the organ-specificity as well as the pathogen and
wound-inducibility are determined by the 358 by region
upstream of the transcription initiation point (Mohan et al.
Plant Mol. Biol. 22:475-490, 1993). Thus, it is observed
for a number of promoters that a part of the reported
sequence maintains the full function if only said part is
the region comprising nucleotides of several hundred by
preceding the transcription initiation point.
Accordingly, any DNA sequence obtained from the region
within several hundred bp, preferably about 500 by upstream
of the transcription initiation point and having the flower
organ-specificity characterized in the present invention is
- g _
CA 02247087 1998-08-26
included in the present invention. For example, if a
region within several hundred by upstream of the
transcription initiation point is easily isolated from rice
genome by PCR with the use of primers designed based on the
nucleotide sequence of the present invention and the region
exhibits the flower organ-specificity inherent to the
promoter of the present invention, then the shorter promoter
sequence is included in the present invention.
The present invention further includes in the scope
thereof DNA fragments having a sequence derived from these
sequences by deletion, substitution, insertion or addition
of one or more nucleotides and showing the promoter activity.
It is well known that when a nucleotide sequence of a
DNA having a physiological activity is slightly modified by
deletion, substitution, insertion or addition of one or more
nucleotides, the physiological activity of the DNA will be
maintained in general. Therefore, the present invention
includes within the scope thereof DNA sequences derived from
the above mentioned promoter sequence by such slight
modification and having the promoter activity. That is to
say, the sequence consisting of the nucleotides of positions
1 - 1234 in the nucleotide sequence represented by SEQ ID
N0:2, parts of this sequence having the promoter activity
(for example, those consisting of several hundred by
upstream of the transcription initiation point), and DNA
sequences derived therefrom by deletion, substitution,
insertion or addition of a small number of nucleotides and
having the promoter activity are all intended to be included
- 9 -
CA 02247087 1998-08-26
in the scope of the present invention.
Similarly, the sequence consisting of the nucleotides
of positions 1- 1140 in the nucleotide sequence represented
by SEQ ID N0:2, the sequence consisting of the nucleotide
sequence of positions 1- to 1121 thereof, and DNA sequences
derived therefrom by deletion, substitution, insertion or
addition of a small number of nucleotides and having the
promoter activity are all included in the scope of the
present invention.
The addition, insertion, deletion or substitution of
nucleotides can be carried out by, for example, site-
directed mutagenesis (see, for example, Nucl. Acids Res.
10:6487-6500, 1982) which is a well-known technique. The
expression "one or more nucleotides" as used herein means
nucleotides in such a number as to allow addition, insertion,
deletion or substitution by the site-directed mutagenesis
method.
Site-directed mutagenesis can be performed in the
following manner with the use of, for example, a synthetic
oligonucleotide primer which is complementary to the single-
stranded phage DNA to be mutated except a specific
discordance, i.e., the desired mutation. Namely, a
complementary strand is synthesized by a phage with the use
of the above-mentioned oligonucleotide as a primer. Next, a
host bacterium carrying the phage is transformed by the
double-stranded DNA thus obtained. The culture of the
transformed bacterium is then plated onto agar and plaques
containing the phage from a single cell are formed. Thus
- 10 -
CA 02247087 1998-08-26
theoretically 50~ of the newly formed colonies will contain
the phage carrying the mutation in the single strand while
the remaining 50~ of the colonies have the original sequence.
The plaques thus obtained are hybridized with a synthetic
probe having been treated with kinase at such a temperature
as to allow the hybridization of the plaques coinciding with
the DNA having the desired mutation as described above but
not with those having the original strands. Then the
plaques hybridized with the probe are picked up and cultured
to subsequently recover the DNA.
In addition to the above site-directed mutagenesis
method, nucleotides) can be substituted, deleted, added or
inserted into the promoter sequence while maintaining its
activity by treating the gene with a mutagen or by
selectively cleaving the gene and then deleting, adding or
substituting the desired nucleotides) followed by ligation.
Also, the substitution, deletion, addition or insertion
of specific nucleotides) may be conducted by the site-
directed mutagenesis with the use of the PCR method
(Mikaelian et al. Nucl. Acids Res. 20:376, 1992) or the
random nucleotide substitution technique (Zhou et al. Nucl.
Acids Res. 19:6052, 1991) by taking advantage of the low
fidelity of Taq DNA polymerase.
Now, the second invention found by the present
inventors will be illustrated.
The second invention of the present invention relates
to a monocotyledon flower organ-specific promoter sequence
which is contained in a sequence identified from a rice
- 11 -
CA 02247087 1998-08-26
genome library with the use of the nucleotide sequence
represented by SEQ ID NO:1 as a probe.
This nucleotide sequence represented by SEQ ID N0:1 can
be obtained by constructing a cDNA library from rice (Oryza
sativa) palea and lemma or pistil, isolating a cDNA which is
expressed specifically in pistil, anther and lodicule by
differential screening and determining the whole nucleotide
sequence thereof. The nucleotide sequence thus determined
may be used as a probe as a whole. Alternatively, use may
be made of a part thereof as a probe. In this case, any
hybridization and washing conditions are employable so long
as they enable the formation of a molecular hybrid if the
nucleotide sequence of the DNA to be identified has a
homology of 80~ or more to the nucleotide sequence
represented by SEQ ID N0:1.
The genome library of rice is constructed by using rice
(Oryzae sativat) green leaf, though the present invention is
not limited thereto. The promoter sequence is identified
from the library thus obtained by using the above-mentioned
probe. In order to determine that the promoter is specific
to flower organs, a chimera gene is constructed by ligating
(3-glucuronidase (GUS) gene to the promoter sequence. The
resultant chimera gene is introduced into rice plant and
then the expression sites are confirmed.
The determination of the above-mentioned nucleotide
sequence represented by SEQ ID N0:1, the construction of the
rice genomic library and the assessment of the specific
promoter activity are described in detail in Examples as
- 12 -
CA 02247087 1998-08-26
will be given hereinafter, though the present invention is
not limited thereto.
As described above, the nucleotide sequence represented
by SEQ ID N0:2, in particular, the sequence comprising the
nucleotides of positions 1 - 1234 is a novel DNA fragment
isolated by the present inventors. Based on the disclosure
of the present invention, those skilled in the art can
easily isolate DNA fragments having a flower organ-
specificity similar to the one of the present invention from
various monocotyledon genome libraries with the use of at
least a part of the nucleotide sequence comprising the
nucleotides at positions 1 - 1234 of the nucleotide sequence
represented by SEQ ID N0:2. The conditions for
hybridization with the probe can be appropriately determined
too. Therefore, the present invention includes within the
scope thereof DNA fragments which are hybridizable with at
least a part of the nucleotide sequence consisting of the
nucleotides of positions 1 - 1234 of SEQ ID N0:2 and have a
flower organ-specific promoter activity similar to that of
the present invention.
The promoter of the present invention is a novel flower
organ=specifi.c--promoter-which--makes--it--possible to
genetically manipulate and improve not only anther but also
pistil and lodicule which was previously impossible
particularly in monocotyledons. Thus the promoter is useful
for, e.g., the following purposes.
(1) Creation of female sterile plants by use of a
structural gene capable of inducing sterility wherein said
- 13 -
CA 02247087 1998-08-26
gene is ligated to the promoter sequence of the present
invention or a part thereof.
(2) Flower organ-specific enlargement or elongation by
use of a structural gene capable of promoting the elongation
or division of plant cells wherein said gene is ligated to
the promoter sequence of the present invention or a part
thereof .
(3) Genetic regulation of flowering by means of the
expression of the promoter of the present invention in
lodicule.
(4) Providing the whole flower organs or a part thereof
with an improved tolerance to herbicides or diseases by use
of a gene imparting tolerance to herbicides or resistance to
diseases wherein said gene is ligated to the promoter.
The promoter of the present invention is expressed in
the stigma, style, anther wall, filament and lodicule of
rice in the flowering period. When this promoter is used,
for example, in the improvement of male sterile rice, its
expression in anther wall and filament can be ignored.
Further, it is sometimes expected that the sensitivity to a
gene product varies from organ to organ. In such a case,
the promoter of the present invention will be useful, for
example, to specifically improve stigma and style or
lodicule.
Finally, the third invention established by the present
inventors will be illustrated.
The third invention relates to a DNA sequence which
comprises the nucleotides of positions 114 - 1097 in the
- 14 -
CA 02247087 1998-08-26
nucleotide sequence represented by SEQ ID NO:1 or a part of
said sequence, or a DNA sequence derived therefrom by
deletion, substitution, insertion or addition of one or more
nucleotides and encoding a protein having a biological
activity equivalent to that of the protein encoded by the
DNA consisting of the above-mentioned nucleotide sequence.
The third invention further relates to a sequence consisting
of the amino acid sequence represented by SEQ ID N0:3, a
part of this sequence or an amino acid sequence derived from
these amino acid sequences by deletion, substitution,
insertion or addition of one or more amino acids and having
a biological activity equivalent to that of the protein
consisting of the above-mentioned amino acid sequence.
The DNA sequence of the present invention, i.e., the
sequence consisting of the nucleotides of positions 114 -
1097, and the amino acid sequence represent a novel
chitinase having homologies of 67 to 69~ and 54 to 61~,
respectively to the known rice class I chitinase.
The amino acid sequence represented by SEQ ID N0:3 has
the following characteristics.
By analogy based on the probable homologies to various
class I chitinases, its structure is supposed to have the
following elements from the N-terminal side thereof: a
leader sequence having consecutive hydrophobic amino acid
residues (amino acids of positions 1 - 20 in SEQ ID N0:3) at
the N-terminus; a chitin-binding region rich in cysteine
residues (amino acids of positions 21 - 61 in SEQ ID N0:3)
in the N-terminus region of the mature protein; and a spacer
- 15 -
CA 02247087 1998-08-26
region (amino acids of positions 62 - 83 in SEQ ID N0:3)
followed by the catalytic region (amino acids of positi84 -
328 in SEQ ID N0:3). In this catalytic region, the first
tyrosine residue (Verburg et al. J. Biol. Chem., 267, 3886-
3893, 1992; Y at position 199 in SEQ ID N0:3) in NYNYG
(amino acids at positions 198 - 202 in SEQ ID N0:3), which
is considered as the active site of chitinase, is conserved.
At the C-terminus, characteristic consecutive amino acid
residues (at positions 318 - 328 in SEQ ID N0:3) showing no
homology to other rice chitinases are observed. The
molecular weight and isoelectric point of the mature protein
region (from positions 21 to 328 in SEQ ID N0:3) are
calculated respectively as about 32 kD and 7.24.
When mature protein region (amino acids of positions 21
- 328 in SEQ ID N0:3) is expressed in E. coli and the
chitinase activity is measured as one of the biological
activities thereof, the chitinase activity can be detected
in practice.
As discussed above, a plant class I chitinase has a
cysteine-rich chitin-binding region which is followed by a
spacer region at the N-terminus of the mature protein.
However, Iseli et al. (Plant Physiol. 10221-226, 1993)
reported that the chitinase and antimicrobial activities are
maintained in the absence of these regions. Accordingly, it
is highly probable that the chitinase of the present
invention also has chitinase activity exclusively in the
catalytic region, namely, without the chitin-binding and the
spacer regions. Therefore, it is expected that the
- 16 -
CA 02247087 1998-08-26
catalytic region consisting of the amino acids of positions
84 - 328 in SEQ ID N0:3 should have a biological activity
equivalent to those of the entire 175 protein (amino acids
of positions 1 - 328 in SEQ ID N0:3) or the mature protein
(amino acids of positions 21 - 328 in SEQ ID N0:3). Thus,
this region is also included in the present invention.
As described above, the novel chitinase of the present
invention has chitinase activity and thus is useful for the
following purposes:
(1) Production of disease or insect damage-resistant
plants by way of the transformation of plant cells by the
DNA sequence comprising the nucleotides of positions 114 -
1097 in the DNA sequence represented by SEQ ID NO:1 of the
present invention or a part thereof, wherein said DNA
sequence or a part thereof has been ligated to a
constitutive, tissue-specific, time-specific or inducible
promoter.
(2) Application of chitooligosaccharides produced by
the chitinase as materials for manufacturing foods,
cosmetics and drugs.
Examples
Example 1: Isolation of flower organ-specific cDNA
Paddy rice varieties "Alcihiltari" , "Tsulcinohiltari" and
"IR24" were grown in a greenhouse and subjected to the
following experiments.
(1) Extraction of RNA
The leaf, pistil, anther, lodicule, palea and lemma,
immature seed, germinating seed, root and callus of "IR24"
- 17 -
CA 02247087 2004-O1-30
and palea and lemma (4.5 to 6.0 mm in length) of "Akihikari"
were collected, immediately frozen in liquid nitrogen and
then stored at - 80°C. A portion of the pistil was divided
into the stigma and ovary tissues.
The total RNA was extracted from these tissues by the
SDS-phenol method of Watanabe and Price (Proc. Natl. Acad.
Sci. USA, 79, 6304-6308, 1982) except that (3-mercaptoethanol
was added as an antioxidant to the extraction buffer to give
a final concentration of 10~ (V/V). The tissues to be used
in the reverse transcription PCR experiment were treated
with DNase I (FPLC pure, manufactured by Pharmacies) in the
presence of RNase inhibitor (RNAguard* manufactured by
Pharmacies), rather than being subject to lithium chloride
precipitation, so as to minimize the contamination with any
trace amount of DNA. The leaf and root [expressed in "root
(soil)" in Fig. 2 and Table 1 as will be given hereinafter]
were collected from a plant grown for 1 month in the
greenhouse after sowing. The pistil, anther, lodicule and
palea and lemma were collected from a plant immediately to
several days before flowering. The immature seed was
collected from a plant 1 to 2 weeks after flowering. The
germinating seed and root were obtained from a plant
aseptically grown on an N6 medium (Chu et al. Scientia
Sinica, 18, 659-668, 1975) respectively for 1 and 3 weeks
after sowing.
The callus was induced from a seed in an N6 solid
medium containing 2 mg/1 of 2,4-D and then cultured before
use in a liquid medium of the same composition under shaking
* trademark
- 18 -
CA 02247087 2004-O1-30
for 1 week. The total RNA of the pistil and leaf was
purified to provide polyA+RNA by using Oligotex-dT30*super
(manufactured by Takara Shuzo Co., Ltd.) in accordance with
the manufacturer's instructions
(2) Construction of palea and lemma and pistil cDNA
libraries
About 2.2 ~g and 1 ~,g of respective polyA+RNA isolated
and purified from palea and lemma and pistil was employed as
a template to synthesize the cDNA by using ZAP-cDNA
Synthesis Kit*(manufactured by STRATAGENE). The
determination of RI uptake ratio indicated that about 462 ng
and about 55 ng of the first strand cDNA of the palea and
lemma and pistil were reversely transcribed by the oligo-dT
priming, and about 1,022 ng and about 72 ng of the second
strand cDNA were synthesized directly from the first strands.
In accordance with the manufacturer's instructions, the cDNA
was connected to an EcoRI adaptor and digested with XhoI, to
be ligated into vector Uni-ZAPXR* Next, the phage DNA was
packaged into phage particles by using Giga-pack Gold*
packaging extract (manufactured by STRATAGENE). The phage
was transfected into E, coli PLK-F' host cells, which were
then inoculated on a plate and each library size was
examined. As a result, the palea and lemma cDNA library
size was calculated as 1 x 106 pfu (plaque forming unit)
while that of the pist cDNA library was calculated as 3 x
106 pfu .
(3) Differential screening
Differential screening was carried out basically in
* trademarks - 19 -
CA 02247087 2004-O1-30
accordance with the method of Gasser et al. (The Plant Cell
1, 15-24, 1989). About 2,000 pfu of the phage from the
palea and lemma cDNA library was infected into E. coli PLK-
F' cells and the cells were plated on square petri dishes
(14 x 10 cm). For each plate, a replica filter was prepared
with the use of a nylon membrane filter Hybond-N+
(manufactured by Amersham) and the filter was treated in
accordance with the manufacturer's instructions.
As the probes for hybridization, use was made of
single-stranded cDNA synthesized from about 100 ng of the
polyA+RNA (or about 2 ~,g of the total RNA) of pistil and
leaf. To 2 ~,l of an RNA solution, 0.5 mM of d(ATG)TP, 10
mM of DTT and 1 x M-MuLV buffer (manufactured by BRL) were
added. Next 30 ng/~,1 of Random DNA Hexamer (manufactured by
Pharmacia) [or 80 ng/~,1 of Oligo dT Primer (manufactured by
Amersham)] was added thereto (the concentration indicates
the final concentration in each case). After dissociating
the secondary structure of the RNA by heating at 65°C for 5
minutes, the primer was annealed at room temperature. After
further adding 1.5 unit/~,1 of RNase inhibitor (RNAguard,
manufactured by Pharmacia), 10 unit/~.1 of reverse
transcriptase M-MuLV (manufactured by BRL) and 4 ~Ci/~1 of
[a-3zP]dCTP (each expressed in the final concentration), the
liquid reaction mixture of 20 ~.1 in total was maintained at
37°C fo:r one hour. Subsequently, RI-unlabeled dCTP was
further added to give a final concentration of 0.5 mM and
the reaction was continued for 30 minutes.
The labeled DNA probes were purified by using Quick
* trademark
- 20 -
CA 02247087 2004-O1-30
Spin Column*G-50 Sephadex*(manuf actured by BOEHRINGER
MANNHEIM). The probes were denatured by adding an
equivalent amount of 2 N NaOH (final concentration: 1 N).
The filter was first treated in a hybridization buffer (0.25
M NazHP04 pH 7.2, 7~ SDS, 1 mM EDTA, 1 x Denhardt's
solution) at 68°C for 10 minutes. Then the single-stranded
probes (final concentration: 0.2-0.3 x 10' cpm/ml) and
carrier.DNAs (0.1 mg/ml, salmon sperm DNA, 0.1 ~Cg/ml ?DNA,
0.1 ~g/ml rice DNA) were added thereto and hybridization was
performed at 68°C overnight (16 to 24 hours).
The filter was washed in the buffer (20 mM Na2HP04 pH
7.2, 1~ SDS, 1 mM EDTA) at room temperature twice and at
68°C twice each for 15 minute. Next, this filter was
exposed to Kodak X-Omat*Film at - 70°C for 4 to 5 days.
When about 20,000 plaques were examined, 114 plaques showing
intense hybridization signals with the pistil probe but only
weak or background signals with the leaf probe were selected
by the primary screening. Subsequently, these plaques were
further purified and 41 plaques were selected in the
tertiary screening stage.
Among these plaques, one showing a particularly weak
signal with_the leaf probe (indistinguishable from the
background) was stored in 200 ~1 of SM buffer (0.1 M NaCl, 7
mM MgSO~, 50 mM Tris-CL, pH 7.5, 0.01 gelatin) containing
one drop of chloroform at 4°C. Then the thus stored liquid
was diluted and the phage was plated so as to give a
considerably low plaque density (10 to 100 pfu/plate). A
plaque separated from others was isolated and stored in the
'* trademarks - 21 -
CA 02247087 2004-O1-30
same buffer. From this liquid, a lysate (plating
lysate) containing the phage at a high concentration was
prepared and in vivo excision was performed in accordance
with the instructions attached to ZAPcDNA Synthesis Kit.
Thus a plasmid [pBluescriptSK(-)]* was cut from the phage
genome. Then it was digested with restriction enzymes EcoRI
and XhoI (manufactured by Takara Shuzo Co., Ltd.) and thus a
cDNA insert (about 0.8kb) was isolated and purified.
(4) Analysis on organ-specif is expression of cDNA clones
i) Northern hybridization analysis
The cDNA clone selected in the above (3) was subjected
to Northern hybridization to examine the expression patterns
and expression levels in various organs. Filters were
prepared in the following manner. First, the secondary
structure of the total RNA (20 ~.g) from each of the organs
described in the above (1) was dissociated in accordance
with the method of Sambrook et al. (Molecular Cloning, 1982)
with the use of deionized Glyoxal and DMSO and then
fractionated in a 1~ agarose gel. Next, the RNA was blotted
onto a nylon membrane Gene Screen Plus*(DU PONT) by the
convention capillary transfer method. After drying in a
vacuum oven at 80°C for 1 hour, the filter was boiled in 20
mM Tris-C1 (pH 8.0) for 5 minutes to thereby remove Glyoxal
therefrom. As a probe, the 0.8 kb EcoRI fragment of the
above-mentioned cDNA was RI-labeled by using Multiprime
Labeling System*(manufactured by Amersham).
Pre-hybridization and hybridization were carried out in
accordance with the manufacturer's instructions attached to
* trademarks - 22 -
CA 02247087 1998-08-26
the filter. The filters were washed with 2 x SSC, 1~ SDS
and 0.2 x SSC, 1~ SDS at room temperature each for 5 minutes,
then with 0.16 x SSC, 1~ SDS at 65°C for 15 minutes twice
and then with 2 x SSC at room temperature for 1 minute.
Subsequently the filters were exposed to Kodak X-Omat Film
at - 70°C overnight. As a result, signals were observed
exclusively in the lanes of pistil, anther and lodicule
while the other lanes showed no signal, as shown in Fig. 1.
Thus, it was clarified that the differential clone isolated
above was expressed strongly in pistil, anther and lodicule
but in very or extremely low level in other organs. The
size of the transcripts was estimated to be 1.5 kb.
Then the expression doses were determined by measuring
the signal densities with a densitometer. As a result, the
relative expression levels in anther and lodicule were
respectively about 2 and about 4, taking that in pistil as 1.
ii) Reverse transcription PCR analysis
To analyze the organ-specific expression of the cDNA
clone at a higher precision, reverse transcription PCR was
carried out by using RNA of various rice organs as templates.
First, the partial nucleotide sequence of the cDNA was
determined. By using GENESIS 2000 Fluorescence Sequences
(manufactured by Du Pont), the nucleotide sequence of the
cDNA inserted into the plasmid pBluescript SK(-) was
determined. In accordance with the manufacturer's
instructions attached to the Sequences, T7 DNA polymerase
reaction was performed by using RV and M4 primers
(manufactured by Takara Shuzo Co., Ltd.) of M13 followed by
- 23 -
CA 02247087 2004-O1-30
electrophoresis on 6~ acrylamdie gel. Then, the nucleotide
sequence was determined from both the 5'- (EcoRI) an3'-
(XhoI) sides.
On the basis of about 300 nucleotides in the 5'-side of
this DNA, appropriate primers:
5'-GACACCCGCAAGCGTGA-3' (75RV1: 17-mer) and
5'-CCCTTCACCTCCTTGTA-3' (75FW1; 17-mer);
were synthesized with DNA Synthesizer (manufactured by ABI)
and purified by OPC Cartridge*(manufactured by ABI) for the
reverse transcription PCR experiment. With these primers, a
product of 101 by was amplified.
Further, the following primers synthesized based on the
sequence of rice actin 1 gene (Racl, McElroy et al. Plant
Mol. Biol. 14, 163-171, 1990
5'-GTATCCATGAGACTACATACAACT-3' (24-mer) and
5'-TACTCAGCCTTGGCAATCCACA-3' (22-mer);
were used as controls. These primers were selected so that
an intron would be included therebetween. Therefore, it was
intended that if the template DNA was contaminated with
genomic DNA, a product (350 bp) of the genomic DNA would be
amplified along with the product (267 bp) of the cDNA
The total RNA of each of the above-mentioned organ was
serially diluted (1 fig, 30 ng, 1 ng, 30 pg) and treated at
65°C for 5 minutes to thereby dissociate the secondary
structure. After quenching on ice, it was incubated in a
reaction mixture comprising 1 x Perkin Elmer Gene Ampbuffer
1 mM dNTPmix, 5 ng/~1 oligo dTlS primer (manufactured by
Amersham), 2.5 mMgCl2, 3 U/~1 RNase inhibitor (RNAguard,
* trademarks - 24 -
CA 02247087 2004-O1-30
manufactured by Pharmacia) and 1 U/~l reverse transcriptase
M-MuLV (manufactured by BRL) (each concentration referrs to
the final concentration) at 37°C for 30 minutes. Next, it
was treated at 95°C for 5 minutes to dissociate the RNA-cDNA
hybrid and then cooled on ice. Then a pair of primers (10 -
20 pmoles), 10 x buffer and 1 unit of AmpliTaq Polymerase
(manufactured by Perkin Elmer) were added and the reaction
mixture of 50 ~1 in total volume was subjected to PCR for 40
cycles with each cycle consisting of 1 minute at 94°C, 1
minute at 60°C and 2.5 minutes at 72°C.
As a control experiment, the reverse transcription
product (i.e., total RNA) prepared from each organ was
subjected to PCR with the use of primers for Racl gene,
which is considered to be constitutively expressed in all
organs in rice. As a result, the anticipated PCR product
(267 b:p) was detected from all of the organs examined. This
indicated that no template cDNA preparations employed were
contaminated with substantial amount of genomic DNA. The
d2tection limits (amount of template RNA) in germinating
seed and root were 0.5 ~g and 1 ng respectively, while the
limits in other organs were 30 ng. Supposing that Racl gene
was expressed in all of the organs tested herein at the same
level, it was estimated that the reverse transcription PCR
efficiencies in germinating seed and root were respectively
about 1/17 and about 30, taking that in pistil as 1, while
those an other organs were almost the same as that in pistil.
Subsequently, a reverse transcription PCR experiment
was carried out by using clone-specific primers which had
* trademark - 25 -
i
~>
CA 02247087 1998-08-26
been preliminarily proved to amplify the product of expected
molecular weight by using plasmid clones. When the cDNA
reversely transcribed from 1 ~,g of RNA was used as a
template in PCR, the expected product (101 bp) was detected
from pistil, anther, immature seed and palea and lemma, as
shown in Fig. 2A. Namely, no PCR product was amplified from
cDNA of other organs. In the case of pistil, the expression
was observed both in stigma and ovary. In each organ from
which the PCR product was detected, the template RNA was
diluted and the expression level was estimated. As a result,
in pistil (stigma and ovary) and anther, the PCR product was
amplified from the most minimum quantity of the template (30
pg). In contrast, the PCR product was amplified from 30 ng
or above, and 1 ~.g of the template in palea and lemma, and
immature seed, respectively (Fig. 2B).
When the expression level in pistil (stigma and ovary)
was taken as 1, therefore, the level in anther was estimated
as about 1 while those in palea and lemma and immature seed
were calculated respectively as 10-3 and 3 x 10-5. That is to
say, this gene was expressed only at an extremely low level
in organs other than flower organs. Table 1 summarizes the
results of the reverse transcription PCR and the Northern
analysis.
- 26 -
CA 02247087 1998-08-26
~.
Table 1: Relative expression dose of RPC175 in various
organs estimated from Northern analysis and
reverse transcription PCR (referring the dose in
stigma or pistil as to 1)
Organ pistil (stigma ovary) anther lodicule leaf
Northern 1 (NT NT) 2 4 0
analysis
1O RT-PCR 1 (1 S1) 1 NT 0
Organ root root (soil) germinating seed callus
Northern 0 NT 0 0
analysis
RT-PCR 0 0 0 0
Organ palea and lemma immature seed
Northern 0 0
analysis
RT-PCR 10-3 3 x 10-5
NT: not analyzed.
(5) Genomic Southern hybridization analysis
One month after sawing, genomic DNA was isolated and
- 27 -
CA 02247087 1998-08-26
purified by the phenol SDS method (Komari et al. Theor. Appl.
Genet. 77, 547-552, 1989) from paddy rice plants of the
varieties of "Tsukinohikari" and "IR24". About 5 ~,g of DNA
was digested with restriction enzymes BamHI, EcoRI, HindIII,
PstI, SalI and XhoI (manufactured by Takara Shuzo Co., Ltd.)
and the DNA fragments were fractionated in a 0.8~ agarose
gel. After blotting the DNA onto a nylon membrane filter
HybondN+ (Amersham), genomic Southern hybridization was
carried out with the use of the above-mentioned cDNA
fragment of 0.8 kb which had been RI-labeled similar to the
above (4)i).
The hybridization and the subsequent washing were
effected according to the manufacturer's instructions
attached to the filter. As a result, several faint bands
were observed in addition to one or two intense bands,(Fig.
3), though the hybridization was effected under conditions
that would not allow any hybridization to take place unless
the genomic DNA had a high homology to the probe. That is
to say, when digested with EcoRI, for example, a strong
signal (2.6 kb) and three weak signals of 1.6 kb were
detected. It was considered that such a faint band might
have a somewhat short homologous region to the probe or
might not have high homology to the probe. These results
indicate that the cloned gene may have a few related
sequences in rice genome.
(6) Isolation of full-length cDNA
The pistil cDNA library [Example 1 (2)] was screened
with the use of the cDNA clone of 0.8 kb as a probe. About
- 28 -
CA 02247087 1998-08-26
F
1.6 x 105 pfu of the phage containing the pistil cDNA was
plated on 8 square petri dishes in the same manner as that
of Example 1 (3) and replica filters were prepared. These
filters were subjected to hybridization with the above cDNA
(0.8 kb) which had been RI-labeled with the use of
Multiprime Labeling System (manufactured by Amersham). As a
result, 40 positive plaques were obtained by the primary
screening. Among these plaques, 20 were subjected to in
vivo excision and plasmids containing the cloned cDNA were
cut out from phage DNA.
Subsequently, these plasmids were digested with EcoRI
and the cDNA clones were excised. When these clones were
compared with each other, the longest ones (3 clones) were
about 1.25 kb in size. One typical clone was selected
therefrom and the nucleotide sequence of about 300 by at the
3'-side was determined. When compared with the
corresponding region of the clone of 0.8 kb from "Akihikari"
employed as a probe, the nucleotide sequences of these
clones almost completely coincided with each other including
the 3'-untranslated region.
To examine in detail whether or not the obtained clone
(1.25 kb) and the clone (0.8 kb) originated from the same
gene, a pair of primers as follows were synthesized based on
the nucleotide sequence determined above:
5'-GACATCATGTCGGCGTCTGCG-3' (175RV1; 21-mer) and
5'-GCCATGACCATGCATACATATGG-3' (175FW1; 23-mer).
Then reverse transcription PCR was effected for all of the
rice organs in the same manner as the one employed in
- 29 -
CA 02247087 1998-08-26
Example 1 (4) ii) but for 30 cycles. The results thus
obtained were the same as those obtained in the case of the
clone of 0.8 kb.
Accordingly, it was clarified that the gene of the
present invention was expressed almost exclusively in pistil,
anther and lodicule. The expression level thereof in palea
and lemma and immature seed were about 1/1,000 times as much
as the expression level in pistil, anther and lodicule,
while no detectable level of expression was observed in
other organs. These facts clarified that the selected cDNA
clone of 1.25 kb had the same origin as that of the cDNA of
0.8 kb isolated by the differential screening. Thus, this
cDNA clone was employed as the probe in the subsequent
isolation of genomic clones. This cDNA clone of 1.25 kb was
named "RPC175".
(7) Determination of the nucleotide sequence of RPC175
The entire nucleotide sequence of the cDNA clone RPC175
(about 1.25 kb), which is expressed specifically in flower
organs, was determined in the following manner with the use
of Fluorescence Sequencer (Model 373A, manufactured by
Applied Biosystems). By using the M13 primers RV (5'-side
of the cDNA, decoding the sense strand) and M4 (3'-side of
the cDNA, decoding the antisense strand) on the plasmid
vector pBluescript SK(-) carrying RPC175 integrated
thereinto, the nucleotide sequences of about 250 to 300 by
in the 5'- and 3'-sides were first determined.
Based on the nucleotide sequence information thus
obtained, internal primers were constructed and the
- 30 -
CA 02247087 1998-08-26
nucleotide sequences of the sense strand and antisense
strand were decoded from both sides. Next, further primers
were synthesized based on the partial nucleotide sequences
thus decoded and the nucleotide sequences of the sense
strand and antisense strand were consecutively decoded.
Thus, 9 internal primers (4 for the sense strand and 5 for
the antisense strand) were used in total including the
primers used in the reverse transcription PCR. On the other
hand, it was known by restriction analysis that RPC175 had
two ApaI sites. Thus, RPC175 was split into 3 fragments at
these sites and subcloned into the same site of the plasmid
vector pBluescript SK(-). Then the nucleotide sequence was
determined by the M13 primers.
Thus the entire nucleotide sequence of RPC175 was
determined by using the internal primers and the subcloning.
Next, the nucleotide sequence thus determined was analyzed
by using GENETYX-MAC8.0, a software for analyzing nucleotide
sequence/amino acid sequence. As a result, it was found
that the complete nucleotide sequence of RPC175 consisted of
1,258 by and had 2 initiation codons (ATG), separated by a
sequence of 36 bp, in the same reading frame in the 5'-side
and the upstream ATG was located immediately after a
sequence capable of forming a stem loop.
The reading frame as determined by the ORF analysis
enabled estimation of amino acids. Thus, it was determined
that 340 amino acids were encoded when the translation was
initiated from the upstream ATG, while 328 amino acids were
encoded when the translation was initiated from the
- 31 -
CA 02247087 1998-08-26
downstream ATG. Two polyA signals (5'-AATAAA-3') were
located downstream of the termination codon. The entire
nucleotide sequence of RPC175 is represented by SEQ ID NO:1.
It is to be understood that the first 60 by region originate
in the genome clone as will be described hereinafter and
that SEQ ID NO:1 includes all the nucleotides from the
transcription initiation point to polyA.
The amino acid sequence encoded by RPC175 is
represented by SEQ ID N0:3. As will be described
hereinafter, it was highly probable that of the two ATGs the
downstream ATG was the transcription initiation point. Thus,
the amino acid sequence consisting of 328 amino acids in
total from the downstream ATG to the termination codon is
shown in SEQ ID NO: 3. In the amino acid sequence
represented by SEQ ID N0:3, the sequence consisting of the
amino acids of positions 1 - 20 is estimated to be the
leader sequence while the sequence after the leader is the
amino acid sequence of the mature protein, as will be
illustrated hereinafter.
A homology analysis was conducted by the software
GENETYX-MAC/CD 32 and BZAST, an Internet program for
nucleotide sequence detection. As a result, RPC175 was
homologous to class I chitinases of rice, wheat, barley,
corn, potato and tomato. That is, it showed homology over
the entire regions, excepting for the variable region (amino
acids of positions 62 - 83 in SEQ ID N0:3), including the
leader sequence with consecutive hydrophobic amino acids
(positions 1 - 20), the chitin-binding region rich in
- 32 -
CA 02247087 1998-08-26
cysteine (positions 21 - 61) and the catalytic region
(positions 84 - 328). The catalytic region contained the
first tyrosine residue in NYNYG (Y at position 199 in the
amino acid positions 198 - 202 positions in SEQ ID N0:3)
which is conserved in a number of basic chitinases and
considered as the active site. At the C-terminus,
characteristic consecutive amino acids (amino acids
positions 318 - 328 in SEQ ID N0:3) were observed unlike
other rice chitinases. RPC175 showed homologies to various
rice class I chitinases of about 67 to 69~ based on the
nucleic acids and about 54 to 61~ based on the amino acids.
The molecular weight and isoelectric point of the
mature protein (amino acids of positions 21 - 328 in SEQ ID
N0:2) were calculated respectively to be about 32 kD and
7.24.
Example 2: Isolation of promoter
(1) Construction of genomic library
Genomic DNA was isolated by the SDS-phenol method, and
purified by the lithium chloride precipitation method for
elimination of RNA from rice leaves about 2 months after
sowing. As a preliminary test, the DNA was first partly
digested with--a restriction--enzyme-Mbol-(irianufactured by-
Takara Shuzo Co., Ltd.) to determine the digestion
conditions which would allow the formation of fragments of
16 to 23 kb in apparent size. Next, the genomic DNA was
digested under the so determined reaction conditions and
subjected to sucrose density gradient centrifugation.
Sucrose was dissolved in a buffer (20 mM Tris-HC1 pH 8.0, 1
- 33 -
CA 02247087 2004-O1-30
mM EDTA, 200 mM NaCl) to give a gradient of 5 concentrations
(10, 17.5, 25, 32.5 and 40~). These sucrose solutions were
layered in this order in a centrifugation tube (40PA,
manufactured by Hitachi) and finally the partly digested DNA
solution was layered on top of the gradient. After
centrifuging at 20,000 rpm for 17 hours at 20°C by using a
rotor SRP28 SA (manufactured by Hitachi), the mixture was
divided into 80 portions (0.5 ml each) with a peristaltic
pump (AC-2110, manufactured by Atto) to provide a fraction
containing DNA fragments of 16 to 23 kb in the largest
amount.
This DNA fraction was then ligated with a vector LAMBDA
DASA*II/BamH(manufactured by STRATAGENE) by the action of T4
DNA ligase (manufactured by BOEHRINGER MENNHEIM) and then
packaged into phage particles by using Gigapack II Gold
packaging extract (manufactured by STRATAGENE). Thus, a
rice genomic library was constructed, the size of which was
calculated as about 5 x 106 pfu.
(2) Screening of clones
About 10,000 pfu of the phage was mixed with E. coli
SRBP2 for infection and inoculated into a square petri dish
(14 x 10 cm). After an incubation at 39°C overnight, a
nylon membrane filter Hybond N+ (manufactured by Amersham)
was brought into contact with the plaque surface and then
processed in accordance with the manufacturer's instructions
attached to the filter. The probe was a 1.2 kb EcoRI
fragment of the rice flower organ-specific cDNA (RPC175)
which was used after being RI-labeled with the use of
* trademark - 34 -
CA 02247087 1998-08-26
Multiprime Labeling System (manufactured by Amersham). Thus,
plaque hybridization was carried out. The hybridization and
washing were effected under the same conditions as those
specified in the above Example 1 (3) provided that 1 x
Denhardt's solution and carrier DNAs were not employed.
From about 160,000 plaques, 35 positive clones were selected
in the primary screening. Subsequently, the secondary
screening was performed to give 12 positive clones.
Next, phage DNAs were prepared from these plaques.
They served as templates, in the PCR which was performed
with the use of the RPC175-specific primers 175FW1 and
175RV1 as in the foregoing reverse transcription PCR. From
tYia PC'.R Pxr~PrimPnt i»i nQ sane-snc~cific primers . the taraet
,..__._-_ .__ ___r_________-- _--__r, _,-__- -r__---_ ~-_ ,
clones were screened. As a result, the expected product of
about 200 by was found to have been amplified in 8 clones
out of 12. Five clones among them were further subjected to
PCR by using another set of primers (75FW1 and 75RV1). As a
result, a product longer by about 90 by than the one
amplified by using cDNA as a template was amplified in every
case .
Subsequently, the nucleotide sequence was determined
for the PCR products of these 5 clones at 2 sites (about 400
by in total). When compared with the nucleotide sequence of
the control cDNA, these 5 genomic clones all showed a
homology of 99~ or above except the intron sequence. Based
on these facts, it was concluded that these clones most
probably represented the genomic clone which was the target
of this screening.
- 35 -
CA 02247087 1998-08-26
The product obtained by using 75FW1 and 175RV1 had an
intron of 85 by having a 5'-GT-AG-3' sequence in the both
ends thereof. Therefore, when the DNA of the genomic clone
was employed as a template, a PCR product longer than that
amplified by using cDNA as a template was amplified. This
intron had a PstI site at the 3'-terminus.
(3) Subcloning of gene region
The total genomic DNA of rice was digested with a
restriction enzyme EcoRI and genomic Southern analysis was
carried out by using the RPC175 gene as a probe. Thus a
band with a weak signal appeared at about 1.6 kb in addition
to the one with a strong signal at about 2.6 kb (Fig. 3).
On the other hand, phacae DNA was extracted from the above-
mentioned 5 clones and digested with EcoRI followed by
Southern hybridization with the use of RPC175 as a probe.
As a result, it was found that the DNA fragments which
formed hybridization with RPC175 were limited to those of
2.6 kb and 1.6 kb, which agreed with the results of the
Southern analysis on the genomic DNA. It was known from the
nucleotide sequence data, that RPC175 had the unique EcoRI
site about 70 by upstream of the 3'-terminus. Therefore,
the- 1-:6--kb--fragment-with. a-weak-signal was-cons~~ere~~o -
have been detected due to the homology between the short
region (about 70 bp) from the EcoRI to the poly A sites in
the 3'-region of RPC175 cDNA employed as a probe and the
genomic DNA fragment.
From the signal intensity in the genomic Southern
analysis, it was anticipated that the 2.6 kb EcoRI fragment
- 36 -
CA 02247087 1998-08-26
would include the complete structural gene region and at
least about 1 kb upstream thereof, unless it contained a
large intron. Thus, this fragment was subcloned into the
plasmid vector Bluescript SK(-) and named "RPG102". For
further analysis, RPC102 was digested with a restriction
enzyme PstI and electrophoresed on an agarose gel, whereby,
RPC102 was divided into 4 fragments of about 1.2, 0.8, 0.4
and 0.2 kb.
Next, these DNA fragments were transferred onto a
filter and subjected to Southern analysis with the use of
RPC175 as a probe. As a result, signals were detected in 3
(about 0.8, 0.45 and 0.1 kb) out of the 4 fragments. It
way kiaown frvaW - t he nucicv tide ~c~uc ncaQ_. data that RPC175 hud
a PstI site about 45 by downstream of the 5'-terminus and
another PstI site about 120 bydownstream thereof. Thus,
the band of 0.1 kb in size detected by the Southern analysis
was assignable to this region. It was also known that
another PstI site was located about 50 by upstream of the
EcoRI site at the 3'-terminus, and in addition, an analysis
with the use of restriction enzymes indicated that the
distance between the second PstI site in the 5'-side and the
PstI site in the 3'-side was about 0.95 kb. Accordingly, it
was assumed that RPG102 contained an intron of about 200 by
in addition to the above-mentioned intron of 85 bp, and that
the fragment of 1.25 kb was cut into the fragments of 0.8 kb
and 0.45 kb at the PstI site in the intron of 85 bp.
Based on these facts, it was considered that the 3
bands detected by the Southern analysis corresponded to the
- 37 -
CA 02247087 2004-O1-30
structural gene region and that the promoter region was
contained in the PstI fragment of 1.2 kbp which did not form
a molecular hybrid with RPC175 cDNA.
(4) Identification of promoter region
By analyzing the nucleotide sequence in the 5'-side of
RPC175 cDNA, it was clarified that two ATGs were contained
in the same reading frame in this region of RPC175.
A primer containing the downstream ATG:
5'-CTTCATGGCCACCTGCAGGTTTGC-3' (CSFW; 24-mer)
was synthesized and the nucleotide sequence of about 300 by
in the 3'-side of the promoter region of RPG102 was
determined.
To ensure the determination of the transcription
initiation point by the primer extension method, another
primer of about 40 by upstream of C5F
5'-TGCGATCATGGCAAGATGC-3' (p3FW2; 19-mer)
was synthesized.
These primers (10 pmole each) were RI-labeled at the
5'-terminus by phosphorylation with the use of [Y-'2P]ATP
according to the manufacturer's instructions attached to
MEGARABEL* kit (manufactured by Takara Shuzo Co., Ltd.). 0.1
pmole (0.3 x 106 cpm) of these labeled primers and 20 ~,g of
the total RNA of pistil or leaf were annealed in the
presence of 3 U/~1 of RNase inhibitor (RNAguard,
manufactured by Pharmacia) in a buffer (0.25 M KC1, 2 mM
Tris-HC1 pH 8.0, 0.2 mM EDTA) in a reaction system of 10 ~,l
at 40°C for 2 hours . After adding 30 ~.1 of another buffer
(66 mM Tris-HCl pH 8.3, 6.6 mM MgClz, l.3 mM DTT, 0.66 mM
* trademark _ 3g _
CA 02247087 1998-08-26
dNTP , 130 ~.~,g/ml actinomycin D ) and 1 ~,1 ( 200 units ) of a
reverse transcriptase (M-MuLV, manufactured by BRL), the
mixture was incubated at 37°C for 1 hour. Then ethanol and
ammonium acetate were added to allow precipitation to occur.
After washing the precipitate with 70~ ethanol, the product
was air-dried and then dissolved in an electrophoresis
buffer which was prepared by mixing the reaction termination
solution of T7 Sequencing Kit (manufactured by Pharmacia)
with 0.1 M NaOH and 1 mM EDTA (2 . 1). A 1/3 portion of
this solution was heated at 95°C for 3 minutes and then
electrophoresed on a 6~ aCrylamide gel. By using the same
primers, an extension reaction was carried out with T7
Sequencing Kit by using a plasmid containing RPG102 as a
template, and the product thus obtained was electrophoresed
simulataneously.
The results are shown in Fig. 4. No extension product
was obtained from leaf RNA in which the gene was not
expressed, while 2 bands (in the case of the CSFW primer)
and 3 bands (in the case of the P3FW2 primer) of extension
products were detected by using the total RNA of pistil as
the template. Comparison of the sequence ladders generated
side by side indicated that the products by the two primers
were detected at the same position in the sequence of RPG
102.
These results indicated that the transcription of
RPG102 was initiated from A (adenine) at 3 positions
existing at intervals of several bases. A TATA box-like
sequence 5'-TATATAA-3' was found 30 by upstream of the first
- 39 -
CA 02247087 1998-08-26
transcription initiation point (adenine) from the 5'-
terminus. The location of the TATA box-like sequence
coincided with genes of other plant (Joshi, Nucleic Acids
Res., 15, 6643-6653, 1987). Moreover, as described above,
the two ATG translation initiation codons 36 by apart from
each other in the same reading frame were located 77 by and
113 by downstream of this transcription initiation point
(Fig. 5).
(5) Determination of whole nucleotide sequence of RPG102
Among the fragments formed by digesting RPG102 with
PstI in Example 2 (3), the fragments of 1.2, 0.8 and 0.45 kb
were subcloned into the same sites of pBluescript. From the
PstI 1.2 kb fragment containing the promoter sequence, among
the above-mentioned fragments, deletion clones with stepwise
deletion of 100 to 200 by were prepared from the both
strands (20 clones in total) by using a deletion kit kilo-
sequence for (manufactured by Takara Shuzo Co., Ltd.) and
the nucleotide sequence was determined with the use of M13
primer (manufactured by Takara Shuzo Co., Ltd.) with
Fluorescence Sequencer (Model 373A, manufactured by Applied
Biosystems). Regarding the fragments of 0.8 kb and 0.45 kb
each containing the structural gene, the nucleotide -
sequences were determined by using the M13 primer
(manufactured by Takara Shuzo Co., Ltd.) and the internal
primers described in the above Example 1(7). Furthermore,
the nucleotide sequence in the 3' region of RPG102 per se
was determined by using the M13 primer and the internal
primers. Thus, the entire nucleotide sequence of RPG102 was
- 40 -
CA 02247087 1998-08-26
finally clarified.
As a result, it was found that the whole nucleotide
sequence of the RPG102 clone consisted of 2,636 by and, when
compared with the nucleotide sequence of the cDNA clone
RPC175, two introns (85 by and 199 bp) were contained in the
region of the structural gene. The nucleotide sequences
5'GT and AG3' at both ends were conserved in both of these
introns. The nucleotide sequences in the regions other than
these introns of the genomic clone RPG102 coincided
completely with the cDNA clone RPC175. A poly A signal-like
sequence 5'-AATAAA-3' (Heidecker and Messing, Annu. Rev.
PlantPhysiol. 37, 439-466, 1986) was located about 90 by
ppc~_rPam ~f ttl_iP Frn_R_T_ ci ta_. i _n_ t_h_P '~ ' ~i de ~_n_c~ alhnyt 4_0
lop
downstream of the translation termination codon TAG.
The entire nucleotide sequence of RPG 102 is
represented by SEQ ID N0:2 wherein the sequences in the
parentheses are the introns. Fig. 6 shows a comparison of
the restriction maps of RPG102 and RPC175.
Example 3: Analysis of promoter expression site
(1) Construction of vectors for analyzing promoter
expression and transformation of rice
To analyze the expression of the isolated promoter in
vivo, vectors having GUS ((3-glucuronidase) reporter gene
linked thereto were constructed in the following manner. As
described above, two ATGs were contained in the same reading
frame 77 by and 113 by downstream of the most upstream
transcription initiation point. Since it was difficult to
determine by experiment which of the ATGs was the actual
- 41 -
CA 02247087 1998-08-26
translation initiation point, vectors for analyzing the
expression of promoter were constructed for both of these
ATGs.
An SnaBI site was located 64 by upstream of the
upstream ATG (the first ATG), i.e., 13 by downstream of the
most upstream transcription initiation point, while a PstI
site was located 12 by upstream of the downstream ATG (the
second ATG) (refer to SEQ ID NOS: 1 and 2). These sites,
were useful in the construction of the vectors from the
plasmid wherein the 1.2 kb PstI fragment containing the
promoter region of RPC175 had been integrated into the PstI
site of pBluescript as constructed in the step of the
nucleotide sequence analysis. In the case of the promoter
for analysis of the first ATG, this plasmid was digested
with restriction enzymes PstI and SnaBI. Thus a promoter
fragment (about 1.1 kb) was cut out therefrom and then the
both ends were blunted with DNA Blunting Kit (manufactured
by Ta7cara Shuzo Co., Ltd.). In the case of the promoter for
the second ATG, the fragment was digested at the restriction
sites HindII and XbaI on pBluescript outside the PstI site
and thus a promoter fragment (about 1.2 kb) was cut out.
The vector used in this example was the super binary
vector pSB24 (Komari et al. Plant J. 10, 165-174, 1996) for
Agrobacterjum. This vector contains a GUS structural gene
which in turn contains the first intron of castor bean
catalase at a downstream of CaMV35S promoter so that the
expression level will be increased by the intron. This
vector was digested with HindIII and XbaI and the 35S
- 42 -
CA 02247087 1998-08-26
promoter was eliminated therefrom. Then the vector was
blunted (for analysis of the first ATG) at its sticky ends
or not (for analysis of the second ATG) and ligated
respectively with a blunt ended PstI-SnaBI fragment (1.1 kb)
or a HindIII-XbaI fragment (1.2 kb) to thereby give vectors
pYOT175IG-1 and pYOT175IG-2 each having a structure of
RPC175 promoter + IGUS + NOS terminator. In order to check
any possibility that the tissue-specificity might be
effected by the intron, an additional vector carrying no
intron was constructed, particularly in the case of the
promoter for the second ATG. To this end, an intron-free
super binary vector pSB21 (Komari et al. Plant J. 10, 165-
174 _ 19961 waS tmc~c3 _ Thi ~ ml a~mi d way c3i aP~fiPC3 wi 1-h Hi nc3TTT
-_ _, -_ _ _, ____ _--__ -__-_ r__-___-_ ..~- ~-~____~ ..-___ __-__~---
and XbaI and the 35S promoter was eliminated therefrom.
Then it was ligated with the above-mentioned HindIIII-XbaI
fragment of about 1.2 kb to thereby give a vector pYOT175G-2
having a structure of RPC175 promoter + GUS + NOS terminator.
Fig. 7 illustrates the procedures for constructing these 3
vectors for the expression analysis. With respect to
pYOT175IG-2 and pYOT175G-2 among these vectors when the
translation of RPC175 was initiated from the upstream ATG in
transformed rice cells, frame shifts of -1 type and + 1 type
occurred respectively, and thus the GUS protein would not be
translated.
Each vector thus constructed was transferred from E.
coli into Agrobacterium tumefaciens by tri-parental mating.
Then these constructs were introduced in parallel into calls
developed from immature rice embryo ("Tsukinohikari")
- 43 -
CA 02247087 1998-08-26
together with hygromycin resistance gene by the aid of
Agrobacterium in accordance with the method of Hiei et al.
(Plant J., 6, 271-282, 1994). The transfer of genes was
confirmed by PCR, and the transformants were grown in a
greenhouse.
(2) Analysis of promoter expression site by way of
histological observation of GUS
According to the method of Jefferson et al. (EMBO J., 6,
3901-3907, 1987), various organs of the rice transformants
were stained for GUS with the use of X-gluc. (5-bromo-4-
chloro-3-indolyl (3-D-glucuronide) as the substrate in order
to histologicaly observe the cells under a stereoscopic
microscope and an optical microscope. As a result, GUS
expression by the RPC175 promoter was observed in pistil
stigma, anther, filament and lodicule in most of the
transformants in the cases of the intron-inserted constructs
(i.e., pYOT175IG-1 and pYOT175IG-2). In some plants, the
GUS expression was observed in palea and lemma, leaf or root
(Fig. 8).
In the case of the intron-free construct (pYOT175G-2),
there were a considerable ratio of individual plants wherein
no GUS expression was observed in each organ examined,
though the gene transfer was confirmed by PCR and Southern
analysis. The expression observed in some individuals was
in the form of spot. Moreover, the organ-specificity of
expression well coincided with the cases of the intron-
inserted constructs (Fig. 8). Thus, it was confirmed that
the existence of intron did not substantially change the
- 44 -
CA 02247087 1998-08-26
tissue-specificity.
The fact that GUS expression was observed in pYOT175IG-
2 and pYOT175G-2 strongly indicated that the second ATG was
the translation initiation point of the RPC175 gene.
Among the transformants showing the GUS expression at
least in some of the tissues, the ratios of the trans-
formants showing the GUS expression in all of pistil, anther,
filament and lodicule were 81~ for pYOT175IG-1, 94~ for
pYOT175IG-2 and 25~ for pYOT175G-2. In the case of each
construct, about 50~ of these transformants showed no
expression in palea and lemma, leaf and root, thus agreeing
with the results of Northern analysis and RT-PCR analysis.
In Fig. 8, the ordinate refers to the number of
transformants showing the expression in the specified organ.
In pistil, the GUS expression was observed in stigma
axis and branched site. Namely, the GUS gene was not
expressed in the cells in the hairy stigma tip (Fig. 9A).
On the other hand, no GUS expression was observed in ovary.
Iii-stamen, GUS expression was observed at a high frequency
in filament, in addition to anther (Fig. 9B). Moreover, GUS
was highly expressed in vascular bundle tissues in lodicule
and cells therearound (Fig. 9C).
Next, the expression time-specificity at various
development stages of flower organs was examined. As a
result, the strongest expression was observed in pistil at
the heading and flowering time. At the growth stage showing
a distance between auricles of the last two leaves of - 5 to
5 cm, the pistil of the transformants harboring the
- 45 -
CA 02247087 1998-08-26
construct carrying the inserted intron showed GUS expression.
In contrast, the transformants with the intron-free
construct showed no GUS expression. These results suggest
that the expression of the RPC175 promoter is stronger in
the pistil at the flowering time than in the pistil at the
time of the differentiation of the hairy tissues in the top
of stigma.
Although it remains unknown why the expression was
observed in leaf, root or palea and lemma, the position
effect of the sites of rice genomes into which T-DNA was
integrated or rearrangement of the introduced genes may be
accountable for to these results.
(3) Measurement of promoter activity by GUS fluorescent
assay
From each of pYOT175IG-1 and pYOT175G-2, one line was
selected so that the promoter expression sites as determined
by the histological observation of GUS in the transformation
generation would coincide well with the results of Northern
analysis and RT-PCR. Then, the GUS expression in the next
generation (R1 generation) was examined by the fluorescent
analysis method with the use of MUG (4-methylumbelliferyl (3-
D-glucuronide) as the substrate. Leaf, root, pistil, anther
(+ filament), lodicule and palea and lemma were collected
from one plant of the non-transformant, one R1 plant of the
pYOT175IG-1 line and four R1 plants of the pYOT175G-2 line.
Then protein was extracted from each plant and GUS was
assayed. The results are shown in Fig. 10. The GUS
activities in the leaf and root of the transformants were
- 46 -
CA 02247087 2004-O1-30
comparable to those of the non-transformant (18 to 210
units), while the GUS activities in pistil, anther and
lodicule of the transformants were about 10 to 1,000 times
as high as those of the non-transformant, though the
activities varied from plant to plant. Namely, extremely
high activities of 486 to 38,829 units, 1,044 to 14,496
units and 1,808 to 203,190 units per mg protein were
observed respectively in pistil, lodicule and anther. [1
unit herein referrs to the activity by which 1 pmole of 4-MU
(4-methylumbelliferone) is produce from MUG in 1 minute.]
Also, in palea and lemma, activities (64 to 650 units) 1 to
10 times as high as that of the non-transformant were
observed. These facts indicated that the flower organ-
specific expression of the 175 promoter was stably
maintained in the decendants of transfarmants.
Thus, it was confirmed by analyzing GUS in the
generation of the transformation and the next generation
that this promoter is one expressed specifically in flower
organs.
Example 4: Assay for chitinase activity of 175 protein
(1) Expression of the protein encoded by RPC175 in E. coli
To examine whether the chitinase-like protein encoded
by RPC175 would actually have chitinase activity or not, the
175 protein was first expressed in E. coli by using The QIA
expressionist System*(manufactured by QIAGEN).
i) Construction of expression vector
As an expression vector pQE30 was employed. In this
vector, 6 histidine residues are positioned upstream of the
* trademark - 47 -
CA 02247087 1998-08-26
multicloning site. Thus, a protein will be expressed, by
using this vector, as a fused protein having a histidine tag
at the N-terminus.
Fig. 11 shows the procedure for the construction.
RPC175 encodes a chitinase-like protein. By comparison with
structures of other chitinases it was considered that RPC175
has a leader sequence consisting of 20 amino acids at the N-
terminus. In the gene construction, this leader sequence
was eliminated. First, RPC175 was digested with PstI to
prepare a fragment of about 1 kb which contained almost all
of the regions but a part of the N-terminal region of the
mature protein. Separately, the following two primers were
synthesized:
175mat5Bm 5'-GCGGGATCCGAGCAGTGCGGCAGGCAG-3';
C5FW2 5'-TTGCAGTAGTCGTCGGTGAG-3';
and PCR was carried out to amplify the remaining part of N-
terminus. The amplified product was digested with BamHI and
PstI and subcloned into pBSII. After confirming the
nucleotide sequence, this plasmid was digested with PstI and
treated with CIP. Into this plasmid the above-mentioned
PstI fragment of 1 kb was inserted to construct a plasmid
containing the entire region of RPC175 mature protein. Next,
this plasmid was digested with BamHI and HindIII and cloned
into the vector pQE30 having been digested with the same
enzymes. After confirming the nucleotide sequence, the
vector thus obtained (named pQE30-1750N) was used in the
expression in E. coli.
ii) Expression in E. coli and purification of protein
- 48 -
CA 02247087 2004-O1-30
Competent cells of E. coli M15 were prepared and
transformed by the expression vector constructed above.
Plasmids were extracted from colonies of transformants and
the introduction of the expression vector was confirmed.
Subsequently, the E. coli cells were cultured and induced
with IPTG in accordance with the protocol attached to the
kit. Briefly, a 1/50 aliquot of the E. coli cells
suspension cultured overnight was added to 50 ml of a 2XYT
liquid medium containing ampicillin and kanamycin. After
culturing for 2.5 hours, it was confirmed that the
absorbance at 600 nm (Afioo) reached about 0.5. Then 2 to 4
mM of IPTG was added and the culture was continued for
additional 4.5 hours. In addition, two kinds of control
cultures were included, namely, one which was free from
IPTG-induction and the other which relates to E. colt
transformed with the vector (pQE30) alone. The cells of
each culture were collected by centrifugation and stored at
- 80°C. The extraction of crude proteins and the
purification thereof with Ni-NTA Agarose *(manufactured by
QIAGEN) were each carried out in accordance with the
manufacturer's protocol. The crude protein extract and the
purified protein were electrophoresed on 12.5 to 15~ SDS
polyacrylamide gel according to the method of Laemmli
(Nature 227, 680-685, 1970) and then stained with Coomassie*
brilliant blue (CBB) 8250. As a result, no band seemingly
assignable to the protein encoded by RPC175 was observed in
the soluble protein fraction from any of the cultures. In
contrast thereto, a band with somewhat larger in size than
* trademarks _
CA 02247087 1998-08-26
expected (i.e., 33 kD) was observed exclusively in the
insoluble fraction of the induction-treated culture
containing pQE30-1750N. Thus, the protein encoded by RPC175
was mostly insoluble. To solubilize this protein, it was
necessary to add 8 M of urea to the buffer. However, the
insoluble protein was expressed in a considerably large
amount and could be purified on Ni-NTA Agarose. Fig. 12
shows the result of electrophoresis of 1/2 of the whole 175
protein purified from the cells cultured on a scale of 50 ml.
Subsequently, to provide samples to be used for raising an
antibody, the E. coli was cultured on a 250 ml-scale and the
insoluble 175 protein was extracted and purified under the
same conditions as those described above. Then the band of
the expressed protein was cut from the polyacrylamide gel.
The polyacrylamide gel band thus cut out was further minced
into pieces with a razor, then transferred into an Eppendof
tube to be ground in a homogenizes. After adding 10 times
volume of a buffer (20mM Tris pH 8.0, 1~ SDS), the mixture
was shaken at room temperature over one or two nights so as
to elute the protein from the acrylamide gel. After
removing the gel by centrifugation, the supernatant was
dialyzed against 80~ acetone overnight in a dialysis tube
Spectra/Por1 MWC0:6-8,000 (manufactured by Spectrum Medical
Industries). Next, the protein solution was recovered from
the dialysis tube and dried.
The protein sample was suspended in 1 x SDS Sample
Buffer (Maniatis et al. 1982) and treated at 95°C for 5
minutes. Next, the protein was electrophoresed on a 15~
- 50 -
CA 02247087 1998-08-26
polyacrylamide gel. In order to confirm that the protein
recovered from the cut out gel was in fact the desired one,
Western blotting was performed with the use of Ni-NTA HRP
conjudgate (manufactured by QIAGEN) as the antibody. On the
other hand, the gel after the completion of the
electrophoresis was stained with CBB and the protein
concentration was estimated by comparing with markers of
known concentrations (Prestained SDS-PAGE standards Low
Range, manufactured by BIORAD).
iii) Production of antibody
The production of antibody was undertaken by Sawady
Technology Co., Ltd. When determined by ELISA, the rabbit
antibody had a titer of 23,600. As a result of Western
analysis with the use of HRP as the secondary antibody, this
antibody reacted with the sample protein with a high
sensitivity.
iv) Solubilization of protein encoded by RPC175
As described above, the protein encoded by RPC175, when
expressed in E. coli, was mostly (99~ or above) insoluble.
When the soluble fraction was subjected to Western blotting
with the use of the above-mentioned antibody, on the other
hand, the 175 protein was detected though in a small amount.
Moreover, it was also found that this protein contained in a
trace amount could be purified on Ni-NTA Agarose. Generally
speaking, when a foreign protein is expressed in E. coli,
the protein often cannot assume the correct folded structure
but forms inclusion bodies due to rapid induction of
expression. This phenomenon can be avoided by employing
- 51 -
CA 02247087 2004-O1-30
milder induction conditions. To obtain a large amount of
175 protein in the soluble form, therefore, the following
experiment was carried out with respect to the IPTC
concentration and culture temperature which were the main
factors of the induction conditions. Namely, the induction
was performed under three conditions (at 37°C with 2 mM of
IPTG; at 25°C with 0.5 mM of IPTG; and at 15°C with 0.1 mM
of IPTG). The culture was continued for 4.5 hours at 37°C
and 25°C and for 18 hours at 15°C. After culturing under the
conditions as specified above, the cells showed
turbidities (Aboo) of 1.04, 0.89 and 0.85 respectively at
37°C , 25°C and 15°C . The E. coli cells ( in 50 ml
liquid
culture medium:) which expressed the protein under these
conditions were collected by centrifugation and stored at
- 80°C. From these cells, proteins were extracted by using
a urea-free buffer solution in accordance with QIAGEN's
instructions and the 175 protein carrying the HIS tag was
purified with the use of Ni-NTA Agarose. Finally, the 175
protein was eluted from the Ni-NTA Agarose with 300 ~,1 of a
0.1 M phosphate buffer (pH 4.5) containing 10 mM of Tris.
The eluate (10 ~.l) was electrophoresed on SDS-PAGE followed
by Western analysis with the use of the above-mentioned
antibody against the 175 protein. Since it was anticipated
that the 175 protein in the samples was only in a trace
amount, ECL+plus* System (manufactured by Amersham) was used
in the Western blotting. The primary and secondary
antibodies were added each at a concentration of 1/10,000
and reacted each time for 1 hour with the ECL nitrocellulose
* Trademark - 52 -
CA 02247087 1998-08-26
membrane having the fractionated proteins blotted thereon.
The reaction with the substrate was continued for 5 minutes
and the X-ray film was exposed to light for 2 to 20 minutes.
As a result, the densities of the bands assignable to the
purified soluble 175 protein increased as the IPTG
concentration and the culture temperature of E. coli were
lowered as shown in Fig. 13. The densities of these bands
were compared with that of the bands of the above-mentioned
175 protein of a known concentration (prepared by dissolving
10 ng of the insoluble fraction prepared for the production
of the antibody in 8 M urea) electrophoresed on the same gel.
As a result, the soluble 175 protein was obtained in amounts
of 97.6 ng, 12.4 ng and 2.1 ng in the order of how mild the
culture conditions were. At the same time, 10 ~,l aliquots
of the whole proteins eluted from the Ni-NTA Agarose gel
were quantitated with Bio-Rad Protein Assay (manufactured by
BIORAD). As a result, the protein contents were
respectively 38 ~,~,g, 24 ~.g and 34 ~,g. Thus, the ratios of
tYie 175 protein in the whole proteins eluted were calculated
respectively as 2.57, 0.52 and 0.06. These results
suggest that the ratio of the soluble 175 protein could be
elevated by lowering the IPTG concentration and the culture
temperature.
(2) Assay of chitinase activity of E. coli
Chitinase activity was assayed by the Reissig method by
determining the saccharides solubilized from colloidal
chitin as the substrate. The colloidal chitin was prepared
in the following manner. Chitin powder 2 g was dissolved
- 53 -
CA 02247087 1998-08-26
gradually in 100 ml of cold conc. hydrochloric acid while
elevating temperature and then filtered through a G-3 glass
filter. The filtrate was added slowly to 10 times volume of
sterilized water and allowed to stand at 4°C overnight to
re-precipitate the chitin. After removing the supernatant,
the precipitate was re-suspended in sterilized water and
centrifuged at 6,000 g for 10 minutes. The washing was
repeated until the pH of the supernatant became neutral.
The precipitate was finally suspended in 150 ml of
sterilized water to give a colloidal chitin solution.
The chitinase activity was measured in the following
manner. A 100 ~.1 aliquot of the enzyme solution and 100 wl
of the nnl l ni ria l nlvi ti n cnl ~iti nn copra mi zrcr9 anti i nnmhatc~~ ai-
37°C for 2 hours . After centrifuging at 6 , 000 rpm for 5
minutes, 150 ~,1 of the supernatant was collected. As the
blanc test same enzyme solution alone was incubated at 37°C
for 2 hours and then colloidal chitin was added immediately
before centrifugation. To each of these supernatants, 15 ~.~.1
of a 1 M phosphate buffer (pH 7.2) was added to adjust the
pH value. Subsequently, 10 ~,1 of 3~ Helicase (manufactured
by SIGMA) was added and the mixture was incubated at 37°C
for 1 hour to allow the chitin oligomers to be hydrolyzed.
Next, 30 ~,l of 0.8 M potassium borate-KOH (pH 10.2) was
added and the mixture was boiled for 3 minutes.
Simultaneously, 25, 50 and 100 nmol N-acetylglucosamine
(GIcNAC, manufactured by SIGMA) solubilized in the above
assay reagents were also boiled to provide a standard curve.
After the completion of boiling, the mixtures were
- 54 -
CA 02247087 1998-08-26
immediately ice-cooled followed by addition of 1 ml of a
solution of p-dimethyl aminobenzaldehyde (DMAB, manufactured
by Wako Pure Chemical Industries, Inc.) prepared by
dissolving 1 g of DMAB in 100 ml of acetic acid containing
1~ of hydrochloric acid. After incubating at 37°C for 20
minutes, the absorbance (Alas) was measured and the amount of
GlcNAc was calculated from the standard curve. One unit is
defined as the activity of the enzyme which cause
solubilization of saccharides corresponding to 1 E,imol of N-
acetylglucosamine in 1 minute.
By this assay system, there were measured the chitinase
activities of the purified 175 protein carrying the HIS tag
produced by E. coli cells cultured under the above-mentioned
three expression-inducing conditions. Further, the proteins
in the two kinds of control cultures [i.e., one having E.
coli with the vector (pQE30) alone and the other being free
from IPTG-induction] were extracted, purified and subjected
to the assay. As a result, an apparent chitinase activity
was detected in the test wherein pQE30-175~N was subjected
to the induction of expression at the culture temperature of
15°C and IPTG concentration of 0.1 mM. The enzyme activity
in this culture was 1.9 mU/mg protein, i.e., 3 to 4 times as
high as those in the control cultures (0 to 5.1 mU/mg
protein). However, it is to be understood that this
activity was based on the whole proteins eluted from the Ni-
NTA Agarose. As described above, the 175 protein amounted
to about 2.57 of the eluted proteins. Thus, it is
estimated that the enzyme activity of the 175 protein is at
- 55 -
CA 02247087 1998-08-26
least several ten mU/mg protein. In the test lot of the
culture temperature of 25°C, a slight chitinase activity,
compared with the control lots, was detected. However, the
test lot of the culture temperature of 37°C showed no
activity. This is seemingly because the 175 protein
subjected to the assay had only a low concentration.
Based on these results, it has been clarified that the
chitinase-like protein encoded by RPC175 has actually a
chitinase activity.
- 56 -
CA 02247087 1998-08-26
Table 2: Chitinase activity of protein encoded by RPC175
gene
Culture Expression IPTC concn. Activity
temp.(C) vector (mM) (mU/mg protein)
15 pQE30 0 0
pQE30
0.1 0.50
15 pQE30-1750N 0 0.51
15 pQE30-1750N 0.1 1.90
10 25 pQE30 0 0.99
pQE30
0.5 1.04
25 pQE30-1750N 0 1.48
25 pQE30-1750N 0.5 1.62
15 37 pQE30 0 0.35
37 pQE30 2 0.72
37 pQE30-1750N 0 0.62
.~37 pQE30-175~N 2 0.68
20 EFFECTS OF THE INVENTION
According to the present invention, it becomes possible
to genetically manipulate flower organs not only anther but
also pistil or lodicule of plants. Thus female sterile
plants and rice plants with exposed stigma may be
25 constructed. Also, the flowering characteristics may be
physiologically regulated. The present invention further
makes it possible to construct plants which are resistant
- 57 -
CA 02247087 1998-08-26
against pathogenic bacteria and fungi containing chitin.
- 58 -
CA 02247087 2004-O1-30
SEQUENCE LISTING
S (1) GENERAL
INFORMATION:
(i) APPLICANT:
(A) NAME: JAPAN TOBACCO INC.
(B) STREET: 2-1. TORANOMON 2-CHOME, MINATO-KU
1O (C) CITY: TOKYO
(E) COUNTRY: JAPAN
(F) POSTAL CODE (ZIP): 105-8422
(ii) TITLE OF INVENTION: FLOWER ORGAN-SPECIFIC
GENE AND ITS
1S PROMOTER SEQUENCE
(iii) NUMBER OF SEQUENCES: 3
(iv) CORRESPONDENCE ADDRESS:
2O (A) ADDRESSEE: Robic
(B) STREET: 55 St-Jacques
(C) CITY: Montreal
(D) STATE: QC
(E) COUNTRY: Canada
~S (F) ZIP: H2Y 3X2
(G) TELEPHONE: 514-987-6242
(H) TELEFAX: 514-895-7874
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Disk 3.5" / 1.49 MB
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: TXT ASCII
3S (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: 2.247.087
(B) FILING DATE: 26-DEC-1997
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: JP 96/349505
(B) FILING DATE: 27-DEC-1996
4S (2) INFO>RMATION FOR SEQ ID NO: 1
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1318 base pairs
(B) TYPE: nucleic acid
SD (C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii; MOLECULE TYPE: cDNA to mRNA
SS (vi) ORIGINAL SOURCE:
(A) ORGANISM: Oryza sativa L.
(B) STAIN . IR24
(C) TISSUE TYPE: Fistii
EO (vii) IMMEDIATE SOURCE:
(A) LIBRARY : ZAPII cDNA library from pistil mRNA
59
CA 02247087 2004-O1-30
(B) CLONE : RPC 175
(xi) SEQUENCE DESCRIPTION: SEQ ID N0: 1
atcacLCacc cacaccactg aaaagcaaga 60
agctacgtac ttttgttgaa
actcaaccaa
gaaataagc:a cttgccatg cgcagcaagggctgcaaa cctgcaggtg cc tg 116
t at g a
Met
1
aag gccctg gcgctggccgtg ctggccctcgcc tacgccgcg gcgacg 164
Lys Alaheu AlaLeuAlaVal LeuA1aLeuAla TyrAlaAla AlaThr
5 10 15
gcg cgcgcc gagcagtgcggc aggcaggccggc ggcgccagg tgcccc 212
Ala ArgAla G1uGlnCysGly ArgGlnA1aGly GlyAlaArg CysPro
20 25 30
IS aac aggctc tgctgcagcagg tgggggtggtgc ggcctcacc gacgac 260
Asn ArgLeu CysCysSerArg TrpGlyTrpCys GlyLeuThr AspAsp
35 40 45
tac tgcaag ggcggctgccag agccagtgccgc gtctcccgc gacggc 308
Tyr CysLys GlyGlyCysGln SerGlnCysArg ValSerArg AspGly
50 55 60 65
ggc gacgac gacgtcgccgcg gtgctgctcacg gcgccgggc ggcggc 356
Gly Aspi~spAspValAlaAla ValLeuLeuThr AlaProGly GlyGly
70 75 80
cgc gccggc gtggcgtccgtc gtgacgtcggac cagttcgag cgcatg 404
Arg Alanly ValA1aSerVal ValThrSerAsp GlnPheGlu ArgMet
85 90 95
ctg ccccac cgcgacgacgcg gcgtgccccgcc cgcgggttc tacgcc 452
Leu ProHis ArgAspAspAla AlaCysProAla ArgGlyPhe TyrAla
100 1 05 110
tac cgcgcc ttcgtcgccgcg gccggcgcgttc ccggccttc gccgcc 500
Tyr ArgAla PheValAlaAla AlaGlyAlaPhe ProAlaPhe AlaAla
115 120 125
acg ggcgac gccgacacccgc aagcgtgaggtc gccgcgttc ctggcc 548
Thr GlyAsp A1aAspThrArg LysArgGluVal A1aAlaPhe LeuA1a
130 135 140 145
cag acttcc cacgcgacctct ggtgggccctac tcgtggggc tactgc 595
Gln ThrSer HisA1aThrSer GlyGlyProTyr SerTrpGly TyrCys
150 155 160
tac aaggag gtgaagggcgcg acgtcagacttc tgcgtgccg aacgcg 644
Tyr LysGlu ValLysGlyAla ThrSerAspPhe CysValPro AsnAla
I65 170 175
cgc tggccg tgcgcgcccggc aaggcgtaccac gcccgcgga cccatg 692
Arg TrpPro CysAlaProGly LysAlaTyrHis A1aArgGly ProMet
1g0 185 190
caa atcgca tacaactacaac tatggggcggcc ggcgaggcg atcggc 740
Gln I1eAla TyrAsnTyrAsn TyrG1yAlaAla GlyGluAla IleG1y
195 200 205
gcg gacctg ctgggcaacccg gagctggtggca acggacccg acggtg 788
Ala AspLeu LeuGlyAsnPro GluLeuValAla ThrAspPro ThrVal
210 215 220 225
gcg t~caag acggcgctgtgg ctgtggatgacc gcgcggtcg ccgagc 836
Ala PheLys ThrAlaLeuTrp LeuTrpMetThr AlaArgSer ProSer
230 235 240
cag ccgtcg ccgcacgccgtc gtcacggggcag tggactccg actccc 884
SJ Gln ProSer ProHisAlaVal ValThrGlyGln TrpThrPro ThrPro
245 250 255
gcg gacagc gcggccggccgc gcgccaggctac gggctcacc acgaac 932
Ala AspSer AlaAlaGlyArg AlaProGlyTyr GlyLeuThr ThrAsn
260 265 270
atc ctcacc ggcgggctccag tgcgccggcggc aacggcggc gccgac 980
I1e LeuThr GlyGlyLeuGln CysAlaGlyGIy AsnG1yGly AlaAsp
CA 02247087 2004-O1-30
275 280 285
cgg gtc gcg ttc aagcgc tgc gac ctc ggc ggc tac 1028
tac tac gtg gtc
Arg Vai Ala Phe LysArg Cys Asp Leu G1y Gly Tyr
Tyr Tyr Val Val
290 295 300 305
$ ggg ccc ctg tgcttc cag gcg ttc gac gac atc 1076
aac gac ggc ccg ggc
Giy Fro Asn Leu CysFhe Gln Ala Phe Asp Asp Ile
Asp Gly Pro Gly
310 315 320
atg tcg gcg tct gcgaag acgtgtgcgccgccgtgccgccccgatcg1130
gcg tag g
Met Ser Aia Ser AlaLys
Ala
325
atcgaataaa attgcgtgtg tcgcacggtcgctctgcagccagagtgagt1190
agtacgcact
gagtttgctt tatgtatttt gcgaggaattcttcatggatctgtgaaagc1250
tcggtttcgg
ccatatgtat gcatggtcat aagtagtactgatcttctcgaaaaaaaaaa1310
ggcatgaata
aaaaaaaa 1318
1$
(3) INFOF,MATION FOR SEQ ID NO: 2
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2636 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: doable
2$ (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: Genomic DNA
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Oryza sativa L,
(B) STAIN . IR24
(C) TISSUE TYPE: Green leaf
(vii) IMMEDIATE SOURCE:
3$ (A) LIBRARY : dashII genomic library from green leaf genome
DNA
(B) CLONE : RPG 102
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2
gaattcatatctatcatacaaagagatctaggttgcatttcttcatatagatcctgtctc60
atcctgggtagttgtaacgcaaactttccaacgaatcaaaccagagcacggctcgatctg120
gctgatgcatgtgtgacatcgaatcccaggaaacaaagacgatcgttttcactactgttc180
tatctcttcatctagtttaattaatgccctgtatattcgatcgtgcatccatgtatcagt240
4$ gggctcagttaaacaaagcagacgcaggcatgcaggagatgaaaacgagcaacgcaccct300
cgtgctgcccgaaagacagtgtactctccacactggcatgactcatttctacgggtgaaa360
acagagcggattcagacagataatggtcataccatatcctaaaccatattttttaagcgg420
attcagagtgggtgcggataggatacggatgcgcatgcggagaggattatttcggatgtc480
ggaaatggtgcggaatcagttc:gaaaaagattaaatttatcggatgttacatgtgtatac54C
$0 aatcaatacaatattaagttagcaatgcaagaaacaataatacaataatcaataaacgat600
ccatcatactaattatgtgcttaagtgttaaacaatatgaatacatgatgtctataatat660
aaaaatacagctacgcaagtatgccatgagaaggtgaaagcctcagactaagaaatctat720
gctaattgataaattagtacattggatagaccaacttatgttatatgcaatagatagagt780
gattacatgtgttgataaattcgaattatccggcaaacggccaatcggataatccgatag840
$$ aaatgtccgataatctgcatcc:accggattttagagataccatatcctcatccgcatccg900
cattatactatcctcatccgcattcatatccgccggatttctaaaagcccataccatatc960
ctcgtttc~gaacggattcggagtggatcggatctatccgatcggttttcactcctactca1020
tttcacac:aagatgaggccatcaccttgcataaccgattttacacaagctagatgaggcc1080
atgatctc:ctc'tatataagaggccatgcagtctgtggcttcatcactcaccagctacgta1140
60 cactcaac:caacacaccactgaaaagcaagattttgttgaagaaataagcatcttgccat1200
gatcgcagcaagggctgcaaacctgcaggtggcc atg gcg ctg 1255
aag gcc gcc
ctg
61
CA 02247087 2004-O1-30
Met
Lys
Ala
Leu
Ala
Leu
A1a
1 5
gtg ctggccctc gcctacgccgcg gcgacggcgcgc gccgagcag tgc 1303
Val LeuAlaLeu AlaTyrAlaAla A1aThrAlaArg AlaGluG1n Cys
S 10 15 20
ggc aggc:aggcc ggcggcgccagg tgccccaacagg ctctgctgc agc 1351
Giy ArgGlnAla GlyGlyAlaArg CysProAsnArg LeuCysCys Ser
25 30 35
agg tgggggtgg tgcggcctcacc gacgactactgc aagggcggc tgc 1399
l~ Arg TrpGlyTrp CysGlyLeuThr AspAspTyrCys LysGlyG1y Cys
40 45 50 55
cag agcc:agtgc cgcgtctcccgc gacggcggcgac gacgacgtc gcc 1447
Gln SerC~lnCys ArgValSerArg AspGlyGlyAsp AspAspVa1 Ala
60 65 70
1$ gcg gtgctgctc acggcgccgggc ggcggccgcgcc ggcgtggcg tcc 1495
Aia ValI,euLeu ThrAlaProGly GlyGlyArgA1a GlyValAla Ser
75 80 85
gtc gtgacgtcg gaccagttcgag cgcatgctgccc caccgcgac gac 1543
Val Val'ChrSer AspGlnPheGlu ArgMetLeuPro HisArgAsp Asp
20 90 95 100
gcg gcgl.gcccc gcccgcgggttc tacgcctaccgc gccttcgtc gcc 1591
Ala A1aCysPro AlaArgGlyPhe TyrA1aTyrArg AlaFheVa1 Ala
105 110 115
gcg gccggcgcg ttcccggccttc gccgccacgggc gacgccgac acc 1639
25 A1a AlaGlyA1a PheProAlaPhe A1aAlaThrGly AspAlaAsp Thr
120 125 130 135
cgc aag~~gtgag gtcgccgcgttc ctggcccagact tcccacgcg acc 1687
Arg LysArgGlu ValAlaAlaPhe LeuAlaGlnThr SerHisAla Thr
140 195 150
30 tct g taacgtttac catgt 1746
gtaacgtag ttgtcacgtt
ggaactcacg
tgtacgtaca
Ser
cttatgcacg 1799
agtgcgcatg
tgtccctgca
g
gt
ggg
ccc
tac
tcg
tgg
ggc
tac
Gly y Tyr
Gly
Pro
Tyr
Ser
Trp
Gl
7.55 160
35 tgc tacaaggag gtgaagggcgcg acgtcagacttc tgcgtgccg aac 1847
Cys TyrLysGlu ValLysGlyAla ThrSerAspPhe CysValPro Asn
165 170 175
gcg cgctggccg tgcgcgcccggc aaggcgtaccac gcccgcgga ccc 1895
Ala ArgTrpPro CysA1aProGly LysAlaTyrHis AlaArgGly Pro
40 180 185 190
atg caaatcgca to gtccatataa 1951
gtaagagaac at
gcaaaggagc
aaaccaaaac
Met GlnIleAla Tyr
195
gaacttg caaacaaaaaatc aatgg gaaaaatctt aaaatgcaac
2011
cacaa acgaacacta
45 gggattt catccgtgaaacg tttcg tatttggact
gaacaaatga 2071
ttcaa agactagtac
caaacta ctggaatctaatt attca ttcag tat 2127
ttcaa at c ggg
aac gcg
tac
aac
Asn Tyr
Tyr Gly
Asn Ala
200
gcc ggcgaggcg atcggcgcggac ctgctgggcaac ccggagctg gtg 2175
Ala GlyGluAla IleG1yAlaAsp LeuLeuGlyAsn ProG1uLeu Val
205 210 215
gca acggacccg acggtggcgttc aagacggcgctg tggctgtgg atg 2223
A1a ThrAspPro ThrValA1aPhe LysThrAlaLeu TrpLeuTrp Met
220 225 230 235
55 acc gcgcggtcg ccgagccagccg tcgccgcacgcc gt~gtcacg ggq 2271
T:,rAlaArgSer ProSerGlnPro SerProHisAla ValValThr Giy
240 245 250
cag tggactccg actcccgcggac agcgcggccggc cgcgcgcca ggc 2319
G1n TrpThrPro ThrProAlaAsp SerA1aA1aGly ArgAlaPro Gly
60 255 260 265
tac gggctcacc acgaacatcctc accggcgggctc cagtgcgcc ggc 2367
62
CA 02247087 2004-O1-30
Tyr Gly LeuThrThrAsn IleLeuThr GlyGlyLeuGln CysAla Gly
270 275 280
ggc aac ggcggcgccgac cgggtcgcg ttctacaagcgc tactgc gac 2415
G1y Asn GlyG1yA1aAsp ArgValAla PheTyrLysArg TyrCys Asp
285 290 295
gtg ctc ggcgtcggctac gggcccaac ctggactgcttc ggccag gcg 2463
Val Leu GlyValG1yTyr G1yProAsn LeuAspCysPhe GlyGln Ala
300 305 310 315
ccg ttc gacggcgacatc atgtcggcg tctgcggcgaag tagacgtgtgcg 2514
l~ Phe A.spGlyAspIle MetSerAla SerAlaAlaLys
Pro
320 325
ccgccgtgcc ggccccgatc gagtacgcac
ttcgcacggt2574
gatcgaataa
aattgcgtgt
cgctctgcag ccagagtgag ttcggtttcg
ggcgaggaat2639
tgagtttgct
ttatgtattt
tc 2636
(4) INFORMATION FOR SEQ ID N0: 3
ZO (l) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 328 base pairs
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE:
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Oryza sativa L.
(B) STAIN . IR29
(C) TISSUE TYPE: Pistil
(vii) IMMEDIATE SOURCE:
(A) LIBRARY : ZAPII cDNA library from pistil mRNA
(B) CLONE : RPC 175
(xi) SEQUENCE DESCRIPTION: SEQ ID N0: 3
Met
Lys
A1a
Leu
Ala
Leu
Ala
Val
Leu
Ala
Leu
Ala
Tyr
Ala
Aia
4~ 1 5 10 15
Ala ThrAlaArgAla GluG1nCysGly ArgGinAlaGly GlyAla
20 25 30
Arg CysProAsnArg LeuCysCysSer ArgTrpGlyTrp CysGly
35 40 45
4J Leu ThrAspAspTyr CysLysGlyGly CysG1nSerG1n CysArg
50 55 60
Val SerArgAspGly GlyAspAspAsp Va1AlaAlaVal LeuLeu
65 70 75
Thr AlaProGlyGly G1yArgAlaG1y Va1AlaSerVal ValThr
50 80 85 90
Ser AspGlnPheGlu ArgMetLeuPro HisArgAspAsp AlaAla
95 100 105
Cys FroAlaArgGly PheTyrAlaTyr ArgAlaPheVal AlaAla
11C 115 120
55 Ala GlyAlaFhePro A1aFheA1aA1a ThrGlyAspAla AspThr
125 130 135
Arg LyeArgGluVal AlaAlaPheLeu AlaGlnThrSer HisA1a
1_40 145 150
Thr SerGlyGlyPro TyrSerTrpG1y TyrCysTyrLys GluVa1
155 160 165
Lys GlyA1aThrSer AspPheCysVal ProAsnAlaArg TrpPro
63
CA 02247087 2004-O1-30
170 175 180
Cys Ala ProGlyLysAla TyrHisAla ArgGlyProMet GlnI1e
185 190 195
Ala Tyr AsnTyrAsnTyr GlyAlaA1a GlyG1uAlaI1e GlyAla
S 200 205 210
Asp Leu LeuGlyAsnPro GluLeuVal AlaThrAspPro ThrVal
215 220 225
Ala Phe LysThrAlaLeu TrpLeuTrp MetThrAlaArg SerPro
230 235 240
Ser Gln ProSerProHis AlaValVal ThrGlyGlnTrp ThrPro
295 250 255
Thr Pro A1aAspSerA1a AlaGlyArg AlaProGlyTyr GlyLeu
260 265 270
Thr Thr AsnIleLeuThr GlyGlyLeu GlnCysAlaG1y G1yAsn
275 280 285
G1y Gly A1aAspArgVal AlaPheTyr LysArgTyrCys AspVal
290 295 300
Leu Gly ValGlyTyrGly ProAsnLeu AspCysPheG1y GlnA1a
305 310 315
Pro Phe AspGlyAspIle MetSerAla SerAlaAlaLys
320 325
64
